Augmentation of Stress Induced Gastric
Mucosal Damages after Helicobacter
pylori Infection; Mechanisms and
Strategy for Prevention
Augmentation of Stress Induced Gastric
Mucosal Damages after Helicobacter
pylori Infection; Mechanisms and
Strategy for Prevention
.
. 2
,
,
.
.
. ,
, ,
. .
. Proteome
, EMSA .
, 1
.
, , ,
.
,
.
Augmentation of stress induced gastric mucosal
damages after Helicobacter pylori infection;
Mechanisms and strategy for prevention
by
Tae Young Oh
A Dissertation Submitted to The Graduate School of Ajou University
in Partial Fulfillment of the Requirements for the Degree of
DOCTOR OF PHILOSOPHY
Supervised by
Ki-Baik Hahm, M.D., Ph.D.
Department of Medical Sciences
The Graduate School, Ajou University
December 19, 2003
- ABSTRACT -
Augmentation of Stress Induced Gastric Mucosal
Damages after Helicobacter pylori Infection;
Mechanisms and Strategy for Prevention
Purpose: Among the several environmental factors which can influence the
outcome of Helicobacter pylori (H. pylori) infection, stress might be one of the
prime effectors responsible for stress ulceration in the stomach. However, the
exact underlying mechanisms to explain why gastric lesions are augmented after
stress in the presence of H. pylori infection and how stress affects the outcomes
of H. pylori infection are not clearly documented yet. This study was aimed to
reveal how the stress does influence the severity of H. pylori-related gastric
mucosal damage and if so, to dig out the underlying molecular mechanism, and
to search the proper strategy to prevent the disaster.
Materials & Methods: In order to establish the H. pylori-associated gastritis
model, we infected the Sprague-Dawley rats with SS1 strain of H. pylori
(VacA+, CagA+). After the six months of infection, the presence of H. pylori in
the stomach was identified. The water immersion restraint stress (WIRS) was
imposed on the half of rats at 24 weeks after infection. Rats were restrained in
a wire-stress cage for 30, 120 and 480 min at 21 water immersion state.
After sacrificing rats with ethyl ether inhalation, stomach was immediately
isolated for gross and microscopic lesion scores and parts of the stomach were
preserved for the measurement of MDA, iNOS, IL-1 , IL-2, IL-6, IL-10, TNF- ,
and IFN- . RNase protection assays (RPA) were done for looking at the
transcriptional changes of cytokines and chemokines. Electrophoretic mobility shift
assay (EMSA) was done for measuring the DNA binding activity of NF- B. In
vitro experiments were coincided with animal study. Cultured gastric mucosal
cells were either administered with H. pylori or subject to receive heat shock
(43 , 5 min). Using extracted proteins, polyacrylamide gel electrophoresis or
2-dimensional gel electrophoresis were done, transferred to nitrocellular paper,
and blotted with several heat shock protein (HSP) antibodies to look at the
change of HSP after H. pylori or stress and both. Animal experiments were
repeated to observe the protection against WIRS by antioxidants.
Results: Stress itself acted as augmenting factor in H. pylori-associated gastritis,
based on the finding that bleeding rates and bleeding index were significantly
increased after both H. pylori infection and stress compared to stress alone
without H. pylori infection. Significantly higher levels of oxidative stress and
Th1 type lymphocyte responses were observed in group with both stress and H.
pylori infection. Significantly elevated levels of TBA-RS and iNOS were
observed in both WIRS and H. pylori infected group compared to WIRS or H.
pylori infection alone group. HSP27 and HSP70 acted as protective protein and
phosphorylation of HSP90 critically contributed to augmented gastric mucosal
damage. Antioxidant pretreatment significantly attenuated the stress-associated
gastric mucosal lesions.
Conclusion: Stress was proven to be the one of the critical determinants of the
severity of H. pylori-associated gastric lesions. The presence of H. pylori
contributed to significant deterioration of stress-associated gastric mucosal lesion.
HSP dyregulation and oxidative stress might be the responsible mechanism for
that. Antioxidants could be considerated as the strategy to prevent the
augmentation of gastric lesion by H. pylori infection and stress.
Key Words: Helicobacter pylori, Stress, Water immersion restraint stress,
Heat Shock Protein, Oxidative stress, Antioxidant, DA-9601
TABLE OF CONTENTS
TITLE PAGE ----------------------------------------------------------------------------------- 1
ABSTRACT ------------------------------------------------------------------------------------- 2
TABLE OF CONTENTS ------------------------------------------------------------------ 5
LIST OF FIGURES ----------------------------------------------------------------------- 7
LIST OF TABLES ------------------------------------------------------------------------ 9
. INTRODUCTION ------------------------------------------------------------------------ 10
. MATERIALS AND METHODS ---------------------------------------------------- 15
A. Materials ------------------------------------------------------------------------- 15
1. Animals --------------------------------------------------------------------- 15
B. Methods --------------------------------------------------------------------------- 15
1. H. pylori Culture -------------------------------------------------------- 15
2. Infection with H. pylori ----------------------------------------------- 16
3. Water Immersion Resraint Stress ------------------------------------ 16
4. Gross and Histological Observation --------------------------------- 17
5. TBA-reactive Substance ------------------------------------------------- 18
6. Cytokine Measurment ---------------------------------------------------- 18
7. 2-D Gel Electrophoresis ----------------------------------------------- 19
8. Cell Culture on Heat Shock Induced Stress -------------------- 19
9. Western Blotting --------------------------------------------------------- 20
10. RNase Protection Assay ------------------------------------------------ 21
11. Electrophoretic Mobility Shift Assay -------------------------------- 22
12. Stastical Assay ------------------------------------------------------------ 22
. RESULTS --------------------------------------------------------------------------------- 23
. DISCUSSION ---------------------------------------------------------------------------- 49
. CONCLUSION -------------------------------------------------------------------------- 56
BIBLIOGRAPHY ---------------------------------------------------------------------------- 57
--------------------------------------------------------------------------------------- 69
LIST OF FIGURES
Fig. 1. Bleeding index of WIRS-induced gastric mucosa in rats with or without
H. pylori infection. ---------------------------------------------------------------- 26
Fig. 2. Bleeding rates (%) of WIRS-induced gastric mucosa in rats with or
without H. pylori infection. ----------------------------------------------------- 27
Fig. 3. Microscopic observation of WIRS-induced gastric mucosa in rats with or
without H. pylori infection after stress loaded 480 min. ---------------- 28
Fig. 4. Changes of TBA-RS on WIRS-induced gastropathy in rats with H. pylori
infection. ----------------------------------------------------------------------------- 31
Fig. 5. (A) Changes of IFN- on WIRS-induced GMD in rats with H. pylori
infection. (B) Changes of TNF- on WIRS-induced GMD in rats H.
pylori infection. -------------------------------------------------------------------- 33
Fig. 6. Change of proteomic profiles at 30 (A), 120 (B) and 480 (C) min on
WIRS-induced GMD in H. pylori-infected rats. ---------------------------- 34
Fig. 7. Detection of various HSPs expression in cultured AGS cells by Western
blot analysis. ------------------------------------------------------------------------ 36
Fig. 8. 2 D-gel electrophoresis. ------------------------------------------------------------ 37
Fig. 9. Activation of HSP90, HSP70, HSP60 and HSP27 in cultured AGS cells.
------------------------------------------------------------------------------------------ 38
Fig. 10. Representative macroscopic findings of the gastric mucosa of rats.
------------------------------------------------------------------------------------------ 42
Fig. 11. Microscopic observation of WIRS-induced GMD in H. pylori-infected
rats. ----------------------------------------------------------------------------------- 43
Fig. 12. Effect of antioxidant on HSPs expressions according to group.
------------------------------------------------------------------------------------------ 44
Fig. 13. Results of RNase protection assay (RPA) for cytokine (rCK-3).
------------------------------------------------------------------------------------------ 45
Fig. 14. Results of RNase protection assay (RPA) for apoptosis (rAPO).
------------------------------------------------------------------------------------------ 46
Fig. 15. Effect of NF-κB by DA-9601 on WIRS-induced GMD in rats with H.
pylori infection. -------------------------------------------------------------------- 47
LIST OF TABLES
Table 1. Criteria of bleeding index. ------------------------------------------------------ 18
. INTRODUCTION
Stress ulcer is a highly prevalent clinical entity, especially encounted
frequently in emergency department because urgent symptoms like severe
dyspepsia and upper gastrointestinal bleeding bothered the patients. Usually stress
ulcer is described as acute gastric mucosal lesion (AGML) since its underlying
fundamental mechanisms are mostly based on the disruption of the balance
between the mucosal defense system and the mucosal offense system. Structural
elements of gastric mucosal defense include the mucus and epithelial cell barrier,
and physiological elements of protection during the acute phase of the injury
involve mucin production, bicarbonate ion secretion and gastric mucosal
microcirculation.1 Experimentally stress-induced AGML is due, in large part, to
either gastric acid hypersecretion or the tremendous and prompt reduction in
mucosal blood flow.2,3 Other factors, which contribute to AGML (stress
ulceration) are decreases in prostaglandin synthesis, cytokine liberation, and the
disruption of cellular restitution and repair mechanisms.4
Since we cannot provoke AGML in human, to develop the appropriate
experimental models is necessitated and the model of water immersion restraint
stress (WIRS) is most popularly used in these investigations.5 This model
appears to be very suitable especially in testing various factors affecting the
formation and healing of gastric mucosal lesion (GML).6,7 An important role in
damage and protection of this barrier is played by gastric microcirculation.
Disturbance in blood perfusion of gastric mucosa result in the formation of
erosions and ulcers. This phenomenon typically occurs in experimental model of
stress induced or ischemic gastric lesions.8
In clinical study, stress ulceration of the stomach was first described in
burned patients in 1842.9 Gastric mucosal lesions develop in 91% of patients
suffering head trauma.10 The incidence of stress ulceration is approximately 82%
in general surgical patients admitted to an intensive care unit (ICU). Stress
gastritis is usually presented as upper gastrointestinal bleeding in critically ill
patients due to severe physiological stress.11 The syndrome of stress-related GML
of the gastrointestinal tract was first described in 1971 by Lucas et al. who
termed this 'stress-related erosive syndrome'.12 Harvey Cushing first described the
association between CNS injury and gastroduodenal disease in 1932.13 Gastric
mucosal damage generally results from an imbalance between aggressive factors
(acid, pepsin, mucosal hypoperfusion, ischemic- reperfusion injury, intramucosal
acid-base balance, systemic acidosis, free radicals, bile salts, Helicobacter pylori
and NSAIDs) and defense factors (mucosal prostaglandins, mucous bicarbonate
barrier, epithelial restitution and regeneration, mucossal blood flow and cell
membrane and tight junctions).14 Stress ulcer also might be caused by
disequlibrium between these two factors, but the exact underlyng mechanisms are
inferred and not clarified clearly yet.
However, the discovery that Helicobacter pylori (H. pylori) is a major
cause of peptic ulcer and even gastric cancer has tempted many to conclude that
psychological factors are unimportant. But this is dichotomised thinking. There is
solid evidence that psychological stress triggers many ulcers and impairs response
to treatment, while H. pylori is inadequate as a mono-causal explanation as most
infected people do not develop ulcers. Simply H. pylori is inadequate as a sole
explanation for various gastric disease including peptic ulcer disease and gastric
cancer. H. pylori alone does not explain fully the epidemiological patterns of
upper gastrointestinal disease.
By the way, psychological stress is not only empirically associated with
ulcers, but is a very plausible risk factor for ulcer disease. As plausible
explanations for this, people affected by stress may also smoke more, sleep less,
and take more NSAIDs, thereby increasing their susceptibility to ulcer by
mechanisms that are not related to gastric acidity. Compared to health people,
patients with duodenal ulcers are particularly likely to response to laboratory
stressors by secreting more acid. Yamamoto et al. published interesting finding
suggestive of the relationship between H. pylori infection and stress-induced
gastric mucosal injury.15 Moreover, several epidemiologic evidences stress the
contribution of stress on H. pylori-associated gastric pathologies. Immediately
after the Great Hanshin Earthquake in Kobe in 1995, the recurrence rate of
peptic ulcer in patients infected with H. pylori was significantly higher than that
in patients in whom H. pylori had been eradicated.16 The recurrence rate of
duodenal ulcers was 93% in patients infected with H. pylori, but was zero in H.
pylori-eradicated patients.
Other very conclusive evidence showing the contribution of environmental
stress on gastric carcinogenesis came from the report of Cho et al..17 They
extend their investigation by comparing the incidence rate of stomach cancer
among the same three ethnic groups in the state of Illinois. The incidence of
stomach cancer was observed to be the lowest in whites (22.5/100,000),
intermediate in African (28.2/100,000), and highest (62.6/ 100,000) in immigrant
Koreans. The highest rate of stomach cancer in immigrant Koreans indicates
profound genetic-environmental interaction. According to the study by Van der
Voort et al., the severity of gastric and duodenal mucosal injury in critically ill
patients during mechanical ventilation is significantly correlated with the presence
of H. pylori infection.18
The existence of H. pylori itself, however, is not enough for the
development of peptic ulcer, because most infected people never develop ulcer
diseases. Chronic use of NSAIDs is also considered to be an independent risk
factors, but there are still many patients with peptic ulcer who do not have H.
pylori infection or use NSAIDs.19-21 These findings strongly suggest that other
factors, such as stress, diet or smoking, may contribute to the pathogenesis of
peptic ulcer.22 An association between peptic ulcer and physical stresses such as
trauma or burn is well established.23,24 There is also revelent evidence that
psychological stress causes ulcers and impairs the patient's response to the
treatment.25,26 Additive effects of H. pylori infection on stress-induced gastric
ulcer were also ssuggested, because the prevalence of H. pylori infection in ulcer
patients after the earthquake was much higher than in ulcer-free controls living
in same area.16
Based on these backgrounds that the simple presence of H. pylori in the
stomach might predispose to augmented response after stress, we performed the
current study to 1) reveal whether the H. pylori infection could affect the
severity of AGML after stress in animal model, 2) what is underlying
mechanism for the augmented response after the both H. pylori infection and
stress, and 3) to provide the effective strategy to prevent the disaster of H.
pylori infection on the stomach after stress. The following experiments including
animal experiment and in vivo experiment including 2D-gel electrophoresis,
Western blot, RNase protection assay, and histopathological evaluations were
done.
. MATERIALS and METHODS
A. Materials
1. Animals
Six week-old specific-pathogen-free (SPF) Sprague-Dawley rats (male,
Charles River Japan) were used for experiments. They were fed on sterilized
commercial pellet diets (Biogenomics Co., Seoul, Korea) and given sterile water
ad libitum. A total of 200 rats were maintained. They were housed in an
air-conditioned biohazard room designed for infectious animals, with a 12 h L:12
h D cycle.
B. Methods
1. H. pylori Culture
H. pylori (SS1 strain) known to fulfil the Lausanne criteria27 were kindly
provided in a frozen state by Prof. Adrian Lee.28 Bacteria with the typical S
shape, Gram-negative rods with modified Gram stain, and positive oxidase,
urease and catalase were all presumed to be H. pylori. They were stored in
liquid nitrogen and infected in the mice after cultivation. For the liquid culture,
6 days before inoculation 150 of H. pylori isolates were inoculated into
Brain Heart Infusion (BHI) broth supplemented with 10% sheep blood, 5% horse
serum, and Skirrow's supplement in an anaerobic jar with the micro-aerophilic
gas-generating kit CampyPack-Plus (Becton Dickinson, USA) at 37 and 5%
O2/10% CO2/85% N2 for 5 days. Cultures used for dosing the mice were grown
under micro-aerophilic conditions for 4 days in brain heart infusion broth (Difco,
CA) supplemented with 10% foetal calf serum and 5% sheep whole blood in a
shaking incubator.
2. Infection with H. pylori
The rats were inoculated with a bacterial suspension, a single intragastric
dose of a 1 ×107 CFU/mL, obtained from 4-day liquid cultures of SS1 strain.
The rats were dosed three times for a 3 day period with 100 of bacterial
suspension (approximately 1×106 CFU) by oro-gastric tube. They received three
inoculations over a period of 3 days. Control rats were given same amout of
normal saline and were housed in isolators in order to prevent risk of infection.
3. Water Immersion Restraint Stress
Twenty four weeks after inoculation of H. pylori, gastric mucosal lesions
induced by WIRS in rats. The animals were deprived of food, but allowed free
access to water 24 h before insult of WIRS. Rats were places in strain cage and
immersed in water (21 ) for 30, 120 or 480 min. Animals were sacrificed
immediately after the end of water immersion. Stomachs were removed and
opened along the greater curvature, followed by rinsing with phosphate-buffered
saline. For RNA and protein extraction, the stomachs were dipped into RNA
later solution and quickly frozen in liquid nitrogen and stored at 80 until
extraction. For, histological examination, gastric tissue was fixed in 10% buffered
formalin. We divided the animals into five groups, that is, control group only
with WIRS, H. pylori infection group with WIRS, two other groups orally
administered DA-9601 6 or 20 mg/kg, and final group pretreated with
-tocopherol 40 mg/kg.
4. Gross and Histological Observation
Infected rats were killed by cervical dislocation at 24 weeks after H. pylori
inoculation. The stomach was placed in 10% buffered formalin and embedded in
paraffin, and 4 sections were cut. In order to determine the presence of H.
pylori and for pathological findings, haematoxylin and eosin (H&E) staining and
Warthin-Silver stainings were employed on formalin-fixed sections. According to
the criteria of Yamamoto et al. (Table 1), bleeding index was evaluated on
formalin-fixed section and the bleeding rate (%) was calculated.15
Table 1. Criteria of bleeding index
Bleeding index Criteria
0 no bleeding at all
1mild bleeding
(small amounts of coagula in the stomach)
2moderate bleeding
(intermediate between 1 and 3 points)
3
severe bleeding
(contents of the stomach were filled with
blood in duding coagula)
5. TBA-reactive Substance
The concentration of thiobarbituric acid-reactive substance (TBA-RS), an
index of lipid peroxidation, was measured in the gastric mucosal homogenates
using the method of Ohkawa et al..29 The level of TBA-RS in the mucosal
homogenate was expressed as nM of malondialdehyde per mg of protein using
1,1,3,3-tetramethoxypropane as a standard.
6. Cytokine Measurement
The concentration of IFN- and TNF- in the gastric tissue of rat was
measured by enzyme-linked immunosorbent assay (ELISA). First, 2 ml of
phosphate-buffered saline (PBS) containing 0.1% sodium dodesylsulfate (SDS)
and 0.1% Tween 20 was added to each frozen specimen. The specimen was
then homogenized for 90 sec in cold water. After overnight storage at 20 , it
was centrifuged at 400 g for 15 min at 4 . The supernatant was analysed
with a Biotrak Rat Cytokine ELISA System (Amersham International,
Buckinghamshire, England). Results were expressed in terms of concentration per
mg of protein. SPECTRAmax 250 (Molecular Devices, Sunnyvale, CA, USA)
was used as the ELISA reader, and protein was measured using Bicinchoninic
acid (BCA) Protein Assay Reagents (Pierce Chemical, Rockford, IL, USA).
7. 2-Dimensional Gel Electrophoresis
Cultures grown in liquid media to mid-log phase were pelleted, washed
once in 1 ml 0.9% NaCl, and frozen at 80 . Cell pellets were then treated
with urea-SDS sample buffer, including DNase and RNase, according to
procedures of the manufacturer (Genomic Solution, ESA), and 2-D gel analysis
was performed as described.30 The ESA isoelectric focusing system with pH 3-10
ampholines was used to generate gradients ranging approximately from pH 4.5 to
6.5. Alternatively, the Amersham IPGphor system was used with 18 cm IPG
strip gels generating a nonlinear pH gradient of 3 to 10. The second dimension
SDS-PAGE gel 11.5% Duracryl separated proteins over the range of molecular
weight from 10 to 80 kD. Proteins were stained with Silver stain or Coomassie
blue.
8. Cell Culture on Heat Shock Induced Stress
Human gastric adenocarcinoma (AGS) cells were purchased from American
Type Culture Collection (ATCC, Rockville, MD). They were cultured for
fluorescence microscopy on glass coverslips or for micro injection studies on
etched grid cover slips marked by numbers and letters (Bellco, Vineland, NJ) in
Ham's F12 medium (Gibco BRL, Gaithersburg, MD) supplemented with
L-glutamine, with 10% fetal calf serum (FCS, HyClone, Logan, UT), antibiotics
and antimycotics in a humidified 5% CO2 atmosphere. The H. pylori were
washed with PBS (0.01 M NaH2PO4/ Na2HPO4, 145 mM NaCl, pH 7.2) and
harvested in F12 medium without FCS and antibiotics/antimyotics. Bacterial
concentration was adjusted to optical density 0.5 using wave length of 565 nm.
AGS cells were transferred to medium without FCS, antibiotics and antimycotics
about 15 min before bacteria were added (1 ml H. pylori / 2 ml media) and the
mixture was incubated at 37 for time period indicated usually 2 h. Cells
were induced heat stress 43 for 30 min.
9. Western Blotting
Each frozen gastric mucosa was homogenized in ice-cold 20 mM Tris-HCl
buffer, pH 7.5 containing 2 mM EDTA, 0.5 mM EGTA, 300 mM sucrose, 2
mM phenylmethyl sulfonyl fluoride (PMSF) with a tissue tearer at 4C. Protein
concentrations were determined by Bio-rad reagent (Bio-rad, Hercules, CA) using
bovine serum albumin as standard. Ten microgram of protein from the
homogenates was denatured in the sample buffer and subjected to electrophoresis
on an 8 % Tris-glycine gel and transferred onto polyvinylidene difluoride
membranes (PVDF). The blots were pretreated with Tris-buffered saline
containing 5 % nonfat dry milk, 1 % albumin and 0.1 % Tween 20 and then
incubated overnight at 4 with antibodies for COX-1 (SC1754, Santacruz
Biotech, Santa Cruz, CA), COX-2 (SC1756, Santacruz Biotech, Santa Cruz, CA)
and 3,3'-diaminobenzidine reagents. Filters were washed three times and incubated
with a horseradish peroxidase-conjugated secondary antibody against goat IgG,
developed using a commercial enhanced chemiluminosense system (ECL), and
exposed to films.
10. RNase Protection Assay (RPA)
The RPA is a highly sensitive and specific method for the detection and
quantitation of mRNA species. Gene expressions of IFN- , TNF- , GM-CSF,
TGF- 1, TGF- 3, TGF- 2, LT, TNF, MIF, IFN were examined by RNase
protection assay with two housekeeping gene products, L32 and GAPDH in
ethanol-induced GMD rat using rck-3 Multi-probe Template set (BD,
PharMingen, San Diego, CA). Total RNA was extracted from the gastric mucosa
by the Trizol method (Life technologies, Gibco BRL) according to the
manufacturer's protocol and quantified spectrophotometrically by absorption at 260
nm and 280 nm. Total RNA (20 mg) was labeled with [32P] UTP (Amersham
Pharmacia Biotech, Buckinghamshire, UK), using T7 RNA polymerase according
to the manufacturer's description, and hybridized at 42 overnight with 1105
cpm of riboprobe, and then digested with RNase A cocktail. The reaction
products were resolved on 5 % acrylamide gel and analyzed after 72 h by
autoradiography.
11. Electrophoretic Mobility Shift Assay (EMSA)
Nuclear proteins were extracted from the tissues of Group I, II, , IV,
and V. Nuclear proteins (10 mg) were incubated for 30 min at 25 with 20
pg of 32P-labeled oligonucleotides containing the NF- B binding site
(GATCGAGGGGGACTTTCCCAGC) and 1 g of poly dI-dC in 5 ml of a
solution consisting of 20 mM HEPES, 4 mM MgCl2, 50 mM CaCl2, 1 mM
EDTA, 1 mM DTT, and 4% glycerol. The mixtures were loaded onto a
non-denaturing 6% polyacrylamide gel with 0.25 × TBE electrophoresis buffer.
After electrophoresis, gels were dried and exposed to the radiography film for 18
h at 70 with intensifying screens. Supershift assays were also performed
using rabbit antibodies against four kinds of Rel protein; p50, p65, p52, c-Rel to
determine the Rel protein composition of oxygen-derived free radicals-activated
NF- B dimers in nuclear extracts of esophageal mucosa of GERD. Each
anti-p50, -p65, -p52, -c-Rel antibody (Santa Cruz, CA) was mixed with the NF-
B probe at the start of the 30 min-incubation.
12. Statistical Assay
Results are expressed as the mean±S.E.M.. The data were analysed by
one-way analysis of variance (ANOVA), and the stastical significance between
groups was determined by Duncan's multiple range test. Statistical significance
was accepted with a p<0.05.
. RESULTS
1. The Influence of Stress on H. pylori-associated Gastropathy; Macroscopic
and Microscopic Observation
1) The macroscopic changes
H. pylori infection alone only provoked the gastric inflammations in rats.
There were neither ulcerative lesions nor tumorous lesions in the stomach upto
24 weeks after H. pylori infection. WIRS, on the other hand, formed multiple
erosions with hemorrhagic changes. By the way, stress significantly increased
gastric lesions of H. pylori infection than without H. pylori infection. WIRS of
30 min duration alone did not develop any GML, but when stress was imposed
in H. pylori-infected rat, multiple scattered hemorrhagic erosions were noted even
after 30 min of WIRS, severe than rats without H. pylori infection. The gastric
lesions including erosions and linear ulcerations were appeared after 120 min of
WIRS and multifocal hemorrhagic lesion at 480 min. Hemorrhagic, erosive
lesions shown at 30 min after WIRS increased number and size of hemorrhagic
lesion at 120 and 480 min in H. pylori-infected group and linear ulcerations
were noted thereafter. Bleeding index of WIRS alone increased the score by
0.33, 0.75, 0.88 and 0.99 at 30, 120, 480 and 720 min (Fig. 1) and bleeding
index of WIRS with H. pylori infection increased the score by 0.38, 0.93, 1.35
and 1.97 at 30, 120, 480 and 720 min, of which index was increased in a
time-dependent manner. Compared to WIRS alone, bleeding index of WIRS with
H. pylori infection increased at 480 and 720 min respectively with singnificant
difference (p<0.05). Bleeding rates of WIRS alone increased the percentage by 0,
59.6, 69.7 and 80.4 % at 30, 120, 480 and 720 min in time-dependent manner
(Fig. 2). Compared to WIRS alone, bleeding rates of WIRS with H. pylori
infection significantly increased the percentage by 41.6, 79.9, 90.8 and 100 at
30, 120, 480 and 720 min respectively (p<0.05).
2) The microscopic changes
The WIRS caused serious pathological changes in the stomach, of which
severity was significantly increased in accordance with the times of restraint
stress. Pathologically, overt gastric ulcer with necrotic bases and exudative
changes and inflammatory cell infiltrations, mostly neutrophils were observed.
Only 30 min duration of WIRS caused some erosive changes with inflammatory
cells. However, in group affected with both stress and H. pylori infection, the
gastric lesions were more brisk and aggravated. In a same time point, the overall
pathological changes including hemorrhages and erosions were apparently severe
in rats affected with both stress and H. pylori infection than groups of rat only
done with WIRS. Microscopic examination of the mucosa after 480 min
WIRS-induced GMD revealed widespread damage of the surface epithelium with
many cells sloughed off into the gastric lumen and focal area of deep
hemorrhagic necrosis. Severe hemorrhagic GMD are observed WIRS-induced
GMD with H. pylori infection animals (Fig. 3). Inflammatory cell infiltration and
hemorrhage were noted in the lamina proporia as well as submucosa. The degree
of mucosal inflammation became more prominent and a mild to moderate
decreased thickness layers was also seen during this period.
WIRS alone
WIRS + H. pylori
WIRS (min)
Ble
edin
g in
dex
0.5
1.0
1.5
2.0
2.5
030 120 480 720
*
*
WIRS alone
WIRS + H. pylori
WIRS (min)
Ble
edin
g in
dex
0.5
1.0
1.5
2.0
2.5
030 120 480 720
*
*
Fig. 1. Bleeding index of WIRS-induced gastric mucosa in rats with or
without H. pylori infection. WIRS was applied for 30, 120, 480 and
720 min at 40 weeks after H. pylori infection. Bleeding index was
expressed as Table 1 and all values are expressed as mean ± S.E.M. for
6 8 rats. Asterisk indicates stastical difference from WIRS alone (* :
p<0.05)
WIRS alone
WIRS + H. pylori
WIRS (min)
Ble
edin
g ra
tes
(%)
20
40
60
80
100
030 120 480 720
*
*
*
*
WIRS alone
WIRS + H. pylori
WIRS alone
WIRS + H. pylori
WIRS (min)
Ble
edin
g ra
tes
(%)
20
40
60
80
100
030 120 480 720
*
*
*
*
Fig. 2. Bleeding rates (%) of WIRS-induced gastric mucosa in rats with or
without H. pylori infection. WIRS was applied for 30, 120, 480 and
720 min at 40 weeks after H. pylori infection. Bleeding rates was
expressed as ratio of hemorrhage recurrence and all values are expressed
as Mean ± S.E.M. for 6 8 rats. Asterisk indicates stastical difference
from WIRS alone (* : p<0.05)
(A) (B)
(C) (D)
Fig. 3. Microscopic observation of WIRS-induced gastric mucosa in rats with
or without H. pylori infection after stress loaded 480 min. (A) and
(B) were observed inflammation in epithelium on WIRS alone, (C) and
(D) were checked severe gastritis and hemorrhage in epithelium on WIRS
with H. pylori infection. (A, C ×40, B, D ×100)
2. The Influence of Stress on H. pylori-associated Gastropathy; Changes of
Several Mediators Involved in H. pylori-induced Gastric Mucosal Damages
1) Oxidative mediators
The contents of thiobarbituric acid reactive substances (TBA-RS, a marker
of lipid peroxidation) were significantly increased in WIRS with H. pylori
infection compared to WIRS group without H. pylori infection at 30, 120, 480
and 720 min (*p<0.05, **p<0.01) (Fig. 4). After 720 min of WIRS, TBARS
was seen maximum level (4.4 pg/mg of protein).
2) Cytokines
Production of INF- was significantly increased in WIRS with H. pylori
infection than without H. pylori infection on time-dependent manner (Fig. 5A).
After 480 min of WIRS, IFN- was seen maximum level (79.0 pg/mg protein),
but IFN- was decreased after 720 min. The group of without H. pylori
infection didn't change level of IFN- .
The content of TNF- and IL-10 were increased in WIRS with H. pylori
infection and no H. pylori infection on time-dependent manner (Fig. 5B). TNF-
was not significantly differently among groups.
3) Proteome markers
Changes of proteomic profiles were differentially expressed on
WIRS-induced GMD in H. pylori-infected rats (Fig. 6). Identifications of changes
spot by SELDI-TOF analysis were seen with the check of genebank
identification number. After 30 min in WIRS, Fig. 6A identified three spots into
(1) PART1 (putative novel phosphatidylinositol 3 kinase, AAB32956, gi:806955),
(2) BMI-1 (murine leukemia viral oncogene homolog, XP_031361, gi:14747007)
and (3) hypothetical protein (XP_035122, gi:14783675). After 120 min in WIRS,
Fig. 6B identified five spots into (4) nestin (P48681, gi:1346682), (5) mitotic
spindle associated protein (AAK91712, gi:15193198), (6) hypothetical protein
(XP_044197, gi:14744107), (7) caspase-9 (N92123, gi:1264432) and (8) solute
carrier family 26, number 1, isoform b (AAH15517, gi:15930164). And, after
480 min in WIRS, Fig. 6C identified one spot (9) ZA (AAB36122, gi:1478361).
WIRS alone
WIRS + H. pylori
WIRS (min)
TB
AR
S (p
g/m
g pr
otei
n)
1
2
3
4
5
030 120 480 720
**
**
*
*
WIRS alone
WIRS + H. pylori
WIRS alone
WIRS + H. pylori
WIRS (min)
TB
AR
S (p
g/m
g pr
otei
n)
1
2
3
4
5
030 120 480 720
**
**
*
*
Fig. 4. Changes of TBA-RS on WIRS-induced gastropathy in rats with H.
pylori infection. TBA-RS was determined at 30, 120, 480 and 720 min
for using ELISA kit (OXIS, CA). Asterisk indicates stastical difference
from WIRS alone **: Significance different from no H. pylori infection
vs. p<0.01.
(A)
WIRS alone
WIRS + H. pylori
WIRS (min)
Inte
rfer
on-γ
(pg/
mg
prot
ein)
20
40
60
80
100
030 120 480 720
*
*
*
*
WIRS alone
WIRS + H. pylori
WIRS alone
WIRS + H. pylori
WIRS (min)
Inte
rfer
on-γ
(pg/
mg
prot
ein)
20
40
60
80
100
030 120 480 720
**
**
**
**
(B)
WIRS alone
WIRS + H. pylori
WIRS (min)
TN
F-α
(pg/
mg
prot
ein)
25
50
75
100
125
030 120 480 720
WIRS alone
WIRS + H. pylori
WIRS alone
WIRS + H. pylori
WIRS (min)
TN
F-α
(pg/
mg
prot
ein)
25
50
75
100
125
030 120 480 720
Fig. 5. (A) Changes of IFN- on WIRS-induced GMD in rats with H. pylori
infection. IFN- was determined at 30, 120, 480 and 720 min for using
ELISA kit. *: Significance different from no H. pylori infection vs.
p<0.05. **: Significance different from no H. pylori infection vs. p<0.01.
(B) Changes of TNF- on WIRS-induced GMD in rats H. pylori
infection. TNF- was determined at 30, 120, 480 and 720 min for using
ELISA kit. IFN- and TNF- were checked severe gastritis and
hemorrhage in epithelium on WIRS with H. pylori infection. *:
Significance different from no H. pylori infection vs. p<0.05. **:
Significance different from no H. pylori infection vs. p<0.01.
(A) (B) (C)
Fig. 6. Change of proteomic profiles at 30 (A), 120 (B) and 480 (C) min on
WIRS-induced GMD in H. pylori-infected rats. Identification for
differentially expressed spot by 2-dimensional gel electrophoresis analysis
from genebank identification numbers as described in the mateials and
methods. At 30, 120 and 480 min, we observed detection of three, five
and one spot on WIRS-indued GMD in H. pylori-infected rats.
3. The Influence of Stress on H. pylori-associated Gastropathy; Changes of
Heat Shock Proteins (HSPs)
1) Western blot analysis
H. pylori infection alone decreased expression of HSP70 and HSP27, but
heat-induced stress increased expression of HSP90, HSP70 and HSP27 in AGS
cells (Fig. 7). In H. pylori infected AGS cell, heat shock increased HSP70, but
decreased HSP27. The changes of other HSPs including HSP90 and HSC70 were
not significant.
2) 2-D gel electrophoresis with blotting
Fig. 8 showed the overall change of proteome spots according to the times
after heat shock in AGS cell. There was no significant change of HSP90 in
spite time passages. However, when we transferred the whole proteome spots
separated by 2D-gel electrophoresis in to NC paper and applied with each
specific antibodies of various HSPs, the change of HSP expression were
significantly different according to time points. As times passed, significant
phosphorylation of HSP90 and HSP27 wre noted and also heat shock or H.
pylori infection triggered the significant phosphorylation of these proteins (Fig.
9). When the cells were treated with both H. pylori and heat shock, these
phosphorylations of HSP90 were significantly increased, reflecting that H. pylori
or stress and both provoked the activation of HSP90 rather than the changes of
amounts.
- + - + - - + +
Hsp 90
70
60
27
H. pyloriHeat shock
α−tubulin
- + - + - - + +
Hsp 90
70
60
27
H . p y l o r i
H e a t s h o c k
α − t u b u l i n
Fig. 7. Detection of various HSPs expression in cultured AGS cells by
Western blot analysis. Either heat shock and/or H. pylori infection were
induced in AGS cells. After extracting proteins from each group, proteins
were separated and transferred onto NC paper, blotted with HSP 27, 60,
70, and 90 antibodies, respectively. Proteins amounts were balanced with
-tubulin amounts.
Control + Heat shock + Heat shock
presence of H. pylori
Fig. 8. 2 D-gel electrophoresis. Isoelectric focusing with PAGE separation was
done in each group, control, heat shock, and H. pylori infection. Each
spots were analyzed with Image Analyser.
HSP90HSP70
HSP60
HSP27Control
H. pylori
Heat shock
H. pylori +
Heat shock
HSP90HSP70
HSP60
HSP90HSP70
HSP60
HSP27Control
H. pylori
Heat shock
H. pylori +
Heat shock
Fig. 9. Activation of HSP90, HSP70, HSP60 and HSP27 in cultured AGS
cells. After 2D-PAGE separatiom, the gels were transferred into NC
paper and blotted with each antibody. H. pylori infection alone or heat
shock provoked significant phosphorylation of HSP90 and 27. Both H.
pylori and heat shock together induced more apparent phosphorylation of
HSP90, which might be the principal mechanism of gastric mucosal
damages.
4. Prevention of Stress-induced Augmented Gastric Lesions with Antioxidants
1) Macroscopic and Microscopic evidences
As shown in Fig. 10, treatment of DA-9601 (6, 20 mg/kg, po) or
-tocopherol (40 mg/kg, po) significantly attenuated the severity of WIRS-induced
GMD in H. pylori-infected rats. Rats were sacrificed and fixed with 10% neutral
formalin buffer at 30, 120 or 480 min after WIRS. At 30 min, control was
observed several GMD in stomach, DA-9601 (6 mg/kg) and -tocopherol were
equal effect (1-2 scatter GMD). But, DA-9601 (20 mg/kg) was not at all seen
GMD in stomach. At 120 min, control was seen a lot of linear and hemorrhagic
GMD and DA-9601 were decreased GMD in dose-dependently manner.
-Tocopherol seem to GMD in administration of DA-9601 6 mg/kg. Finally, at
480 min after WIRS induced GMD, control was seen high severe, a lot of
thick-linear and hemorrhagic GMD, even observed a few gastric ulcer in any
animals. Administration of DA-9601 (6 and 20 mg/kg) were not change gross
observations and number of GMD, and not seen linear and hemorrhagic GMD at
all. -Tocopherol was observed more severe than DA-9601 6 mg/kg.
In the control group, pathological changes were noted with hemorrhagic
GMD at 120 and 480 min after WIRS in H. pylori-infected rats (Fig. 11A). At
120 min after WIRS, control was mainly observed hemorrhagic site and
inflammation-related factors in epithelium of fundic area, and severe hemorrhagic
gastritis at 480 min after WIRS. DA-9601 (20 mg/kg) was not seen GMD at
120 min after WIRS, and observed weakly GMD without hemorrhage at 480
min after WIRS (Fig. 11B).
2) Molecular evidences; Western blot of HSP changes
The changes of various HSPs was determined by Western blotting with
antibody against HSP90, HSP70 and HSP27 (Fig. 12). DA-9601 significantly
increased HSP70 and HSP27 expressions on WIRS-induced GML of H.
pylori-infected rats.
3) Molecular evidences; RNase protection assay
The changes of mRNA of inflammation-related cytokines and
apoptosis-related factors were measured by RPA using the RNA obtained from
rat gastric mucosa of each group. The TNF- , TGF- 1, MIF and IFN- mRNA
transcript with two housekeeping gene, L32 and GAPDH were detected in the
rat gastric mucosa using rck-3 multi probe template set (Fig. 13). Antioxidant
treatment significantly decreased these inflammatory cytokines mRNA expression
levels at 0.5, 2 or 8 h after WIRS inducetion in H. pylori-infected rats.
Similarily Bcl-xL, caspase-1, caspage-2, caspase-3 mRNA transcript with
two housekeeping gene, L32 and GAPDH were detected in the rat gastric
mucosa using rAPO multi probe template set, although the level of mRNA
expression weak (Fig. 14). Antioxidant increased these apoptosis-related mRNA
expression levels at 30, 120 or 480 min after WIRS inducetion in H.
pylori-infected rats, suggesting the preventive induction of apoptosis related gene
transcript to prevent the necroinflammation.
4) Molecular evidences; NF- B DNA bindings
Fig. 15 shows the NF- B complex of nuclear proteins extracted from each
group. Pretreatment with DA-9601 significantly decreased NF- B DNA binding
in a dose dependent manner, suggesting the antioxidant regulated the
transcriptional binding for either cytokines or other inflammation related genes.
(A) (B)
(C) (D)
(A) (B)
(C) (D)
Fig. 10. Representative macroscopic findings of the gastric mucosa of rats.
At 480 min of WIRS-induced stress, we observed gastric mucosa in H.
pylori infection rats. These groups are (A) control, (B) DA-9601 6
mg/kg, (C) DA-9601 20 mg/kg, and (D) -tocopherol 40 mg/kg.
(A) (B)
(C) (D )
Fig. 11. Microscopic observation of WIRS-induced GMD in H. pylori-
infected rats. (A) and (B) denoted the representive gastric pathology in
rats affected with both H. pylori infection and WIRS 120 and 480
minutes, respectively. (A) and (B) denoted the gastric pathology in group
treated with DA-9601 at 120 and 480 min, respectively. Significant
protection was noted in rats pretreated with antioxidant.
30 120 480 30 120 480
WIRS alone
WIRS pretreatedWith DA -9601
HSP27
HSP70
HSP90
30 120 480 30 120 480
WIRS alone
WIRS pretreatedWith DA -9601
HSP27
HSP70
HSP90
Fig. 12. Effect of antioxidant on HSPs expressions according to group.
DA-9601 treatment induced significant levels of HSP70 and HSP27,
which might be involved in the protective action against WIRS in rats.
1 2 3 4 5 6 7 8 9 1 0
I F N- βT N F -β
G M - C S F
T G F- β 1
T G F- β 2
L T b
T N F- α
M I FI F N -γ
L 3 2
G A P D H
T G F -β 3
1 2 3 4 5 6 7 8 9 1 0
I F N- βT N F -β
G M - C S F
T G F- β 1
T G F- β 2
L T b
T N F- α
M I FI F N -γ
L 3 2
G A P D H
T G F -β 3
Fig. 13. Results of RNase protection assay (RPA) for cytokine (rCK-3). The
RNA extracted from each group according to the treatment of DA-9601
were hybridized with radiolabelled multi-probes hybridizing with
inflammation associated cytokines, which included IFN- , TNF- ,
GM-CSF, TGF- 1, TGF- 3, TGF- 2, LT-b, TNF- , MIF and IFN- with
two housekeeping gene products, L32 and GAPDH and digested with
RNase enzyme. Each lane signify the levels offf transcript of each gene.
Lane denotes; 1: probe, 2: control RNA, 3: yeast RNA, 4: normal, 5:
WIRS alone for 30 min, 6: WIRS for 30 min pretreated with DA-9601,
7: WIRS alone for 120 min, 8: WIRS for 120 min pretreated with
DA-9601, 9: WIRS alone for 480 min and 10: WIRS for 480 min
pretreated with DA-9601.
F a s A g ( 4 3 5 )
B c l-xL ( L ) ( 3 9 3 )
B c l-xL ( S ) ( 3 4 3 )
F a s L ( 3 1 5 )
C a s p a s e -1 ( 2 8 2 )
C a s p a s e - 3 ( 2 5 5 )
C a s p a s e - 2 ( 2 3 1 )
B a x ( 2 1 0 )
B c l- 2 ( 1 8 9 )
L 3 2 ( 1 4 1 )
G A P D H ( 1 2 5 )
1 2 3 4 5 6 7 8 9 10
F a s A g ( 4 3 5 )
B c l-xL ( L ) ( 3 9 3 )
B c l-xL ( S ) ( 3 4 3 )
F a s L ( 3 1 5 )
C a s p a s e -1 ( 2 8 2 )
C a s p a s e - 3 ( 2 5 5 )
C a s p a s e - 2 ( 2 3 1 )
B a x ( 2 1 0 )
B c l- 2 ( 1 8 9 )
L 3 2 ( 1 4 1 )
G A P D H ( 1 2 5 )
1 2 3 4 5 6 7 8 9 10
Fig. 14. Results of RNase protection assay (RPA) for apoptosis (rAPO).
Genes of Fas Ag, Bcl-xL (L), Bcl-xL (S), FasL, Caspase-1, Caspase-2,
Caspase-3, Bax and Bcl-2 were examined by RNase protection assay
with two housekeeping gene products, L32 and GAPDH according to the
drug treatment. Each lane denotes. 1: probe, 2: control RNA, 3: yeast
RNA, 4: normal, 5: WIRS alone for 30 min, 6: WIRS for 30 min
pretreated with DA-9601, 7: WIRS alone for 120 min, 8: WIRS for 120
min pretreated with DA-9601, 9: WIRS alone for 480 min and 10:
WIRS for 480 min pretreated with DA-9601.
N F -κ B
1 2 3 4 5 6 7 8
N F -κ B
1 2 3 4 5 6 7 8
Fig. 15. Effect of NF-κB by DA-9601 on WIRS-induced GMD in rats with
H. pylori infection. NF-κB DNA binding activities were measured by
electrophoretic mobility shift assay using 32P-labeled oligonucleotide
coding NF-κB binding sites Significant increased in NF-κB binding
activities were noted after H. pylori infection or H. pylori infection and
heat shock and these radiactivities were markedly decreased with
antioxidant treatment Lane 1: no probe 2: control cells (30 min) 3: H.
pylori infection 4: H. pylori infection + heat shock 5: H. pylori + heat
shock pretreated with DA-9601 6: H. pylori infection 7: H. pylori
infection + heat shock 8: H. pylori + heat shock pretreated with
DA-9601.
. DISCUSSION
The present study showed for the first time that the gastric lesion by H.
pylori could be augmented by both stress and oxidative stress and the
dysregulation of heat shock protein might be responsible for augmented gastric
lesion. These findings can explain why the incidence of gastric cancer is so high
in Korea, because we can infer that the high prevalence of H. pylori infection
and complex social structure might lead to notoriously high incidence of gastric
cancer in Korea.
As major etiologic factors leading to peptic ulcer disease, and
hypersecretion, smoking, alcohol, NSAIDs, bile acid, and stress are considered.
The German blitz in London, the Kobe Hanshin great earthquake, economic
crisis in Sophia, and sovereignty negotiations in Hong Kong have all been
followed by an abrupt increase in peptic ulcers of both the stomach and the
duodenum.31-33 By the way the evidence that psychological stress is one of those
factors is not invalidated by the discovery of H. pylori. Among potential
mediators, several known behavioral risk factors for ulcers - smoking, alcohol
abuse, and lack of sleep - have clear associations with real-life stress and are
known to impair wound healing through their effects on immune function.34 On
the physiological side, stress is known to modify gastric blood flow, which plays
an important role in the gastric mucosal barrier, and to affect possible mediators
such as thyrotropin-releasing hormone, cytokines, and corticotropin-releasing
hormone. Besides, stress seems to have variable effects on gastric motility:
delayed gastric emptying could increase the risk of gastric ulcer, while
accelerated emptying could increase the net acid load delivered to the duodenum
at any given level of gastric secretion, enhancing the risk of duodenal ulcer;
skipped meals and poor sleep might increase duodenal acid load still further.35
Psychological stress may also promote the growth of H. pylori in the duodenum
since the H. pylori-inhibitory effects of bile seem to be reversed by acid.36
The WIRS model is one of the most widely used methods for studying the
pathogenesis of peptic ulcer.15,16,37-41 It has been established that exposure to
WIRS rapidly induces gastric mucosal lesions in rats, but the interaction between
H. pylori infection and WIRS was not clearly defined because that the results
have been rather conflicting.42 Using BALB/c mice, Matsushima et al. reported
that H. felis infection itself did not cause gastric mucosal erosions, but it did
augment the stress-induced erosions.16 And, Yamamoto reported that H. pylori
infected C57BL/6 mice increased the severity of mucosal injury at 30 min of
stress exposure, but at 720 min, there was no difference in mucosal lesions
between mice with or without H. pylori infection.15 In the present study,
long-term WIRS induced gastric mucosal damages no respected of H. pylori
infection, but mean severity was significantly higher in group infected with H.
pylori compared to no H. pylori infection. We observed that the bleeding index
and bleeding rate in WIRS-induced rats with H. pylori infection were
significantly higher than without H. pylori infection. In histological observation
and inflammation-mediated factors, stress augmented inflammation of gastric
mucosa, and increased TBA-RS, IFN- , and TNF- in gastric mucosa layer
with H. pylori infection.
The changes in oxygen-free radicals and pro-inflammatory cytokines are
induced by both stress and H. pylori, but their roles in the development of
gastric ulcers are not fully understood.15,16,43 Recent reports suggest that the effect
of altered cytokines may be different in stress-induced and H. pylori-associated
ulcers. For example, Matsushima et al. reported that both Helicobater felis
infection and water-immersion stress induced a similar IL-1 response.40 And,
we found that the Th1 lymphocytic responses were augmented in group affected
with both stress and H. pylori infection, suggesting the intense involvement of
gastric inflammation after H. pylori infection was increased. The production of
IFN- and TNF- was significantly higher in the infected than in the uninfected
group of rats, which supports the findings.44-46 The changes in IFN- and TNF-
induced by H. pylori infection and stress treatment indicate that these
cytokines may be candidates for the cause of acute mucosal injury of the
stomach. On the other hand, the time lag between the occurrence of mucosal
injuries and the alterations in cytokine production, and the absence of
inflammatory cell reaction suggest that additional mechanisms may be involved
in the formation of gastric mucosal injuries in the early phase of stress
treatment.
In H. pylori-infected gastric mucosa, significant generations of oxidative
radicals was involved. NH3 derived from H. pylori reacts with HOCl to yield
monochloramine (NH2Cl) and these liphophilic compounds freely penetrates
biological membranes to oxidize intracellular components.47 Therefore, a new
therapeutic approach using agents that inhibit reactive oxygen species (ROS)
production from activated neutrophils or scavenging ROS has been proposed for
H. pylori associated gastric mucosal inflammation. We and other groups have
demonstrated that some kinds of gastroprotective drugs, such as rebamipide,
polaprezine, and ecabet sodium, have these properties documented in vitro and in
vivo.48,49 In the stress and H. pylori infected condition, ROS from neutrophils
could play an important role in the pathogenesis of gastric mucosal injury.50-52
Under WIRS, gastric mucosal oxidative stress as well as lesion formation were
attenuated by treatment with the xanthine oxidase inhibitor, allopurinol,
suggesting the importance of xanthine/xanthine oxidase system for the
development of ischemic-reperfusion injury in the stomach.53 The most important
physiological function of antioxidant enzymes like peroxidase, catalase, and
glutathione peroxidase is to detoxify cellular H2O2 to prevent oxidative damage
to the cell.54 SOD dismutase O2- into H2O2, which is then scavenged by
peroxidase and catalase so that the highly reactive OH or HOCl formed by
MPO-catalysed Cl- oxidation is not generated.55 H2O2 is diffusible and may go to
any cellular compartment where it locally produces highly reactive OH in
presence of O2- through a metal-catalysed Haber-Weiss reaction.56 Neutrophil
accumulation in stomach clogged the microvasculature, thus causing tissue
ischemia.57 Accumulation of H2O2, which not only causes oxidative damage of
the gastric mucosa, but also leads to apoptotic cell death during ulceration.58,59
Our results confirmed that H. pylori increased contents of TBA-RS in
WIRS-induced GMD.
In the current experiment, antioxidant treatment including -tocopherol or
DA-9601 reported to possessing the antioxidative actions in the stomach,
ameliorated the gastric lesions provoked by both stress and H. pylori infection.
-Tocopherol is known to antioxidant, and DA-9601 is ethanol extract of
Artemisia asiatica possesses antioxidative and antiinflammatory activities.
DA-9601 mainly contribute to its protective effects against experimentally
induced gastric damage (gastritis, gastric ulcer and duodenal ulcer) in animal
models.60-62 The mechanisms of DA-9601 are known as antioxidantive effect,
anti-inflammatory effect, reepithelization of gastric mucosa and cytoprotective
effects, potentially.63-65 Recently, DA-9601 evaluated chemopreventive effect on
phorbol ester-induced ornithine decarboxylas activity, papilloma foemation, COX2
expression, iNOS expression, NF- B activation in mous skin.66
Similarily the antioxidant administration markedly decreased the mRNA of
several inflammatory cytokines and even transcription factor like NF- B, known
to be inflammation-associated transcription factor. H. pylori activated NF- B in
gastric mucosa in vivo and cultured epithelial cells in vitro.67 Maeda et al.
identified upstream mediators that regulate H. pylori-induced NF- B-dependent
IL-8 production.68 H. pylori-induced apoptosis in gastric epithelial cells is
suppressed by inhibition of NF- B activation using catalase, pyrrolidine
dithiocarbamate, an antisense oligonucleotide for NF- B subunit p50, or
peroxisome proliferator-activated receptor ligands. Kanai et al. who noted that
TGF- plays an anti-apoptotic role in gastric mucosal cells by enhancing the
expression of Bcl-2 family proteins via an NF- B-dependent pathway.69
Antioxidant, -tocopherol and DA-9601, weakened inflammation via inhibition of
ROS production and DA-9601 especially decreased inflammation and
apoptosis-mediators in RPA and reduced NF- B activation in EMSA.
Another important changes in stress and H. pylori-associated gastric lesions
were the changes of molecular chaperones in our study. One of these key
moleculaes involved in the response against stress might be heat shock protein
(HSP), which are necessary for survivals of cells under stress conditions.70,71 The
heat shock response was first discovered in 1962 by Ritossa, who observed a
pattern of Drosophila salivary gland chromosome puffs that were induced in
response to transient exposures to elevated temperature.72 They have been
classified into six major families according to their molecular size (HSP100,
HSP90, HSP70, HSP60, HSP40 and small HSP27), of which HSP70 is one of
the most extensively studied in mammalian cell.73,74 HSP family is induced in
cultured gastric mucosal cells by heat stress, and this protein has a
cytoprotective function in vivo.75 ROS-mediated rabbit gastric cell injury was also
reportedly to be partially protected through the induction of HSP70 by
antioxidative drug application.76
Although the relationship between H. pylori infection and host HSPs
response has not been fully clarified, a recent study has shown that H. pylori
infection reduces and cancelled the inductions of HSP70 in gastric mucosa.77 All
organisms respond to exposure to sublethal temperatures and to a variety of
other stresses such as heavy metal ions, ethanol, anoxia, and oxidants, through
the rapid induction and synthesis of HSPs.78 Their induction and synthesis has
been correlated with the acquisition of thermotolerence, a property of cells and
organisms to show transient protection from the adverse effects of subsequent
heat or chemical stresses.79 Evidence for the protective effects of individual heat
shock proteins has been reported for human HSP27, yeast HSP104, human
HSP70, mammalian HSP90, and Drosophila HSP27.80-84 The level of HSP90 is
generally similar, ubiquitously existed and expressed, in most tissues, with the
highest level observed in the intestine and the germ tissue. HSP25 was
particularly abundant in stomach, colon, and bladder, with reduced levels in
ovary, lung, and skin.85 Restraint and water-immersion stress caused rapid
expression of HSP90, HSC70, and HSP70 mRNAs in the hypothalamus, and
these expression were followed by inductions of the respective HSP proteins.86
The stress protein HSP70 is an inducible protein synthesized in response to a
stressor. Nakamura et al. suggested that synthesis of HSP by sublethal heat
played an important role in the intracellular mechanism of gastric protection
against ethanol.87 HSP70 induction after a conditioned emotional stress would be
cytoprotective for gastric mucosal oxidative injury.88 Koh et al. study showed a
significant increase in MPO activity in the conditions without HSP70 induction
and a significant reduction in MPO activity with HSP induction.89
In the current our experiment, very important finding was grawn from the
2D-gel electrophoresis experiment showing the active phosphorylation of HSP90
was noted after either H. pylori infection or heat shock. These phosphorylation
was further active after the challenge of both stress and H. pylori infection.
Similar finding was also observed in HSP27 (Fig. 9). Recently, HSP90 is
regarded as significant oncoprotein, based on which, multiple targets for HSP90
were tried in clinical field as promising anticancer agents. HSP90 is
constitutively expressed at 2 10 fold higher levels in tumor cells compared with
their normal counterparts, suggesting that it could be crucially important for the
growth and/or survival of tumors. These can be explained by the fact that as
client proteins chaperoned by HSP90, mutated p53, Akt kinase, Raf-1 kinase,
Bcr-Abl kinase, ErbB2 transmembrane kinase, CDK4, Wee1, and certain basic
helix-loop-helix transcription factors including HIF-1 were revealed. Therefore,
active phosphorylation of HSP90 shown in our experiment result might
participate in the propagation or perpetuation of stress-associated gastropathy and
extentively in possible carcinogenesis.
Therefore, the remedy for the prevention of stress-augmented H.
pylori-associated gastropathy might be the induction of cytoprotective HSP70 or
27 and conservation of HSP90. Our trial of antioxidant caould be the ideal
target for that since pretreatment of antioxidant, -tocopherol or DA-9601 could
induced or preserve the HSP70 and intramucosal GSH with the preservation of
HSP90.
. CONCLUSION
This study showed new proof that stress might be the very important
environmental facts determining the outcome of H. pylori infection irrespective of
virulence or host factors. Since H. pylori is highly associated with either the
peptic ulcer disease or gastric cancer, stress also be the critical contributing
factors for that significant oxidative stress and immune derangement were
attributed to the cause of augmentation of GMD after both H. pylori and stress.
Dysregulation of HSP response is also fundamentally involved in these
augmentation of gastric damage. Antioxidant can prevent the degree of H. pylori
and stress-associated GMD, for that significant inductions of HSP70 or HSP27
were noted.
BIBLIOGRAPHY
1. Holzer P: Gastroduodenal mucosal defense. Curr Opin Gastroenterol
16:469-78, 2000
2. Kitagawa H, Fujiwara M and Osumi Y: Effect of water-immesion stress on
gastric acid secretion and mucosal blood flow in rats. gastroenterology
77:298-302, 1979
3. Tepperman BL and Jacobson ED: Circulatory factors in gastric mucosal
defense and repair. In: Physiology of the gastrointestinal tract (ed. Johnson
LR) New York, Raven Press, 1994, pp 1131-51
4. Wallace JL: Mechanisms of protection and healing: Current knowledge and
future research. Am J Med 110(1A):195-235, 2001
5. Takagi KY, Kayuya Y and Watanabe K: Studies on drugs for pepic ulcer.
A reliable method for producing stress ulcers in rats. Chem Pharm Bull
12:465-72, 1964
6. Brzozowski T, Konturek SJ, Kwiecien S, Pajdo R, Drozdowicz D and
Sliwowski Z et al.: SV-480, a novel synthetic flavonoid derivative of
sophoradin, with potent gastroprotective and ulcer healing activity. J Physiol
Pharmacol 46:83-98, 1998
7. Brzozowski T, Konturek PC, Konturek SJ, Brzozowska I, Kwiecien S and
Hahn EG: Involvement of ornithine decarboxylase and polyamines in
epidermal growth factor-induced recovery of gastric mucosa from gastric
lesions provoked by stress. Regul Pept 74:73-84, 1998
8. Brzozowski T, Konturek PC, Pajdo R, Kwiecien S, Ptak A and Sliwowski Z
et al.: Brain-gut axis in gastroprotection by leptin and cholecystokinin against
ischemia-reperfusion induced gastric lesions. J Physiol Pharmacol 52:583-602,
2001
9. Billroth J: Ueber duidenalgeschwure beisepticame. Wein Med Wochenschr
17:705, 1867
10. Bank S, Misra P, Mausner D, Kurtz L, Rehman M and Wise L: The
incidence, distribution and evolution of stress ulcers in surgical intensive
care patients. Am J Gastroenterol 74:76, 1980
11. Cook DJ, Fuller HD, Guyatt GH, Marshall JC, Leasa D and Hall R et al.:
Risk factors for gastrointestinal bleeding in critically ill patients. N Engl J
Med 330:67-381, 1994
12. Lucas CE, Sugawa C, Riddle J, Rector F, Rosenberg B and Walt J: Natural
history and surgical dilemma of 'stress' gastric bleeding. Arch Surg
102:266-73, 1971
13. Cushing H: Peptic ulcers and the interbrain. Surg Gynecol Obstetrics
55:1-34, 1932
14. Duerksen DR: Stress-related mucosal disease in critically ill patients. Best
Prac Res Clin Gastroenterol 17:327-44, 2003
15. Yamamoto N, Sakagami T, Fukuda Y, Koizuka H, Hori K and Sawada Y et
al.: Influence of Helicobacter pylori infection on development of stress-
induced gastric mucosal injury. J Gastroenterol 35:332-40, 2000
16. Matsushima Y, Aoyama N, Fukuda H, Kinoshita Y, Todo A and Himeno S
et al.: Gastric ulcer formation after the Hanshin-Awaji earthquake: a case
study of Helicobacter pylori infection and stress-induced gastric ulcers.
Helicobacter 4:94-9, 1999
17. Cho NH, Moy CS, Davis F, Haenszel W, Ahn YO and Kim H: Ethnic
variation in the incidence of stomach cancer in Illinois, 1986-1988. Am J
Epidemiol 144:661-4, 1996
18. Van der Voort PH, Van der Hulst RW, Zandstra DF, Geraedts AA, Van der
Ende A and Tytgat GN: Prevalence of Helicobacter pylori infection in
stress-induced gastric mucosal injury. Intensive Care Med 27:68-73, 2001
19. Laine l, Marin-Sorensen M and Weinstein WM: Nonsteroidal
antiinflammatory drug-associated gastric ulcers do not require Helicobacter
pylori for their development. Am J Gastroenterol 87:1398-402, 1992
20. McColl KEL, El-Nujumi AM, Chittajallu RS, Dahill SW, Dorrian CA and
El-Omar E: A study of the pathogenesis of Helicobacter pylori negative
chronic duodenal ulceration. Gut 34:762-8, 1993
21. Tovey FI and Hobsley M: Is Helicobacter pylori the primary cause of
duodenal ulceration? J Gastroenterol Hepatol 14:1053-6, 1999
22. Kurata JH and Nogawa AN: meta-nalysis of risk factors for peptic ulcer,
NSAIDs, Helicobacter pylori and smoking. J Clin Gastroenterol 24:2-17,
1997
23. Eiseman B and Heyman RL: Stress ulcers: a continuing challenge. N Engl J
Med 282:372-4, 1970
24. Pruitt BA and Goodwin CW: Stress ulcer disease in the burned patient.
World J Surg 5:209-22, 1981
25. Ellard K, Beaurepaire J, Jones M, piper D and Tennant C. Acute and
chronic stress in duodenal ulcer disease. Gastroenterology 99:1628-32, 1990
26. Feldman M, Walker P, Green JL and Weingarden K: Life events stress and
psychological factors in men with peptic ulcer disease. A multidimensional
case-controlled study. Gastroenterology 91:1370-9, 1986
27. Michetti P, Wadstrom T, kraehenbuhl JP, Lee A, Kreiss C and Blum AL:
Frontiers in Helicobacter pylori research: pathogenesis, host response,
vaccine development and new therapeutic approches. Eur J Gastroenterol
Hepatol 8:717-22, 1996
28. Lee A, O'Rourke J, De Ungria MC, Robertson B, Daskalopoulos G and
Dixon MF: A standardized mouse model of Helicobacter pylori infection:
introducing the Sydney strain. Gastroenterology 112:1386-97, 1997
29. Ohkawa H, Ohnishi N and Yagi K: Assay for lipid peroxide for animal
tissue by thiobarbituric acid reaction. Anal Biochem 95:351-8, 1986
30. Blankenhorn D, Phillips J and Slonczewski JL: Acid and base-induced
proteins during aerobic and anaerobic growth of Escherichia coli revealed
by 2-D gel electrophoresis. J Bacteriol 181:2209-16, 1999
31. Aoyama N, Kinoshita Y, Fujimoto S, Himeno S, Todo A and Kasuga M et
al.: Peptic ulcers after the Hanshin-Awaji earthquake:increased incidence of
bleeding gastric ulcers. Am J Gastroenterol 93:311-6, 1998
32. Lam Sk, Hui WM, Shiu LP and Ng MM: Society stress and peptic ulcer
perforation. J Gastroenterol Hepatol 10:570-6, 1995
33. Nice DS, Garland CF, Hilton SM, Baggett JC and Mitchell RE: Long-term
health outcomes and medical effects of torture among US Navy prisoners of
war in Vietnam. JAMA 276:375-81, 1996
34. Veldhuis JD and Iranmanesh A: Physiological regulation of the human
growth hormone (GH)-insulin like growth factor type I (IGF-I) axis:
predominant impact of age, obesity, gonadal function, and sleep. Sleep
19(Suppl. 10):s221-4, 1996
35. Dubois A and Castell DO: Abnormal gastric emptying response to
pentagastrin in duodenal ulcer disease. Dig Dis Sci 26:292-6, 1981
36. Graham DY: Helicobacter pylori infection in the pathogenesis of duodenal
ulcer and gastric cancer: a model. Gastroenterology 113:1983-91, 1997
37. Kitagawa H, Fujiwara M and Osumi Y: Effects of water-immersion stress on
gastric secretion and mucosal blood flow in rats. Gastroenterology
77:298-302, 1979
38. Zeniya A, Otaka M, Itoh H, Kuwabara T, Fujimori S and Otani S et al.:
Induction and intracellular localization of a 72-kDa heat shock protein in rat
gastric mucosa after water-immersion stress. J Gastroenterol 30:572-7, 1995
39. Popovic M, Popovic N, Bokonjic D and Dobric S: Cold restraint-induced
gastric lesion in individual- and group-stressd rats. Int J Neurosci 91:1-10,
1997
40. Shian Wm, Sasaki I, Kamiyama Y, Naito H, Matsuno S and Miyazawa T:
The role of lipid peroxidation on gastric mucosal lesions induced by
water-immersion-restraint stress in rats. Surg Today 30:49-53, 2000
42. Lee A, O'Rourke J, De Ungria MC, Robertson B, Daskalopoulos G and
Dixon MF: A standardized mouse model of Helicobacter pylori infection:
introducing the Sydney strain. Gastroenterology 112:1386-97, 1997
43. Wilson KT and Fantry GT: Pathogenesis of Helicobacter pylori infection.
Curr Opin Gastroenterol 15:66-71, 1999
44. Noach LA, Bosma NB, Jansen J, Hoek FJ, Van Deventer SJ and Tytgat
GN: Mucosal tumor necrosis factor-alpha, interleukin-1beta, and interleukin-8
production in patients with Helicobacter pylori infection. J Gastroenterol
29:425-9, 1994
45. Karttunen R, Karttunen T, Ekre HP and MacDonald TT: Interferon gamma
and interleukin 4 secreting cells in the gastric antrum in Helicobacter pylori
positive and negative gastritis. Gut 36:341-5, 1995
46. Yamaoka Y, Kita M, Kodama T, Sawai N, Kashima K and Imanishi J:
Induction of various cytokines and development of severe mucosal
inflammation by cagA gene positive Helicobacter pylori strains. Gut
41:442-51, 1997
47. Grisham MB, Jefferson MM, Thomas EL: Role of mono chloramines in the
oxidation of erythrocyte hemoglobin by stimulated neutrophils. J Biol Chem
259:6757-65, 1984
48. Shimoyama T, Fukuda S, Liu Q, Nakaji S, Munakata A and Sugawara K:
Ecabet sodium inhibits the ability of Helicobacter pylori to induce
neutrophil production of reactive oxygen species and interleukin-8. J
Gastroenterol 36:153-7, 2001
49. Suzuki H, Mori M, Seto K, Miyazawa M, Kai A and Suematsu M et al.:
Polaprezine attenuates the Helicobacter pylori-induced gastric mucosal
leucocyte activation in Mongolian gerbils a study using intravital
videomicroscopy. Aliment Pharmacol Ther 15:715-25, 2001
50. Granger DN, Hollwarth ME and Parks DA: Ischemia-reperfusion injury: role
of oxygen-derived free radicals. Acta Physiol Scand 548(Suppl):47-63, 1986
51. Ito M and Guth PH: Role of oxygen-derived free radicals in hemorrhagic
shock-induced gastric lesions in rats. Gastroenterology 88:1162-7, 1985
52. Yoshikawa T, Naito Y, Kishi A, Tomii T, Kaneko T and Iinuma S et al.:
Role of oxygen, lipid peroxidation, and antioxidants in the pathogenesis of
gastric mucosal injury induced by indomethacin in rats. Gut 34:732-7, 1993
53. Nishida K, Ohta Y, Kobayashi T and Ishiguro I: Involvement of the
xanthine/xanthine oxidase system and neutrophils in the development of
acute gastric mucosal lesions in rats with water immersion restraint stress.
Digestion 58:340-51, 1997
54. Bandyopadhyay U, Das D and Banerjee RK: Reactiv oxygen species:
oxidative damage and pathogenesis. Curr Sci 77:658-66, 1996
55. Naito Y, Yoshikawa T, Ando T, Kishi A, Veda S and Oyamada H: changes
in superoxide dismutase activity in the gastric mucosa of peptic ulcer
patients. J Clin Gastroenterol 14:S131-4, 1992
56. Halliwell B and Gutteridge JMC: Role of free radicals and catalytic metal
ions in human disease. An overview. Methods Enzymol 186:1-85, 1990
57. Kozol R, Kopatsis A, Fligiel SEG, Czanko R and Callewaert D:
Neutrophil-mediated injury to gastric mucosal surface cells. Dig Dis Sci 39:
138-44, 1994
58. Suzuki H and Ishii H: Role of apoptosis in Helicobacter pylori associated
mucosal injury. J Gastroenterol Hepatol 15:D46-54, 2000
59. Szabo I and Tarnawski AS: Apoptosis in the gastric mucosa: molecular
mechanisms, basic and clinical implications. J Physiol Pharmacol 51:3-15,
2000
60. Oh TY, Ryu BK, Park JB, Lee SD, Kim WB and Yang J et al.: Studies on
antiulcer effects of DA-9601, an Artemisia Herba extract against
experimental gastric ulcers and its mechanism. J Appl Pharmacol 4:111-21,
1996
61. Oh TY, Ahn BO, Ko JI, Ryu BK, Kim SH and Kim WB et al.: Studies on
protective effect of DA-9601, an Artemisiae Herba extract, against
alcohol-induced gastric mucosal damage and its mechanism. J Appl
Pharmacol 5:202-10, 1997
62. Oh TY, Lee JS, Ahn BO, Lee KJ, Kim WB and Kim YB et al.: Oxidative
stress more than acids is implicated in pathogenesis of reflux esophagitis in
rats. Gut 49:364-71, 2001
63. Huh K, Kwon TH, Shin US, Kim WB, Ahn BO and Oh TY et al.:
Inhibitory effects of DA-9601 on ethanol-induced gastrohemorrhagic lesions
and gastric xanthine oxidase activity in rats. J Ethnopharmacol 88:269-73,
2003
64. Lee JJ, Han BG, Kim MN and Chung MH: The inhibitory effect of
eupatilin on Helicobacter pylori-induced release of leukotriene D4 in the
human neutrophils and gastric mucossal cells. Korean J Physiol Pharmacol
1:573-580, 1997
65. Oh TY, Ryu BK, Ko JI, Ahn BO, Kim SH and Kim WB et al.: Protective
effect of DA-9601, an extract of Artemisiae Herba, against
naproxen-induced gastric damage in arthritic rats. Arch Pharm Res 20:414-9,
1997
66. Seo HJ, Park KK, Han SS, Chung WY, Son MW and Kim WB et al.:
Inhibitory effects of the standardized extract (DA-9601) of Artemisia
asiatica Nakai on phorbol ester-induced ornithine decarboxylase activity,
papilloma formation, cyclooxygenase-2 expression, inducible nitric oxide
synthase expression and nuclear transcription factor kappa B activation in
mouse skin. Int J Cancer 100:456-62, 2002
67. Isomoto H, Mizuta Y, Miyazaki M, Takeshima F, Omagari K and Murase K
et al.: Implication of NF-kappaB in Helicobacter pylori-associated gastritis.
Am J Gastroenterol 96:2768-76, 2000
68. Maeda S, Yoshida H, Ogura K, Mitsuno Y, Hirata Y and Yamaji Y et al.:
H. pylori activates NF-kappaB through a signaling pathway involving IkB
kinase, NF- B-inducing kinase, TRAF2, and TRAF6 in gastric cancer cells.
Gastroenterology 119:97-108, 2000
69. Kanai M, Konda Y, Nakajima T, Izumi Y, Takeuchi T and Chiba T:
TGF-alpha inhibits apoptosis of murine gastric pit cells through an
NF-kappaB-dependent pathway. Gastroenterology 121:56-67, 2001
70. Hirakawa T, Rokutan K, Nikawa T and Kishi K: Geranylgeranylacetone
induces heat shock proteins in cultured guinea pig gastric mucosal cells and
rat gastric mucosa. Gastroenterology 111:34-57, 1996
71. Zeniya A, Otaka M, Itoh H, Kuwabara T, Fujimori S and Otani S et al.:
Induction and intracellular localization of a 72-kDa heat shock protein in rat
gstric mucosa after water-immersion stress. J Gastroenterol 30:572-7, 1995
72. Ritossa F: A new puffing pattern induced by temperature shock and DNP.
Drosophila Experientia 18:571-3, 1962
73. Jolly C and Morimoto R: Role of heat shock response and molecular
chaperones in oncogenesis and cell death. J Natl Cancer Inst 92:1564-72,
2000
74. Xu Q, Hu Y, Kleindienst R and Wick G: Nitric oxide induces heat shock
protein 70 expresion in vascular smooth muscle cells via activation of heat
shock factor 1. J Clin Invest 100:1089-97, 1997
75. Schoeniger LO, Andreoni KA, Ou GR, Risby TH, Bulkley GB and
Udelsman R et al.: Induction of heat shock gene expression in postischemic
pig liver depends on superoxide generation. Gastroenterology 106:177-84,
1994
76. Hahm KB, Park IS, Kim YS, Kim JH, Cho SW and Lee SI et al.: Role of
rebamipide on induction of heat shock proteins and protection against
reactive oxygen metabolite-mediated cell damage in cultured gastric mucosal
cells. Free Radic Biol Med 22:711-6, 1997
77. Fisher H, Konturek PC, Huber V, Neumann J, Hahn EG and Schmitz W et
al.: Heat shock protein 70 (HSP 70) in gastric mucosal damage and
adaptation: effects of Helicobacter pylori infection. Gastroenterology
114:122, 1998
78. Lindquist SL and Craig E: The heat shock proteins. Annu Rev Genet
22:262-77, 1988
79. Li GC and Werb Z: Correleation between synthesis of heat shock proteins
and development of thermotolerence in Chinese hamster fibroblast. Proc Natl
Acad Sci USA 79:3218-22, 1982
80. Lavoie JN, Gingras-Breton G, tanguay RM and Landry J: Induction of
Chinese hamster HSP27 gene expression in mouse cells confers resistance
to heat shock. HSP27 stabilization of the microfilament organization. J Biol
Chem 268:3420-9, 1993
81. Sanchez Y and Lindquist S: HSP104 required for induced thermo- tolerance.
Science 248:1112-5, 1990
82. Angelidis CE, Lazaridis I and Pagoulatos GN: Constitutive expression of
heat-shock protein 70 in mammalian cells confers thermoresistance. Eur J
Biochem 199:35-9, 1991
83. Rollet E, Lavoie JN, Landry J and Tanguay RM: Expressin of Drosophila's
27k-Da heat shock proein in rodent cells confers thermal resistance.
Biochem Biophys Res Commun 185:116-20, 1992
84. Rollet E, Lavoie JN, Landry J and Tanguay RM: Expression of Drosophila's
27 kDa heat shock protein in rodent cells confers thermal resistance.
Biochem Biophys Res Commun 185:116-20, 1992
85. Tanguay RM, Wu Y and Khandjian EW: Tissue-specific expression of heat
shock proteins of the mouse in the absence of stress. Develop Genet
14:112-8, 1993
86. Rokutan K, Hirakawa T, Teshima S, Nakano Y, Miyoshi M and Kawai T et
al.: Implications of heat shock/stress proteins for medicine and disease. J
Med Invest 44:137-47, 1988
87. Nakamura K, Rokutan K, Marui N, Aoike A and Kawai K: Induction of
heat shock proteins and their implication in protection against
ethanol-induced damage in cultured guinea pig gastric mucosal cells.
Gastroenterology 101:161-6, 1991
88. Nagahashi S, Suzuki H, Miyazawa M, Nagata H, Suzuki M and Miura S et
al.: Ammonia aggravates stress-induced gastric mucosal oxide injury through
the cancellation of cytoprotective heat shock protein 70. Free Radi Biol
Med 33:1073-81, 2002
89. Koh Y, Lim CM, Kim MJ, Shim TS, Lee SD and Kim WS et al.: Heat
shock response decreases endotoxin-induced acute lung injury in rats.
Respirology 4:325-30, 1999
- -
Helicobacter pylori
;
( : )
: H. pylori
, . H. pylori
,
. 1) H. pylori
, 2) H. pylori
, 3) H. pylori
.
: SS1 H. pylori SD rat 24 .
H. pylori 30, 120, 480
. , , cytokine
. AGS , H. pylori heat stress HSPs
(HSP90, HSP70, HSP60 HSP27), iNOS COX-2 2-D Western
blot . H. pylori rat DA-9601
-tocopherol 30, 120 480 .
, , Western blot
HSPs , RPA cytokine apoptosis
. , EMSA NF- B , 2-D
protein , SELDI-TOF . ,
in vitro AGS cell Northern blot
, Western blot HSPs, iNOS
COX-2 .
: H. pylori rat
,
( ) . Bleeding index bleeding rate
H. pylori .
TBA-RS cytokine IL-1 TNF- H. pylori
. H. pylori rat 2-D
SELDI-TOF 30 3 , 120 5 ,
480 1 , genebank
. AGS cell 2-D HSP90, HSP70, HSP60 HSP27
H. pylori cell heat shock .
H. pylori Western blot HSP70 iNOS ,
HSP90, HSP60, HSP27 COX-2 . , H. pylori
rat DA-9601 -tocopherol
30, 120 480 DA-9601 (6, 20
mg/kg) , -tocopherol 40 mg/kg
DA-9601 6 mg/kg . Western blot
DA-9601 (20 mg/kg) HSP90, HSP70 HSP27
. Cytokine apoptosis RPA
RNA . EMSA DA-9601
NF- B . Proteome protein
. AGS cell H. pylori
DA-9601 -tocopherol heat shock Western
blot cytokine HSPs
.
: cytokine
, HSPs
.
. , DA-9601 heat shock protein
.
: Helicobcter pylori, , heat shock protein,
, , DA-9601