ORIGINAL PAPER

Dopamine Promotes the Survival of Embryonic Striatal Cells:Involvement of Superoxide and Endogenous NADPH Oxidase

Liping Ma Æ Jiawei Zhou

Accepted: 27 December 2005 / Published online: 9 May 2006

� Springer Science+Business Media, Inc. 2006

Abstract The dopaminergic system appears early in

mammalian brain development, and a neurodevelopmental

role for dopamine (DA) has been suggested. In the present

study, we found that DA markedly promoted the survival

of embryonic striatal cells in cultures. The failure of DA

receptor antagonists to block this survival-promoting effect

and the capability of S-apomorphine, which is devoid of

DA receptor agonist activity but possesses antioxidative

activity as R-apomorphine and DA, to completely mimic

this effect suggested that DA receptor activation was not

required in the survival-promoting effect elicited by DA,

and its antioxidative activity might be involved. Moreover,

it was found that mRNA of NADPH oxidase was expressed

in the embryonic striatum. Furthermore, DPI or apocynin,

NADPH oxidase inhibitors, promoted the survival of

embryonic striatal cells. Addition of either DA or DPI into

striatal cell cultures decreased the superoxide level. These

results indicate that the mechanisms underlying the

neuroprotective effects of DA were likely associated with

its antioxidative activity. NADPH oxidase might contrib-

ute, at least in part, to ROS generation.

Keywords Embryonic Æ Dopamine Æ Striatum Æ Neural

precursor cells Æ NADPH oxidase Æ Antioxidant activity

Introduction

The development of the central nervous system (CNS) is a

complex process, in which multiple factors participate,

including neurotransmitters. The expression of neuro-

transmitters, their receptors and transporters has been de-

scribed during early development well before the onset of

synaptic activity, and their roles in regulating growth

during specific developmental period have been suggested

(for review, see [1]). For example, GABA and glutamate

have been shown to directly or indirectly regulate precursor

cell proliferation [2]. Similarly, a role for dopamine (DA)

in regulating development of nigrostriatal dopaminergic

pathway has been also suggested. In the striatum of

developing rat brain, expression of DA receptors D1, D2,

D3 and D5 has been observed in E14 [3, 4] while tyrosine

hydroxylase (TH)-immunoreactive processes appear in

ventricular zone at the same embryonic stage (E14) or even

earlier (E12) [5–7]. From the early appearance of me-

sencephalic DA input in the striatum and their temporal/

spatial relationships to the striatal patch-matrix organiza-

tion, it has been concluded that DA plays an important role

in the development of the striatum [5, 7–9]. In fact, the DA

afferents can modulate the morphological characteristics of

striatal neurons as well as the expression of striatal neu-

ropeptides [8, 9]. The striatal cells at the time DA appears

in the developing striatum exhibit a proliferative potential

L. Ma Æ J. Zhou

Key Laboratory of Proteomics, Institute of Biochemistry

and Cell Biology, Shanghai Institute for Biological Sciences,

200031 Shanghai, China

L. Ma Æ J. Zhou

Graduate School of the Chinese Academy of Sciences,

200031 Shanghai, China

J. Zhou (&)

Institute of Biochemistry and Cell Biology, Chinese Academy

of Sciences, Building 23, Room 316, 320 Yueyang Road,

200031 Shanghai, P.R. China

e-mail: jwzhou@sibs.ac.cn

Tel.: +86-21-5492-1073

Fax: +86-21-5492-1073

Neurochem Res (2006) 31:463–471

DOI 10.1007/s11064-006-9038-6

123

and they are regarded as neural precursor cells that gen-

erate neurons and glia of CNS [2, 6]. However, the influ-

ence of DA on striatal cells has not been fully understood.

In the present study, we investigated the effect of DA on

the embryonic neural cells of striatum. It was observed that

DA significantly promoted the survival of neural precursor

cells and those differentiated cells by its antioxidant activity.

NADPH oxidase, which contributes to generation of radical

oxygen species (ROS), was expressed in developmental

striatum. Inhibitors for NADPH oxidase also showed sur-

vival-promoting effect as DA did. It was suggested that DA

promoted the survival of striatal cells by antagonizing the

ROS, at least in part, produced by NADPH oxidase.

Materials and methods

Animals

All animal experiments were carried out in accordance

with the United States National Institutes of Health Guide

for the Care and Use of Laboratory Animals. Female,

Sprague-Dawley rats were obtained from an animal house

(Shanghai Institutes for Biological Sciences, Chinese

Academy of Sciences). Presence of the plug was taken to

indicate conception and the day of plug was regarded as

embryonic day (E) 0.

Cultures and treatments

Cell cultures were prepared from the striatum of E14 rat

embryos (n=3). Dissociated cells were seeded to poly-L-

lysine (10 lg/ml, Sigma, St. Louis, MO, USA) coated 96-

well or 48-well plates at a cell density of 2.5 · 105/cm2.

Cells were maintained at 37�C in a humidified atmosphere

of 5% CO2 and 95% air, in Dulbecco’s modified Eagle’s

medium (DMEM, Life Technologies, Gaithersburg, MD,

USA) and Ham’s F12 (1:1), supplemented with 1% N2

supplement (Life Technologies) and streptomycin/penicil-

lin, a similar culture system to that for neural precursor

cells in presence of growth factors [10]. Cells derived from

cortical cortex of E14 rats were obtained using the same

manipulations except that the cortical tissues were digested

by 0.025% trypsin for 5 min before dissociation. A variety

of compounds, such as DA (0.02–10 lM), R-apomorphine

(R-APO, 0.02–5 lM), S-APO (0.02–10 lM), apocynin

(0.05–1 mM) and diphenyleneiodonium (DPI, 0.05–5 lM)

were added immediately after cells were seeded, except

that DA receptor antagonists SKF83566 (1–10 lM) and

spiperone (1–10 lM) were applied to cultures as least 2 h

before R-APO or DA was added. Doses of R-APO, S-APO,

DPI and apocynin shown in figures were those exhibiting

significant difference (survival-promoting effect) compared

to untreated, and higher doses reached a plateau. Cell

viability was examined 24 h following treatment or at

indicated time points.

Cell viability measurements

Cell viability assays were performed using two methods, i.e.

MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-dipheyltetrazolium

bromide, Sigma) assay and fluorescein diacetate (FDA)

staining. For MTT assays, cultures were incubated with

5 mg/ml MTT at 37�C for 2 h. The formazan product was

dissolved in solution containing 20% sodium dodecyl sul-

fate and 50% N,N-dimethylformamide at 37�C for at least

6 h, and the absorption was determined at 570 nm in a

microplate reader (Model 550, Bio-Rad) after automatic

subtraction of background readings. To perform FDA

staining, the cells were stained with 10 lg/ml FDA

(C24H16O7, Sigma), which rendered viable cells bright

green under epi-fluorescence. The number of surviving cells

was counted. In both cases, the results were expressed as a

percentage of live cells counted in paired untreated cultures.

Immunocytochemistry

Mouse anti-nestin antibody (1:300, BD Pharmingen) was

used to identify neural precursor cells. The peroxidase was

visualized by incubation with diaminobenzidine (DAB)

(Sigma).

TUNEL assay

Terminal deoxynucleotidyl transferase-mediated biotiny-

lated UTP nick end labeling (TUNEL) technique was used

to examine apoptotic cell at 24 h in vitro. The staining was

performed according to the manufacturer’s instruction

manual (Promega, Madison, WI, USA). Occurrence of

apoptosis was quantified by scoring the percentage of

TUNEL-positive cells in the total cell count.

Cell count

For positive cells counting, in all cases, the number of

positively stained cells was counted at 200 · magnifica-

tion in five selected fields per well (i.e. 3-, 6-, 9-, and

12-o’clock positions and in the center). The data were

expressed as percentage of paired untreated cultures (n=3).

Semi-quantitative RT-PCR

Reverse transcription-polymerase chain reaction (RT-PCR)

was employed to reveal expression of NADPH oxidase in

464 Neurochem Res (2006) 31:463–471

123

striatal cells or cortical cells (n=3). Primers were also de-

signed to amplify regions of coding sequence from the

glyceraldehydes-3-phosphate dehydrogenase (GAPDH)

gene. Primers used to amplify a region of interest were as

follows: gp91-phox, 5¢-TTCCAGTGCGTGTTGCTC-3¢(forward) and 5¢-TTTCCAAGTCATAGGAGGGT-3¢ (rev-

erse); p22-phox, 5¢-ACGCTTCACGCAGTGGTA-3¢ (for-

ward) and GACAGCAGTAAGTGGAGGACA (reverse);

p47-phox, 5¢-ATCGCTGACTACGAGAAGGG-3¢ (forw-

ard) and 5¢-CAGGAATCGGACGCTGTT-3¢ (reverse); GA

PDH, 5¢-CCCACGGCAAGTTCAACGGCA-3¢ (forward)

and 5¢-TGGCAGGTTTCTCCAGGCGGC-3¢ (reverse). PCR

was performed sequentially (denaturation–annealing–

extension) at the following conditions: p47-phox, 45 s at

94�C, 45 s at 60�C and 60 s at 72�C (32 cycles); p22-phox,

30 s at 94�C, 30 s at 60�C and 60 s at 72�C (32 cycles);

gp91-phox, 45 s at 94�C, 45 s at 58�C, and 60 s at 72�C (32

cycles); GAPDH, 30 s at 94�C, 30 s at 56�C, and 60 s at

72�C (22 cycles). For semi-quantitative RT-PCR, the con-

ditions were the same as above except the cycling numbers

(28 cycles for NADPH oxidase subunits).

Measurement of superoxide release

The release of superoxide was determined by measuring

the superoxide dismutase (SOD)-inhibitable reduction of

cytochrome c as described previously [11]. Cultures grown

in 48-well plates (1 · 106/well) were maintained in phenol

red-free DMEM/F12 (400 ll/well). Four hours later, 40 ll

of ferricytochrome c (100 lM) was added in combination

with or without 600 U/ml SOD. To determine the effect of

DA or NADPH oxidase inhibitor DPI on cellular super-

oxide levels, they were added into the culture immediately

after plating. Thirty minutes after the addition of cyto-

chrome c, the optical density was measured by spectro-

photometry at 550 nm and converted to nmol of

cytochrome c reduced using the extinction coefficient

E550=21.0 · 103 M)1 cm)1. The reduction of cytochrome

c, which can be inhibited by pre-treatment with SOD,

reflects superoxide release. While DPI alone had no effect

on the oxidation status of cytochrome c, DA alone can

increase the oxidation of cytrochrome c in absence of cells.

The effect of DA on the oxidation of cytochrome c was

taken into consideration by subtraction from the results.

Statistical analysis

All data were expressed as means � SEM of triplicates

from three independent experiments (n=3). Statistical

analysis used commercially available statistical software

(GraphPad Prism v4.0, GraphPad Software Inc. San Diego,

CA, USA). Student–Newman–Keuls test (as a post hoc

test) was used to compare data samples from the untreated

group with the different treatment groups, or between pairs

of groups. Differences were considered significant only

when P-values were <0.05.

Results

Effect of DA on E14 striatal neural precursor cells

and neural cells

There have been numerous reports demonstrating that E14

striatal cells exhibit a proliferative potential [2, 6], and they

are regarded as neural precursor cells which generate

neurons and glia of CNS. To examine whether neural

precursor cells are present in the E14 striatal cell cultures,

the expression of nestin, a neural stem cell marker [12], on

these cells was investigated. Consistent with previous study

demonstrating that about 70% E14 striatal cells are undif-

ferentiated [10], it was observed that about 65% E14 stri-

atal cells were nestin-positive in the cultures employed in

the present study. A similar culture system to that for

neural precursor cells was used here. Under current culture

conditions, the viability of embryonic striatal cells in the

untreated cultures decreased as described previously [13].

It decreased to about 30% of the level at 0 h in vitro.

Remarkably, treatment of the culture with DA (5 lM)

rescued striatal cells from cell death (Fig. 1a, b). MTT

assay revealed that the cell viability of DA-treated cultures

was 2.5-fold higher than that of untreated cultures 24 h

after plating (Fig. 1c). The survival-promoting effect of

DA was concentration-dependent and the maximal dose

was 5 lM. Higher concentration (e.g. 10 lM, Fig. 1c) re-

sulted in deterioration of the culture and 5 lM DA thus

was employed in the rest of studies.

The effect of DA on nestin-positive cells was also

investigated using nestin immunocytochemistry. Following

treatment of the culture with DA, the number of surviving

nestin-positive cells was increased up to 2.5-fold compared

to the untreated (Fig. 1d–f). Moreover, it was observed that

the average percentage of nestin-positive cells in either

DA-treated or untreated cultures remained unchanged,

suggesting that DA treatment promoted the survival of both

neural precursor cells and differentiated cells.

To examine whether the decrease of cell viability results

from apoptosis, TUNEL assay was performed on the cul-

tures 24 h after plating. It was observed that a number of

cells in untreated striatal cultures were stained positive for

TUNEL (Fig. 1g). However, the number of TUNEL-posi-

tive cells was markedly reduced by 75% in DA-treated

cultures (Fig. 1g–i). This indicated that striatal cells

underwent apoptosis and DA partly inhibited this process.

Neurochem Res (2006) 31:463–471 465

123

Effects of DA receptor antagonists

It is known that both D1 and D2 receptors are expressed in

neuronal cells and precursor cells of E14 embryonic stri-

atum [4]. It is not clear, however, whether DA receptors are

involved in DA-induced increase of cell survival in this

study. To examine whether the DA receptors mediate this

process, R-APO, a catechol-derived non-specific dopamine

D1/D2 receptor agonist, was applied to mimic the effect of

DA. Addition of R-APO (0.2 lM) into the culture in-

creased the number of surviving striatal cells to 2.25-fold

compared to the untreated (Fig. 2). However, pre-treatment

of the culture with either SKF83566 (D1 receptor antago-

nist) or spiperone (D2 receptor antagonist) followed by

addition of R-APO or DA did not affect the survival-pro-

moting effect of R-APO or DA, indicating that the effect of

DA or R-APO was not mediated via DA receptors (Fig. 2).

To further test this notion, the effect of S-APO, the

S-isomer of APO, which is devoid of DA receptor agonist

activity but possessing antioxidant activity as R-APO and

DA, was evaluated. As shown in Fig. 2, addition of S-APO

(0.2 lM) increased the number of surviving striatal cells by

up to 2.3-fold compared to the untreated. This indicated

that DA receptors were not required for its survival pro-

moting effect. Consistent with previous studies that DA or

R-APO can exhibit neuroprotective effects in several

models via their antioxidant activity [14, 15], it is likely

that DA uses the same mechanism to promote the survival

of striatal cells.

Role of NADPH oxidase in the apoptosis of striatal

cells derived from E14 embryos

It has been shown that NADPH oxidase is one of sources

generating ROS, which contributes to apoptosis of sym-

pathetic neurons when nerve growth factor is deprived

untreated 5µM DA0

100

200

300*

Nes

tin

po

siti

ve c

ells

(% o

f u

ntr

eate

d)

untreated 5µM DA0

50

100

150

*T

UN

EL

po

siti

ve c

ells

(% u

ntr

eate

d)

0 0.02 0.2 2 5 100

100

200

300

*

*

*

Concentrations of DA (µM)

Cel

l via

bili

ty(%

of

un

trea

ted

)

(a) (b) (c)

(f)(e)

(h)(g)

(d)

(i)

Fig. 1 Effect of DA on the survival of embryonic striatal cells in

cultures. a–c DA significantly promoted the survival of striatal cells

derived from E14 embryos. a, b Phase-contrast photomicrographs

show a representative area of cultured striatal cells 24 h after plating

in untreated a or treated with 5 lM DA b. c Dose–response curve of

DA itself on the cell viability of cultured striatal cells assayed by

MTT analysis. d–f Effect of DA on the survival of neural precursor

cells. Nestin immunohistochemistry was carried out 24 h after plating

and the numbers of nestin-positive cells were counted. d, e

Photomicrographs of nestin-stained striatal cells 24 h after plating

in untreated d or treated with 5 lM DA e. f Quantitative analysis of

the survival of nestin-positive neural precursor cells. g–i Inhibition of

DA on the apoptosis of striatal cells. TUNEL staining was carried out

on embryonic cells 24 h after plating. g, h Photomicrographs of

TUNEL-stained striatal cells in untreated g or treated with 5 lM DA

h. i Quantitative analysis of TUNEL-positive cells. All data above

represent the mean � SEM of triplicates from three independent

experiments. *P < 0.05 compared to untreated. Scale bar, 50 lm

466 Neurochem Res (2006) 31:463–471

123

[16]. First, mRNA expression of three subunits of NADPH

oxidase was examined in the embryonic striatum. RT-PCR

analysis of the embryonic striatal tissue yielded single band

of the predicted size for each subunit, suggesting the

expression of NADPH oxidase in this tissue (Fig. 3a). The

NADPH oxidase activity was then assessed by measuring

the superoxide dismutase (SOD)-inhibitable reduction of

cytochrome c as described previously [11]. It was observed

that superoxide was produced at 1.48 � 0.06 nmol per

1 · 106 striatal cells, demonstrating that the NADPH oxi-

dase in these cells was functional.

To test whether NADPH oxidase contributes to striatal

cell apoptosis, the striatal cell cultures were treated with

NADPH oxidase inhibitors, DPI or apocynin. FDA staining

was used to examine the cell viability following DPI or

apocynin treatment. It was found that the number of viable

cells was increased up to 2.6-fold or 2.1-fold compared to

the untreated in the presence of either 0.5 lM DPI or

0.05 mM apocynin (Fig. 3b–d). However, inhibitors of

NADPH oxidase failed to maintain the survival of the cells

for longer time (e.g., 48 h) whilst DA still improved cell

survival (data not shown). Moreover, combinational treat-

ment of dopamine and DPI or apocyinin did not show

additive effect when compared with that treated with DA

alone (Fig. 3d). This suggested that NADPH oxidase was

one of the factors involved in the striatal cell death that

could be inhibited by DA treatment.

Although both DPI and DA could promote the survival

of striatal cells, different mechanism seemed to be in-

volved, i.e., DPI directly inhibits the production of super-

oxide while DA scavenges the released superoxide. Thus, it

was supposed that both DPI and DA reduce extracellular

level of superoxide thereby promoting the survival of

striatal cells. To assess this possibility, the superoxide level

was measured after the cells were treated with either DPI or

DA. Treatment with either DPI or DA remarkably de-

creased the amount of superoxide almost to zero (Fig. 3e).

These data suggested that DA might promote the survival

of striatal cells by reducing the superoxide free radical

produced, at least in part, by endogenous NADPH oxidase.

Effect of DA on E14 cells derived from cerebral cortex

To examine whether DA exerts similar survival-promoting

effect on embryonic neural cells from other brain regions

such as the cerebral cortex, the embryonic cortical cells

(E14) were cultured and treated with DA. It was observed

that the viability of cortical culture was not altered evi-

dently 24 h after plating. Although the viability dropped

72 h in vitro, no significant difference was found in the cell

viability between the untreated and DA-treated (Fig. 4a),

indicating that DA did not exhibit survival-promoting ef-

fect on embryonic cortical cells as that in striatal cultures.

Since there were many differences between cortical and

striatal cells in cultures, the expression of NADPH oxidase

in embryonic cortical cells was also investigated. The

expression of NADPH oxidase was also observed in

embryonic cerebral cortex (E14). Furthermore, in the

comparison of NADPH oxidase subunits expression in

striatum and in cortex, it was found that the mRNA

expression level of p47-phox and gp91-phox in striatum

was higher than that in cortex, while the expression pattern

was reversed in the case of p22-phox (Fig. 4b, c). And

similar results were obtained as to the activity of NADPH

oxidase (1.41 � 0.08 nmol) in cortical cells to that in

striatal cells. These results suggested that precursor cells

derived from cortex might have stronger resistance to ROS

than those from the striatum and distinct mechanisms were

involved in apoptosis of embryonic cells from different

brain regions.

Discussion

In the present study, we provide evidence that DA is able to

increase the survival of embryonic striatal cells through

antioxidative activity. NADPH oxidase might contribute, at

least partially, to this ROS generation.

The present study suggests that DA may be important

for the survival of striatal cells, such as neural precursor

untreat

ed SKFSPI

DA

SKF+DA

SPI+DA

R-APO

SKF+R-APO

SPI+R-A

PO

S-APO

0

100

200

300

* **

Cel

lvi

abili

ty(%

of

un

trea

ted

)

Fig. 2 Influences of DA receptor agonists and antagonists on the

survival of E14 striatal cells. Effect of a non-selective D1/D2 receptor

agonist, R-APO (0.2 lM), the D1 receptor antagonist, SKF83566

(SKF, 10 lM), the D2 receptor antagonist, spiperone (SPI, 10 lM) or

S-APO (0.2 lM), the S-isomer of APO, which is devoid of DA

agonist activity but possessing antioxidant activity as R-APO and DA,

were evaluated. R-APO or S-APO was added into the embryonic

striatal cell cultures immediately after plating and the DA receptor

antagonists were added 2 h before R-APO or DA (5 lM) was applied.

MTT assay was performed 24 h after plating. Data represent the

mean � SEM of triplicates from three independent experiments.

While cell viability of cultures treated with DA, SPI, SKF, R-APO or

S-APO was compared with untreated, cultures of DA receptor

antagonists plus DA or R-APO were compared with culture treated

with DA or R-APO alone. *P < 0.05

Neurochem Res (2006) 31:463–471 467

123

cells and neuronal cells. This is consistent with previous

studies that lesion of the substantia nigra results in a dra-

matic reduction in the survival of developing striatal neu-

rons [17] and inhibition of DA synthesis by genetic

mutation causes striatal shrinkage [18]. The present study

also demonstrated that DA promoted the survival of nestin-

immunoreactive neural precursor cells, and the survival-

promoting effect of DA was not cell-type specific, implying

that DA is also essential for the survival of striatal neural

precursor cells.

The mechanism through which DA achieves these po-

sitive effects on striatal cells survival has not been well

understood. While the DA receptors are expressed in early

developing striatum, it is possible that they mediate these

positive effects. However, there is strong evidence arguing

against this notion that DA receptor antagonists could not

untreat

ed DADPI

0.0

0.5

1.0

1.5

2.0

* *Sup

erox

ide

leve

l(n

mol

/106

cells

)

230 bp

517 bp

1 3

untreat

ed DPI

Apocynin DA

DA+DPI

DA+Apocy

nin0

100

200

300

400

**

*

FDA

+ ce

lls(%

of u

ntre

ated

)

(a)

(b) (c)

(e)(d)

42

Fig. 3 Role of NADPH oxidase in the apoptosis of striatal cells derived

from E14 embryos. a mRNA expression of three subunits of NADPH

oxidase in E14 striatal cells revealed by RT-PCR. Lane 1, marker, and

the arrow indicating the size of the corresponding band; lane 2, p47-

phox (510 bp); lane 3, p22-phox (201 bp); lane 4, gp91-phox (571 bp).

b–c Effect of NADPH oxidase inhibitors, DPI and apocynin, on the

survival of striatal cells. FDA staining was used to examine the cell

viability of striatal cultures treated with DPI or apocynin 24 h after

plating. Microphotographs of striatal cells in untreated b or treated with

0.5 lM DPI. d Quantitative analysis of effect of DPI (0.5 lM),

apocynin (0.05 mM), DA and DPI, DA and apocynin on the survival of

striatal cells. While cell viability of cultures treated with DPI, apocynin

or DA was compared with untreated, cultures of DA plus DPI or

apocynin were compared with culture treated with DA alone. e Both DA

and DPI decreased the superoxide level in embryonic striatal cells.

*P < 0.05 compared with untreated 4 h after plating. Data represent the

mean � SEM of triplicates from three independent experiments.

*P < 0.05 compared with untreated. Scale bar, 50 lm

468 Neurochem Res (2006) 31:463–471

123

block the survival-promoting effect of DA [15, 19]. On the

other hand, the antioxidant properties of DA receptor ag-

onists have been shown to exert neuroprotective effects in

disease models [19, 20]. In the present study, the failure of

DA receptor antagonists to block the survival-promoting

effect of R-APO and the capability of S-APO, which is

devoid of DA agonist activity but possessing antioxidative

activity as R-APO and DA, to completely mimic this effect

suggest that the apoptosis-inhibiting effect of DA does not

require its receptor activation, but its antioxidative activity

as in other culture models [14, 15, 20]. Also, the ability of

antioxidant, such as vitamin C, to mimic the survival-

promoting effect of DA (data not shown) further suggests

that the antioxidative activity of DA may contribute to this

survival-promoting effect. The antioxidative property of

DA and R-APO has also been indicated in their survival-

promoting effect on neurons [15, 21] and their capability of

protecting cells from the toxic effect of H2O2, and MPTP

[20, 21]. As compounds containing a catechol structure

exhibit significant antioxidative properties and act as

reducing agents, it is most likely that the neuroprotective

effect of DA or R-APO depends on their catechol structure

[22, 23].

In spite of its neuroprotective effect, DA has also been

reported to be toxic when high concentrations (e.g. 1 mM)

are used [24]. This appears to result from the production of

oxygen radicals, since the toxicity can be prevented by

either the antioxidant ascorbic acid [25] or over-expression

of superoxide dismutase [26]. DA can oxidize spontane-

ously in vitro or through an enzyme-catalyzed reaction in

vivo to form ROS and free radical, which can damage

cellular components [27]. With its neuroprotective effect

mentioned before, these data suggest that DA displays

scavenger properties at low doses [15, 28], whereas at high

concentrations it causes cell death [24, 29]. The overall

manner by which an antioxidative drug affects the level of

oxidative stress depends on the balance between radical

scavenging and radical activating properties [23]. Obvi-

ously, in developmental and physiological brain, the con-

centration of DA is too low to exhibit toxic effect.

NADPH oxidase is a five-subunit enzyme that transfers

electrons from NADPH to molecular oxygen to produce

superoxide radicals. The presence of NADPH oxidase in

neuronal cells of most regions in CNS indicates that this

enzyme plays an important role in the CNS [30, 31]. Despite

its physiological functions, the ROS generated by NADPH

0h 24h 48h 72h0

50

100

150untreatedDA (5 µM)

*

Time in vitro

Cel

l via

bili

ty(%

of

un

trea

ted

)Striatum Cortex

p47-phox

p22-phox

gp91-phox

GAPDHp47-phox p22-phox gp91-phox

0

50

100

150

200

250StriatumCortex

*

*

*Opt

ical

Den

sity

(%o

fst

riat

um)

(a)

(b) (c)

Fig. 4 Effect of DA on cortical cells and the comparison of

mRNA expression of NADPH oxidase subunits in striatum and in

cortex. a No survival-promoting effect of DA on embryonic

cortical cells in cultures. No changes in cell viability of E14

cortical cells were found between the untreated and DA-treated,

even when the viability decreased 72 h in vitro (compared to 0 h).

Data represent the mean � SEM of triplicates from three indepen-

dent experiments. *P < 0.05 compared with untreated at 0 h in vitro

and those treated with DA was compared with paired untreated.

b Comparison of mRNA expression of NADPH oxidase subunits in

striatum and cortex. The mRNA expression level of p47-phox and

gp91-phox in striatum was higher than that in cortex, but the

expression pattern was reversed in the case of p22-phox.

c Quantitative analysis of the density of the mRNA expression of

NADPH oxidase subunits in striatum and in cortex. *P < 0.05

compared with striatum (n=3)

Neurochem Res (2006) 31:463–471 469

123

oxidase has been linked to several apoptotic models in

nervous system, e.g., apoptosis of sympathetic neurons and

cells death induced by BDNF [11, 32]. The fact that mice

lacking NADPH oxidase exhibits stronger resistance to

neuronal loss after ischemia than wild-type mice also

demonstrated that NADPH oxidase play an important role

in neuronal apoptosis [33]. Similarly, NADPH oxidase

might also play an important role in the apoptosis of

embryonic striatal cells. This is supported by our finding

presented here that the inhibition of NADPH oxidase re-

duced the level of superoxide, resulting in significantly

enhanced survival of the striatal cells. As DA also decreased

the level of superoxide, it is likely that DA might scavenge

ROS, at least partially, generated by NADPH oxidase,

thereby promoting the survival of striatal cells.

In conclusion, the results reported here indicate that

the embryonic striatal cells may undergo apoptosis in

cultures induced by ROS, which can be reduced by DA

released from the afferents of nigral DA neurons. The

presence of NADPH oxidase in the E14 striatum sug-

gested that this enzyme might play a role in the devel-

opment of striatum.

Acknowledgements This work was supported by grants from the

Chinese Ministry of Science & Technology (No. 2004AA221130),

Shanghai Metropolitan Fund for Research and Development

(No. 04BZ14005), State Key Program for Basic Research of

China (No. 2006CB500704) and Natural Science Foundation of

China (No. 90408004 and 30470540).

References

1. Cameron HA, Hazel TG, McKay RD (1998) Regulation of neu-

rogenesis by growth factors and neurotransmitters. J Neurobiol

36(2):287–306

2. Luk KC, Kennedy TE, Sadikot AF (2003) Glutamate promotes

proliferation of striatal neuronal progenitors by an NMDA

receptor-mediated mechanism. J Neurosci 23(6):2239–2250

3. Diaz J et al (1997) Selective expression of dopamine D3 receptor

mRNA in proliferative zones during embryonic development of

the rat brain. J Neurosci 17(11):4282–4292

4. Schambra UB et al (1994) Ontogeny of D1A and D2 dopamine

receptor subtypes in rat brain using in situ hybridization and

receptor binding. Neuroscience 62(1):65–85

5. Voorn P et al (1988) The pre- and postnatal development of the

dopaminergic cell groups in the ventral mesencephalon and the

dopaminergic innervation of the striatum of the rat. Neuroscience

25(3):857–887

6. Ohtani N et al (2003) Dopamine modulates cell cycle in the

lateral ganglionic eminence. J Neurosci 23(7):2840–2850

7. Specht LA et al (1978) Immunocytochemical localization of

tyrosine hydroxylase in processes within the ventricular zone of

prenatal rat brain. Brain Res 156(2):315–321

8. Graybiel AM, (1984) Correspondence between the dopamine

islands and striosomes of the mammalian striatum. Neuroscience

13(4):1157–1187

9. Kuppers E et al (2000) Developmental regulation of glutamic

acid decarboxylase mRNA expression and splicing in the rat

striatum by dopamine. Brain Res Mol Brain Res 81(1–2):

19–28

10. Shimazaki T et al (1999) A role for the POU-III transcription

factor Brn-4 in the regulation of striatal neuron precursor

differentiation. EMBO J 18(2):444–456

11. Kim SH et al (2002) Brain-derived neurotrophic factor can act as

a pronecrotic factor through transcriptional and translational

activation of NADPH oxidase. J Cell Biol 159(5):821–831

12. Frederiksen K, McKay RD (1988) Proliferation and differentia-

tion of rat neuroepithelial precursor cells in vivo. J Neurosci

8(4):1144–1151

13. Reynolds BA, Tetzlaff W, Weiss S (1992) A multipotent EGF-

responsive striatal embryonic progenitor cell produces neurons

and astrocytes. J Neurosci 12(11):4565–4574

14. Gassen M, Gross A, Youdim MB (1999) Apomorphine, a dopa-

mine receptor agonist with remarkable antioxidant and cytopro-

tective properties. Adv Neurol 80:297–302

15. Iacovitti L, Stull ND, Mishizen A (1999) Neurotransmitters, KCl

and antioxidants rescue striatal neurons from apoptotic cell death

in culture. Brain Res 816(2):276–285

16. Tammariello SP, Quinn MT, Estus S (2000) NADPH oxidase

contributes directly to oxidative stress and apoptosis in nerve

growth factor-deprived sympathetic neurons. J Neurosci

20(1):53RC

17. van der Kooy D (1996) Early postnatal lesions of the substantia

nigra produce massive shrinkage of the rat striatum, disruption of

patch neuron distribution, but no loss of patch neurons. Brain Res

Dev Brain Res 94(2):242–245

18. Zhou QY, Palmiter RD (1995) Dopamine-deficient mice

are severely hypoactive, adipsic, and aphagic. Cell 83(7):

1197–1209

19. Miglio G et al (2004) Cabergoline protects SH-SY5Y neuronal

cells in an in vitro model of ischemia. Eur J Pharmacol

489(3):157–165

20. Uberti D et al (2002) Pergolide protects SH-SY5Y cells against

neurodegeneration induced by H(2)O(2). Eur J Pharmacol

434(1–2):17–20

21. Stull ND, Polan DP, Iacovitti L (2002) Antioxidant compounds

protect dopamine neurons from death due to oxidative stress in

vitro. Brain Res 931(2):181–185

22. Liu J, Mori A (1993) Monoamine metabolism provides an anti-

oxidant defense in the brain against oxidant- and free radical-

induced damage. Arch Biochem Biophys 302(1):118–127

23. Gassen M et al (1996) Apomorphine is a highly potent free

radical scavenger in rat brain mitochondrial fraction. Eur J Phar-

macol 308(2):219–225

24. Petersen A et al (2001) Brain-derived neurotrophic factor inhibits

apoptosis and dopamine-induced free radical production in stri-

atal neurons but does not prevent cell death. Brain Res Bull 56(3–

4):331–335

25. Dexter DT et al (1994) Increased levels of lipid hydroperoxides

in the parkinsonian substantia nigra: an HPLC and ESR study.

Mov Disord 9(1):92–97

26. Pardo B et al (1995) Toxic effects of L-DOPA on mesencephalic

cell cultures: protection with antioxidants. Brain Res 682(1–2):

133–143

27. Gassen M, Gross A, Youdim MB (1998) Apomorphine enantio-

mers protect cultured pheochromocytoma (PC12) cells from

oxidative stress induced by H2O2 and 6-hydroxydopamine. Mov

Disord 13(2):242–248

28. Mytilineou C, Han SK, Cohen G (1993) Toxic and protective

effects of L-dopa on mesencephalic cell cultures. J Neurochem

61(4):1470–1478

470 Neurochem Res (2006) 31:463–471

123

29. Pardini C et al (2003) Dose-dependent induction of apoptosis by

R-apomorphine in CHO-K1 cell line in culture. Neuropharma-

cology 45(2):182–189

30. Serrano F et al (2003) NADPH oxidase immunoreactivity in the

mouse brain. Brain Res 988(1–2):193–198

31. Kim MJ et al (2005) Immunohistochemical study of p47Phox and

gp91Phox distributions in rat brain. Brain Res 1040(1–2):178–186

32. Hwang JJ, Choi SY, Koh JY (2002) The role of NADPH oxidase,

neuronal nitric oxide synthase and poly(ADP ribose) polymerase

in oxidative neuronal death induced in cortical cultures by brain-

derived neurotrophic factor and neurotrophin-4/5. J Neurochem

82(4):894–902

33. Walder CE et al (1997) Ischemic stroke injury is reduced in mice

lacking a functional NADPH oxidase. Stroke 28(11):2252–2258

Neurochem Res (2006) 31:463–471 471

123