double candida antarctica lipase b co-display on pichia ...script co. (nanjing, china) and was...

APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY

Double Candida antarctica lipase B co-display on Pichiapastoris cell surface based on a self-processingfoot-and-mouth disease virus 2A peptide

Yu-Fei Sun & Ying Lin & Jun-Hui Zhang & Sui-Ping Zheng &

Yan-Rui Ye & Xing-Xiang Liang & Shuang-Yan Han

Received: 21 April 2012 /Revised: 19 June 2012 /Accepted: 22 June 2012 /Published online: 14 July 2012# Springer-Verlag 2012

Abstract To develop a high efficiency Candida antarcticalipase B (CALB) yeast display system, we linked two CALBgenes fused with Sacchromyces cerevisiae cell wall proteingenes, the Sed1 and the 3′-terminal half of Sag1, separately bya 2A peptide of foot-and-mouth disease virus (FMDV) in asingle open reading frame. The CALB copy number of recom-binant strain KCSe2ACSa that harbored the ORF was identi-fied, and the quantity of CALB displayed on the cell surfaceand the enzyme activity of the strain were measured. Theresults showed that the fusion of multiple genes linked by2A peptide was translated into two independent proteins dis-played on the cell surface of stain KCSe2ACSa. Judging fromthe data of immunolabeling assay, stain KCSe2ACSa dis-played 94 % CALB-Sed1p compared with stain KCSe1 thatharbored a single copy CALB-Sed1 and 64 % CALB-Sag1pcompared with stain KCSa that harbored a single copy CALB-Sag1 on its surface. Besides, strain KCSe2ACSa possessed170 % hydrolytic activity and 155 % synthetic activity com-pared with strain KCSe1 as well as 144 % hydrolytic activityand 121 % synthetic activity compared with strain KCSa.Strain KCSe2ACSa even owned 124 % hydrolytic activitycompared with strain KCSe2 that harbored two copies CALB-Sed1. The heterogeneous glycosylphosphatidylinositol-

anchored proteins co-displaying yeast system mediated byFMDV 2A peptide was shown to be an effective method forimproving the efficiency of enzyme-displaying yeastbiocatalysts.

Keywords 2A peptide . Co-display . CALB . Sed1p .

Sag1p . Pichia pastoris

Introduction

Yeast surface display technology has been extensively ap-plied to the construction of a whole-cell catalyst using cellwall proteins as anchors (Shibasaki et al. 2009). The mostwidely used anchors are known as cell wall glycosylphos-phatidylinositol (GPI) proteins, such as Sed1p and Sag1p ofSacchromyces cerevisiae (Van der Vaart et al. 1997; Ye et al.2000; Pepper et al. 2008). Target enzymes can be immobi-lized on the yeast cell surface by fusing them with GPI-anchored proteins. During the past two decades, the meth-ylotrophic yeast Pichia pastoris has been developed into ahighly successful system for the production of a variety ofheterologous proteins, and the yeast surface display technol-ogy has been extremely promoted based on P. pastoris(Bajaj et al. 2010; Ryckaert et al. 2010; Wasilenko et al.2010).

Lipases (triacylglycerol hydrolases, E.C. 3.1.1.3) are aclass of hydrolase which catalyze the hydrolysis of trigly-cerides to glycerol and free fatty acids. Besides, lipases alsocan catalyze the transesterification and the synthesis ofesters as well as exhibit enantioselective properties (Guptaet al. 2007; Inaba et al. 2009; Singh and Mukhopadhyay2012). The Candida antarctica lipase B (CALB) is one ofthe most famous and versatile lipases applied in industry.Many reactions have been reported to be successfully cata-lyzed by CALB (Martín-Matute et al. 2005; Tanino et al.

Y.-F. Sun :Y. Lin : J.-H. Zhang : S.-P. Zheng :Y.-R. Ye :X.-X. Liang : S.-Y. Han (*)Guangdong Key Laboratory of Fermentation and EnzymeEngineering, School of Bioscience and Bioengineering,South China University of Technology,Higher Education Mega Center,Guangzhou 510006, People’s Republic of Chinae-mail: [email protected]

Y.-F. SunDepartment of Biological and Chemical Engineering,Guangxi University of Technology,Donghuan Rd.,Liuzhou 545006, People’s Republic of China

Appl Microbiol Biotechnol (2012) 96:1539–1550DOI 10.1007/s00253-012-4264-0

2007; Engström et al. 2010; Lee et al. 2010; Zhao et al.2010).

Enzymes displayed on yeast surface obtain improvedenzyme characteristics and are convenient for recycling(Kondo and Ueda 2004). However, low catalytic efficiencyof the yeast-displayed enzyme is one of bottleneck for theirapplications (Han et al. 2010). The quantity of lipase on thecarrier surface is directly related to its catalytic capability(Pereira et al. 2001; Blanco et al. 2004; Huang et al. 2007).One strategy for enhancing the expression of target enzymeson the cell surface is to construct a co-display system. Thetotal amount of target enzymes on a co-display yeast surfaceis greater than that of single-display yeast, no matter ifenzymes were carried by two independent vectors or inte-grated in a single one (Fujita et al. 2002; Fujita et al. 2004;Katahira et al. 2004). However, general methods to con-struct co-display yeast are time-consuming, and they usuallyrequire multiple selectable markers. Furthermore, the loss,rearrangement, or silencing of foreign genes that occursduring the process of recombinant propagation can lead toexpression instability or interplay, which is exacerbated byan increasing number of transgenic loci and the repeated useof homologous sequences (Francois et al. 2002; Amendolaet al. 2005; Halpin 2005). Thus, it is necessary to develop aconcise and efficient method to realize enzymes co-display.

Picornaviruses, such as foot-and-mouth disease virus(FMDV), encode all of their proteins in a polypeptide derivedfrom a single open reading frame (ORF) (de Felipe et al.2006). The 2A peptide acts co-translationally, directing aprogrammed translational recoding event in which translation

is terminated at the final proline codon of the 2A peptideconserved sequence -NPGP-, leaving all amino acids of 2Aapart from this proline as part of the N-terminal protein.Translation then continues, generating a downstream proteinwith an N-terminal proline, specified by the final codon of 2A(Ryan et al. 1991; de Felipe et al. 2003). It provides a conve-nient way to construct multiple proteins co-express systemfrom a single ORF. The 2A peptide-dependent co-expresssystem requires less operation to establish a multiple geneexpression cassette compared with the other co-express sys-tems (de Felipe 2002; Douin et al. 2004). Foreign studies havebeen reported on protein co-expression by using the 2A pep-tide in mammalian, plant, and yeast host cells (Amrani et al.2004; Fang et al. 2005; Wang et al. 2007; Roongsawang et al.2010).

In this study, we used two GPI-anchored proteins, Sed1pand C-terminal half of Sag1p, as well as the FMDV 2Apeptide to establish a novel double CALB surface co-displaying P. pastoris system (Fig. 1). The quantity of thesurface-displaying CALB-Sed1p and CALB-Sag1p and theenzyme activity of the recombinants were subsequentlyinvestigated.

Materials and methods

Strains and media

The Escherichia coli strain TOP10F′ kept in our laboratorywas used as a host for recombinant DNA manipulation. P.

Fig. 1 Scheme shows the co-display of CALB-Sed1p and CALB-Sag1p mediated by a 2A peptide in strain KCSe2ACSa. During self-processing, the 2A peptide separates the upstream CALB-Sed1p fromthe downstream CALB-Sag1p, accompanying by nascent peptidetranslocation. The 2A peptide retained at the C-terminus of CALB-Sed1p is cut off along with the “CALB-Sed1p-GPI anchor” complex

formation. The extra proline retained at the N-terminus of CALB-Sag1p is removed along with the secondary signal peptide duringsecretion. The final CALB-Sed1p or CALB-Sag1p displaying on thecell surface does not contain any amino acid residue of 2A peptide. Sthe alpha signal sequence, Pro proline, ω site the cleavage/attachmentsite of C-terminal GPI anchoring signal

1540 Appl Microbiol Biotechnol (2012) 96:1539–1550

pastoris strain GS115 was purchased from Invitrogen Co.(USA) and used to display CALB. E. coli was grown inLuria–Bertani medium (1 % tryptone, 0.5 % yeast extract,0.5 % sodium chloride, and 0.1 % glucose). Yeast was growneither in YPD medium (1 % yeast extract, 2 % peptone, and2 % glucose) or BMGY/BMMY medium (1 % yeast extract,2 % peptone, 100 mM potassium phosphate, pH 6.0, 1.34 %yeast nitrogen base [YNB], 4×10−5 % biotin, and 1 % glycerolor 0.5 % methanol). Yeast recombinants were screened usingMD plates (1.34 % YNB, 4×10−5 % biotin, 2 % dextrose, and1.5 % agar) and then inoculated on the tributyrin plates (1 %tributyrin, 1 % yeast extract, 1.34 % YNB, 4×10−5 % biotin,0.5 % methanol, and 1.5 % agar) to sort out lipase-displayingstrains. The vector pPIC9K was purchased from Invitro-gen Co. We replaced the SnaBI restriction site ofpPIC9K with MluI, ApaI, and SalI sites. Antibodiesfor Western blot analysis were obtained from MBLCo. (rabbit anti-FLAG polyclonal antibody; rabbit anti-6×His polyclonal antibody; horseradish peroxidase(HRP)-conjugated goat anti-rabbit IgG secondary anti-body; Japan). In addition, primary antibodies for immu-nofluorescence were obtained from Agilent Co. (mouseanti-FLAG monoclonal antibody; USA) and Abgent Co.(mouse anti-6×His monoclonal antibody; USA), respec-tively. The secondary antibody, Alexa Fluor-488-conjugated goat anti-mouse IgG, was purchased fromInvitrogen Co. The SYBR Premix ExTaq RealtimePCR Kit, T4 DNA ligase, restriction enzymes, andPrimeSTAR HS DNA polymerase were obtained fromTakara Co. (Dalian, China). The Plasmid Miniprep Kitand DNA recovery Kit were provided by Omega Co.(USA). Primers were synthesized by the Generay Co.

(Shanghai, China). The sequencing service was suppliedby BGI (Shenzhen, China).

Construction of plasmids and yeast transformation

All primers used for plasmid construction were listed inTable 1. The CALB gene was amplified from the plasmidpKNS-CALB (Su et al. 2010a) via the polymerase chainreaction (PCR) using the primers Phc1/Phc2, and a 6×Histag was added to the CALB 5′-terminus. The 3′-terminal halfof Sag1 (GenBank 853460, 970-1953) was amplified usingthe primers Psag1/Psag2 with the S. cerevisiae genomeDNA as the template. Plasmid pKSa was constructed viaSag1 (SalI/NotI-digested) subcloning into pPIC9K, andpKCSa was created by ligating CALB (ApaI/SalI-digested),Sag1 (SalI/NotI-digested), and pPIC9K (ApaI/NotI-digested). In a similar way, pKSe was constructed by sub-cloning Sed1 (ApaI/NotI-digested; GenBank 851649) am-plified using Psed1 and Psed2 as primers into pPIC9K.Plasmid pKCSe was constructed via FLAG-CALB (ampli-fied by Pfc1/Pfc2, MluI/ApaI-digested) subcloning intopKSe . A 60 - n u c l e o t i d e FMDV 2A f r a gmen t(CAGCTTTTGA ACTTTGATTT GTTGAAACTTGCCGGAGATG TTGAGTCTAA CCCTGGACCT) fusedwith the α factor signal sequence of S. cerevisiae (GenBankJ01340.1, 174~440) was artificially synthesized by Gene-script Co. (Nanjing, China) and was flanked with EcoRI andApaI sites. The 2A-α-factor (EcoRI/ApaI-digested), 6×His-CALB (ApaI/SalI-digested) and 3′-terminal half of Sag1fragments (SalI/NotI-digested) were subcloned into pKCSe(EcoRI/NotI-digested) to produce the pKCSe2ACSa plas-mid, containing the “FLAG-CALB-Sed1-2A-α factor-

Table 1 Primers used for plas-mid construction and quantita-tive PCR analysis

Name Sequence (5′-3′) Annotation

Phc1 TTCAGGGCCCCATCACCATCATCACCATCTACCTTCCGGTTCG

ApaI site (underline)and 6×His tag (italics)

Phc2 TCTAGTCGACGGGGGTGACGATGC SalI site

Pfc1 CTCAACGCGTGATTACAAGGATGACGACGATAAGCTACCTTCCGGTTCGGACC

MluI site (underline)and FLAG tag (italics)

Pfc2 GTAAGGGCCCGGGGGTGACGATGC ApaI site

Psag1 TCTAGTCGACGGTCGGAACCTCGGTACAG SalI site

Psag2 TCATGCGGCCGCTTAGAATAGCAGGTACGAC NotI site

Psed1 GAATGGGCCCCAATTTTCCAACAG ApaI site

Psed2 GCACGCGGCCGCCCTAGGGAATTCTAAGAATAAC

NotI and EcoRI sites

Pg1 GTATGGGCCCTGTGAGGCTGAAATGTG ApaI site

Pg2 CTCAGAATTCCATGCCAACTCAATCC EcoRI site

Prtc1 CCAAACCCATCCTTCTCG qPCR for CALB

Prtc2 GGCGTTGACCATGTACTCC qPCR for CALB

Prtg1 GTCGGGACACGCCTGAAACT qPCR for G

Prtg2 CCACCTTTTGGACCCTATTGAC qPCR for G

Appl Microbiol Biotechnol (2012) 96:1539–1550 1541

6×His-CALB-Sag1” ORF. Plasmids pKSa, pKSe, pKCSa,pKCSe, and pKCSe2ACSa were transformed into E. coliTOP10F′ for propagation, and then they were extracted forverification by restriction enzyme digestion and sequencing.The plasmids were linearized with SacI and transformedinto P. pastoris GS115 using the lithium chloride (LiCl)method, according to the manufacturer's instructions(Invitrogen).

Yeast transformants were initially grown on MD plates toscreen for the recombinants before single recombinant cloneswere inoculated onto tributyrin plates to identify lipase-displaying yeast clones. Recombinants transformed by pKSaand pKSe were identified via the PCR reaction using theprimers Psag1/Psag2 and Psed1/Psed2, respectively.

Quantitative PCR assay of CALB copy number

The quantitative PCR (qPCR) assay protocol was derivedfrom the Pfaffl method (2001). A standard plasmid pKCGwas constructed containing a CALB gene and a 600 bp Gfragment (the interval partial sequence between P. pastorisGS115 genes 8198905 and 8198906). The G fragment wasamplified from P. pastoris GS115 genomic DNA by PCRusing the primers Pg1/Pg2 (Table 1) and then replaced theSed1 gene of pKCSe. pKCG was transformed into E. coliTOP10F′ strain for propagation. To prepare the standardplasmid working solution for qPCR assay, pKCG wasextracted from a positive recombinant and diluted to a100-pg/μL solution by ultrapure water. The qPCR assaywas performed using a gradient dilution pKCG workingsolution (1×100–1×10−6) as templates and the primersPrtc1/Prtc2 and Prtg1/Prtg2. For each gradient sample, thecrossing points of the amplification curve with the thresholdline (CT) versus the pKCG concentration input were plottedto calculate the slope. The amplification efficiencies ofCALB and the G fragment (ECALB, EG) in the exponential

phase were calculated according to the equation E010(−1/slope). Genomic DNA of the yeast recombinants was pre-pared using a yeast DNA extraction Kit (Omega, USA) andapproximately adjusted to a 1,000-pg/μL solution for qPCRassay. The yeast recombinant DNA and the standard plas-mid were analyzed simultaneously using a realtime PCRinstrument (ABI7500). The CT value of CALB and G withthe standard plasmid (CT-CALB control, CT-G control) andsamples (CT-CALB sample, CT-G sample) were entered intoEq. 1 to calculate the CALB copy number (ratio).

ratio ¼ ECALBð ÞΔCT�CALB control�sampleð Þ

EGð ÞΔCT�G control�sampleð Þ ð1Þ

Yeast culture with methanol induction

Single clone of the yeast transformants was inoculated into a250-mL flask with 25 mL BMGY medium. Cells were cul-tured at 30 °C in a shaking incubator (250 rpm) for 48 h beforethey were induced in a 250-mL flask with 25 mL BMMYmedium for 5 days. To maintain induction, methanol wasadded to make a final concentration of 0.75 % every 24 h.

Immunofluorescence microscopy and flow cytometryanalysis

Yeast cells were harvested by centrifugation after methanolinduction for 120 h. The immunolabeling analysis wasperformed using a modified version of the protocol ofKobori et al. (1992). Yeast cells were resuspended inphosphate-buffered saline (PBS, pH 7.4) supplemented with1 % (m/v) bovine serum albumin to block the cell surface. Amonoclonal antibody against FLAG tag (DYKDDDDK)was used as the primary antibody. The cell suspension(200 μL, OD60001) was incubated with primary antibody

Fig. 2 Outline of the vector expression cassette used in this study. ThepKCG contains a CALB gene and a G fragments used for quantitativePCR analysis. The control vectors pKSa and pKSe possess a cell wallprotein gene Sag1 or Sed1, respectively. The single-CALB-displayvector pKCSa and pKCSe possess a CALB-Sag1 fusion and a CALB-

Sed1 fusion, respectively. The double-CALB co-display vectorpKCSe2ACSa encodes a fusion containing a CALB-Sag1 and aCALB-Sed1 linked by a FMDV 2A peptide. S the alpha signal se-quence, TT transcription termination


(final concentration 10 ng/μL) at room temperature for 2 h.Cells were washed twice with PBS and resuspended in200 μL PBS (with 1 % BSA) before being exposed to thesecondary antibody (final concentration 10 ng/μL) AlexaFluor 488-conjugated goat anti-mouse IgG, for 1 h at roomtemperature. After being washed three times with PBS, adrop of cell suspension was loaded on a glass slide and thenwas directly observed using a fluorescence microscope (BX51,Olympus, Japan). In addition, a part of cell suspension wasused for the flow cytometry analysis (Quanta SC, Beckman

Coulter). Ten thousand cells of each sample were counted andanalyzed with the Exp032 software (Beckman Coulter) toobtain the total fluorescence (TF) value. The CALB-Sed1p onthe one cell surface of each sample was present as the meanrelative fluorescence (MRF0(TFsample−TFbackground)×0.0001).Similarly, the 6×His tag immunolabeling was performed,but the final concentration of primary antibody was in-creased to 40 ng/μL in cell suspension (OD60001). Thus,the CALB-Sag1p on the cell surface of each sample wasdetermined.

Fig. 3 Quantitative PCR assayof the CALB copy number inthe recombinant yeast straingenomic DNA. Strain KSa andstrain KSe were set asbackground, respectively, forCALB copy number calculation.The threshold value (horizontaldashed line) was set at 0.2. Thevalues indicate the average ±standard deviations from threeindependent qPCR experiments


Western blot analysis

The cell suspension (500 μL, OD600050) used for GPI-anchored cell wall proteins preparation was digested bylaminarinase (Sigma, USA) for 4 h in 37 °C as de-scribed previously (Mrsǎ et al. 1997). Proteins in poly-acrylamide gels were transferred to nitrocellulose (NC)membranes. The membranes were blocked with PBS(with 3 % BSA) and incubated with a rabbit anti-FLAG polyclonal antibody (1:2,000) and an anti-6×Hispolyclonal antibody (1:500), respectively. The NC mem-branes were washed six times with PBS before beingexposed to the HRP-conjugated goat anti-rabbit IgGpolyclonal antibody. Protein bands were visualized byexposure on X-ray films (Fujifilm, Japan) after themembranes were treated with enhanced chemilumines-cence solution (Thermo Pierce, USA).

CALB activity assay

The hydrolytic activity of CALB was detected spectro-photometrically using p-nitrophenyl butyrate (pNPB,50 mM) as the substrate solution (Su et al. 2010b). Yeastcells were collected by centrifugation at 6,000 rpm atroom temperature for 5 min. After the cells had beenwashed twice with 1 mL PBS, the cell suspension wasadjusted to 3.0 (OD600). The reaction solution containing100 μL yeast cell suspension (equal to 7.68×10−5 g drycell weight), an equal volume of the substrate solutionand 800 μL Tris–HCl buffer (pH 8.0, 50 mM) wereincubated at 45 °C for 5 min, and the absorbance at405 nm was measured using a microplate reader. Thehydrolytic activity of CALB was determined as theamount of enzyme that released 1-μmol p-nitrophenol(pNP) from the substrate per minute, under the assayconditions.

To evaluate the synthetic activity of CALB, 3.7 mmolabsolute ethanol and 3.0 mmol n-hexanoic acid were cata-lyzed to produce ethyl caproate at 55 °C in 4.4 mL n-heptane using 50 mg lyophilized yeast cells. The residualn-hexanoic acid was titrated with 0.01 M NaOH solutionafter a 30-min reaction. The amount of ethyl caproate wasequal to the amount of consumed n-hexanoic acid. One unitof CALB synthetic activity was defined as the amount ofenzyme that produced 1 μmol ethyl caproate per minute,under the assay conditions.

Statistics

Data collected from flow cytometry analysis and enzy-matic activity assay were evaluated by paired compar-isons using Student's t test; p<0.05 was consideredsignificant.

Results

Vector construction and P. pastoris transformation

To display more CALB on the yeast cell surface, we intro-duced a bicistronic expression element, the FMDV 2Apeptide, to construct an efficient double-CALB co-displayvector pKCSe2ACSa. In pKCSe2ACSa, S. cerevisiae α-factor secretion signal sequences were put ahead of eachCALB gene and were applied to guide the CALB-Sag1pand CALB-Sed1p fusions into secreting process, respective-ly. To evaluate the impact of the anchor proteins Sag1p andSed1p on CALB, we constructed two vectors pKSa andpKSe dispalying Sag1p and Sed1p on the host cell surface.Besides, we constructed two single CALB display vectorspKCSa and pKCSe displaying CALB-Sag1p and CALB-Sed1p, respectively (Fig. 2).

Restriction enzyme digestion and DNA sequencing ver-ified that all plasmids matched their designs (data notshown). After transformation, the positive yeast recombi-nants were sequentially screened using MD plates, tributyrinplates, and PCR reactions. Yeast recombinants were namedas KSa, KSe, KCSa, KCSe, and KCSe2ACSa according tothe plasmids used.

CALB copy number identification by qPCR

The qPCR assay was performed on CALB copy numberidentification. Plasmid pKCG (Fig. 2) contained a CALBand a 600-bp non-coding region G was used as a standardDNA template to calculate the amplification efficiency ofCALB (ECALB) and G (EG). The ECALB was 2.046, and theEG was 2.005. Both matched the requirements of the qPCRassay. The average CT of CALB and G in pKCG from tripletexperiments were also calculated (CT-CALB pKCG022.28;CT-G pKCG022.00). We tested a certain number of clonesfor each kind of yeast recombinants and consequentlyscreened six representative strains (Fig. 3). Strain KSa andstrain KSe were control sets that only possessed Sed1 andSag1, respectively; Strain KCSa and strain KCSe1 weresingle copy CALB-Sag1 and CALB-Sed1 harbored yeast,respectively. Strain KCSe2 was screened from KCSerecombinants, possessing homogenous two copies CALB-Sed1 created spontaneously by plasmid multiple integrationevents in Pichia; strain KCSe2ACSa contained a single

�Fig. 4 Fluorescence microscopy and flow cytometry assays of CALB-Sed1p displaying P. pastoris recombinants. Yeast cells were detectedafter being immunolabeled with mouse anti-FLAG monoclonal anti-body and subsequently with goat anti-mouse IgG antibody conjugatedwith Alexa Fluor-488. Strain KCSe1 (filled with gray) was set asstandard CALB-Sed1p expressing strain to compare with strain KCSe2and strain KCSe2ACSa. TF the total fluorescence of 10,000 countedcells


copy of CALB-Sag1-2A-CALB-Sed1expression cassette.The CALB copy number of the six strains was determined.

Determination of CALB displaying on the yeast cell surface

To validate whether the CALB-Sed1p and CALB-Sag1pfusions were located on the yeast cell surface, fluorescencemicroscopy assay and flow cytometry were applied. Afterimmunolabeled with anti-FLAG antibody, the strain KCSe1,strain KCSe2, and strain KCSe2ACSa cells emitted signif-icant green fluorescence when excited. But there was littlefluorescence emitted from the strain KSe and strain KCSacells (Fig. 4). It was indicated that the CALB-Sed1p wasexpressed and anchored on the cell surface of strain KCSe1,strain KCSe2, and strain KCSe2ACSa. To detect the CALB-Sed1p on the surface of these strains, 10,000 cells of eachstrain were counted to measure the TF value using flowcytometry. The TF of strain KSe labeled with anti-FLAGantibody (TFKSe-F) was set as the background. Therefore,the MRF value of each strain was calculated, which repre-sented the relative amount of CALB-Sed1p on the one cellof this strain. Strain KCSe1 was defined as the standardCALB-Sed1p expressing strain and MRFKCSe1-F (526.76)was set as 100 %. Strain KCSe2 possessed stronger fluores-cence (MRFKCSe2-F 627.27) than strain KCSe1, which cor-responded to 119 % of MRFKCSe1-F. There was a significantdifference between the MRFKCSe2-F and MRFKCSe1-F exam-ined by t test (p<0.05), thus strain KCSe2 displayed moreCALB-Sed1p on its surface than strain KCSe1. It seems thatthe CALB-Sed1p displayed on the cell surface increaseswith the gene dosage. In addition, strain KCSe2ACSa pro-duced 94 % fluorescence intensity (MRFKCSe2ACSa-F

496.98) to the strain KCSe1, which indicated that itsCALB-Sed1p quantity was similar to that of strain KCSe1.

The strain KSa, strain KCSe1, strain KCSa, andstrain KCSe2ACSa were detected in a similar way afterimmunolabeled with anti-6×His antibody. Strain KCSaand strain KCSe2ACSa emitted green fluorescence whenexcited, indicating that CALB-Sag1p was displayed ontheir cell surfaces. The TF of strain KSa was set as thebackground, and MRFKCSa-H (122.61) was defined asthe 100 %. Strain KCSe2ACSa produced less fluores-cence (MRFKCSe2ACSa-H 78.41) than strain KCSa. Itmeans that there was approximately 64 % of CALB-Sag1p on strain KCSe2ACSa compared with strainKCSa. Figure 5 shows fluorescence microscopy andflow cytometry assays of CALB-Sag1p displaying P.pastoris recombinants.

Comparison of the enzyme activities of the yeasts

To compare hydrolytic activity of CALB on the surfaceof living yeast strains, we inoculated a tributyrin agar

plate with the strain KSa, strain KSe, strain KCSa,strain KCSe1, strain KCSe2, and strain KCSe2ACSa.After being cultured for 2 days at 30 °C, different-sizehaloes were observed around the edge of the recombi-nant clones (Fig. 6a). Strain KCSe2 had a larger haloaround it compared with strain KCSe1, and the biggesthalo was produced by strain KCSe2ACSa. These dataindicated that the yeast strains with two copies CALBgenerally possessed higher hydrolytic activity than single-copy CALB-harbored strains. The Western blot analysisshowed that more CALB-Sed1p was anchored on the cellwall of strain KCSe2 than strain KCSe1. But strainKCSe2ACSa possessed similar CALB-Sed1p as strainKCSe1, which means the superfluous enzymatic activity ofstrain KCSe2ACSa should be attributed to the CALB-Sag1pco-displayed (Fig. 6b, c). This result was in accord with that ofimmunolabeling assay. In addition, the molecular weight ofCALB-Sed1p and CALB-Sag1p extracted from strainKCSe2ACSa cell wall was identical to that of strain KCSe1and strain KCSa, respectively. The 2A peptide, therefore,executed its function successfully.

After 120 h of induction, yeast cells were harvested andlyophilized for whole-cell catalyst preparation. In order todetermine the synthetic activity of these strains, ethyl hex-anoate was synthesized at 55 °C using the whole-cell cata-lysts (Fig. 7). The hydrolytic activities of strain KCSe2 andstrain KCSe2ACSa were obviously higher than the others,which approximately corresponded to the size of haloes ontributyrin agar plate. The activity of strain KCSe1 was 529U/g dry cell for hydrolysis and 217 U/g dry cell for synthe-sis. The hydrolytic activity of strain KCSe2 (728 U/gdry cell) corresponded to 137 % of strain KCSe1 ownedas well as it is up to 135 % (294 U/g dry cell) syntheticactivity of strain KCSe1. And strain KCSe2ACSaexhibited 170 % hydrolytic activity (900 U/g dry cell)and 155 % synthetic activity (337 U/g dry cell) com-pared with strain KCSe1. Significant difference of thehydrolytic or synthetic activity existed between strainKCSe1 and strain KCSe2 (p<0.05), or between strainKCSe1 and strain KCSe2ACSa (p<0.05). Therefore, theactivities were seemed to be affected by the CALB copynumber. Besides, there is a significant difference ofhydrolytic activity between strain KCSe2 and strainKCSe2ACSa (p00.048), but not for synthetic activity(p00.121).

�Fig. 5 Fluorescence microscopy and flow cytometry assays of CALB-Sag1p displaying P. pastoris recombinants. Yeast cells were detectedafter being immunolabeled with mouse anti-6×His monoclonal anti-body and subsequently with goat anti-mouse IgG antibody conjugatedwith Alexa Fluor-488. Strain KCSe1 (filled with gray) was set asbackground, and strain KCSa was set as standard CALB-Sag1pexpressing strain to compare with strain KCSe2ACSa. TF the totalfluorescence of 10,000 counted cells


Discussion

To improve the catalytic activity of yeast surface-displayingsystem, we constructed a co-display P. pastoris strainKCSe2ACSa based on 2A peptide self-cleavage trait. The 2Aresidues did not staywith final CALB-Sed1p because it was leftwith the Sed1p GPI anchoring signal apart from the matureprotein by a GPI transamidase when the “CALB-Sed1p-GPIanchor” complex was formatted (Pittet and Conzelmann 2007).The proline of 2A was also isolated from downstream proteinwith secondary α-factor secretion signal sequence by signalpeptidase in the process of secretion (Fig. 1). Thus, the finalCALB-Sed1p and CALB-Sag1p of strain KCSe2ACSa wereexpressed together from a single mRNA, lacking any aminoacids of 2A. It was the precondition of following comparisonwith strain KCSe1 and strain KCSa.

Flow cytometry and Western blot analysis showed thatCALB-Sag1p and CALB-Sed1p have been co-displayed onthe surface of strain KCSe2ACSa, and the fluorescenceintensity of strain KCSe2ACSa indicated that it possessed94 % CALB-Sed1p compared with strain KCSe1 (Fig. 4)and 64 % CALB-Sag1p compared with strain KCSa(Fig. 5). Interestingly, The sum of proportional hydrolyticactivity of strain KCSe1 (94 %×529 U/g dry cell) and strainKCSa (64 %×623 U/g dry cell) was 896 U/g dry cell, whichnearly equaled the experimental value of hydrolytic activity(900 U/g dry) of strain KCSe2ACSa. But the fluorescenceintensity of these strains did not correlate well with theirsynthetic activity. The synthetic activity may be affected bymultiple reasons besides the CALB itself. It is reasonable to

assume that the CALB displayed on strain KCSe2ACSapositively correlates with its activity. Blanco et al. (2004)examined the hydrolytic activity of immobilized CALBversus the lipase loading and found that the activity ofcatalyst was increased following the rise of CALB loading.A similar result was reported by using chitosan nanofibrousmembrane for Candida rugosa lipase immobilization(Huang et al. 2007). Our result was in accord with theprevious reports. Therefore, the higher activity of strain

Fig. 7 Recombinant yeast cells surface enzymatic activity assays(120 h). The hydrolytic activity was measured using pNPB as sub-strate, and the synthetic activity was evaluated by synthesis of ethylhexanoate. Data came from three independent experiments. ND nodetectable synthetic activity

Fig. 6 Halo formation by recombinant yeasts on tributyrin agar plateand Western blot analysis of GPI-anchored cell wall proteins. Yeastcells (a) were cultivated at 30 °C for 2 days after being inoculated witha tributyrin agar plate. For WB analysis, yeast cells were induced by

methanol for 120 h in BMMY medium. GPI-anchored cell wall pro-teins were extracted using laminarinase and examined by anti-FLAGantibody (b) or anti-6×His antibody (c)


KCSe2ACSa than strain KCSe1 and strain KCSa should beattributed to more CALB displayed on its surface.

The flow cytometry data indicated that 2A peptide hadslight distorting effect on the expression of CALB-Sed1p,but an obvious side effect on CALB-Sag1p. In some cases,polyproteins mediated by 2A peptide have a decreased yieldcompared with the independent expression under the sameconditions (La Grange et al. 2001; Roongsawang et al.2010). A possible explanation is that the reduction of targetproteins should result from limitations of total protein syn-thesis. In addition, artificial polyprotein self-processing by2A peptide makes it difficult to achieve complete cleavagein a non-native context. Donnelly et al. (2001) used GUSand GFP as reporters to study the 2A peptide “cleavage”mechanism and found that product quantity of upstreamprotein exceeded downstream protein by twofold to seven-fold, even though the order of proteins in polyprotein wasreversed. The authors suggested that different levels ofsynthesis between the upstream and downstream proteinsmight be more reasonably accounted for the suboptimalfunctioning of 2A peptide by the efficiency of the “pseu-do-termination” event and the “re-initiation” event of thesystem. Besides, they suggested that a long 2A peptide(within ~30 aa) might be better for the downstream proteinexpression. In strain KCSe2ACSa, the inadequate expres-sion of CALB-Sag1p could be caused by suboptimal func-tioning of 2A peptide used in P. pastoris.

Intentionally, we screened strain KCSe2 to compare withstrain KCSe2ACSa. Both of them have two copies of CALBin their genomic DNA, but strain KCSe2ACSa possessedhigher activity than strain KCSe2. It seems that the co-display of the CALB-Sed1 and the CALB-Sag1 by strainKCSe2ACSa make the biocatalyst more efficient comparedwith strain KCSe2. Although Sed1p and Sag1p bind to thecell wall by GPI anchor, they have different characteristicsin shape, charge, and space conformation. These differencesmay reduce their competition to a minimum. They wouldcomplement each other, in a way, when they were co-displaying together. Consequently, the mosaic distributionof CALB-Sag1p and CALB-Sed1p on the cell surface in-creased the proteins loading, and then promoted efficiencyof strain KCSe2ACSa.

The reusability of strain KCSe2ACSa was quite well. Noobvious activity decrease was found after five cycles ofethyl hexanoate synthesis (data not shown). This traitmatched a previous report (Tanino et al. 2009). Given thecost of enzymes, strain KCSe2ACSa that can be producedeasily by cultivation of yeasts are suggested to be availablefor synthesis of esters and even polymers.

In summary, we have demonstrated a novel double-CALB co-displaying yeast strain KCSe2ACSa using aFMDV 2A peptide to mediate two heterogeneous GPI-anchored fusion protein expression in a single ORF. Both

CALB-Sag1p and CALB-Sed1p were successfully co-displayed on the strain KCSe2ACSa cell surface. StrainKCSe2ACSa exhibited higher hydrolytic and synthetic ac-tivities than strain KCSa and strain KCSe1. The developedstrategy is the starting point for the further research,which may have great value in the fields of high-efficiency biocatalyst, multi-enzyme complex, or vaccinedevelopment.

Acknowledgments This research is supported by the National Nat-ural Science Foundation of China (no. 30900017; 20976062) and theFundamental Research Funds for the Central Universities, SCUT (no.2009ZM0038).

References

Amendola M, Venneri MA, Biffi A, Vigna E, Naldini L (2005)Coordinate dual-gene transgenesis by lentivirial vectors carry-ing synthetic bidirectional promoters. Nat Biotechnol 23:108–116

Amrani AE, Barakate A, Askari BM, Li X, Roberts AG, Ryan MD,Halpin C (2004) Coordinate expression and independent subcel-lular targeting of multiple proteins from a single transgene. PlantPhysiol 135:16–24

Bajaj A, Lohan P, Jha PN, Mehrotra R (2010) Biodiesel productionthrough lipase catalyzed transesterification: an overview. J MolCatal B: Enzym 62:9–14

Blanco RM, Terreros P, Fernández-Pérez M, Otero C, Díaz-GonzálezG (2004) Functionalization of mesoporous silica for lipase immo-bilization: characterization of the support and the catalysts. J MolCatal B: Enzym 30:83–93

de Felipe P (2002) Polycistronic viral vectors. Curr Gene Ther 2:355–378

de Felipe P, Hughes LE, Ryan MD, Brown JD (2003) Co-translational,intraribosomal cleavage of polypeptides by the foot-and-mouthdisease virus 2A peptide. J Biol Chem 278:11441–11448

de Felipe P, Luke GA, Hughes LE, Gani D, Halpin C, Ryan MD (2006)E unum pluribus: multiple proteins from a self-processing poly-protein. Trends Biotechnol 24:68–75

Donnelly MLL, Luke G, Mehrotra A, Li X, Hughes LE, Gani D, RyanMD (2001) Analysis of the aphthovirus 2A/2B polyprotein‘cleavage’ mechanism indicates not a proteolytic reaction, but anovel translational effect: a putative riposomal ‘skip’. J Gen Virol82:1013–1025

Douin V, Bornes S, Creancier L, Rochaix P, Favre G, Prats AC,Couderc B (2004) Use and comparison of different internal ribo-somal entry sites (IRES) in tricistronic retroviral vectors. BMCBiotechnol 4:16

Engström K, Vallin M, Syrén PO, Hult K, Bäckvall JE (2010) Mutatedvariant of Candida antarctica lipase B in (S)-selective dynamickinetic resolution of secondary alcohols. Biomol Chem 9:81–82

Fang J, Qian JJ, Yi S, Harding TC, Tu GH, VanRoey M, Jooss K(2005) Stable antibody expression at therapeutic levels using the2A peptide. Nat Biotechnol 23:584–590

Francois IEJA, Broekaert WF, Cammue BPA (2002) Differentapproaches for multi-transgene-stacking in plants. Plant Sci163:281–295

Fujita Y, Takahashi S, Ueda M, Tanaka A, Okada H, Morikawa Y,Kawaguchi T, Arai M, Fukuda H, Kondo A (2002) Direct andefficient production of ethanol from celluosic material with a


yeast strain displaying cellulolytic enzymes. Appl Environ Micro-biol 68:5136–5141

Fujita Y, Ito J, Ueda M, Fukuda H, Kondo A (2004) Synergisticsaccharification, and direct fermentation to ethanol, of amorphouscellulose by use of an engineered yeast strain codisplaying threetypes of cellulolytic enzyme. Appl Environ Microbiol 70:1207–1212

Gupta N, Sahai V, Gupta R (2007) Alkaline lipase from a novel strainBurkholderia multivorans: statistical medium optimization andproduction in a bioreactor. Process Biochem 42:518–526

Halpin C (2005) Gene stacking in transgenic plants—the challenge for21st century plant biotechology. Plant Biotechnol J 3:141–155

Han SY, Han ZL, Lin Y, Zheng SP (2010) Construction of highefficiency Pichia pastoris surface display system based on Flo1protein. Prog Biochem Biophys 37:200–207

Huang XJ, Ge D, Xu ZK (2007) Preparation and characterization ofstable chitosan nanofibrous membrane for lipase immobilization.Eur Polym J 43:3710–3718

Inaba C, Maekawa K, Morisaka H, Kuroda K, Ueda M (2009) Efficientsynthesis of enantiomeric ethyl lactate by Candida antarcticalipase B (CALB)-displaying yeasts. Appl Microbiol Biotechnol83:859–864

Katahira S, Fujita Y, Mizuike A, Fukuda H, Kondo A (2004) Con-struction of a xylan-fermenting yeast strain through codisplay ofxylanolytic enzymes on the surface of xylose-utilizing Saccharo-myces cerevisiae cells. Appl Environ Microbiol 70:5407–5414

Kobori H, Sato M, Osumi M (1992) Relationship of actin organizationto growth in the two forms of the dimorphic yeast Candidatropicalis. Protoplasma 167:193–204

Kondo A, Ueda M (2004) Yeast cell-surface display-applications ofmolecular display. Appl Microbiol Biotechnol 64:28–40

La Grange DC, Pretorius IS, Claeyssens M, van Zyl WH (2001)Degradation of xylan to D-xylose by recombinant Saccharomycescerevisiae coexpressing the Aspergillus niger β-xylosidase (xlnD)and the Trichoderma reesei xylanase II (xyn2) genes. Appl Envi-ron Microbiol 67:5512–5519

Lee KW, Min K, Park K, Yoo YJ (2010) Development of an amphi-philic matrix for immobilization of Candida antarctica lipase Bfor biodiesel production. Biotechnol Bioproc Eng 15:603–607

Martín-Matute B, Edin M, Bogár K, Kaynak FB, Bäckvall JE (2005)Combined ruthenium (II) and lipase catalysis for efficient dynam-ic kinetic resolution of secondary alcohols. Insight into the race-mization mechanism. J Am Chem Soc 127:8817–8825

Mrsǎ V, Seidl T, Gentzsch M, Tanner W (1997) Specific labelling ofcell wall proteins by biotinylation. Identification of four covalent-ly linked O-mannosylated proteins of Saccharomyces cerevisiae.Yeast 13:1145–1154

Pepper LR, Cho YK, Boder ET, Shusta EV (2008) A decade of yeastsurface display technology: where are we now? Comb Chem HighThroughput Screen 11:127–134

Pereira EB, de Castro HF, de Moraes FF, Zanin GM (2001) Kineticstudies of lipase from Candida rugosa: a comparative studybetween free and immobilized enzyme onto porous chitosanbeads. Appl Biochem Biotechnol 91–93:739–748

Pfaffl MW (2001) A new mathematical model for relative quantifica-tion in real-time RT-PCR. Nucleic Acids Res 29:2002–2007

Pittet M, Conzelmann A (2007) Biosynthesis and function of GPIproteins in the yeast Saccharomyces cerevisiae. Biochim BiophysActa Mol Cell Biol Lipids 1771:405–420

Roongsawang N, Promdonkoy P, Wongwanichpokhin M, Sornlake W,Puseenam A, Eurwilaichitr L, Tanapongpipat S (2010) Coexpres-sion of fungal phytase and xylanase utilizing the cis-acting hy-drolase element in Pichia pastoris. FEMS Yeast Res 10:909–916

Ryan MD, King AM, Thomas GP (1991) Cleavage of foot-and-mouthdisease virus polyprotein is mediated by residued located within a19-amnio-acid sequence. J Gen Virol 72:2727–2732

Ryckaert S, Pardon E, Steyaert J, Callevaert N (2010) Isolation ofantigen-binding camelid heavy chain antibody fragments(nanobodies) from an immune library displayed on the surfaceof Pichia pastoris. J Biotechnol 145:93–98

Shibasaki S, Maeda H, Ueda M (2009) Molecular display technologyusing yeast-arming technology. Anal Sci 25:41–49

Singh AK, Mukhopadhyay M (2012) Overview of fungal lipase: areview. Appl Biochem Biotechnol 166:486–520

Su GD, Huang DF, Han SY, Zheng SP, Lin Y (2010a) Display ofCandida antarctica lipase B on Pichia pastoris and its applicationto flavor ester synthesis. Appl Microbiol Biotechnol 86:1493–1501

Su GD, Zhang X, Lin Y (2010b) Surface display of active lipase inPichia pastoris using Sed1 as an anchor protein. Biotechnol Lett32:1131–1136

Tanino T, Ohno T, Aoki T, Fukuda H, Kondo A (2007) Developmentof yeast cells displaying Candida antarctica lipase B and theirapplication to ester synthesis reaction. Appl Microbiol Biotechnol75:1319–1325

Tanino T, Aoki T, Chung WY, Watanabe Y, Ogino C, Fukuda H, KondoA (2009) Improvement of a Candida antarctica lipase B-displayingyeast whole-cell biocatalyst and its application to the polyestersynthesis reaction. Appl Microbiol Biotechnol 82:59–66

Van der Vaart JM, te Biesebeke R, Chapman JW, Toschka HY, KlisFM, Verrips CT (1997) Comparison of cell wall proteins ofSaccharomyces cerevisiae as anchors for cell surface expressionof heterologous proteins. Appl Environ Microbiol 63:615–620

Wang S, Yao Q, Tao J, Qiao Y, Zhang Z (2007) Co-ordinate expressionof glycine betaine synthesis genes linked by the FMDV 2A regionin a single open reading frame in Pichia pastoris. Appl MicrobiolBiotechnol 77:891–899

Wasilenko JL, Sarmento L, Spatz S, Pantin-Jackwood M (2010) Cellsurface display of highly pathogenic avian influenza virus hemagglu-tinin on the surface of Pichia pastoris cells using alpha-agglutinin forproduction of oral vaccines. Biotechnol Prog 26:542–547

Ye K, Shibasaki S, Ueda M, Murai T, Kamasawa N, Osumi M,Shimizu K, Tanaka A (2000) Construction of an engineered yeastwith glucose-inducible emission of green fluorescence from thecell surface. Appl Microbiol Biotechnol 54:90–96

Zhao H, Song Z, Olubajo O, Cowins JV (2010) New ether-functionalized ionic liquids for lipase-catalyzed synthesis of bio-diesel. Appl Biochem Biotechnol 162:13–23


double candida antarctica lipase b co-display on pichia ...script co. (nanjing, china) and was...

Documents