Hum Genet (1993) 92:477-480 human .. genet, cs

�9 Springer-Verlag 1993

Diverse polymorphism within a short coding region of the human aldehyde dehydrogenase-5 (ALDH5) gene

David Sherman 1, Vibha Dav~ 2, Lily C. Hsu 2, Timothy J.Peters l, Akira Yoshida 2

1 Department of Clinical Biochemistry, King's College School of Medicine and Dentistry, London, UK 2 Department of Biochemical Genetics, Beckman Research Institute of the City of Hope, Duarte, CA 91010, USA

Received: 1 December 1992 / Revised: 30 March 1993

Abstract. H u m a n a ldehyde dehydrogenase -5 gene (origi- nal ly named as ALDHX) is expressed in l iver and testis. The ALDH5 does not contain introns in the coding se- quence for 517 amino acid residues. With in a short nu- c leot ide region of the gene, the fo l lowing three nucleot ide changes were found in high frequencies , i.e., a si lent C<-->T at nucleot ide (nt) 183, C<---~T at nt 257 assoc ia ted with a Val<---~Ala substi tut ion, and T<--->G at nt 320 associ- ated with a Arg<--+Leu substi tut ion. The f requency o f C at nt 183 is 81% in Caucas ians and 65% in Japanese, and the di f ference is s tat is t ical ly not significant . The f requency o f C at nt 257 is 76% in Caucas ians and 55% in Japanese, and the difference is s tat is t ical ly s ignif icant (P = 0.02). The f requency o f T at nt 320 is 71% in Caucas ians , whi le it is only 27% in Japanese. The rac ia l d i f ference at nt 320 is h ighly s ignif icant (P < 0.001). N o s ignif icant d i f ference was found in the genotypes o f the three nuc leo t ide posi- t ions be tween a lcohol ic and nona lcohol ic Caucas ians within the l imi ted numbers o f subjects examined .

Introduction

Among the four human a ldehyde dehydrogenase (alde- hyde: N A D + oxidoreductase, EC 1.2.1.3; abbreviat ion A L D H ) genes thus far characterized, the ALDH5 (origi- nal ly named as ALDHX) has a unique genomic organiza- tion, i.e., the gene does not contain introns in the coding se- quence for 517 amino acid residues (Hsu and Chang 1991).

Dur ing the course of c loning and charac ter iza t ion of the c D N A and the gene, Hsu and Chang (1991) found three nucleot ide changes: a si lent C<--->T at nt 183 (counting f rom adenine o f the ini t ia t ion codon), C<-->T at nt 257 as- socia ted with a Val~--~Ala substi tution, and T<-->G at nt 320 associa ted with a Arg<-->Leu substi tut ion, within a short nucleot ide region in e ight genomic and one c D N A clones f rom eight unre la ted indiv iduals examined by the nu- c leot ide sequencing (Fig. 1).

Correspondence to: A. Yoshida

We examined gene f requencies and l inkage o f the three muta t ions in Caucas ians and Orientals .

Materials and methods

Genomic DNA

Genomic DNAs were prepared from leucocytes of peripheral blood samples taken from unrelated volunteer donors. About 60% (20 of 34) of Caucasians (British) were patients with alcoholic liver diseases and the rest were nonalcoholics. All Japanese donors were nonalcoholics. DNA samples were prepared by the method of Blin and Stafford (1976).

Identification o f nucleotide changes

To distinguish T or C at nt 183, DNA samples were amplified by polymerase chain reaction (PCR; Saiki et al. 1988) using a pair of primers a, which was 5" CCTACAACCAGCTGTTCATC 3", and b, which was 5"AAGGTCTCGAGTGAGGCCAA 3". The 271-bp product thus produced was digested by NciI. The PCR product with C at nt 183 should produce 81-bp and 32-bp fragments, while the product with C at nt 183 should produce a 113-bp fragment, in addition to a common 123-bp fragment (Fig. 1).

For identification of the nucleotide at nt 257, DNA samples were amplified using primers a and c, which was 5" CCATGG- GGACCCCAGGCGAAa 3". In order to create a HindIII cleavage site in the PCR product with C, but not with T, at nt 257, a mis- matched nucleotide (shown in lower case) was added to primer c. The PCR product, 175 bp, was digested by HindIII for distin- guishing C or T at nt 257 (Fig. 1).

For determination of nucleotide at nt 320, DNA samples were amplified using a pair of primers d, which was 5" CGGGAAGT- CTTCCGCCTGGG 3" and e, which was TCGATCCCGCTCCA- CTAGGc 3". To create a BglI cleavage site in the PCR product with G, but not T, at nt 320, a mismatched nucleotide (shown in lower case) was included in primer e. The product, 100 bp, was di- gested by BglI to distinguish G or T at nt 320 (Fig. 1).

PCR was performed in a programmable thermal controller using 40 cycles for 45 s at 94~ 60 s at 55~ and 30 s at 72~ and a fi- nal extension at 72~ for I0 min. The PCR products were ana- lyzed by agarose gel (2.5%-4%) electrophoresis, before and after digestion by the restriction enzymes. The nucleotide fragments were visualized by staining with ethidium bromide.

478

1

76

151

Met Leu Arg Phe Leu A1a Pro Arg Leu Leu Set Leu Gin Gly Arg Thr Ala Arg Tyr Set Set Ala A1a Ala Leu ATG CTG CGC TTC CTG GCA CCC CGG CTG CTT AGC CTC CAG GGC AGG ACC GCC CGC TAC TCC TCG GCA GCA GCC CTC

Pro Set Pro Ile Leu Asn Pro CCA AGC CCC ATT CTG AAC CCA

Lys Lys Thr Phe Pro Thr Val AAG AAG ACC TTC CCG ACG GTC

75

Asp Ile Pro Tyr ASh Gin Leu Phe Ile Ash Ash Glu Trp Gin Asp Ala Val Set GAC ATC CCC TAC AAC CAG CTG TTC ATC AAC AAT GAA TGG CAA GAT GCA GTC AGC 150

a ( T h r )

Asn Pro Thr Thr Gly Glu Val Ile Gly His Val Ala Glu Gly Asp Arg Ala Asp AAC CCT ACC ACC GGG GAG GTC ATC GGG CAC GTG GCT GAA GGT GAC CGG GCT GAT 225

(T)

(Val) Val Asp Arg Ala Val Lys Ala Ala Arg Glu Ala Phe Arg Leu Gly Set Pro Trp Arg Arg Met Asp Ala Ser Glu

226 GTG GAT CGG GCC GTG AAA GCA GCC CGG G~A GCC TTC CGC CTG GGG TCC CCA TGG CGG CGG ATG GAT GCC TCT GAG 300 (T)( C

(~g) d > Arg GIy Arg Leu Leu Asn Leu Leu Ala Asp Leu Val GIU Arg Asp Arg Val Tyr Leu Ala Set Leu Glu Thr Leu

301 CGG GGC CGG CTG CTG AAC CTC CTG GCA GAC CTA GTG GAG CGG GAT CGA GTC TAC TTG GCC TCA CTC GAG ACC TTG 375 (G) <

e b

Fig. 1. Nucleotide and deduced amino acid sequences of 5'-coding region of the human ALDHS. Nucleotide changes and amino acid substitutions are indicated in parentheses. Nucleotide regions used as primers a-e in PCR are underlined and the extension directions are indicated by an arrowhead. Ncil cleavage sites existing in the PCR product are double underlined. Nucleotide numbers, counting from adenine of the chain initiation codon, are shown at the right and left sides of the sequence

Results

As expected f rom the reported nucleotide sequence of A L D H S , a 271-bp nucleotide was produced by amplifica- tion using primers a and b. The product contains two N c i I cleavage sites and can produce l l3-bp and 123-bp frag- ments (Fig. 1). In the case o f C at nt 183, a l l 3 -bp frag- ment can be cleaved by N c i I producing 81-bp and 32-bp fragments, but the latter is not visualized on the gel (Fig. 2). The analysis o f N c i I digests o f PCR products revealed the existence o f two types o f alleles in homozygous and heterozygous status.

Amplif icat ion o f D N A samples using primers a and c produced a 175-bp fragment. Examination o f H i n d I I I di- gests o f the products demonstrated the existence o f two c o m m o n types o f alleles with C (151-bp fragment) or T (175-bp fragment) at nt 257 (Fig. 3).

Primers d and e produced an expected 100-bp fragment. The two additional products, about 250 bp and about 170 bp, would be nonspecific PCR products unrelated to the targeted region, or could be produced from other A L D H genes, which are homologous to the A L D H 5 gene (Yoshida et al. 1991). In the case o f a G at nt 320, the 100- bp fragment can be cleaved by Bgl I , producing a 75-bp fragment. The existence o f two common alleles with G or T at nt 320 was demonstrated by the agarose gel elec- trophoresis (Fig. 4).

The genotypes o f the A L D H 5 locus of Caucasians and Japanese individuals are summarized in Table 1. The three nucleotide sites, i.e., nt 183, nt 257, and nt 320, of the gene are dimorphic in both populations.

Observed numbers o f each genotypes o f the three nu- cleotide positions, and the calculated frequencies of each of the alleles are shown in Table 2.

Fig.3. Nucleotide base change at nt 257. The PCR products, pro- duced using primers a and c, were digested by HindIII. The products were separated by agarose gel (3%) electrophoresis. Lanes A, B, C and D undigested products containing 175-bp fragment; lanes A', B', C', and D' digested products. Lane A "heterozygous C/T; lane B "ho- mozygous T/T lane C' homozygous T/F; lane D" homozygous C/C

Fig.2. Nucleotide base change at nt 183. The PCR products, pro- duced using primers a and b, were digested by NciI. The products were separated by agarose gel (4%) electrophoresis, and stained with ethidium bromide. Lane A undigested product (271 bp); lanes B - G digested products containing 113-bp and/or 81-bp fragments; lane B homozygous T/F; lane C homozygous C/C; lane D ho- mozygous C/C; lane E heterozygous C/T; lane F homozygous C/C, lane G heterozygous C/T

Fig.4. Nucleotide base change at nt 320. The PCR products, pro- duced using primers d and e, were digested with Bgll. The prod- ucts were separated by agarose gel (2.5%) electrophoresis. Lanes A, B and C undigested products containing 100-bp fragment; lanes A', B'and C' digested products. Lane A" heterozygous T/G lane B" homozygous T/T lane C' homozygous G/G

Table 1. Genotypes of human A L D H 5 locus of British and Japan- ese individuals

Nucleotide position

nt 183 nt 257 nt 320

Caucasian a

1 C/C C/C T/T

2 C/C C/C T/T

3 C/C C/C G/T

4 C/C CFF T/T

5 T/T C/T GIG

9 C/C C/C G/T

10 C/C C/T T/T

11 C/C C/C G / T

13 C/T C/T G / G

14 T/T C/T T/T

15 C/C T/T G/T

16 C/T C/T G/T

17 C/C C/T T/T

18 C/T C/C T/T

19 C/C C/T G/T

21 C/T - -

22 C/C C/C G/T

23 C/T C/T G/T

24 C/C C/C T/T

25 C/T C/C G/T

26 C/C C/C T/T

27 C/C C/C -

28 C/C C/C T/T

29 C/C C/C G/T 30 _b C/C T/T

32 C/C C/C G/T

33 C/C C/T G/T

34 C/T C/C G/T

35 C/C - T/T

36 C/C T/T T/T

37 - - T/T

38 CFF C/T G/T

39 C/C C/C T/T

40 C/C C/C -

" Caucasian samples 1-25 were from alcoholics, and samples 26-40 from nonalcoholics; all Japanese samples were from non- alcoholics

b Dashes indicate that genotypes were not identified

T h e g e n o t y p e s and g e n e f r e q u e n c i e s o f the th ree nu- c l e o t i d e pos i t ions s h o w n in Tab le 2 are c o m p a t i b l e w i t h the H a r d y - W e i n b e r g e x p e c t a t i o n in b o t h popu la t ions .

T h e d i f f e r ence o f T and C f r e q u e n c i e s at nt 183 be- t w e e n C a u c a s i a n s and J a p a n e s e is no t s ta t i s t ica l ly s ignif i - can t in the s a m p l e s ize e x a m i n e d (P = 0 .066) .

T h e f r e q u e n c i e s o f T and C at nt 257 are s ign i f i can t ly d i f fe ren t (P = 0 .02) b e t w e e n the t w o p o p u l a t i o n g roups . T h e f r e q u e n c y o f G at nt 320 is h i g h e r than that o f T in J apanese , w h i l e the ra t io is r e v e r s e d in Caucas i ans , and the rac ia l d i f f e r ence is h i g h l y s ign i f i can t (P < 0 .001) .

Table 1 (continued)

479

Nucleotide position

nt 183 nt 257 nt 320

Japanese

1 C/T T/T G/G

2 C/C C/C T/T 3 _b _ G/G

4 T/T T/T G/G

5 - - G/G

6 - - GFI"

7 C/T C/T G/G

8 C/T C/T G/T

9 C/T C/T G/G

10 - - G/G

11 C/C C/T -

12 C/C C/C -

13 C/T C/T -

14 C/C C/C G/G

15 C/T C/T G/T

16 T/T T/T GIG

17 T /T T/T G / G

18 C /C C/C G / G

19 C/C C/T G/T

20 C/C C/T G/G

21 C/T C/T G/T

22 C/T C/T -

23 C/C C/C -

24 - - G/G

25 C/C C/C -

26 - - G/T

27 - - G/T

28 - - G/T

29 - - G/T

30 - - T/T

b Dashes indicate that genotypes were not identified

A s t rong l inkage was o b s e r v e d b e t w e e n T (or C) at nt 183 and T (or C) at nt 257 in Japanese (pos i t ive cor re la t ion +0.84; P = 0.0001). The cor re la t ion is on ly m o d e r a t e (+0.17) and stat is t ical ly not s ign i f ican t (P = 0.35) in Cau- casians. A m o d e r a t e l i nkage was o b s e r v e d b e t w e e n T at nt 183 and G at nt 320 in Caucas ians (+0.38) and Or ien ta l s (+0.34). This impl ies that the T(183) -T(257) /C(183) -C(257) pair is m o r e c o m m o n than the T (183 ) -C(257 ) /C(183 ) - T(257) pair, and that the T ( 1 8 3 ) - G 3 2 0 ) / C ( 1 8 3 ) - T ( 3 2 0 ) pa i r is m o r e c o m m o n than the T ( 1 8 3 ) - T ( 3 2 0 ) / C ( 1 8 3 ) - G ( 3 2 0 ) pair in g i v e n he t e rozygo t e indiv iduals . P rev ious nuc l eo t ide s equence ana lyses o f severa l c lones are compa t ib l e w i th these f indings (Hsu and C h a n g 1991).

D i s c u s s i o n

T h e A L D H 5 g e n e is a s s igned to c h r o m o s o m e 9 and ex- p r e s sed in l i ve r and test is (Hsu and C h a n g 1991). E n z y -

480

Table 2. Genotypes and gene frequencies of the human ALDH5 locus Nucleotide changes

and amino acid substitution

Genotypes Gene frequencies

Caucasians

C<--+T at nt 183 C/C C/T T/T C T Thr+-~Thr at 44 22 8 2 0.81 0.19 (32 subjects) (21.0) (9.8) (1.2)

C~---~T at nt 257 C/C C/T T/I" C T Alae-~Val at 69 18 11 2 0.76 0.24 (31 subjects) (17.9) (l 1.3) (1.8)

G+-~T at nt 320 G/G G/T T/T G T Arg~-~Leu at 90 2 14 15 0.29 0.71 (31 subjects) (2.6) (12.8) (15.6)

Japanese

C~--~T at nt 183 C/C C/T T/T C T Thr~-+Thr at 44 9 8 3 0.65 0.35 (20 subjects) (8.5) (9.1) (2.5)

C~-rT at nt 257 C/C C/T T/T C T Ala~Val at 69 6 10 4 0.55 0,45 (20 subjects) (6.05) (9.9) (4.05)

G+--~T at nt 320 G/G G/T T/T G T Arg~--~Leu at 90 2 9 13 0.73 0.27 (24 subjects) (1.7) (9.5) (12.8)

a Figures in parentheses are calculated from the gene frequencies

matic proper t ies o f the enzyme encoded by the gene have not yet been examined in detai l , and the b io logica l role o f the enzyme is not clear. Our p re l iminary study indica ted that the A L D H 5 enzyme ox id ized aromat ic a ldehyde more ef fec t ive ly than short chain al iphat ic a ldehyde (L. C. Hsu and W.-C. Chang, unpubl i shed observat ion) . Thus, the A L D H 5 i s o z y m e may not p lay a role in ace ta ldehyde de toxi f ica t ion in vivo.

T at nt 320 is c o m m o n ( f requency 0.71) in Caucasians , whi le G at nt 320 is c o m m o n (f requency 0.73) in Japanese (Table 2). Ana lys i s o f o ther popula t ions is required to trace the evo lu t ionary or igin o f these two types.

Judging f rom the high frequencies of C at nt 183 and nt 257 in both popula t ions , the wi ld - type gene is p robab ly C180-C257 type, with T180-C257, CI80-T257, and T180-T257 evo lv ing later. It is not c lear whether G or T at nt 320 is the wi ld - type gene.

Three sets o f c o m m o n types, i.e., C or T at nt 183, C or T at nt 257, and G or T at nt 320, exist within a 200-bp re- g ion o f the A L D H 5 gene. By a combina t ion o f these vari- ations, 27 geno types can be d is t inguished within this re- str icted region. To our knowledge , such divergent poly- m o r p h i s m has not been found in the coding region of any funct ional genes.

The evolu t ionary origin o f this unusual po lym orph i sm is not clear. C<--~T at nt 257 and G~--~T at nt 320 generate amino acid subst i tut ions Ala~-+Val at pos i t ion 69 and

Arge--~Leu at posi t ion 90 o f the protein, and m a y induce a change in enzyme propert ies . Select ive pressure might have been involved in the deve lopment o f the po lymor - phism.

Abou t 60% of Caucas ian subjects examined are pa- tients with a lcohol ic l iver diseases, and the remain ing are nonalcohol ics . A stat is t ical ly s ignif icant difference is not found in the frequencies of genotypes in the three posi- tions between a lcohol ics and nonalcoholics .

Acknowledgements'. The authors are grateful to Dr. C. Ahn for sta- tistical analysis. This study was supported by U.S. Public Health Service Grant AA05763.

References

Blin H, Stafford DW (1976) A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res 3 : 2303-2308

Hsu LC, Chang W-C (1991) Cloning and characterization of a new functional human aldehyde dehydrogenase gene. J Biol Chem 266 : 12257-12265

Saiki RK, Gelfand DH, Stoffel S J, Higuchi R, Horn GT, Mullis KB, Erlich HA (1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491

Yoshida A, Hsu LC, Yasunami M (1991 ) Genetics of human alco- hol-metabolizing enzymes. Prog Nucleic Acid Res Mol Biol 40: 255-287