Transcript
Page 1: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Sequence alignmentBioinformatics MTAT.03.239

22.02.2018

Priit Adler

Page 2: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding
Page 3: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

This lecture

• Reference genome

• Genomic variation

• Sequence alignment

• mapping reads to reference your self!

Page 4: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

• How long is human DNA ?

• How many “genes” do we have ?

• Describe the “Central dogma of molecular biology”

Page 5: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Biology milestones

http://imihumangenomproject.blogspot.com.ee/2012/12/genome-sequencing.html

Page 6: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

http://genomebiology.biomedcentral.com/articles/10.1186/gb-2010-11-5-206

Estimate the number of genes in Human

genome

Page 7: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Genomic data

http://www.futuretimeline.net/blog/2014/01/16.htm#.VfsvUZ2qpBc

Page 8: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Genomic data

http://www.ncbi.nlm.nih.gov/genbank/statistics

Growth of GenBank and WGS

Page 9: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Analysis of sequences

• Sequence alignment

• Gene prediction

• Genome assembly

• Protein structure / domains

Page 10: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Reference genome

A reference genome (also known as a reference assembly) is a digital nucleic acid sequence database, assembled by scientists as a representative example of a species' set of genes.

https://en.wikipedia.org/wiki/Reference_genome

Page 11: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Genome• ︎Is the entirety of an organism’s hereditary information

• ︎The genome includes both the genes and non-coding sequences of DNA/RNA

• ︎In 1995, Haemophilus influenzae or was the first genome of a living organism to be sequenced in July 1995

• ︎1 830 140 base pairs of DNA in single circular chromosome that contains 1740 protein-coding gene, 58 transfer RNA genes and 18 other RNA genes

Page 12: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding
Page 13: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Genome sizes

Page 14: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

“Completely” sequenced genomes

Page 15: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Human genome

Page 16: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Human full genome: 3234,8 Mb

Tallinn - Jõgeva - Misso: 320 km

ATGCTCGTAC = 1mm

Page 17: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

DNA

• Protein coding genes cover only 1.5% of human genome

• Basepair variation between 2 genomes <~ 1%

• Structural variation accounts for more…

• What does the rest do ?

Page 18: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

MCF7 (cancer model) genomic rearrangement

bioinformatics.oxfordjournals.org/content/19/suppl_2/ii162.full.pdf+html

Page 19: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Genomic variation

• SNPs — single(short??) nucleotide polymorphisms

• Indels — insertions / deletions

• CNVs — copy number variations

• Genomic rearrangements

Page 20: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Graph genomehttps://www.sevenbridges.com/graph/

Page 21: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

DNA sequencing

• Read length

• Single reads

• paired end reads

https://biomedizin.unibas.ch/fileadmin/DKBW/redaktion/Group_Directories/Bioinformatics/IntroBioc2016/06_RNAseqRaw_html.html

Page 22: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Questions

• Name sources of genetic variance

• Is human genome complete?

• What is the typical sequencing read length?

Page 23: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Gene expression

preRNA

DNA

5’ 3’

mRNA

5’5’3’3’

Page 24: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

DNA vs RNA sequencing

reference genome

reference genome

DNA seq

RNA seq

Page 25: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

DNA complementarity

3’ - ATGCGGTAGGACGGCTAATGCCA - 5’

5’ - TACGCCATCCTGCCGATTACGGT - 3’

Page 26: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

DNA reverse complementarity

3’ - ATGCGGTAGGACGGCTAATGCCA - 5’

TGGCATTAGCCGTCCTACCGCAT

Page 27: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Alignment problem

Find best fitting matching position from reference genome to a sequence read

Page 28: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Alignement problem

• Exact matching

• Edit distance

• sequence alignment

Page 29: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Sequence alignment

dynamic programming

http://avatar.se/lectures/molbioinfo2001/dynprog/dynamic.html

Page 30: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Sequence alignment

Global alignment

Local alignment

Fitting alignment (global - local alignment)

Page 31: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Rosalind glossary

Global alignment - http://rosalind.info/glossary/alignment/

Local alignment - http://rosalind.info/glossary/local-alignment/

Fitting alignment (global - local alignment) - http://rosalind.info/glossary/fitting-alignment/

Page 32: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

B L A S T

Page 33: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

HTS aligners timeline https://www.ebi.ac.uk/~nf/hts_mappers/

Page 34: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

Practice session

docker run -ti --rm -v /path/to/your/course/catalog/:/home/jovyan/bioinf/:rw -p 8888:8888 jupyter/base-notebook

Container will be deleted after use

where your data is:where notebook home is:read and writeopen port to access notbook

Page 35: 2018 02 22 sequence alignment · 2018. 2. 26. · Genome • ︎Is the entirety of an organism’s hereditary information • ︎The genome includes both the genes and non-coding

• Write down 3 things you least understood in today lecture


Top Related