![Page 1: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/1.jpg)
1
Supplementary Information for
Bacterial outer membrane vesicles engineered with lipidated antigens as
a platform for Staphylococcus aureus vaccine
Carmela Irene1+, Laura Fantappiè2+, Elena Caproni,1 Francesca Zerbini1a, Andrea
Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1, Stefano Prete2, Silvia Valensin2,
Enrico König1, Luca Frattini1, Assunta Gagliardi1, Samine J. Isaac1, Alberto Grandi2,
Graziano Guella1 and Guido Grandi1*
Guido Grandi
Email: [email protected] This PDF file includes:
Supplementary text References Figures S1 to S3 Tables S1 to S2
www.pnas.org/cgi/doi/10.1073/pnas.1905112116
![Page 2: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/2.jpg)
2
Supplementary Information Text
Material and Methods
Bacterial strains and culture conditions
HK100 and BL21(DE3) E. coli strains were routinely grown in LB broth at 37°C and used
for cloning and expression experiments, respectively. Staphylococcus Newman strain was
grown in Tryptic soy medium under aerobic conditions and CFUs were estimated by
plating bacteria on Tryptic soy agar plates. Stock preparations of E. coli strains in LB +15%
glycerol and S. aureus in TSB+15% glycerol were stored at -80°C. Each bacterial
manipulation was started using an overnight culture from a frozen stock. When required
ampicillin was added to final concentration of 100 µg/ml.
Plasmids and strains construction and OMVs preparation
BL21(DE3)ΔompA strain was generated as previously described (1). BL21
(DE3)ΔompAΔmsbBΔpagP strain was generated using the CRISPR/Cas genome editing
strategy (2). Briefly, the BL21(DE3)ΔompA strain was transformed with pCasRed plasmid
encoding the Cas9 endonuclease, the tracrRNA and the λRed cassette. Subsequently,
BL21(DE3)ΔompA (pCasRed) was co-transformed with a mutagenic double-stranded
donor DNA (ds-dDNA, Table S2) and the pCRISPR-SacB-gDNA plasmid, which carries
a synthetic DNA fragment (Table S2) coding for a gene specific RNA guide necessary to
direct the Cas9 to the target site. The ds-donor DNA was designed to cause a whole gene
deletion. Positive mutants were identified by colony PCR with gene specific primers (Table
S2).
To express the five S. aureus antigens HlaH35L, LukE, FhuD2, Csa1A and SpAKKAA the
coding sequences were chemically synthetized (Genart-Invitrogen) and PCR amplified
using the primers reported in Table S2. The PCR products were inserted into plasmids pET-
![Page 3: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/3.jpg)
3
OmpA or pET-Lpp plasmid, two pET21 derivatives carrying the sequence encoding the
leader peptide for secretion of E. coli OmpA or Lpp, respectively, using the polymerase
incomplete primer extension (PIPE) cloning method (3). Plasmids were linearized using
the primers couples: omprev/nohisflag and Lpp-R-plasmid/nohisflag (Table S2). The
correctness of the cloning was verified by sequence analysis. pET plasmid derivatives
containing the genes of interest were transformed into BL21(DE3)ΔompA and BL21
(DE3)ΔompAΔmsbBΔpagP strains. Recombinant clones were grown in 200 ml LB medium
(starting OD600=0.05) and, when the cultures had reached an OD600 value of 0.5,
recombinant protein expression was induced by addition of 0.1 mM IPTG.
Purification of recombinant S. aureus antigens and limited proteolysis of LukE,
FhuD2 and Csa1A
Recombinant S. aureus antigens were purified using the TEV protease purification strategy
(4). Briefly, the synthetic genes coding for SpaKKAA, HlaH35L, LukE, FhuD2 and Csa1A
were fused at their 5’ to the sequence coding for a His6-tag and the TEV cleavage site. The
constructs were cloned in a pET15 plasmid downstream of a T7 inducible promoter and
expressed in E. coli BL21(DE3) strain. Bacterial biomass, 5 g wet weight, was
resuspended in 50 ml buffer A (50 mM NaH2PO4, 300 mM NaCl, pH 8.0) in the presence
of a protease inhibitor (0.2 mM PMSF), sonicated thoroughly at 4°C and the total cell lysate
was finally centrifuged (15.000 x g, 30 min, 4°C). The supernatant was filtered (0.22 µm)
and applied to Ni-affinity chromatography (IMAC) using an ÄKTA purifier System (GE)
and a 5 ml HiTrap IMAC column (GE) monitoring absorbance at 280 nm. Protein binding
and column washing was performed at concentrations of 20 mM and 50 mM imidazole,
respectively. Bound proteins were eluted using a linear gradient by increasing buffer B (50
![Page 4: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/4.jpg)
4
mM NaH2PO4, 300 mM NaCl, 500 mM imidazole, pH 8.0) from 10% to 100% over 6
column volumes. Pooled fractions containing the His-tagged recombinant protein was
dialysed against buffer A at 4°C and subsequently digested with TEV protease (1 mg per
100 mg protein) in the presence of 5 mM β-mercaptoethanol. TEV-digested protein pool
was applied to Ni-affinity chromatography and the flow-through, containing the untagged
recombinant protein, was subjected to a final purification step by size-exclusion
chromatography using a HiLoad 16/600 Superdex 75 pg column.
For limited proteolysis experiments, LukE, FhuD2 and Csa1A were treated with 0.16-0.8
ng of Proteinase K, in 100 l PBS for 30 minutes. The reactions were blocked adding
phenylmethhylsulfonyl fluoride (PMSF; Sigma-Aldrich). Digested fragments were
separated by SDS-PAGE and analyzed by Western blot with primary antibodies raised
either against the recombinant proteins or the engineered OMVs expressing the lipidated
proteins.
Western blot and flow cytometry analysis
Western blot analysis was performed as previously reported (1). The polyclonal antibodies
against each antigen were obtained from Genscript by immunizing rabbits with specific
synthetic peptides (Csa1A: GYRDDQFDKNDKG, FhuD2: MDDGKTVDIPKDPK,
LukE: NEFVTPDGKKSAHD, SpAKKAA: AKKLNDAQAPKADN, HlaH35L:
GTNTKDKWIDRSSE) conjugated with KLH protein. Anti-MBP (maltose binding
protein) monoclonal antibody and anti-HISTAG antibodies were purchased from New
England Biolabs and Roche, respectively. Flow cytometry analysis on E.coli strain
expressing lipidated FhuD2 was performed as previously described (5). Primary antibody
against FhuD2 was obtained from Genscript as described above.
![Page 5: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/5.jpg)
5
Triton X-114 protein separation from OMVs
OMVs (100 g of proteins) were diluted in PBS, ice cold TritonX-114 was added to 1%
final concentration and the OMV-containing solution was incubated at 4°C for 1 h under
shaking. The solution was then heated at 37°C for 10 minutes and the aqueous phase was
separated from the detergent by centrifugation at 13,000 g for 10 min. Proteins in both
phases were then precipitated by standard chloroform/methanol procedure, separated by
SDS-PAGE electrophoresis and the protein of interest visualized by Western blot.
LPS purification and Mass spectrometry analysis
LPS extraction
Bacterial cells, harvested from 1 L culture, were washed twice with ethanol, acetone and
petroleum ether, then dried at room temperature. 5 ml of 90% phenol solution was added
to the dried cells, the suspension was heated at 70°C and vigorously stirred for 30 minutes.
Samples were cooled on ice and centrifuged for 20 minutes at 6,000 rpm. The water phase
was collected and dialyzed for two days against water. DNase and RNase (10mg of each)
digestion was performed incubating for 3 hours at 37°C, followed by digestion with
Proteinase K. After overnight dialysis against water, the LPS was lyophilized in a rotatory
evaporator (Büchi Labortechnik AG, Flawil, Switzerland). Dried LPS was weighted and
dissolved in water in a 1-2% solution.
LPS acidic hydrolysis
The protocol for LPS hydrolysis was slightly modified from that of El Hamidi et al. (6).
Briefly, LPS was cleaved by acidic hydrolysis in 2% acetic acid at 100°C for 2 h under
stirring and reflux. The mixture was centrifuged at 3,000 rpm for 30 min at RT, the
recovered pellet was re-suspended in 1 ml of chloroform: methanol: water 3:2:0.25 (v/v)
![Page 6: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/6.jpg)
6
and the solution was centrifuged at 3,000 rpm for 15 min. The organic phase containing
lipid A was collected and the extraction was repeated on the aqueous phase. The pooled
organic phases were dried in a rotatory evaporator and re-suspended in 500 µl of
chloroform: methanol 4:1 (v:v).
Reverse Phase Liquid Chromatography-ElectroSpray Ionization-Mass Spectrometry
(RPLC-ESI-MS)
The chromatographic separations were conducted on a Hewlett-Packard Model 1100 Series
liquid chromatograph (Hewlett-Packard Development Company, L.P., Palo Alto, CA,
USA) coupled to a Bruker Esquire 3000-LC quadrupole ion trap-mass spectrometer
equipped with an ESI source (Bruker Optik GmbH, Ettlingen, Germany). The column was
a Zorbax Eclips XDB-C8 column (150 × 4.6 mm i.d., pore size 200 Å, particle size 3.5
µm) (Hewlett Packard, Palo Alto, CA, USA) maintained at 50°C; mobile phase A was
methanol: water 95:5 (v:v) while mobile phase B was isopropanol. The linear gradient, at
a constant flow rate of 1 ml/min started from 0% B and reached 50% B in 50 min, those
final conditions were kept for 20 min to ensure the complete elution of lipids. Starting
conditions were reached in 2 minutes and column was re-equilibrated for 13 min. Aliquots
of 10 µl of crude extract were injected. ESI was operated in negative ion mode with the
high voltage capillary set at -4000V in the range 500-2000 m/z. Other parameters: high
purity nitrogen at 35 psi, 300°C and flow rate of 7 L/min.
TLR4 reporter cell assay
HEK-blue™ mTLR4 and HEK-blue™ hTLR4 cells (Invivogen) were seeded in a flat-
bottom 96-well plate (5 x 104 cells/well) and stimulated for 16-17 hours with different
concentrations of OMVs or LPS-EK ultrapure (TLR4 agonist), as positive control (10 fold
![Page 7: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/7.jpg)
7
serial dilutions, starting from 0.01 mg/ml). Detection of SEAP activity from cell culture
supernatants was performed the following day by mixing 180 μl QUANTI-Blue™
(Invivogen) per well of a flat-bottom 96-well plate with 20 μl supernatant of stimulated
with OMVS or LPS. After 1h, OD (655 nm) was measured with a spectrophotometer.
Mice Immunization, challenge, ELISA and Hla neutralization assay
Five-week old CD1 female mice were immunized intraperitoneally (i.p.) three times every
two weeks with either 10g of recombinant proteins or different amounts of OMVs
formulated with or without 2mg/ml Alum hydroxide. 5-Combo-OMVs vaccine contained
5g of each engineered OMV (25 g total OMV dose). Sera were collected 10 days after
the last immunization.
For challenge studies, mice were immunized at day 0 and 14 (and day 21 for renal abscess
model) with a combination of 25 g of 5-Combo-OMVs (from BL21ompA strain or
BL21ompAmsbpagP) with or without 2mg/ml Alum hydroxide. For the sepsis
model of infection two weeks after the second immunization mice were i.p. challenged
with 4 x 108 colony forming unit (CFU) of S. aureus Newman strain. Mice were monitored
daily for a 7-day period. Animals health was evaluated using a 1 to 4 pain scale. A value
of 4 was given to mice with: loss of weight >15%, very rough hair coat, impaired mobility.
A score of 3 was given to mice with loss of weight of about 15% and rough hair coat, while
scores of 2 and 1 were given to mice with a loss of weight between 6% and 14% or 0% and
5%, respectively. All procedures were approved by the National Health Institution and
Ethical Committee and for human reasons animals were sacrificed at symptoms of sickness
as recommended by 3Rs rules (‘‘Refinement, Reduction, Replacement’’ policy towards
the use of animals for scientific procedures_ 99/167/EC, Council Decision of 25/1/99).
![Page 8: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/8.jpg)
8
Experiments using the renal abscess and skin infection model were performed as
previously described (7). For the renal model mice were challenged i.v. 10 days after the
third immunization with 1 x 107 colony forming units (CFUs) of S. aureus Newman strain,
while in the skin infection model mice were challenged s.c. 14 days after the second
immunization with 5 x 107 CFUs of S. aureus Newman strain.
ELISA assays on mice sera collected after immunizations were performed as previously
described (1).
Hla neutralization assay was performed as previously described (7) with some minor
modifications. Briefly, serial twofold dilutions of antisera against “Empty”-OMV, rHlaH35L
and HlaH35L-OMVs were incubated with 20 ng rHla (Abcam) for 20 min at 37°C. Then,
erythrocytes derived from de-fibrinated rabbit blood were added, and incubation was
prolonged for a further 15 min at 37 °C. Incubation with water was used as a positive
control (maximal hemolysis). Plates were then centrifuged for 5 min at 1,000 × g, and the
supernatant was analyzed spectrophotometrically by an absorbance microplate reader at
540 nm.
LPS analysis by Mass Spectrometry
The LPS was purified from the four strains and the Lipid A was analysed by Reverse Phase
Liquid Chromatography-ElectroSpray Ionization-Mass Spectrometry (RPLC-ESI-MS).
The spectra obtained for the four preparations are shown in Figure 5. The total ion current
(TIC) of Lipid A from BL21(DE3)ΔompA strain showed a predominant peak (hexa-Ac,
m/z of 1717.2) corresponding to the pseudomolecular ion of monophosphoryl hexa-
acylated lipid A containing four units of 3-hydroxytetradecanoic acid (C14OH), one unit of
![Page 9: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/9.jpg)
9
both dodecanoic acid (C12) and tetradecanoic acid (C14) (Figure 1S). The peak with a
slightly lower retention time (28 min using our chromatographic setup), was identified as
the phosphorylethanolamine analogue of hexa-acylated lipid A (hexa-Ac-PE) (1717+123
Da). Finally, the other minor peaks were attributed to monophosphoryl penta-acylated
lipid A (penta-Ac, m/z 1506.6 at 16.8 min) with no C14 unit, its phosphorylethanolamine
analogue (penta-Ac-PE, m/z 1629.6 at 14.6 min) and tetra-acylated lipid A (tetra-Ac-PE,
m/z 1280.1 at 9 min), carrying three C14OH and one C12 units. The assignment of fatty acyl
units was confirmed by tandem MS. Overall, the spectrum was essentially in line with what
reported for LPS purified from wild type E. coli strains (8), even though the
phosphorylethanolamine analogues are usually not detected in bacteria grown in rich
media. A similar profile was obtained when the Lipid A from BL21(DE3)ΔompA strain
expressing lipidated FhuD2 was analysed, with the difference that the monophosphoryl
hexa-acylated lipid A appeared to be sligthly more abundant with respect to the other
species. The TICs of the Lipid A from BL21(DE3)ΔompAΔmsbBΔpagP presented
substantial differences from BL21(DE3)ΔompA Lipid A. Consistent with the inactivation
of the msbB and pagP genes, the hexa-acylated lipid A species was absent. The
predominant form was the phosphorylethanolamine penta-acylated lipid A (penta-Ac-PE,
m/z 1629.9 at 15.30 min), followed by the penta-acylated species containing no C14 unit
(penta-Ac, m/z 1506.6 at 15.82 min) and, to less extent, the tetra-acylated containing no
C14 unit (tetra-Ac, m/z 1280.1 at 8.44 min) and its phosphorylethanolamine analogue (tetra-
Ac-PE, m/z 1403.1 at 7.60 min). Finally, the spectrum of the
BL21(DE3)ΔompAΔmsbBΔpagP(pET-FhuD2) strain showed two interesting features.
First, the tetracylated monophosphoryl species (tetra-Ac) was more abundant compared to
![Page 10: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/10.jpg)
10
the Lipid A from the same strain not expressing lipidated FhuD2. Second, both penta- and
tetra-acylated phosphorylethanolamine analogues (penta-Ac-PE and tetra-Ac-PE) were
completely missing in the Lipid A preparation of this strain (Figure 5 and Figure 1S).
Considering that the tetra-acylated monophoryl lipid A is known to have a poor TLR4
agonistic activity and that phosphorylethanolamine modification slightly enhances the
TLR4 agonistic activity of Lipid A, these data offer an explanation of the reduced TLR4
stimulation of the OMVsmsbBpagP decorated with the lipidated antigens (see also
Discussion).
References
1. Fantappiè L, de Santis M, Chiarot E, Carboni F, Bensi G, Jousson O, Margarit I,
Grandi G. Antibody-mediated immunity induced by engineered Escherichia coli
OMVs carrying heterologous antigens in their lumen. J Extracell vesicles (2014)
3:24015. doi:10.3402/jev.v3.24015
2. Zerbini F, Zanella I, Fraccascia D, König E, Irene C, Frattini LF, Tomasi M, Fantappiè
L, Ganfini L, Caproni E, Parri M, Grandi A and Grandi G. Large scale validation of
an efficient CRISPR/Cas-based multi gene editing protocol in Escherichia coli.
Microb Cell Fact (2017) 16:68. doi:10.1186/s12934-017-0681-1
3. Klock HE, Lesley SA. The Polymerase Incomplete Primer Extension (PIPE) method
applied to high-throughput cloning and site-directed mutagenesis. Methods Mol Biol
Clift Nj (2009) 498:91–103. doi: 10.1007/978-1-59745-196-3_6
4. Cesaratto F, Burrone OR, Petris G. Tobacco Etch Virus protease: A shortcut across
biotechnologies. J. Biotechnol. (2016) 231, 239–249
![Page 11: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/11.jpg)
11
5. Fantappie L, Irene C, Santis M De, Armini A, Gagliardi A, Tomasi M, Parri M, Cafardi
V, Bonomi S, Ganfini L, Zerbini F, Zanella I, Carnemolla C, Bini L, Grandi A, Grandi
G. Some Gram-negative lipoproteins keep their surface topology when transplanted
from one species to another and deliver foreign polypeptides to the bacterial surface.
Mol Cell Proteomics (2017) 1348–1364. doi:10.1074/mcp.M116.065094
6. El Hamidi A, Tirsoaga A, Novikov A, Hussein A, Caroff M. Microextraction of
bacterial lipid A: easy and rapid method for mass spectrometric characterization. J
Lipid Res (2005) 46:1773–1778. doi:10.1194/jlr.D500014-JLR200
7. Bagnoli F, Fontana MR, Soldaini E, Mishra RPN, Fiaschi L, Cartocci E, Nardi-Dei V,
Ruggiero P, Nosari S, De Falco MG, Lofano G, Marchi S, Galletti B, Mariotti P,
Bacconi M, Torre A, Maccari S, Scarselli M, Rinaudo CD, Inoshima N, Savino S, Mori
E, Rossi-Paccani S, Baudner B, Pallaoro M, Swennen E, Petracca R, Brettoni C,
Liberatori S, Norais N, Monaci E, Bubeck Wardenburg J, Schneewind O, O'Hagan DT,
Valiante NM, Bensi G, Bertholet S, De Gregorio E, Rappuoli R, Grandi G. Vaccine
composition formulated with a novel TLR7-dependent adjuvant induces high and broad
protection against Staphylococcus aureus. Proc Natl Acad Sci (2015) 112:201424924.
doi:10.1073/pnas.1424924112
8. Raetz CRH, Whitfield C. Lipopolysaccharide Endotoxins. Annu Rev Biochem (2002)
71:635–700. doi:10.1146/annurev.biochem.71.110601.135414
![Page 12: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/12.jpg)
12
Fig. S1.
A. Structures of the different Lipid A chemical species.
B. Retention times, measured m/z values (standard deviation in ppm), calculated m/z
values on the basis of the corresponding molecular formula of the structures in
panel A.
RT min Accurate massExact mass
monosotopicMolecular Formula Structure
28,44 1716.2262 (11ppm) 1716.2457 C94H176N2O22P- Hexa-Ac (1)
27,60 1839.2326 (12 ppm) 1839.2543 C96H182N3O25P2- Hexa-Ac-PE (4)
15,82 1506.0141 (22ppm) 1506.0474 C80H150N2O21P- Penta-Ac (2)
15,301629.0231 (20 ppm) 1629.0559 C82H156N3O24P2- Penta-Ac-PE (5)
8,44 1279.8264 (21) 1279.8541 C66H124N2O19P- Tetra-Ac (3)
7,60 1402.8309 (22) 1402.8626 C68H130N3O22P2- Tetra-Ac-PE (6)
A
B
![Page 13: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/13.jpg)
13
Fig. S2.
Figure S2: In vivo protective activity of COMBO-OMVs in the sepsis model of
infection. Analysis of body weight. The figure refers to the same experiment as
described in Figure 6. Mice (30 animals/group) were immunized with 2 doses of
either “Empty-OMV” (25 g/dose) (grey), or combinations of the five engineered
OMVs (black). As control, mice were also immunized with Alum (white). After 2
weeks, mice were infected intra-peritoneally with a lethal dose of S. aureus
Newman strain (4 x 108 CFUs). Mouse weight at day 1, 3 and 5 post infection was
monitored and reported as % of weight loss/gain with respect to the previous weight
measurement.
![Page 14: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/14.jpg)
14
Fig. S3.
Figure S3: (A) Assessment of FhuD2 localization by FACS analysis. Bacterial cells
from BL21ompA and BL21ompA (pET_FhuD2) strains were incubated first with anti-
FhuD2 specific antibodies and subsequently with FITC-labeled anti-rabbit secondary
antibodies. Fluorescence was measured by flow cytometry. Grey areas represent the
background fluorescence signals obtained incubating the cells with the secondary antibody
only. (B) Inhibition of Hla hemolytic activity by sera from mice immunized with
HlaH35L-OMVs. Hemolysis of rabbit erythrocytes was measured by incubating 20 ng Hla
in the presence of increasing dilutions of sera from mice immunized with either 10 g of
purified HlaH35L + Alum, or 10 g of “Empty”-OMVs, or 10 g of HlaH35L-OMVs.
Hemolytic activity is expressed as percentage of OD values over the OD values obtained
incubating erythrocytes with water (100% haemolysis). (C) In vivo protective activity of
HlaH35L-OMVs in the sepsis model of infection. – Groups of 16 mice were immunized
with 2 doses of either “Empty-OMV” (2 g/dose) (grey) or HlaH35L-OMVs (black). After
2 weeks, mice were infected intra-peritoneally with a lethal dose of S. aureus Newman
strain (4 x 108 CFUs). Mice survival 7 days after infection is reported.
0
10
20
30
40
50
60
70
80
0
20
40
60
80
100
1:80 1:160 1:320 1:640 1:1280
"Empty"-OMVs rHla HlaH35L-OMVs
BA
BL21(DE3)/ΔompA(pET FhuD2)
FITC-A
% o
f M
ax
BL21(DE3)/ΔompA(pET empty)
FITC-A
% o
f M
ax
Hem
loly
sis
inh
ibit
ion
(%
)Serum dilutions
Surv
ival
(%
)
C«Empty»-OMVs
HlaH35L-OMVs
![Page 15: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/15.jpg)
15
Table S1.
Sequence homology of FhuD2, Csa1A, LukE, SpaKKAA and HlaH35L proteins as expressed
in OMVs with the same proteins expressed in S. aureus isolates
FhuD2 Csa1A LukE SpAKKAA Hla
% protein identity
Newman strain 100% 100% 98.93% 95.88% 100%
% protein identity
2449 strains in NCBI ≥98.94% ≥ 92.03% ≥ 99.29% ≥99.44% ≥98.66%
![Page 16: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/16.jpg)
16
Table S2. Oligos used in this study
Name Sequence
Primers for gDNA cloning
g-ompA f aaacTTTAGCACCAGTGTACCAGGTGTTATCTTTg
g-ompA r aaaacAAAGATAACACCTGGTACACTGGTGCTAAA
g-msbB f aaacTCCTTTCGCCACCCGCGCTACTGGGGAGCAg
g-msbB r aaaacTGCTCCCCAGTAGCGCGGGTGGCGAAAGGA
g-pagP f aaacACAACGTTTAGAGAAAATATTGTACAAACCg
g-pagP r aaaacGGTTTGTACAATATTTTCTCTAAACGTTGT
Oligo donor
Donor ompA f ACCGTGTTATCTCGTTGGAGATATTCATGGCGTATTTTGGATGATAACGAGGCGCAAAAAGTTCTCGTCTGGTAGAAAAACCCCGCTGCTGCGGGGTTTTTTTTGCCTTTAGTAAATTGA
Donor ompA r TCAATTTACTAAAGGCAAAAAAAACCCCGCAGCAGCGGGGTTTTTCTACCAGACGAGAACTTTTTGCGCCTCGTTATCATCCAAAATACGCCATGAATATCTCCAACGAGATAACACGGT
Donor msbB f CAAGTTGCGCCGCTACACTATCACCAGATTGATTTTTGCCTTATCCGAAACTGGAAAAGCAAAAGCCTCTCGCGAGGAGAGGCCTTCGCCTGATGATAAGTTCAAGTTTGCTTCAGAATA
Donor msbB r TATTCTGAAGCAAACTTGAACTTATCATCAGGCGAAGGCCTCTCCTCGCGAGAGGCTTTTGCTTTTCCAGTTTCGGATAAGGCAAAAATCAATCTGGTGATAGTGTAGCGGCGCAACTTG
Donor pagP f TGTTAATTGTAGCTTTGCTATGCTAGTAGTAGATTTTTGATAAATGTTTTATGGTCACAAAGTTTTAGTAACTTCTTTAAAATCAATAGCTAAAATAAGTAACATCAAAAATAACGCGAC
Donor pagP
GTCGCGTTATTTTTGATGTTACTTATTTTAGCTATTGATTTTAAAGAAGTTACTAAAACTTTGTGACCATAAAACATTTATCAAAAATCTACTACTAGCATAGCAAAGCTACAATTAACA
Screening primers for the genomic loci
ompA F CGTTGTAGACTTTACATCGCCAG
![Page 17: Bacterial outer membrane vesicles engineered with ...€¦ · Anesi1b, Michele Tomasi1, Ilaria Zanella1, Simone Stupia1,Stefano Prete2, Silvia Valensin2, Enrico König1, Luca Frattini1,](https://reader033.vdocuments.site/reader033/viewer/2022050410/5f8766ef2d4e471b1321adaa/html5/thumbnails/17.jpg)
17
ompA R GTCTTCTCTGAAGCAGGATCTGC
msbB F GCCAAAGAGATTGTGCCGCAGC
msbB R CGGTAGAGTAAGTACGTTGCCG
pagP F GCATCATCTTTAATCGATGCGCGG
pagP R GCTGTGTCGGTTACCAGTACACC
Primers for antigens fusion to the OmpA and Lpp Leader sequence and cloning into pET21B
Nohisflag V-f TAACATCACCATCACCATCACGATTACAAAGA
omprev GGCCTGCGCTACGGTAGCGAAA
Lpp-R-plasmid GCTGGAGCAACCTGCCAGCAGAG
OmpA-Hla f1 Accgtagcgcaggcc GCAGATTCTGATATTAATATTAAAACCGGT
Lpp-Hla-f1 ctgctggcaggttgcGCAGATTCTGATATTAATATTAAAACCGGT
Hla-r1 gtgatggtgatgttaATTTGTCATTTCTTCTTTTTCCCAATCGAT
OmpA-Sta006 f1 accgtagcgcaggccGGGAACCAAGGTGAAAAAAATAACAAAG
Lpp-FhuD2-f1 ctgctggcaggttgcGGGAACCAAGGTGAAAAAAATAACAAAG
FhuD2-r1 gtgatggtgatgttaTTTTGCAGCTTTAATTAATTTTTCTTTTAAATCTTTAC
OmpA-Sta011 f1 accgtagcgcaggccGGCATAGGTAAAGAAGCGGAAG
Lpp-CsA1-f1 Ctgctggcaggttgc GGCATAGGTAAAGAAGCGGAAG
CsA1-r1 gtgatggtgatgttaTACATCTCCGCTTTTTTTATAATCTAAGC
OmpA-SpA_DEABC f1 accgtagcgcaggccGCACAGCATGATGAAGCCAAAAAA
Lpp-SpA-f1 Ctgctggcaggttgc GCACAGCATGATGAAGCCAAAAAA
SpA-r1 gtgatggtgatgttaTTTAGGTGCCTGTGCGTCGTT
OmpA-LukE f accgtagcgcaggccAATACTAATATTGAAAATATTGGTGATGGTGC
Lpp-Luke-f1 ctgctggcaggttgcAATACTAATATTGAAAATATTGGTGATGGTGC
Luke-r1 gtgatggtgatgttaATTATGTCCTTTCACTTTAATTTCGTGTGTTTTCCA