Empowering a mesophilic inoculum for thermophilic nitrification: growth mode and
temperature pattern as critical proliferation factors for archaeal ammonia oxidizers
Emilie N. P. Courtens1, Tom Vandekerckhove1, Delphine Prat1, Ramiro Vilchez-Vargas1,
Marius Vital2, Dietmar H. Pieper2, Ken Meerbergen3, Bart Lievens3, Nico Boon1* and
Siegfried E. Vlaeminck1,4*
1Laboratory of Microbial Ecology and Technology (LabMET), Ghent University, Coupure Links 653, 9000
Gent, Belgium
2Microbial Interactions and Processes Research Group, Helmholtz Centre for Infection Research, Braunschweig,
Germany
3Laboratory for Process Microbial Ecology and Bioinspirational Management (PME&BIM), KU Leuven,
Campus De Nayer, Fortsesteenweg 30A, 2860 Sint-Katelijne-Waver, Belgium
4Research Group of Sustainable Energy, Air and Water Technology, Department of Bioscience Engineering,
University of Antwerp, Groenenborgerlaan 171, 2020 Antwerpen, Belgium
*These authors contributed equally and are both senior authors for this work
Corresponding author: Siegfried Vlaeminck
Tel.: +32-9-2645976
Fax: +32-9-2646248
E-mail: [email protected]
Table S1. Primers used for assessing the abundance of β-proteobacterial ammonium
oxidizing bacteria (AOB), ammonium oxidizing archaea (AOA), and the nitrite oxidizing
bacteria (NOB) Nitrospira spp. and Nitrobacter spp. with qPCR.
Target gene Primer Sequence (5’-3’)
Annealing temperature
(°C)
Expected melting temperature
following melt curve analysis (°C)
Reference
Bacterial amoA gene
(AOB)
amoA-1F GGGGTTTCTACTGGTGGT
59 83.5 (±0.5) (Rotthauwe et al. 1997)
amoA-2R CCCCTCKGSAAAGCCTTCTTC
Crenarchaeal CrenamoA23f ATGGTCTGGCTWAGACG
59 82.0 (±0.5) (Tourna et al. 2008)
amoA gene (AOA)
CrenamoA616R GCCATCCATCTGTATGTCCA
16S rRNA gene
Nitrospira sp.
NSR1113F CCTGCTTTCAGTTGCTACCG
54 85.5 (±0.5) (Dionisi et al. 2002)
NSR1264R GTTTGCAGCGCTTTGTACCG
16S rRNA gene
Nitrobacter sp.
Nitro1198F ACCCCTAGCAAATCTCAAAA
AACCG
64 84.0 (±0.5) (Graham et al. 2007)
Nitro1423R CTTCACCCCAGTCGCTGACC
Figure S1. Ammonium consumption and biomass content (suspended and attached) of the
sequential batch reactor (SBR3) and the moving bed biofilm reactor (MBBR) during the start-
up and stabilization period at 38°C.
Figure S2. Effect of nitrite concentration on the ammonium oxidizing activity of the SBR3
sludge at 49°C (n=6).
Figure S3. Volumetric ammonium removal and nitrite/nitrate production rates in the SBR3
during the recovery phase at 48.5°C.
Figure S4. Effect of free ammonia (FA) on the ammonium (A,B) and nitrite (C,D) oxidizing
activity of the SBR3 (A,C) and MBBR (B,D) sludge, along the different reached reactor
temperatures during the experiment (n=6).
Figure S5. Observed sludge yield (Yobs) and sludge volume index (SVI5) of the SBR3 sludge
at the different reactor temperatures.
Figure S6. Heat map showing the community dynamics in the SBR3 and MBBR reactors.
Only those phylotypes with a relative abundance higher than 2.5% of the total community on
at least two sampling points are taken into account. Color code is in % of relative abundance
per sampling point.
Figure S7. Phylogenetic relationships between the most dominant AOB 16S rRNA gene
sequence in the MBBR (Phy1) and closely related described AOB cultures or isolates, as well
as a relevant environmental clone sequences.
Figure S8. Oxygen bulk concentration (mg O2 L-1) and ammonium bulk concentration (mg
NH4+-N L-1) in the SBR (left) and MBBR (right) over a cycle.