dna and genes presentation - biology chapter 11

201

DNA and Genes Section 11.1 - DNA: The Molecule of Heredity

Upload: leslie-samuel

Post on 16-Jun-2015

4.480 views

Category:

Documents

0 download

Report

Download

Embed Size (px):

DESCRIPTION

http://www.leslie-samuel.com - DNA and Genes form the basis for all traits of organisms. This lecture goes through DNA and genes and explains how it leads to every trait you see, through the production of proteins.

TRANSCRIPT

Invalid document format

Dna, chromosomes & genes

PROTEIN SYNTHESIS. DNA and Genes DNA DNA contains genes, sequences of nucleotide bases These Genes code for polypeptides (proteins) Proteins are used

DNA, genes y cromosomas DNA, genes y cromosomas

I. DNA, Chromosomes, Chromatin, and Genes. DNA, Chromosomes, Chromatin, and Genes ... 8 DNA & DNA Replication Worksheet 1. ... 18. After free floating

Introduction to molecular biology. Genes, proteins and DNA A nineteenth-century monk called Gregor Mendel introduced the notion of genes: basic units

Protein Synthesis - Biology with Ms. George - Homebiologywithmsgeorge.weebly.com/.../4/3/22439118/protein_synthesis.pdfPROTEIN SYNTHESIS copyright cmassengale. DNA and Genes ... Biology

Fundamentals of Molecular Biology 4. 4 Fundamentals of Molecular Biology Heredity, Genes, and DNA Expression of Genetic Information Recombinant DNA Detection

Chapter 10- Molecular Biology of Genes Adenine AIDS Anticodon Bacteriophages Codon Cytosine DNA ligase DNA polymerase Double helix Guanine HIV Lysogenic

DNA, genes, and mutations

DNA – Life’s Code Biology 2. The DNA Molecule When we discussed mitosis and meiosis we talked about “genes” – DNA is what makes genes DNA stands for deoxyribonucleic

Genes as DNA: How Genes Encode Proteins

DNA and Genes Biology: Chapter 11 1. DNA Deoxyribonucleic Acid (____________) The genetic material Contains the _______________ for an organism Instructions

Key Area : 2 DNA, genes and chromosomes Unit 1: Cell Biology

Honors Biology Unit 5 2011-2012 1. Genome: Complete complement of an organism’s DNA. ◦ Includes genes (control traits) and non-coding DNA organized

DNA and Genes Biology: Chapter 11Biology: Chapter 11

The Dogma Nucleic acid (DNA/RNA) is important…Why? The central dogma of Molecular Biology –DNA (genes, chromosomes) begets itself (replication), as well

Biology CP Midterm Review. LARGE -------------------------- SMALL Biosphere Ecosystem Organism Cell DNA /Genes Scale of Biology

AP Biology From Gene to Protein How Genes Work AP Biology What do genes code for? proteinscellsbodies How does DNA code for cells & bodies? how are

PROTEIN SYNTHESIS 1. DNA AND GENES DNA ■ DNA contains genes, sequences of nucleotide bases ■ Genes have different alleles. ■ These genes code for polypeptides

Chapter 4 – Genes & DNA

Genes, Genome and DNA

Genetic Material Structure of DNA Replication of DNA Function of Genes Molecular Biology of the Gene Spring 2013 - Althoff Reference: Mader & Windelspecht

AP Biology 2007-2008 Mutations AP Biology Genes Genes code for proteins the order of A, T, C & G Proteins create traits DNA TACGCACATTTACGTACGCGG mRNA

Honors Biology Unit 5 2013-2014 1. Genome: Complete complement of an organism’s DNA. ◦ Includes genes (control traits) and non-coding DNA organized

Gene expression… from DNA to protein biology 1. Genes control metabolism Gene expression is a two stage process –transcription –translation Genes consists

AP Biology 2005-2006 Biotechnology today Genetic Engineering manipulation of DNA if you are going to engineer DNA & genes & organisms, then you need

GENES VII [Books biology genetics] [prentice.hall][genes

Biology Manipulating genes

OS GENES SÃO DNA

DNA, Genes, Chromosomes Chapter 6 & 9 The structure and function of DNA Biology Fall 2012

DNA , Genes, and Chromosomes - Vogel Biology...Genes Genes are located on chromosomes in the cell’s nucleus. Chromosomes are long threads of DNA tightly coiled. ! Each organism must

The DNA Story Germs, Genes, and Genomics 4. Heredity Genes DNA Manipulating DNA

Dna y genes