![Page 1: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/1.jpg)
Biological Sequence Analysis
Spring 2008
1: Introduction
![Page 2: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/2.jpg)
Teachers:Nimrod Rubinstein [email protected] Burstein [email protected]
Tel: 03-640-9245
Reception hours:by appointment.
Course website:
1: Introduction
Administration
http://bioinfo.tau.ac.il/~intro_bioinfo/mta
![Page 3: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/3.jpg)
Requirements1: Introduction
•Home assignments – 25%
•Midterm quiz – 25%
•Final project – 50%
All assignments must be submitted on time
Do not copy!
![Page 4: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/4.jpg)
Goals
To familiarize the students with research topics in sequence analysis in bioinformatics, and with relevant tools in this field
Prerequisites
• Familiarity with topics in molecular biology (cell biology and genetics)
• Basic familiarity with computers & internet
1: Introduction
![Page 5: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/5.jpg)
Ask, Ask, Ask!!
"אין הביישן למד"
1: Introduction
![Page 6: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/6.jpg)
What is Bioinformatics
• “The analysis of biological information using computers and statistical techniques; the science of developing and utilizing computer databases and algorithms to accelerate and enhance biological research “
www.niehs.nih.gov/dert/trc/glossary.htm
1: Introduction
![Page 7: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/7.jpg)
What do bioinformaticians study?
• Bioinformatics today is part of almost every molecular biological research
• To name a few examples…
1: Introduction
![Page 8: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/8.jpg)
Example 1
• Compare proteins with similar sequences (for instance –kinases) and understand what the similarities and differences mean
1: Introduction
![Page 9: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/9.jpg)
Example 2
• Look at the genome and predict where genes are located (promoters; transcription factor binding sites; introns; exons)
1: Introduction
![Page 10: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/10.jpg)
• Predict the 3-dimensional structure of a protein from its primary sequence
Example 3
Ab-initio prediction – extremely difficult!
1: Introduction
![Page 11: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/11.jpg)
• Correlate between gene expression and disease
Example 4
A gene chip – quantifying gene expression in different tissues under different conditions
May be used for personalized medicine
1: Introduction
![Page 12: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/12.jpg)
1: Introduction
Computational biology – revolutionizing science at the turn of the century
![Page 13: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/13.jpg)
Three studies using bioinformatics which highly impacted science
1. Classifying life into domains2. Predicting drug resistance in HIV
and personalizing drug administration
3. Solving the mystery of anthrax molecular biology
1: Introduction
![Page 14: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/14.jpg)
1. Revolutionizing the Classification of Life
1: Introduction
![Page 15: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/15.jpg)
•Life was classified as
plants and animals
•When Bacteria were discoveredthey were initially classified as plants
•Ernst Haeckel (1866) placed all unicellular organisms in a kingdom called Protista, separated from Plantae and Animalia
In the very beginning
1: Introduction
![Page 16: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/16.jpg)
1: Introduction
![Page 17: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/17.jpg)
Thus, life were classified to 5 kingdoms:
When electron microscopes were developed, it was found that Protista in fact include both cells with and without nucleus. Also, fungi were found to differ from plants, since they are heterotrophs (they do not synthesize their food)
LIFE
FungiPlants Animals ProtistsProcaryotes
1: Introduction
![Page 18: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/18.jpg)
Later on, plants, animals, protists and fungi were collectively called the Eucarya domain, and the procaryotes were shifted from a kingdom to be a Bacteria domain
Domains EucaryaBacteria
FungiPlants Animals ProtistsKingdoms
Even later, a new Domain was discovered…
1: Introduction
![Page 19: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/19.jpg)
•The translation apparatus is universal and probably already existed in the “beginning”
rRNA was sequenced from a great number of organisms to study phylogeny
1: Introduction
![Page 20: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/20.jpg)
Carl R. Woese and rRNA phylogeny1: Introduction
![Page 21: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/21.jpg)
A distance matrix was computed for each two organisms. In a very influential paper, they showed that methanogenic bacteria are as distant from bacteria as they are from eucaryota (1977)
1: Introduction
![Page 22: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/22.jpg)
One sentence about methanogenic “bacteria”
“There exists a third kingdom which, to date, is represented solely by the methanogenic bacteria, a relatively unknown class of anaerobes that possess a unique metabolism based on the reduction of carbon dioxide to methane”.
These "bacteria" appear to be no more related to typical bacteria than they are to eucaryotic cytoplasms.“
1: Introduction
![Page 23: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/23.jpg)
From sequence analysis only, it was thus established that life is divided into 3 domains:BacteriaArchaeaEucarya
1: Introduction
![Page 24: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/24.jpg)
1: Introduction
The rRNA phylogenetic tree
![Page 25: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/25.jpg)
2. Revolutionizing HIV treatment
1: Introduction
![Page 26: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/26.jpg)
There are very efficient drugs for AIDS treatment
1: Introduction
A few viruses in blood
DRUG, +a few more days
Many viruses in blood
DRUG, +a few days
Many viruses in blood
![Page 27: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/27.jpg)
Explanation: the virus mutates and some viruses become resistant to the drug
Solution 1: combination of drugs (cocktail)
Solution 2: not to give drugs for which the virus is already resistant. For example, if one was infected from a person who receives a specific drug.
The question: how does one know to which drugs the virus is already resistant?
1: Introduction
![Page 28: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/28.jpg)
Sequences of HIV-1 from patients who were treated with drug A:
AAGACGCATCGATCGATCGATCGTACGACGACGCATCGATCGATCGATCGTACGAAGACACATCGATCGTTCGATCGTACG
Sequences of HIV-1 from patients who were never treated with drug A:AAGACGCATCGATCGATCGATCTTACGAAGACGCATCGATCGATCGATCTTACG AAGACGCATCGATCGATCGATCTTACG
1: Introduction
![Page 29: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/29.jpg)
drug A+AAGACGCATCGATCGATCGATCGTACGACGACGCATCGATCGATCGATCGTACGAAGACACATCGATCGTTCGATCGTACG
drug A-AAGACGCATCGATCGATCGATCTTACGAAGACGCATCGATCGATCGATCTTACG AAGACGCATCGATCGATCGATCTTACG
This is an easy example!
1: Introduction
![Page 30: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/30.jpg)
drug A+AAGACGCATCGATCGATCGATCGTACGACGACGCATCGATCGATCGATCGTACGAAGACACATCGATCATTCGATCATACG
drug A-AAGACGCATCGATCTATCGATCTTACGAAGACGCATCGATCTATCGATCTTACG AAGACGCATCGATCAATCGATCGTACG
This is NOT an easy example! It’s an example of a classification problem
1: Introduction
![Page 31: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/31.jpg)
1: Introduction
2006: Five machine learning tools were compared:•Decision trees•Linear regression•Linear discriminant analysis•Neural networks•Support vector regression
~80% accuracy
![Page 32: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/32.jpg)
1: Introduction
3. Revolutionizing our understanding of the anthrax molecular mechanism
![Page 33: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/33.jpg)
1: Introduction
•Anthrax is a disease whose causative agent is the gram positive Bacillus anthracis
•It infects mainly cattle, swine, and horses but it can also infect humans
•Humans are infected from milk or meat from infected animals
•In humans, it causes skin problems, in cattle – fatal blood poisoning
![Page 34: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/34.jpg)
1: Introduction
•A vaccine was found by Pasteur
•Koch was the first to isolate the bacterium
•Airborne anthrax, such as that induced by weaponized strains used forbioterrosrism is almost always fatal in humans (respiratory distress, hemorrhage)
![Page 35: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/35.jpg)
1: Introduction
How does the bacterium Bacillus anthracis work?It secretes three proteins: protective antigen (PA), edema factor (EF), and lethal factor (LF)
PA monomer first binds to a host-cell surface receptor. This binding triggers proteolytic cleavage (a part of the N terminus is cut out)
The (remaining) PA monomers oligomerize, forming heptamers
![Page 36: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/36.jpg)
1: Introduction
LF and EF bind the heptamer and the entire complex is internalized into an endosome
The acidity in the endosome causes a conformational change in the complex, which helps it penetrate the endosome membrane and to form a pore
The story continues…
![Page 37: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/37.jpg)
1: Introduction
Researchers from the group of David Baker wanted to know how LF and EF bind to the heptameric PA. They used a bioinformatics method called docking…
![Page 38: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/38.jpg)
1: Introduction
This is where the two proteins interact!
![Page 39: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/39.jpg)
1: Introduction
Once they had a prediction, they performed mutagenesis experiments. Changing residues in the predicted interface cancelled the binding interaction.
![Page 40: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/40.jpg)
1: Introduction
How does docking work? Each 3D conformation is given a score. The pair with the best score is chosen
![Page 41: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/41.jpg)
1: Introduction
Challenges: what is the best score?How to go over as many conformations as possible?How to take into account that proteins are flexible?
![Page 42: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/42.jpg)
Gregor Mendellaws of inheritance,“gene”1866
Watson and Crick
DNA Discovery 1953
Genome
Project 2003
1: Introduction
Genomics: historical chronicle
![Page 43: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/43.jpg)
Genome
Project 2003
1: Introduction
![Page 44: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/44.jpg)
1: Introduction
)Slide from Prof. Ron Shamir(
![Page 45: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/45.jpg)
BioinformaticsBioinformatics
• Organize, store, analyze, visualize genomic data • Utilizes methods from Computer Science,
Mathematics, Statistics and Biology
The marriage of Computer Science and Biology
1: Introduction
)Slide from Prof. Ron Shamir(
![Page 46: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/46.jpg)
• At the convergence of two revolutions: the ultra-fast growth of biological data, and the information revolution
Biology is becoming an information science
22 Aug 2005:100,000,000,000 bases
1: Introduction Bioinformatics)Slide from Prof. Ron Shamir(
![Page 47: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/47.jpg)
Bioinformatics – a short CV
• Born ~1990• Grown rapidly• Experience: essential part of modern
Biomedical sciences• Now, a separate multidisciplinary scientific
area• Is one of the cornerstones of 21st Century
biomedical research
1: Introduction
)Slide from Prof. Ron Shamir(
![Page 48: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/48.jpg)
1: Introduction
•Academic research: where it all started•Biotechnology companies•Big Pharmas•National and international centers
The Bioinformatics Actors
Find me gene (gin?)
![Page 49: Biological Sequence Analysis Spring 2008 1: Introduction](https://reader035.vdocuments.site/reader035/viewer/2022062323/56649d4e5503460f94a2d705/html5/thumbnails/49.jpg)
Bioinformatics in Israel
• World class player in research
• Ranked 2-3 in absolute number of papers in the most prestigious and competitive conferences
• Maintaining our competitive global position is nontrivial
1: Introduction )Slide from Prof. Ron Shamir(