diversity and distributions, (diversity distrib.) tracking...

© 2007 The Authors DOI: 10.1111/j.1472-4642.2007.00420.xJournal compilation © 2007 Blackwell Publishing Ltd www.blackwellpublishing.com/ddi

1

Diversity and Distributions, (Diversity Distrib.)

(2007)

BIODIVERSITYRESEARCH

ABSTRACT

With the advent of ‘ancient DNA’ studies on preserved material of extant and extinctspecies, museums and herbaria now represent an important although still underutilizedresource in molecular ecology. The ability to obtain sequence data from archivedspecimens can reveal the recent history of cryptic species and introductions. We haveanalysed extant and herbarium samples of the highly invasive green alga

Codiumfragile

, many over 100 years old, to identify cryptic accessions of the invasive strainknown as

C. fragile

ssp.

tomentosoides

, which can be identified by a unique haplotype.Molecular characterization of specimens previously identified as native in variousregions shows that the invasive

tomentosoides

strain has been colonizing new habitatsacross the world for longer than records indicate, in some cases nearly 100 yearsbefore it was noticed. It can now be found in the ranges of all the other nativehaplotypes detected, several of which correspond to recognized subspecies. Withinregions in the southern hemisphere there was a greater diversity of haplotypesthan in the northern hemisphere, probably as a result of dispersal by the AntarcticCircumpolar Current. The findings of this study highlight the importance ofherbaria in preserving contemporaneous records of invasions as they occur,especially when invasive taxa are cryptic.

Keywords

Biological invasions, invasive species,

Codium fragile

, herbarium samples,

cryptic taxa.

INTRODUCTION

In an age when global travel has become an integral part of our

everyday lives, the spread of invasive species has become so

extensive that the ecological impacts of such invasions represent

a major threat to global biodiversity. The introduction of non-

native species can radically alter existing ecosystems and is now

ranked second only to habitat destruction in terms of potential

ecological catastrophe (Wilcove

et al

., 1998; Gurevitch & Padilla,

2004). Competitive exclusion of and/or hybridization with

native taxa can often result in an overall decrease in diversity and

seriously compromise the ability of the original population(s) to

adapt to new selective pressures, thus increasing the chance of

extinction (reviewed in Booth

et al

., 2007). Marine invasions

represent a particularly serious problem, with around 10

thousand species being transported daily in the ballast water of

ships across the globe (Carlton, 1999; Bax

et al

., 2001). In recent

years, there has been a series of high-profile cases of the spread of

invasive marine species including the green seaweed

Caulerpa

taxifolia

(Jousson

et al

., 2000) and invertebrates such as the

moon jellyfish

Aurelia

(Dawson

et al

., 2005), the tropical brittlestar

Ophiactis savignyi

(Roy & Sponer, 2002), and the Atlantic comb

jelly

Mnemiopsis leidyi

, which devastated the Black Sea and Azov

Sea anchovy industries (Shiganova

et al

., 2001).

Codium fragile

(Suringar) Hariot ssp.

tomentosoides

(van

Goor) Silva is a green alga that has spread rapidly throughout

the globe from its native range in Japan and the North Pacific

(Trowbridge, 1998, 2001) and is considered a significant ecosystem

engineer (Schmidt & Scheibling, 2007). Morphologically distinct

populations have been recognized in various parts of the world

and have sometimes been accorded subspecific status as ssp.

atlanticum

, ssp.

californicum

, ssp.

capense

, ssp.

novae-zelandiae

,

ssp.

scandinavicum

, and ssp.

tasmanicum

. To date, however, there

has been much debate concerning how many distinct subspecies

actually exist and which among these has invasive tendencies

(Goff

et al

., 1992; Trowbridge, 1998; González & Santelices,

School of Biological Sciences, The Queen’s

University of Belfast, 97 Lisburn Road,

Belfast BT9 7BL, Northern Ireland

*Correspondence: Dr Jim Provan, School of Biological Sciences, The Queen’s University of Belfast, 97 Lisburn Road, Belfast BT9 7BL, Northern Ireland. Tel.: +44 28 90972280; Fax: +44 28 90335877; E-mail: [email protected]

Blackwell Publishing Ltd

Tracking biological invasions in space and time: elucidating the invasive history of the green alga

Codium fragile

using old DNA

Jim Provan*, David Booth, Nicola P. Todd, Gemma E. Beatty and

Christine A. Maggs

J. Provan

et al.

© 2007 The Authors

2

Diversity and Distributions

, Journal compilation © 2007 Blackwell Publishing Ltd

2004). Silva (1957) noted that there were morphological

intermediates between subspecies, and that the species could be

conceived as a complex assemblage of populations. Differentiation

between subspecies has traditionally been based on utricle

morphology, particularly the microstructure of terminal mucrons

at utricle apices (Silva, 1957; Fig. 1), but this does not provide

an unambiguous diagnostic character since intrasubspecific

variation in utricle morphology within a subspecies has been

correlated with ecological conditions in some cases (Trowbridge,

1996) and is observed even within individuals (Fig. 1). The invasive

nature of ssp.

tomentosoides

is without question and it is currently

recognized as one of the most invasive seaweeds (Nyberg &

Wallentinus, 2005). It was first recorded in Europe

c.

1900 in

Holland (Silva, 1955) and was reported as having reached the east

coast of North America just over 50 years later (Bouck & Morgan,

1957). More recently, it was recorded in Australasia in 1975

(Dromgoole, 1975), South Africa in 1999 (Begin & Scheibling,

2003), and South America in 2001 (González & Santelices, 2004).

Molecular genetic analysis of widely distributed populations of

ssp.

tomentosoides

has allowed a more detailed examination of its

invasive history and suggests that there were at least two major

episodes in the spread of the subspecies in Europe and the

North Atlantic, with separate introductions from Japan into the

Mediterranean and the Atlantic (Provan

et al

., 2005).

Molecular genetic approaches have provided novel insights

into the processes and mechanisms of algal invasions. Since

the spread of invasive species in the marine environment

frequently occurs on a global scale, it is not always possible to

track accurately the spread of these organisms and genetic

data have frequently highlighted the occurrence of cryptic

introductions within a species (Provan

et al

., 2005; Voisin

et al

., 2005; Uwai

et al

., 2006) as well as the occurrence of

cryptic taxa (McIvor

et al

., 2001; Andreakis

et al

., 2007).

One emerging feature of these studies is that repeated

introductions or introductions from genetically diverse source

populations can give rise to wide gene pools in the invasive

range of these species, rather than the presumed founder

effects generally associated with such introductions (e.g.

Voisin

et al

., 2005).

The establishment of polymerase chain reaction (PCR)-based

techniques in population genetic and phylogenetic analyses has

seen an increase in the use of museum and herbarium samples to

provide complementary information on the evolutionary history

of a wide range of animal and plant taxa (Pääbo, 1989; Soltis

et al

., 1992; Savolainen

et al

., 1995; Gugerli

et al

., 2005; Leonard

et al

., 2005). Despite the difficulties associated with working with

herbarium material such as degradation of DNA and the use of

inhibitory compounds as preservatives (Coradin & Giannasi, 1980),

several studies have successfully utilized preserved plant and

fungal samples to obtain information on historical levels of

genetic diversity or to clarify ambiguous taxonomic classification

(e.g. Maunder

et al

., 1999; De Castro & Menale, 2004; Inderbitzin

et al

., 2004). Algal herbarium material has less often been

investigated, however. The most significant studies to date, all

involving red algae, are the taxonomic clarification based on

ITS1 sequence of several members of the Gigartinaceae (Hughey

et al

., 2001, 2002) and the Ceramiales (Gabrielsen

et al

., 2003;

Skage

et al

., 2005), and the elucidation of the

rbcL-rbcS

spacer

sequence from a herbarium sample of

Porphyra lucasii

(Farr

et al

.,

2003).

In the present study, in order to assess any historical evidence

for invasive tendencies, we sequenced type material of all three

putative invasive subspecies (ssp.

tomentosoides

, ssp.

atlanticum

,

and ssp.

scandinavicum

). We also sequenced freshly collected

Figure 1 Scanning electron micrographs of a single individual of Codium fragile ssp. tomentosoides showing variation in morphological features reported to be ‘diagnostic’ of particular subspecies. (a) External view of a cylindrical branch, composed of a single giant cell with numerous utricles (swollen filament tips). (b) Section through tip reveals internal construction. Core of interwoven filaments is surrounded by utricles that vary in shape from constricted (arrow; diagnostic of this subspecies; Burrows, 1991) to cylindrical (arrowhead). (c) Utricle tips with prolonged points diagnostic of C. fragile ssp. tomentosoides. (d) Utricle tips with short points typical of C. fragile ssp. atlanticum. (e) Utricle tips without points resemble the European native species Codium tomentosum (Burrows, 1991). Material was collected in Ireland (Fanad, Donegal, January 2006), fixed and prepared using the protocol of Berger et al. (2003), and imaged with a FEI Quanta 200 Environmental SEM (FEI, Eindhoven, the Netherlands).

Genetic analysis of

Codium fragile

herbarium samples

© 2007 The Authors



3

material from the geographical areas where each recognized

subspecies is found, i.e. South Africa (ssp.

capense

), northern

Europe (ssp.

atlanticum

), Norway (ssp.

scandinavicum

), New

Zealand (ssp.

novae-zelandiae

), Tasmania (ssp.

tasmanicum

),

and the north-east Pacific (ssp.

californicum

) as well as Mexico,

which has no recognized subspecies. We also analysed herbarium

samples of

Codium fragile

from throughout its range to obtain a

chronology of invasions, particularly to determine whether

cryptic invasions that pre-date their first recorded observations

may have taken place.

METHODS

Sampling and DNA isolation

Fresh material was collected from the regions indicated in Table 1

and preserved in silica gel. These samples were identified based

on morphology and geographical origin. For example, for

samples collected within Europe,

C. fragile

with long pointed

mucrons in at least part of the thallus (Fig. 1c) was identified as

ssp.

tomentosoides

. Thalli with shorter, blunt mucrons (Fig. 1d)

were attributed to ssp.

atlanticum

following Silva (1957). DNA

was extracted using the Qiagen DNeasy® Plant Mini Kit

(QIAGEN, West Sussex, UK) according to manufacturer’s instruc-

tions. Material was also obtained from museum herbarium

samples (see Table 3 for details). A 5–10 mm section was

removed from each sample and DNA extracted as described

above in a separate lab where no previous

Codium

work had

been carried out to guard against false positive results from DNA

contamination. Negative controls (with no target DNA) were

used routinely. DNA was quantified visually on 1% agarose gels

stained with ethidium bromide and subsequently diluted to a

concentration of 50 ng/mL.

PCR amplification and sequencing

The marker analysed in this study was the

rpl

16-

rps

3 region of

the plastid genome amplified using the universal primers of

Provan

et al

. (2004). For herbarium samples, since the entire

c.

450 bp product could not be amplified consistently in a single

reaction using degraded DNA as a template, three overlapping

pairs of primers were designed to amplify the first

c.

360 bp of the

region (Table 2; Fig. 2). PCR was carried out on a MWG Primus

thermal cycler using the following parameters: initial denaturation

at 94

°

C for 3 min followed by 35 cycles (40 cycles for herbarium

samples) of denaturation at 94

°

C for 1 min, annealing at

50

°

C for 1 min, extension at 72

°

C for 1 min, and a final

extension at 72

°

C for 5 min. PCR was carried out in a total

volume of 25

µ

L containing 100 ng genomic DNA, 20 pmol of

forward primer, 20 pmol of reverse primer, 1

×

PCR buffer

(5 m

Tris-HCl [pH 9.1], 1.6 m

[NH

4

]

2

SO

4

, 15

µ

g/mL BSA),

200

µ

dNTPs, 2.5 m

MgCl

2

and 1.0 U

Taq

polymerase

(Genetix, Hampshire, UK). Ten microlitre PCR product was

resolved on 2% agarose gels, visualized by ethidium bromide

staining, and the remaining 15

µ

L was sequenced commercially

(Macrogen, Seoul, South Korea). Sequences were concatenated

Table 1 Extant Codium fragile samples sequenced for the rpl16-rps3 region of the plastid genome in this study, listed by subspecies if definite morphological identification was possible, otherwise by geographical area. Note that three samples were analysed from Muizenberg, South Africa, giving a total number of samples N = 19.

Subspecies or geographical area Source Collector and date Sample code

ssp. atlanticum (A.D. Cotton)

P.C. Silva

Ballintoy, Co. Antrim, Ireland C. A. Maggs (8 Aug 2004) CAT/BT/01

Dooey, Co. Donegal, Ireland J. Kelly (7 Sep 2004) CAT/DD/01

ssp. tomentosoides Van Goor Sagami Bay, Honshu, Japan C. D. Trowbridge (1 Dec 2002) CF/SB/01

Wrightsville Beach, North Carolina, USA C. A. Maggs (13 Apr 2002) CF/NC/01

Fanad, Co. Donegal, Ireland C. A. Maggs (28 Apr 2002) CF/DO/01

Broad Haven, Pembrokeshire, Wales C. A. Maggs (26 Apr 2002) CF/BH/01

Lake Grevelingen, Bruinisse, the Netherlands H. Stegenga (9 May 2002) CF/NL2/01

Vidiago, Asturias, Spain J. Rico (15 Jul 2003) CF/VD1/01

Thau Lagoon, France M. Verlaque (6 Jun 2002) CF/TL1/01

Izola Bay, Slovenia C. Batelli (4 Dec 2002) CF/SL/01

Caldera Bay, Chile J. Correa (25 Sep 2003) CF/CH/01

Northeast Pacific Seal Rock, Oregon, USA C. D. Trowbridge (29 Mar 2000) CF/SR/01

South Africa Muizenberg, Cape Province,

South Africa (3 samples)

R. Anderson (13 Feb 2006)

New Zealand Frank Kitts Lagoon, Wellington,

New Zealand

W. Nelson (22 Oct 2003) GenBank

EF107887

Tasmania Low Head Reserve, Bass Strait,

Tasmania, Australia

E. McQualter (19 Sep 2005) McQualter

#2078

Mexico Punta Eugenia, Baja California, Mexico R. Riosmena-Rodriguez (21 Aug 2004) DB2018

Scandinavia Trondheim, Norway S. Bruns (Jun 2004) CF/NW/01

J. Provan

et al.

© 2007 The Authors

4



and aligned using the

program in the

software package. All unique sequences were confirmed by

re-extraction and re-amplification. Representative samples

(around 20%, largely randomly chosen but including all putative

subspecies) were also amplified in two separate laboratories

including one where no previous

Codium

work had been carried

out and sequenced.

Phylogenetic analysis

After the removal of length-polymorphisms at two hypervariable

microsatellite regions (positions 223–230 and 232–249;

Fig. 2), the alignment was used to reconstruct the evolutionary

relationships between sequences using the maximum parsi-

mony method implemented in the

* software package

(Swofford, 2002). Heuristic searches were performed with 1000

random-addition replicates and tree-bisection-reconnection

(TBR) branch swapping. The closely related species

Codium

tomentosum

and

C. decorticatum

(Verbruggen

et al

., 2007) were

used as outgroups.

RESULTS

Codium fragile

: invasive and native (or non-invasive) haplotypes

The complete results of the molecular identification of

herbarium samples and extant material are shown in Tables 3

and 4. In the alignment of all sequences, a total of five sub-

stitutions was found in the

c.

360 bp

rpl

16-

rps

3 region

sequenced. The utility and robustness of this region of the

plastid genome in delineating taxonomic boundaries within

the genus

Codium

has previously been demonstrated (Verbruggen

et al

., 2007). Length polymorphisms at two microsatellite

repeats (positions 223–230 [(A)

5–8

] and 232–249 [(TA)

7–9

];

Fig. 2) were subsequently removed from the analysis since the

high mutation rates associated with microsatellites can

obscure phylogenetic relationships as evidenced by the absence

of any general correlation between repeat lengths and

taxonomy/geography within our samples. Combining the data

from the five substitutions provided 10 haplotypes (Table 4;

Fig. 3). Multiple sequenced individuals of ssp.

atlanticum and

ssp. tomentosoides displayed no intrasubspecific variation but

had distinct haplotypes. Only herbarium material was

available for ssp. scandinavicum but both samples tested,

including the holotype, were identical to ssp. tomentosoides,

as was a fresh sample of C. fragile from Norway. Two further

haplotypes were associated with groups of herbarium spec-

imens but not found in extant samples. One of these (South

Africa [2]) was found in samples NHM54, NHM55, and

NHM56 (all originally identified as ssp. capense) as well as a

further sample from South Africa identified as C. tomentosum

and sample NHM61 from Cape Horn, South America. This

suggests that material previously attributed to ssp. capense

includes several haplotypes. Similarly, a haplotype shared by

Table 2 Primers used to amplify the rpl16-rps3 region of the plastid genome from Codium fragile herbarium samples.

Primer Sequence

Expected

product (bp)

UCP61F CCMGAHCCCATHCGDGTTTC 155

UCP61R GCCTTTGGTAATTTTGCATT

UCP62F AATGCAAAATTACCAAAGGC 104

UCP62R CTCATGCTCCAACCAAAA

UCP63F TTTTTTGGTTGGAGCATGAG 152

UCP63R TATTGATTATTGTTGTCGAACA

Figure 2 rpl16-rps3 region amplified by the three pairs of primers given in Table 2. Primer annealing sites are shown in bold. Microsatellite repeat regions are shown in italics. Not shown – primer binding region for UCP61F, which was trimmed from the final alignment.

Genetic analysis of Codium fragile herbarium samples

© 2007 The AuthorsDiversity and Distributions, Journal compilation © 2007 Blackwell Publishing Ltd 5

Table 3 Codium fragile herbarium samples analysed in this study*. Subspecies atlanticum and tomentosoides samples are grouped by region (Europe, North America, South Africa, Pacific), by countries within regions, then by date of collection.

Haplotype† Code‡ Source Collector Year Original identification

ssp. atlanticum NHM16 Swanage, England E Batters 1894 ssp. atlanticum

UMF83 Malin Head, Ireland JA Mahoney 1863 ssp. atlanticum

NHM17 Larne, Northern Ireland CA Johnson 1865 ssp. atlanticum

NHM100 Clare Island, Ireland AD Cotton 1911 ssp. atlanticum (type)

UMF3047 Sandeel Bay, Co. Down, Ireland O Morton 1972 ssp. atlanticum

NHM60 Cape of Good Hope, South Africa Brand 1774 C. fragile

ssp. tomentosoides NHM21 Ronaldsay, Orkney, Scotland TS Traill 1891 ssp. atlanticum

NHM31 Loch Druidibeg, South Uist, Scotland R Watling 1967 ssp. tomentosoides

NHM19 Bressay, Shetland, Scotland I Tittley 1973 ssp. atlanticum

NHM20 Tyninghame, Firth of Forth, Scotland I Tittley 1981 ssp. atlanticum

NHM27 Ilfracombe, Devon, England Mrs Griffiths 1853 C. tomentosum

NHM16 Swanage, England E Batters 1894 ssp. atlanticum

NHM18 Bantham, Devon, England MA Wilson 1952 ssp. atlanticum

NHM26 Kimmeridge, Dorset, England CI Dickinson 1954 ssp. tomentosoides

NHM13 Dorset, England JFM Cannon 1960 ssp. atlanticum

NHM33 Lulworth Cove, Dorset, England Miss Embrey 1964 ssp. tomentosoides

NHM34 Bembridge, Isle of Wight, England LF Bowden 1966 ssp. tomentosoides

NHM35 Pagham Harbour, Sussex, England I Tittley 1967 ssp. tomentosoides

NHM36 Rottingdean, Sussex, England I Tittley 1967 ssp. tomentosoides

NHM32 Portscatho, Cornwall, England CEL Hepton 1978 ssp. tomentosoides

UMF79 Tory Island, Co. Donegal, Ireland GG Hyndman 1845 ssp. atlanticum

NHM17 Larne, Northern Ireland CA Johnson 1865 ssp. atlanticum

UMF82 Downings Bay, Ireland JA Mahoney 1886 ssp. atlanticum

UMF87 Portrush, Co. Antrim, Ireland S Wear 1915 ssp. atlanticum

UMF90 Carnalea, Co. Down, Ireland MPH Kertland 1946 ssp. atlanticum

NHM29 Lamb’s Head, Co. Kerry, Ireland AHG Alston 1952 ssp. tomentosoides

NHM28 Co. Galway, Ireland PR Bell 1965 ssp. tomentosoides

UMF3038 Co. Cork, Ireland O Morton 1967 ssp. tomentosoides

UMF3039 Fanore, Co. Clare, Ireland O Morton 1969 ssp. tomentosoides

UMF85 Co. Kerry, Ireland O Morton 1972 ssp. atlanticum

NHM30 The Dorn, Strangford, Co. Down, Ireland O Morton 1976 ssp. tomentosoides

NHM25 St Malo, France JA Monk 1970 ssp. atlanticum

NHM40 Cherbourg Peninsula, HerQuelmoulin, France LM Irvine 1980 ssp. tomentosoides

SFX1 Santec, Brittany, France J Cabioch & D Garbary 1990 ssp. atlanticum

AH Den Helder, Netherlands TJ Stamps 1909 ssp. tomentosoides (neotype)

NHM1 Sas van Goes, Zeeland, Netherlands H Stegenga 1975 C. fragile

NHM39 Zuid Beveland, Oosterschelde, Netherlands I Tittley 1980 ssp. tomentosoides

NHM42 Zuid Beveland, Zeeland, Netherlands P van Reine 1980 ssp. tomentosoides

UC1 Hirsholmene, Denmark S Lund 1940 ssp. scandinavicum

UC2 Hirsholmene, Denmark S Lund 1940 ssp. scandinavicum (type)

NHM38 Nyssum Bredning, Denmark I Tittley, John & Johnson 1985 ssp. tomentosoides

NHM41 Sylt, Germany I Tittley 1978 ssp. tomentosoides

NHM6 Cadaques, Northeast Spain KM Drew 1954 C. fragile

NHM22 Flores, Azores I Tittley & A Neto 1994 ssp. atlanticum

NHM23 Santa Cruz, Azores I Tittley & A Neto 1995 ssp. atlanticum

NHM24 Santa Cruz, Azores I Tittley & A Neto 1995 ssp. atlanticum

SFX3 Prince Edward Island, Canada D Garbary 1999 ssp. atlanticum

SFX5 Blue Rocks, Nova Scotia, Canada D Garbary 1999 C. fragile

SFX2 Prince Edward Island, Canada D Garbary 2001 ssp. atlanticum

NHM43 Melkbosch, South Africa GF Papenfuss 1937 ssp. capense (type)

NHM7 Enoshima, Japan K Okamura Pre-1901 C. fragile

NHM8 Nagasaki, Japan J Matsumura Pre-1910 C. fragile

NHM53 Enoshima, Japan J Matsumara 1910 ssp. tomentosoides

NHM2 Mikuni, North Japan VM Grubb 1927 C. fragile

J. Provan et al.

© 2007 The Authors6 Diversity and Distributions, Journal compilation © 2007 Blackwell Publishing Ltd

ssp. tomentosoides NHM4 Kanagawa Reef, Honshu, Japan J Tanaka 1985 C. fragile

NHM3 St Helen’s Point, Tasmania, Australia EL Rice 1985 C. fragile

NHM37 West Lakes, Adelaide, Australia Womersley & Chinnock 2002 ssp. tomentosoides

NHM46 Stewart Island, New Zealand LM Jones 1935 ssp. novae-zelandiae

Northeast Pacific NHM51 Bird Rock, California, USA D Kapraun 1980 C. fragile

SFX4 Neah Bay, Washington, USA RF Scagel 1955 C. fragile

SFX9 Iceberg point, Washington State, USA CB Hubbard 2000 ssp. californicum

South Africa [1] NHM44 Olifantbosch, South Africa YM Chamberlain 1956 ssp. capense

South Africa [2] NHM54 Strandfontein, South Africa GF Papenfuss 1936 ssp. capense

NHM55 Langebaan, South Africa GF Papenfuss 1938 ssp. capense

NHM56 Kommetje, South Africa F Simons 1956 ssp. capense

NHM59 Cape of Good Hope, South Africa Dickie 1884 C. tomentosum

NHM61 Cape Horn, South America Unknown 1842 C. fragile

New Zealand [1] NHM45 Falkland Islands, South Atlantic Unknown 1910 ssp. novae-zelandiae

New Zealand [2] NHM50 Falkland Islands, South Atlantic RW Rudmose-Brown 1849 ssp. novae-zelandiae

NHM57 St James, Cape Town, South Africa Graves 1956 ssp. capense

NHM58 Bay of Islands, New Zealand Unknown 1841 ssp. novae-zelandiae

Tasmania NHM47 Cape Grim, Australia F Perrin 1949 ssp. tasmanicum

NHM52 Port Phillip Heads, Melbourne, Australia J Bracebridge-Wilson 1890 C. fragile

NHM62 Falkland Islands, South Atlantic Unknown 1910 ssp. tasmanicum

UMF4122 Tasmania, Australia Unknown 1963 ssp. tasmanicum

China NHM5 Pei-tai-ho, North China VM Grubb 1926 C. fragile

*Entries in bold represent misidentified samples which pre-date the first records of ssp. tomentosoides in that region (See also Fig. 3).

†We use the subspecies name for haplotypes where we have sequenced type material, otherwise haplotypes are named for the region corresponding

to the original subspecific designation of the majority of the specimens exhibiting that particular haplotype (e.g. New Zealand for samples originally

identified as ssp. novae-zelandiae).

‡NHM, Natural History Museum Herbarium; UM, Ulster Museum Herbarium, Belfast; UC, University of California Herbarium, Berkeley; SFX, St

Francis Xavier University, Nova Scotia; AH, Amsterdam Herbarium. NHM numbers are our own, as NHM specimens are generally not numbered.

Haplotype† Code‡ Source Collector Year Original identification

Table 3 continued

samples NHM50 and NHM 58 (both originally identified as

ssp. novae-zelandiae) and sample NHM57 (originally ssp.

capense) probably represents a second New Zealand haplotype.

Two unassigned samples from Australia (NHM 52 and

UMF4122) and sample NHM62 from the Falkland Islands

exhibited the Tasmania haplotype. Finally, an extant sample

from Mexico displayed a unique haplotype, as did a herbarium

sample from China (NHM5).

Haplotype /

subspecies

Nucleotide

NE NH

GenBank

accession number50 104 134 164 228

ssp. atlanticum T T T G A 2 6 EU045559

ssp. tomentosoides G C C A T 9 53 EU045560

ssp. scandinavicum G C C A T 0 0 EU045560

Northeast Pacific T C C A A 1 3 EU045561

South Africa [1] T C T G A 3 1 EU045562

South Africa [2] T T C A A 0 5 EU045563

New Zealand [1] T C C G A 1 1 EU045564

New Zealand [2] T T C G A 0 3 EU045565

Tasmania T C C G T 1 4 EU045566

Mexico T C C A T 1 0 EU045567

China G C C G A 0 1 EU045568

NE, number of extant samples sequenced; NH, number of herbarium samples sequenced.

Table 4 Haplotypes detected in Codium fragile samples with identifications.



Figure 3 Parsimony tree showing relationships between haplotypes representing extant (bold) and herbarium samples.

J. Provan et al.


Invasive history of C. fragile ssp. tomentosoides based on herbarium samples

Sixteen of the 21 samples described as C. fragile ssp. atlanticum

were actually the invasive tomentosoides strain that had been

misidentified (Table 3). Likewise, one of the six specimens

identified as ssp. capense (the type specimen) and one of the four

ssp. novae-zelandiae samples were also the tomentosoides strain.

In all cases, the cryptic tomentosoides accessions identified by

sequencing the rpl16-rps3 region pre-date the first record of the

invasive haplotype in the ranges of the native subspecies (Fig. 4).

Of the northern hemisphere unknown samples, the majority

were tomentosoides with the exception of the three of the four

North American samples (NHM51, SFX4, SFX9) which displayed

the north-east Pacific haplotype (Table 3). Sample NHM3 from

Australia, originally identified simply as C. fragile, was also

tomentosoides. All herbarium samples designated as ssp. tomen-

tosoides were correctly identified (Table 3).

DISCUSSION

One of the key issues in tracking the spread of invasive species is

the accurate identification of cryptic taxa. Recent molecular

genetic studies on a range of marine organisms have revealed

many cryptic introductions within species, e.g. in the crustacean

genera Carcinus (Geller et al., 1997) and Limnomysis and Paramysis

(Audzijonyte et al., 2006), the ascidian Clavelina lepadiformis

(Turon et al., 2003), the gastropod Ocinebrellus inornatus (Martel

et al., 2004), and the seaweed Undaria pinnatifida (Voisin et al.,

2005). They have also demonstrated the existence of previously

unidentified cryptic sibling species or subspecies, e.g. in the red

seaweeds Polysiphonia harveyi (McIvor et al., 2001) and Asparagopsis

spp. (Andreakis et al., 2007), the fish Atherinomorous lacunosus

(Bucciarelli et al., 2002), and the jellyfish genera Cassiopea

(Holland et al., 2004) and Aurelia (Dawson et al., 2005). The

broad picture emerging from such studies is that the numbers of

species or taxonomic units involved in bioinvasions have been

underestimated, a crucial factor when identifying putative

management units for potential control or remediation.

There has been much debate surrounding subspecific status

within Codium fragile, both in terms of numbers of possible

subspecies and their invasive tendencies. In his report on ssp.

scandinavicum, Silva (1957) highlighted the ‘great complexity of

the variation pattern encountered’ in mucronate Codium species.

We can now extend this perceptive comment to genetic data.

We have likewise found assemblages that are genetically homo-

geneous, i.e. composed of a single haplotype, particularly in the

northern hemisphere, and others that are heterogeneous,

Figure 4 ‘Timelines’ showing where earliest record of ssp. tomentosoides in various regions (left of scale) was predated by earliest herbarium sample identified as ssp. tomentosoides in that region (right of scale). N/A – no herbarium material predating initial record of introduction analysed.



especially in South Africa. Consequently, we use the subspecies

name for haplotypes where we have sequenced type material

(ssp. atlanticum and ssp. tomentosoides), otherwise haplotypes

are named for the region corresponding to the original subspecific

designation of the majority of the specimens exhibiting that

particular haplotype (e.g. New Zealand for samples originally

identified as ssp. novae-zelandiae).

A comparison of haplotype distribution in the northern and

southern hemispheres suggests a higher degree of endemism in

the northern hemisphere. The five ssp. atlanticum samples

identified were restricted to the British Isles, with both putative

samples of ssp. atlanticum from Prince Edward Island, Canada

(Hubbard & Garbary, 2002), being misidentified ssp. tomentosoides.

Likewise, the three native samples from the Pacific coast of North

America shared a single haplotype. The southern hemisphere

haplotypes, on the other hand, exhibited a wider geographical

distribution: one New Zealand haplotype was found in the

Falkland Islands, South Atlantic (sample NHM45, identified

morphologically by Paul Silva as ssp. novae-zelandiae) while the

other was associated with a South African sample (NHM57).

Similarly, one of the South African haplotypes was found in a

sample from Cape Horn, South America, which had not been

assigned to a particular subspecies. The Tasmania haplotype was

also recovered from an unassigned sample from the Falkland

Islands (NHM 62). This distribution is consistent with the

circulation patterns associated with the Antarctic Circumpolar

Current, which connects the three major ocean basins (Atlantic,

Pacific, and Indian) of the southern hemisphere (Stramma &

England, 1999), and reflects patterns observed in both invertebrates

(Zinsmeister & Feldman, 1984) and other seaweeds (Hommersand,

1986).

The results from both this study and a previous study into the

invasive history of ssp. tomentosoides (Provan et al., 2005) suggest

that ssp. tomentosoides is the only invasive form among the

recognized subspecies of C. fragile and shows very little genetic

variation. This invasive strain has previously been referred to as

C. fragile ssp. tomentosoides, and includes the type of this subspecies.

The correct nomenclature, however, following the International

Code for Botanical Nomenclature (Greuter et al., 2000) is

Codium fragile ssp. fragile. To avoid confusion and because the

name ssp. tomentosoides has been widely used, we here refer to

this is the invasive tomentosoides strain of C. fragile. Trowbridge

(1998) listed subspecies atlanticum and scandinavicum as invasive

taxa but, to date, all samples analysed from Scandinavia were

identified as the tomentosoides strain and we found no evidence of

ssp. atlanticum anywhere other than in the north-east Atlantic

(but see below concerning sample NHM60). Silva (1955) originally

suggested that ssp. atlanticum was an alien in Europe but later

considered that it might be of northern European origin (Silva,

1957); although Trowbridge applied the criteria for identifying

invasive species outlined by Chapman & Carlton (1991),

Boudouresque (1994) and Ribera & Boudouresque (1995), ssp.

atlanticum met them only partially (Trowbridge, 1998). The

main criterion applied was conspicuousness but Cotton (1912)

has highlighted that although it seemed unlikely that ssp. atlanticum

had been overlooked in the British Isles, it had been at least since

1839 due to its morphological similarity to C. tomentosum.

The results reported here suggest that ssp. scandinavicum is a

phenotype of the invasive tomentosoides strain. The invasive

tomentosoides strain, on the other hand, has become almost

ubiquitous in its distribution and is found sympatrically with

most native haplotypes/subspecies. Indeed, most groups of

samples attributed to each subspecies contained mistakenly

identified cryptic accessions of tomentosoides. The ssp. atlanticum

haplotype identified in a South African sample (NHM60) differs

from one of the South African haplotypes by a single substitution

and is most likely an example of homoplasy (although the

possibility of a technical or cataloguing artefact is acknowledged),

rather than reflecting any invasive tendencies.

A major consequence of such difficulties in identifying cryptic

taxa is that the initial colonization events by invasive species

frequently go unnoticed. The analysis of herbarium samples of

Codium fragile has confirmed that the spread of the invasive

strain of C. fragile largely pre-dates records of its first appearance

throughout the globe. According to Silva (1955), the earliest

record of ssp. tomentosoides in the British Isles was from the

River Yealm estuary at Steer Point, South Devon, in 1939. A

dichotomously branching sample from the Ulster Museum

herbarium (UMF79) collected from County Donegal in 1845

and identified as ssp. atlanticum, however, was actually found to

be tomentosoides, suggesting that the invasive strain had reached

Britain at least 90 years before it was first recorded. Likewise, a

sample from Ronaldsay, Scotland, dating from 1891 collected by

Traill and identified by Silva as ssp. atlanticum was also in reality

tomentosoides. The majority (16 of 21) of herbarium samples

identified as ssp. atlanticum were actually revealed to be tomen-

tosoides, including three from Ireland which pre-date its first

recorded appearance in 1941 (Silva, 1955; Parkes, 1975). This

discrepancy can be attributed to the wide morphological

variation in the invasive strain (Fig. 1). Records of the occurrence

of ssp. atlanticum in Ireland date from the start of the 19th

century, long before the first records of ssp. tomentosoides, and

this, coupled with reports of competitive exclusion of ssp.

atlanticum by ssp. tomentosoides, would appear to be consistent

with the native status of ssp. atlanticum (Cotton, 1912; Parkes, 1975).

Although sample numbers for herbarium material from both

South Africa and Australasia were smaller than in ssp. atlanticum,

cryptic accessions of tomentosoides were also found. Samples

were found from both areas that pre-dated the original reports of

the appearance of ssp. tomentosoides in that region. One sample

(NHM46) from New Zealand, collected in 1935 and identified as

ssp. novae-zelandiae, and another (NHM43) from South Africa,

collected in 1937 and identified as ssp. capense, both represented

samples of the invasive strain despite being collected 40 and

62 years before its first record in Australasia and South Africa,

respectively.

The present study has highlighted the value of herbarium

samples for shedding new light on the past invasive history of

introduced algal species. Herbarium specimens are rarely collected

on the rigorous basis required for the experimental design generally

associated with population genetic studies, however. Instead,

herbarium collections tend to comprise groups of samples

J. Provan et al.


representing specific periods of time (usually the active collecting

lifetime of the individual responsible) and specific regions. There

are, however, notable exceptions to this: a study into the invasive

history of the weed Phragmites australis utilized 62 herbarium

samples covering the majority of the USA and was able to track

the spread of introduced haplotypes before and after 1910

(Saltonstall, 2002). In a taxonomic sense, though, the ability to

identify putative cryptic species and/or subspecies will prove

extremely informative in many cases, particularly in clarifying

the early events of bioinvasions as demonstrated in a study using

museum samples of the mussel genus Mytilus that clarified

cryptic species diversity in 100-year-old samples (Geller, 1999).

Such recent advances in the molecular genetic analysis of

museum and herbarium specimens mean that they now represent

a real and still largely untapped resource for reconstructing the

evolutionary and biogeographical history of a variety of extant,

as well as extinct, taxa.

ACKNOWLEDGEMENTS

The authors would like to thank the curators of the herbaria at

the Natural History Museum, London, the Amsterdam Herbarium

and the Ulster Museum and David Garbary, St Francis Xavier

University, for allowing us access to samples. We are particularly

grateful to Paul Silva for providing type material from the

University of California at Berkeley herbarium and for helpful

discussions on nomenclature of Codium fragile. Freshly collected

samples were kindly provided by Cynthia Trowbridge, Wendy

Nelson, Emily McQualter, Svenja Bruns, Rob Anderson, and

Rafael Riosmena-Rodriguez. We warmly thank Dave McCall,

Aquatic Sciences, Department of Agriculture and Rural Develop-

ment, Northern Ireland, for providing the SEM images. This

research was funded by the Esmée Fairbairn Foundation and

under the EU Framework V project ALIENS.

REFERENCES

Andreakis, N., Procaccini, G., Maggs, C.A. & Kooistra, W.H.C.F.

(2007) Phylogeography of the invasive seaweed Asparagopsis

(Bonnemaisoniales, Rhodophyta) reveals cryptic diversity.

Molecular Ecology, 16, 2285–2300.

Audzijonyte, A., Daneliya, M.E. & Vainola, R. (2006) Comparative

phylogeography of Ponto-Caspian mysid crustaceans: isolation

and exchange among dynamic inland sea basins. Molecular

Ecology, 15, 2969–2984.

Bax, N., Carlton, J.T., Mathews-Amos, A., Haedrich, R.L.,

Howarth, F.G., Purcell, J.E., Rieser, A. & Gray, A. (2001) The

control of biological invasions in the world’s oceans. Conserva-

tion Biology, 15, 1234–1246.

Begin, C. & Scheibling, R.E. (2003) Growth and survival of the

invasive green alga Codium fragile subsp. tomentosoides in tide

pools on a rocky shore in Nova Scotia. Botanica Marina, 46,

404–412.

Berger, S., Fettweiss, U., Gleissberg, S., Liddle, L.B., Richter, U.,

Sawitzky, H. & Zuccarello, G.C. (2003) 18S rDNA phylogeny

and evolution of cap development in Polyphysaceae (formerly

Acetabulariaceae; Dasycladales, Chlorophyta). Phycologia, 42,

506–561.

Booth, D., Provan, J. & Maggs, C.A. (2007) Molecular approaches

to the study of invasive seaweeds. Botanica Marina, in press.

Bouck, G.B. & Morgan, E. (1957) The occurrence of Codium in

Long Island waters. Journal of the Torrey Botanical Society, 84,

384–387.

Boudouresque, C.F. (1994) Les espèces introduites dans les eaux

côtières d’Europe et de Méditerranée: etat de la question et

consequences. Introduced species in European coastal waters

(ed. by C.F. Boudouresque), pp. 8–27. European Commission,

Luxembourg.

Bucciarelli, G., Golani, D. & Bernardi, G. (2002) Genetic cryptic

species as biological invaders: the case of a Lessepsian fish

migrant, the hardyhead silverside Atherinomorus lacunosus.

Journal of Experimental Marine Biology and Ecology, 273,

143–149.

Burrows, E. (1991) Seaweeds of the British Isles, Vol. 2 Chlorophyta.

Natural History Museum, London.

Carlton, J.T. (1999) The scale and ecological consequences of

biological invasions in the World’s oceans. Invasive species

and biodiversity management (ed. by O.T. Sandlund, P.J. Schei

and A. Viken), pp. 195–212. Kluwer Academic Publishers,

the Netherlands.

Chapman, J.W. & Carlton, J.T. (1991) A test of criteria for intro-

duced species: the global invasion by the isopod Synidotea

laevidorsalis (Miers, 1881). Journal of Crustacean Biology, 11,

386–400.

Coradin, L. & Giannasi, D.L. (1980) The effect of chemical pres-

ervations on plant collections to be used in chemotaxonomic

studies. Taxon, 29, 33–40.

Cotton, A.D. (1912) Clare island survey: marine algae part 15.

Proceedings of the Royal Irish Academy B, 31, 1–178.

Dawson, M.N., Gupta, A.S. & England, M.H. (2005) Coupled

biophysical global ocean model and molecular genetic analyses

identify multiple introductions of cryptogenic species.

Proceedings of the National Academy of Sciences USA, 102,

11968–11973.

De Castro, O. & Menale, B. (2004) PCR amplification of Michele

Tenore’s historical specimens and facility to utilize an alternative

approach to resolve taxonomic problems. Taxon, 53, 147–

151.

Dromgoole, F.I. (1975) Occurrence of Codium fragile subspecies

tomentosoides in New Zealand waters. New Zealand Journal of

Marine and Freshwater Research, 9, 257–264.

Farr, T.J., Nelson, W.A. & Broom, J.E.S. (2003) A challenge to the

taxonomy of Porphyra. Australia: the New Zealand red alga

Porphyra rakiura (Bangiales, Rhodophyta) occurs in southern

Australia, and is distinct from P. lucasii. Australian Systematic

Botany, 16, 569–575.

Gabrielsen, T.M., Brochmann, C. & Rueness, J. (2003) Phylogeny

and interfertility of North Atlantic populations of ‘Ceramium

strictum’ (Ceramiales, Rhodophyta): how many species?

European Journal of Phycology, 38, 1–13.

Geller, J.B. (1999) Decline of a native mussel masked by sibling

species invasion. Conservation Biology, 13, 661–664.



Geller, J.B., Walton, E.D., Grosholz, E.D. & Ruiz, G.M. (1997)

Cryptic invasions of the crab Carcinus detected by molecular

phylogeography. Molecular Ecology, 6, 901–906.

Goff, L.J., Liddle, L., Silva, P.C., Voytek, M. & Coleman, A. (1992)

Tracing species invasion in Codium, a siphonous green alga,

using molecular tools. American Journal of Botany, 79,

1279–1285.

González, A. & Santelices, B. (2004) A dichotomous species

of Codium (Bryopsidales, Chlorophyta) is colonizing

northern Chile. Revista de Chilena de Historia Natural, 77,

293–304.

Greuter, W., McNeill, J., Barrie, F.R. et al. (2000) International

code of botanical nomenclature (Saint Louis Code). Regnum

Vegetabile, 138, 1–474.

Gugerli, F., Parducci, L. & Petit, R.J. (2005) Ancient plant DNA:

review and prospects. New Phytologist, 166, 409–418.

Gurevitch, J. & Padilla, D.K. (2004) Are invasive species a

major cause of extinctions? Trends in Ecology & Evolution, 19,

470–474.

Holland, B.S., Dawson, M.N., Crow, G.L. & Hofmann, D.K.

(2004) Global phylogeography of Cassiopea (Scyphozoa:

Rhizostomeae): molecular evidence for cryptic species and

multiple invasions of the Hawaiian Islands. Marine Biology,

145, 1119–1128.

Hommersand, M.H. (1986) The biogeography of the South

African marine red algae. Botanica Marina, 29, 257–270.

Hubbard, C.G. & Garbary, D.J. (2002) Morphological variation

of Codium fragile (Chlorophyta) in eastern Canada. Botanica

Marina, 45, 476–485.

Hughey, J.R., Silva, P.C. & Hommersand, M.H. (2001) Solving

taxonomic and nomenclatural problems in Pacific Gigartinaceae

(Rhodophyta) using DNA from type material. Journal of

Phycology, 37, 1091–1109.

Hughey, J.R., Silva, P.C. & Hommersand, M.H. (2002) ITS1

sequences of type specimens of Gigartina and Sarcothalia

and their significance for the classification of South African

Gigartinaceae (Gigartinales, Rhodophyta). European Journal of

Phycology, 37, 209–216.

Inderbitzin, P., Lim, S.R., Volkmann-Kohlmeyer, B., Kohlmeyer,

J. & Berbee, M.L. (2004) The phylogenetic position of

Spathulospora based on DNA sequences from dried herbarium

material. Mycological Research, 108, 737–748.

Jousson, O., Pawlowski, J., Zaninetti, L., Zechman, F.W., Dini, F.,

Di Guiseppe, G., Woodfield, R., Millar, A. & Meinesz, A.

(2000) Invasive alga reaches California – The alga has been

identified that threatens to smother Californian coastal

ecosystems. Nature, 408, 157–158.

Leonard, J.A., Vila, C. & Wayne, R.K. (2005) Legacy lost: genetic

variability and population size of extirpated US grey wolves

(Canis lupus). Molecular Ecology, 14, 9–18.

Martel, C., Viard, F., Bourguet, D. & Garcia-Meunier, P. (2004)

Invasion by the marine gastropod Ocinebrellus inornatus.

France I. Scenario for the source of introduction. Journal of

Experimental Marine Biology and Ecology, 305, 155–170.

Maunder, M., Culham, A., Bordeu, A., Allainguillaume, J. &

Wilkinson, M. (1999) Genetic diversity and pedigree for

Sophora toromiro (Leguminosae): a tree extinct in the wild.

Molecular Ecology, 8, 725–738.

McIvor, L., Maggs, C.A., Provan, J. & Stanhope, M.J. (2001) rbcL

sequences reveal multiple cryptic introductions of the Japanese

red alga Polysiphonia harveyi. Molecular Ecology, 10, 911–919.

Nyberg, C.D. & Wallentinus, I. (2005) Can species traits be used

to predict marine macroalgal introductions? Biological Invasions,

7, 265–279.

Pääbo, S. (1989) Ancient DNA: extraction, characterization,

molecular cloning and enzymatic amplification. Proceedings of

the National Academy of Sciences USA, 86, 1939–1943.

Parkes, H.M. (1975) Records of Codium species in Ireland. Pro-

ceedings of the Royal Irish Academy B, 75, 125–134.

Provan, J., Murphy, S. & Maggs, C.A. (2004) Universal plastid

primers for Chlorophyta and Rhodophyta. European Journal of

Phycology, 39, 43–50.

Provan, J. & Murphy, S. & Maggs, C.A. (2005) Tracking the inva-

sive history of the green alga Codium fragile subsp. tomen-

tosoides. Molecular Ecology, 14, 189–194.

Ribera, M.A. & Boudouresque, C.F. (1995) Introduced marine

plants, with special reference to macroalgae: mechanisms and

impact. Progress in Phycology Research, 11, 187–286.

Roy, M.S. & Sponer, R. (2002) Evidence of a human-mediated

invasion of the tropical western Atlantic by the ‘world’s most

common brittlestar’. Proceedings of the Royal Society of London

Series B, Biological Sciences, 269, 1017–1023.

Saltonstall, K. (2002) Cryptic invasion by a non-native genotype

of the common reed Phragmites australis into North

America. Proceedings of the National Academy of Sciences USA,

99, 2445–2449.

Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M.D.,

Crévecouer, M. & Manen, J.F. (1995) The use of herbarium

specimens in DNA phylogenetics: evaluation and improvement.

Plant Systematics and Evolution, 197, 87–98.

Schmidt, A.L. & Scheibling, R.E. (2007) Effects of native and

invasive macroalgal canopies on composition and abundance

of mobile benthic macrofauna and turf-forming algae.

Journal of Experimental Marine Biology and Ecology, 341,

110–130.

Shiganova, T.A., Mirzoyan, Z.A., Studenikina, E.A., Volovik, S.P.,

Siokou-Frangou, I., Zervoudaki, S., Christou, E.D., Skirta, A.Y.

& Dumont, H.J. (2001) Population development of the

invader ctenophore Mnemiopsis leidyi in the Black Sea and in

other seas of the Mediterranean basin. Marine Biology, 139,

431–445.

Silva, P.C. (1955) The dichotomous species of Codium in Britain.

Journal of the Marine Biology Association UK, 34, 565–577.

Silva, P.C. (1957) Codium in Scandinavian waters. Svensk Botanisk

Tidskrift, 51, 117–134.

Skage, M., Gabrielsen, T.M. & Rueness, J. (2005) A molecular

approach to investigate the phylogenetic basis of three widely

used species groups in the red algal genus Ceramium (Ceramiales,

Rhodophyta). Phycologia, 44, 353–360.

Soltis, P.S., Soltis, D.E. & Smiley, C.J. (1992) An rbcL sequence

from a Miocene Taxodium (bald cypress). Proceedings of the

National Academy of Sciences USA, 89, 449–451.

J. Provan et al.


Stramma, L. & England, M. (1999) On the water masses and

mean circulation of the South Atlantic Ocean. Journal of

Geophysical Research, 104, 20863–20883.

Swofford, D.L. (2002) P*: phylogenetic analysis using

parsimony (* and other methods), Version 4. Sinauer Associ-

ates, Sunderland, MA.

Trowbridge, C.D. (1996) Introduced versus native subspecies of

Codium fragile: how distinctive is the invasive subspecies

tomentosoides? Marine Biology, 126, 193–204.

Trowbridge, C.D. (1998) Ecology of the green macroalga Codium

fragile (Suringar) Hariot: invasive and non-invasive subspecies.

Oceanography and Marine Biology, 36, 1–64.

Trowbridge, C.D. (2001) Coexistence of introduced and native

congeneric algae: Codium fragile and C. tomentosum on Irish

rocky shores. Journal of the Marine Biology Association UK, 81,

931–937.

Turon, X., Tarjuelo, I., Duran, S. & Pascual, M. (2003) Character-

ising invasion processes with genetic data: an Atlantic clade of

Clavelina lepadiformis (Ascidiacea) introduced into Mediterra-

nean harbours. Hydrobiologia, 503, 29–35.

Uwai, S.Y., Nelson, W., Neill, K., Wang, W.D., Aguilar-Rosas,

L.E., Boo, S.M., Kitayama, T. & Kawa, H. (2006) Genetic diver-

sity in Undaria pinnatifida (Laminariales, Phaeophyceae)

deduced from mitochondria genes origins and succession of

introduced populations. Phycologia, 45, 687–695.

Verbruggen, H., Leliaert, F., Maggs, C.A., Shimada, S., Schils, T.,

Provan, J., Booth, D., Murphy, S., de Clerck, O., Coppejeans,

E., Littler, D.S. & Littler, M.M. (2007) Species boundaries and

phylogenetic relationships within the green algal genus

Codium (Bryopsidales) based on plastid DNA sequences.

Molecular Phylogenetics and Evolution, 44, 240–254.

Voisin, M., Engel, C.R. & Viard, F. (2005) Differential shuf-

fling of native genetic diversity across introduced regions

in a brown alga: aquaculture vs. maritime traffic effects.

Proceedings of the National Academy of Sciences USA, 102,

5432–5437.

Wilcove, D.S., Rothstein, D., Dubow, J., Phillips, A. & Losos, E.

(1998) Quantifying threats to imperilled species in the United

States. Bioscience, 48, 607–615.

Zinsmeister, W.J. & Feldmann, R.M. (1984) Cenozoic high-

latitude heterochroneity of Southern Hemisphere marine

faunas. Science, 224, 281–283.

diversity and distributions, (diversity distrib.) tracking...

Documents