dna transcription and translation sections 12.3 and 12.4
TRANSCRIPT
![Page 1: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/1.jpg)
DNA Transcription and Translation
Sections 12.3 and 12.4
![Page 2: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/2.jpg)
Do Now
1. What is RNA
2. How does it differ from DNA?
3. What is protein?
![Page 3: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/3.jpg)
Gene
Segment of DNA that codes for a protein
DNA codes for RNA and RNA makes protein
![Page 4: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/4.jpg)
One Gene – One Enzyme The Beadle and Tatum experiment
showed that one gene codes for one enzyme.
One gene codes for one polypeptide.
polypeptide - a chain of covalently bonded amino acids.
(proteins are made of one or more polypeptide)
![Page 5: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/5.jpg)
![Page 6: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/6.jpg)
12.3 DNA, RNA, and Protein
![Page 7: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/7.jpg)
Let’s make some observations about RNA’s structure
![Page 8: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/8.jpg)
RNA
RNA stands for: Ribonucleic acid
RNA is found: Nucleus and Cytoplasm
![Page 9: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/9.jpg)
RNA Structure
Like DNA, RNA is made up of subunits called _____________, which are made of three parts: Sugar (ribose) Phosphate Nitrogen Base
![Page 10: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/10.jpg)
RNA’s Nitrogen Bases
Adenine (A) Cytosine (C) Guanine (G) Uracil (U)
![Page 11: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/11.jpg)
There are 3 types of RNA: Messenger RNA (mRNA) Ribosomal RNA (rRNA) Transfer RNA (tRNA)
![Page 12: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/12.jpg)
All RNA is …
Single stranded Many different shapes “Cheap copy” of DNA
![Page 13: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/13.jpg)
![Page 14: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/14.jpg)
Do Now
1. What is a protein made of?
2. Explain the process between DNA and proteins.
![Page 15: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/15.jpg)
Transcription
First step in making proteins Process of taking one gene (DNA)
and converting into a mRNA strand DNA -> RNA Location:
Nucleus of the cell
![Page 16: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/16.jpg)
![Page 17: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/17.jpg)
Steps to Transcription
1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA
![Page 18: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/18.jpg)
Steps to Transcription (Cont.)
2. One strand acts as a template.
![Page 19: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/19.jpg)
Steps to Transcription (Cont.)
3. A mRNA copy is made from the DNA template strand by RNA polymerase
4. A mRNA copy is made until it reaches the termination (stop signal) sequence
5. The two strands of DNA rejoin.
![Page 20: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/20.jpg)
Template vs. Non Template Strand
![Page 21: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/21.jpg)
![Page 22: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/22.jpg)
![Page 23: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/23.jpg)
Transcription animations
http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html
http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/transcription.htm
![Page 24: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/24.jpg)
Transcribe this DNA to mRNA
![Page 25: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/25.jpg)
![Page 26: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/26.jpg)
Think- Pair- Share 1. Where in the cell does transcription occur? 2. What nucleic acids are involved in the
process of transcription? 3. What is the importance of transcription? 4. In transcription, how come the whole DNA
molecule is not copied into mRNA? 5. How does one gene differ structurally from
another? 6. Because one gene differs from another, what
molecules in the cell will also be different?
![Page 27: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/27.jpg)
mRNA Processing
Pre-mRNA – the original sequence of RNA created during transcription
mRNA reaches the ribosomes
![Page 28: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/28.jpg)
RNA Processing
![Page 29: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/29.jpg)
What is RNA Processing?
After transcription the pre-mRNA molecule undergoes processing 5’ cap is added Poly A tail is added to the 3’ end Introns are removed.
![Page 30: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/30.jpg)
Do Now
Label the Transcription diagram
![Page 31: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/31.jpg)
RNA Processing In Eukaryotes only Introns- non-coded sections Exons- codes for a protein Before RNA leaves the nucleus, introns are
removed and exons are spliced together A cap and poly A tail are added to ends of the
sequence mRNA leaves the nucleus through the nuclear
pores
![Page 32: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/32.jpg)
Why is it necessary to add the poly A tail and 5’ cap?
![Page 33: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/33.jpg)
Let’s try an activity (11.5)
http://www2.pearsonsuccessnet.com/snpapp/iText/products/0-13-115075-8/index.html
![Page 34: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/34.jpg)
![Page 35: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/35.jpg)
Pg. 339
Pg. 339
![Page 36: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/36.jpg)
Let’s an example…
Original DNA Sequence (DNA): 5’ GTACTACATGCTATGCAT 3’ Translate it (RNA): 3’ CAUGAUGUACGAUACGUA 5’
Add the 5’ cap: 3’ CAUGAUGUACGAUACGUA 5’ cap
![Page 37: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/37.jpg)
Finish the job!
Remove the introns “UGUA” and “AUAC”:3’ CAUGAUGUACGAUACGUA 5’ cap
3’ CAUGACGGUA 5’ cap
Add a poly A tail onto the 3’ end
3’ CAUGACGGUA 5’ capPoly A tail
![Page 38: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/38.jpg)
Get a new partner!
DNA Strand of non-template strand:
5’ ATCGGTAGAGTATTTACAGATA 3’
Remove introns: CGGUA UUACAG
![Page 39: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/39.jpg)
Think, Pair, Share
Take a minute think on your own, then pair with your partner, and share your ideas!
Evolutionary, why do you think there are introns?
Where did they come from? Why do we have them? Remember there is NO wrong answer!
![Page 40: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/40.jpg)
PROTEINS!
![Page 41: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/41.jpg)
Proteins are made up of amino acids!!!
Proteins are polymers of amino acids
Only 20 different amino acids BUT there are hundreds of thousands
of different proteins
How can this be?
![Page 42: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/42.jpg)
Let’s compare to it to the English language How many letters are in the alphabet?A,b,c,d,…26 How many words are there?Miss, Ings, is, smart, .. Almost infinite! Each word has a unique structure of letters.
Similar to proteins and amino acids
![Page 43: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/43.jpg)
Proteins- (PCFNa)
-made of 20 different Amino Acids
- Amino Acids bond to form polypeptide chains
![Page 44: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/44.jpg)
How do amino acids form these peptide chains?
Peptide Bonds – Link each amino acids together to form proteins
![Page 45: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/45.jpg)
How many amino acids are in a dipeptide chain?
How about a tripeptide chain?
How many water molecules are formed from 2 amino acids?
How many water molecules are formed from 100 amino acids?
![Page 46: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/46.jpg)
Do Now Perform transcription on this DNA segment:
GCTTCATACGA
Do RNA processing and remove the introns: GAA and UGC
How does this mRNA sequence leave the nucleus?
Where does it go?
![Page 47: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/47.jpg)
Protein
Structure
http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm
![Page 48: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/48.jpg)
![Page 49: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/49.jpg)
Translation
Production of proteins from mRNA mRNA goes to the ribosomes in the
cytoplasm or the RER and produces proteins
![Page 50: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/50.jpg)
![Page 51: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/51.jpg)
Steps to Translation 1. mRNA leaves the nucleus and
binds to a ribosome 2. the 5’ end of mRNA binds to
ribosome
![Page 52: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/52.jpg)
Ribosome
Two subunits to the ribosome 3 grooves on the ribosome (A, P, E) A: tRNA binding site P: polypeptite bonding site E: exit site
![Page 53: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/53.jpg)
Steps to Translation (Cont.)
3. Ribosome looks for the start Codon (AUG) Codon: group of 3 nucleotides on the
messenger RNA that specifies one amino acid (64 different codons)
![Page 54: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/54.jpg)
![Page 55: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/55.jpg)
Steps to Translation (Cont.)
4. Amino acids attached to a tRNA molecule and are brought over to the mRNA.
5. This tRNA has an anticodon that matches the codon on the mRNA strandAnticodon:
Group of 3 unpaired nucleotides on a tRNA strand. (binds to mRNA codon)
![Page 56: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/56.jpg)
tRNA
![Page 57: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/57.jpg)
Think-Pair-Share The mRNA sequence reads the following
codons: What amino acids do they stand for? AUG GGA GAG CAA
** What amino acid does the anticodon CGU stand for?***
![Page 58: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/58.jpg)
Steps to Translation (Cont.)
6. tRNA binds to the mRNA sequence and adds an amino acid
7. Each amino acid matches up with 1-6 tRNA molecules
8. tRNA leaves and amino acids bond together through a polypeptide bond
![Page 59: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/59.jpg)
Think – Pair - Share
Find the amino acid sequence for the following mRNA sequence (translation)
AUGCGACGAAUUUAA
![Page 60: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/60.jpg)
![Page 61: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/61.jpg)
Translation Animations
http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html
http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/translation.swf
![Page 62: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/62.jpg)
Steps to Translation (Cont.)
9. The mRNA sequence continues until a stop codon is reached.
10. The amino acids disconnect from the mRNA sequence and a protein is formed.
![Page 63: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/63.jpg)
![Page 64: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/64.jpg)
Think-Pair-Share
Get with a partner, one partner transcribes and the other translates.
![Page 65: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/65.jpg)
Do Now
Do transcription on this DNA sequence:
CGTACGCTCCCTAGACTA
Do Translation- Remember to start the right place!
![Page 66: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/66.jpg)
Do Now
Do transcription on this DNA sequence:
TTTTATACTGAGGGTTAACTCGT
Do Translation- Remember to start the right place!
![Page 67: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/67.jpg)
![Page 68: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/68.jpg)
![Page 69: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/69.jpg)
1. 2. 3.
![Page 70: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/70.jpg)
4. 5. 6.
![Page 71: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/71.jpg)
1. Initiation The two ribosomal subunits
come together with the mRNA and the first tRNA molecule which attaches to the start codon (AUG).
This is the only tRNA that will attach to the P site.
The first amino acid is always methionine.
![Page 72: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/72.jpg)
2. Codon Recognition
The tRNA anticodon will hydrogen bind to the mRNA codon in the A site.
![Page 73: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/73.jpg)
3. Bond Formation
The amino acid in the P site will form a peptide bond with the amino acid in the A site.
![Page 74: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/74.jpg)
4. Translocation
The tRNA's and the mRNA move down one site. The empty tRNA is released from the exit site.
![Page 75: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/75.jpg)
5. Repeat
This process will repeat hundreds of times.
![Page 76: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/76.jpg)
6. Termination
Translation is terminated with the stop codon is reached. There are three different stop codons UGA, UAA, UAG.
The release factor recognizes the stop codon and releases the polypeptide strand. All the factors break apart and are reused.
![Page 77: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/77.jpg)
![Page 78: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/78.jpg)
Do Now Take the following amino acid
sequence, do reverse transcription and translation (find RNA and DNA).
Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop
What do you notice about your DNA sequences?
![Page 79: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/79.jpg)
Do Now
Template strand of DNA: 5’ TTACGGCTAGGAGTAGCCGAATTCTG
3’
Remove the introns: CUCAUC
Determine protein sequence
![Page 80: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/80.jpg)
Do Now
![Page 81: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/81.jpg)
![Page 82: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/82.jpg)
How do cells know what protein to make when?
Gene Regulation: ability of an organism to control which genes are transcribed.
![Page 83: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/83.jpg)
Controlling Transcription
Transcription factors ensure that a gene is used at the right time and that protein are made in the right amounts
The complex structure of eukaryotic DNA also regulate transcription.
![Page 84: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/84.jpg)
HOX Genes
Everyone develops from a zygote Zygote undergoes mitosis Cell differentiation: cells
become specialized Certain gene sequences determine
cell differentiation
![Page 85: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/85.jpg)
HOX Genes
Homeobox Genes (Hox Genes) are sequences of DNA
Hox genes are responsible for the general body pattern of most animals.
![Page 86: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/86.jpg)
HOX Genes
Are transcribed at specific times, and located in specific places on the genome
Mutations:
![Page 87: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/87.jpg)
Telephone
We are going to play the game telephone.
Every time a DNA makes a copy (spreading of a message), mutations can happen (mistakes in a message)
![Page 88: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/88.jpg)
Mistakes in DNA
Cell make mistakes in replication, and transcription
Most often these mistakes are fixed
EX.
![Page 89: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/89.jpg)
Mutations
A permanent change that occurs in a cell’s DNA is called a mutation.
Three types of mutations: Point mutation Insertion Deletion
![Page 90: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/90.jpg)
Point Mutation
Substitution: A change in just one base pair Missense Mutation: amino acid is change Nonsense Mutation: amino acid is changed
to a stop codon
![Page 91: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/91.jpg)
Frameshift Mutations Causes the reading
frame to shift to the left or the right
Insertion: Addition of a nucleotide
Deletion: Removal of a nucleotide
![Page 92: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/92.jpg)
![Page 93: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/93.jpg)
ACGAAATACAGACAT
Decide what type of mutation occurred:
ACGAAATAGAGACAT
ACAAATACAGACAT
ACGAAATACAGGACAT
![Page 94: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/94.jpg)
![Page 95: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/95.jpg)
Causes of Mutations Mutations can happen spontaneously Mutagens: Certain chemicals or
radiation that can cause DNA damage Causes bases to mispair and bond
with the wrong base High-energy forms of radiation, such
as X rays and gamma rays, are highly mutagenic.
![Page 96: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/96.jpg)
Sex Cell vs. Somatic Cell Mutations
Somatic cell mutations are not passed on to the next generation.
Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring
![Page 97: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/97.jpg)
![Page 98: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/98.jpg)
![Page 99: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/99.jpg)
Chromosomal Mutations
Piece of chromosome can be broken off, duplicated, or moved to another chromosome
![Page 100: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/100.jpg)
Fragile X Syndrome
Repeat of CGG about 30 times
Causes mental and behavior impairments
![Page 101: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/101.jpg)
![Page 102: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/102.jpg)
Protein Folding and Stability
Substitutions also can lead to genetic disorders.
Ex. Sickle Cell Anemia (caused by a substitution mutation)
Can change both the folding and stability of the protein
![Page 103: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/103.jpg)
Sickle Cell Anemia
![Page 104: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/104.jpg)
Causes of Mutations Mutations can happen spontaneously Mutagens: Certain chemicals or
radiation that can cause DNA damage Causes bases to mispair and bond
with the wrong base High-energy forms of radiation, such
as X rays and gamma rays, are highly mutagenic.
![Page 105: DNA Transcription and Translation Sections 12.3 and 12.4](https://reader030.vdocuments.site/reader030/viewer/2022032607/56649ece5503460f94bdb944/html5/thumbnails/105.jpg)
Sex Cell vs. Somatic Cell Mutations
Somatic cell mutations are not passed on to the next generation.
Mutations that occur in sex cells are passed on to the organism’s offspring and will be present in every cell of the offspring