dna how is the expression of genes controlled in prokaryotes? what are some ways the expression of...

90
DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Upload: rhoda-gordon

Post on 31-Dec-2015

217 views

Category:

Documents


1 download

TRANSCRIPT

Page 1: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

DNA

How is the expression of genes controlled in prokaryotes?

What are some ways the expression of genes are controlled in eukaryotes?

What are histones?

Page 2: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

DNA Technology

Meet Dolly

Page 3: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Biotechnology

The manipulation of organisms or use of living things as technology

i.e. genetic engineering, manipulating genes for practical purposes

Page 4: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Studying One Gene

If we want to study a particular gene in depth, it is cumbersome to use the entire DNA molecule

Much easier if we can make multiple copies of that one gene to focus on

Page 5: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Gene Cloning

We will first look at the overview of cloning a particular gene, then go into it in detail

The goal is to create multiple copies of a single segment of DNA

Page 6: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Step 1A

Isolate a plasmid from a bacterial cell

Page 7: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Step 1B

Isolate the DNA we wish to clone

Page 8: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Step 2

Insert gene into plasmid

Recombinant DNA

Page 9: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Step 3

Reinsert Plasmid into Bacteria

Recombinant Bacterium

Page 10: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Step 4

Plasmids replicate independently, reproducing the gene of interest

Page 11: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Step 5 / Step 6

Identify the bacterial plasmids that did in fact clone the gene

Use the gene! Can use copies of the gene itself Can use the protein products of the gene

Page 12: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Why Is This Useful?

We can insert genes into other organisms

i.e. in agriculture we can introduce pest-resistance to crops

Alter bacteria to accomplish a task Create proteins for medicines and other uses

Create Human Growth Hormone to treat short kids

Page 13: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Restriction Enzymes

Cut DNA at specific places (recognize target sequences)

Used to combat foreign DNA in nature

Create restriction fragments

Creates the same fragments every time

Page 14: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Sticky Ends

Doesn't cut at the same spot on both strands

Leaves single stranded edges called sticky ends

These two ends can be resealed by DNA ligase

Or new DNA can be inserted between

Page 15: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Recombinant DNA using Restriction Enzymes

Page 16: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

DNA

What is a restriction enzyme? What are sticky ends? What is a plasmid? What are some of the uses of genetic

engineering?

Page 17: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

A More Detailed Look at Cloning

We use a plasmid containing 2 useful genes

1 – ampicillin resistance

2 – lacz gene Called a cloning

Vector Easy to insert in

bacteria

Page 18: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Restriction Enzyme Targets lacz Gene

A restriction enzyme recognizes and cuts a segment of the lacz gene

Also cuts DNA containing gene of interest into small fragments

Page 19: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Mix Plasmids with Our DNA

Sticky ends of plasmid can base pair with sticky ends of DNA

Also end up with plasmid-plasmid combos and DNA-DNA combos etc.

Seal Plasmid and DNA using DNA ligase

Page 20: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Some Plasmids take in the DNA, some Don't

DNA is inserted in the middle of the lacz gene if DNA is taken by plasmid

Amp gene is intact either way

Page 21: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Introduction of Plasmids to Bacterial Cells

Recall transformation, bacteria will take up plasmids

The bacteria do not have the lacz gene

Some bacteria take in plasmids with our DNA

Some take in unaffected plasmids

Page 22: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Plate the Bacteria

We place the bacteria on a plate containing ampicillin and X-gal

Only bacteria containing the plasmid can grow (the ampicillin resistance allows their survival)

Bacterial Colonies

Page 23: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

What Is X-Gal?

X-gal reacts with galactosidase to create a blue product

The product of the lacz gene breaks down galactosidase

If the lacz gene is intact – no blue

If there is foreign DNA then lacz gene is interrupted and bacteria are blue White Blue

Page 24: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Checking our Agar Plate

Blue colonies have taken in foreign DNA in their plasmids

White colonies have the plasmid – but no foreign DNA is in the plasmid and the lacz gene is intact

Page 25: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Isolate Our Gene of Interest

The foreign DNA may not have been the gene we care about!

We must use nucleic acid probe (a short segment of complementary DNA) to find the gene of interest

Attach fluorescent protein to probe

Page 26: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Making the Bacteria Express the Gene

We can express the gene in the bacteria, but sometimes we need to insert a promoter as well

Called an expression vector

The promoter tells the prokaryotic RNA polymerase to transcribe the gene

Page 27: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

cDNA

Introns are a pain for prokaryotes

Sometimes it's necessary to make DNA without the introns first

Use reverse transcriptase to make cDNA from mRNA

Page 28: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Genomic Library vs. cDNA library

Collection of all of the segments of the DNA that is separated by restriction fragments

The library will have multiple copies of each gene

Some genes are split between two segments

cDNA library contains only the segments that code for a gene

In fact only codes for genes transcribed – useful for studying genes expressed in brain cells for example

Page 29: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Polymerase Chain Reaction (PCR)

Allows us to quickly make many copies of a segment of DNA

Very specific, due to use of specific primers that recognize each gene

Need only small amount of DNA to replicate

Page 30: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

PCR

Heat the DNA to separate the strands

Cool strands and allow DNA primers to bind to DNA

DNA polymerase synthesizes new strand

Repeat

Page 31: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Why is PCR So Amazing?

From a small amount of DNA we can make millions of copies

Important in solving crimes with DNA, determining paternity etc.

Useful for a lot of other biotech processes

Page 32: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Gel Electrophoresis

Separates DNA, Proteins etc. based on charge and size

For DNA, all molecules have the same charges, so separates DNA by length of strand

Page 33: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Restriction Fragment Analysis

Cut pieces of DNA with restriction enzymes

The same DNA with the same enzymes will produce the same fragments every time

Show up as bands on gel electrophoresis

Page 34: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Southern Blotting

The full genome has too many genes to use simple gel electrophoresis (get too many bands)

But we can use Southern Blotting to identify only the genes we care about

Page 35: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Southern Blotting

We add radioactively labelled DNA to our gel electrophoresis

We can figure out A) if the DNA segment we are interested in is present and

B) What size fragment the segment is located on

C) How many times the gene is present

Page 36: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?
Page 37: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Restriction Length Polymorphisms (RFLPs)

Recall that human's have DNA that is 99.9% similar

So how can we compare DNA? By identifying locations in the genome where

people often differ If two people differ in a nucleotide that is part of

a restriction site, then only one of the people will have their DNA cut by that restriction enzyme

Page 38: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

RFLPs

Page 39: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Finding Genes in Genomes

In situ hybridization Use a radioactive

probe that can base pair with the gene

i.e. we can see if a gene from a mouse is present in humans

Page 40: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

The Human Genome Project

Working version of genome worked out in 2000

“Final Draft” in 2003 Not a single individual

– there are many places where nucleotides differ

Available on the Internet

Page 41: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Genetic Linkage Mapping

As discussed earlier, we can figure out the order of genes by the frequency of recombination

Genes that are further apart are more likely to be separated during crossing over

Page 42: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Getting the Whole Genome

Cut the genome into tons of little pieces

These pieces are identifiable restriction fragments

Then order fragments by how they overlap

Must first clone DNA so we have copies

Page 43: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Chromosome Walking

Each segment overlaps, so we can use the end of one segment to probe for the next segment

Page 44: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

DNA Sequencing (The Basics)

We take a strand of DNA and make copies of it The DNA is added to a solution containing

everything necessary for DNA replication Primer, DNA Polymerase, A, T, G and C

nucleotides One more ingredient in each batch

Page 45: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Dideoxy Nucleotides!

Special nucleotides that are missing another OH group

ddA nucleotides are added to the DNA

If a dd nucleotide is added DNA replication ends

No phosphodiester bond can be made

Each dd nucleotide is labelled with a fluorescent color

Page 46: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Synthesize New DNA

The DNA is replicated, BUT replication ends as soon as a dd nucleotide is added

We end up with a bunch of different length strands, each labelled by the dd nucleotide on the end

Page 47: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

DNA Segments Are Separated By Size

DNA is run through a machine – smaller segments get through faster

A computer reads the color at the end

Tells us the order of the nucleotides

Page 48: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Much Faster than the Sanger Method

This revolutionized the Human Genome Project Sanger method – have 4 batches, introduce 1

dd nucleotide to each batch Use gel electrophoresis 4 separate times to

determine the length of the strands ending in A, C, G and T

Page 49: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

We Can Use cDNA to Identify Which Genes Are Expressed

Separate genes (by gene cloning and hybridization)

Make cDNA and label it Mix cDNA and each gene to see if they match Can tell which genes are in that cDNA

Page 50: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Microassay

Page 51: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Practical Applications

Identify diseases Gene Therapy Pharmaceuticals Forensics Genetic Engineering Nitrogen fixation and other agricultural uses Understanding our blueprints!

Page 52: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Identifying Diseases

Using PCR we can identify a small amount of a virus in a blood sample

Can examine a person's genes to look for diseases

i.e. Huntington's disease

Page 53: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Gene Therapy

Correct genetic disorders by changing genes or inserting genes

Can we change a person's genes using retroviruses?

Ethical dilemma?

Page 54: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Pharmaceuticals

Make hormones and proteins using bacteria

Make vaccines by altering viruses

Antisense nucleic acids – prevent translation of mRNA of cancer and viruses?

Page 55: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Forensics

We can match up DNA found at a crime scene with suspect's DNA

Used both to help prove guilt and innocence!

Ethical dilemma – should we store DNA of convicted criminals?

Page 56: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Agricultural Uses

Bovine Growth Hormone to raise milk production

Can speed up growth of animals

Easier to manipulate genes in plants

Can introduce pest resistance, or change nutrition

Page 57: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Ti Plasmids in Plants

Certain plants can have genes enter their chromosomes via Ti plasmids from a specific bacteria

Plants can be regenerated from one cell, making it much easier to introduce new genes to the entire plant

Page 58: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?
Page 59: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Gene CloningRestriction Enzyme

Plasmid

Page 60: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Restriction Enzyme Cuts Plasmid

Sticky Ends

Page 61: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Same Restriction Enzyme Cuts DNA

Page 62: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Mix Plasmid and DNA

Page 63: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Make Bacteria Take Up Plasmid

Page 64: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Place Bacteria on Agar Plate

Page 65: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Bacteria with No Plasmids Are Killed By Ampicillin

ampicillin

Page 66: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Bacteria with DNA Turns Blue

Our DNA

Page 67: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Bacteria and Plasmids Replicate

Page 68: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

DNA Libraries

Page 69: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

DNA Libraries

Genomic(all DNA)

cDNA(DNA expressed)

Then we make copies!

Page 70: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Isolate Cells and Collect mRNA

Cells from Brain Tissue

RNA Polymerase

pre-mRNA

SpliceosomemRNA

Page 71: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Make cDNA out of RNA

mRNAReverse Transcriptase

DNA

DNA Polymerase

cDNA

Page 72: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

DNA Libraries

Genomic(all DNA)

cDNA(DNA expressed)

Page 73: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Restriction Fragment Length Polymorphism

AAAATTTTAAAATTTTAAAATTTT TTTTAAAATTTTAAAATTTTAAAA

AAAATTTTAAAGTTTTAAAATTTT TTTTAAAATT TCAAAATTTTAAAA

We find the one spot in the sequence where human's are known to differ. We can then find a restriction enzyme that cuts around that spot

Page 74: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

If We Then Place the DNA in Gel Electrophoresis, We Can Tell the

DNA Apart

Page 75: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Southern Blotting

DNA A DNA B DNA C

Red is our gene of interest. We can check if any of the 3 individuals have it and how many times. If we have a sample containing the gene 3 times, we can figure out which person it belongs to

Page 76: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Chop up DNA with Restriction Enzyme

DNA A DNA B DNA C

Page 77: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Use Gel Electrophoresis to Separate Fragments

Page 78: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Use X-Ray to View Only the Gene of Interest

Compare that to our sample DNA to confirm a match!

Page 79: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Chromosome Walking

ACGTTGCATTGCAACGTA Use GCAT as a probe

Page 80: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Chromosome Walking

ACGTTGCATTGCAACGTA

GCATACGTCGATTGCGTATGCAGCTAAC

Use ATTG as probeGATTGCCTGC

CTAACCGACG

Page 81: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

We Can Use cDNA to Identify Which Genes Are Expressed

Separate genes (by gene cloning and hybridization)

Make cDNA and label it Mix cDNA and each gene to see if they match Can tell which genes are in that cDNA

Page 82: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Microassay

Fluorescent labelled cDNA from a salivary gland

Page 83: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Practical Applications

Identify diseases Gene Therapy Pharmaceuticals Forensics Genetic Engineering Nitrogen fixation and other agricultural uses Understanding our blueprints!

Page 84: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Identifying Diseases

Using PCR we can identify a small amount of a virus in a blood sample

Can examine a person's genes to look for diseases

i.e. Huntington's disease

Page 85: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Gene Therapy

Correct genetic disorders by changing genes or inserting genes

Can we change a person's genes using retroviruses?

Ethical dilemma?

Page 86: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Pharmaceuticals

Make hormones and proteins using bacteria

Make vaccines by altering viruses

Antisense nucleic acids – prevent translation of mRNA of cancer and viruses?

Page 87: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Forensics

We can match up DNA found at a crime scene with suspect's DNA

Used both to help prove guilt and innocence!

Ethical dilemma – should we store DNA of convicted criminals?

Page 88: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Agricultural Uses

Bovine Growth Hormone to raise milk production

Can speed up growth of animals

Easier to manipulate genes in plants

Can introduce pest resistance, or change nutrition

Page 89: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

Ti Plasmids in Plants

Certain plants can have genes enter their chromosomes via Ti plasmids from a specific bacteria

Plants can be regenerated from one cell, making it much easier to introduce new genes to the entire plant

Page 90: DNA How is the expression of genes controlled in prokaryotes? What are some ways the expression of genes are controlled in eukaryotes? What are histones?

DNA

How can we separate bacteria that took up the plasmid from those that did not? What important gene does the plasmid contain?

How can we separate bacteria that have our DNA in them from those that do not What gene gets interrupted when foreign DNA is

inserted? What is Gel Electrophoresis?