저 시-비 리- 경 지 2.0 한민

는 아래 조건 르는 경 에 한하여 게

l 저 물 복제, 포, 전송, 전시, 공연 송할 수 습니다.

다 과 같 조건 라야 합니다:

l 하는, 저 물 나 포 경 , 저 물에 적 된 허락조건 명확하게 나타내어야 합니다.

l 저 터 허가를 면 러한 조건들 적 되지 않습니다.

저 에 른 리는 내 에 하여 향 지 않습니다.

것 허락규약(Legal Code) 해하 쉽게 약한 것 니다.

Disclaimer

저 시. 하는 원저 를 시하여야 합니다.

비 리. 하는 저 물 리 목적 할 수 없습니다.

경 지. 하는 저 물 개 , 형 또는 가공할 수 없습니다.

내 RhD 헌 에 DEL

Rh-Hr

연 학 학원

학과

내 RhD 헌 에 DEL

Rh-Hr

지도 수 신

사 학 함

2015 12 월

연 학 학원

학과

사 학 함

심사 원 신

심사 원 락

심사 원 원

연 학 학원

2015 12 월

감사

본 하 지 끊 없는 심과 사랑

지도해주신 경하는 신 수님과 락 수님,

원 수님께 진심 감사드립니다. 그리고 쁘신

가운 도 아낌없는 언 격 해 주신 수님,

승태 수님, 신새암 생님께 감사 말씀 드립니다.

또한 연 에 할 수 도 많 시간 할애하고,

실험 도 주신 식 연 원과 진단검사 학과 액

행 트 생님들께 감사드립니다.

마지막 항상 원해주고 어 주는

님과 아내, 아들에게 사랑과 감사 드립니다.

씀

차

약 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 1

I. ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 3

II. 재료 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 6

1. 청학 검사 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 6

가. 착 시험 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 6

나. RhCcEe ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 6

2. RHD 검사 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 7

가. Multiplex PCR ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 7

나. MLPA ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 8

다. Exon 9 직 염 열 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 10

III. 결과 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 12

1. RhD 액 착 시험 Multiplex PCR ∙∙∙∙∙∙∙ 12

2. RhCeEe ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 13

3. MLPA ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 14

4. Exon 9 직 염 열 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 15

IV. 고찰 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 17

V. 결 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 21

참고 헌 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 22

약 ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 25

그림 차

Figure 1. PCR analysis of exon 4, exon 7, exon 10 and

promoter of RHD gene ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 12

Figure 2. Multiplex ligation-dependent probe amplifica

tion (MLPA) analysis results ∙∙∙∙∙∙∙∙∙∙∙∙ 15

Figure 3. PCR and sequencing analysis of exon 9 of the

RHD gene ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 16

차

Table 1. Primer sequences for deletion of RHD Genes

∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 8

Table 2. RHD- and RHCE- specific probes from the RH

MLPA test ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 9

Table 3. Results of adsorption elution test and PCR

in RhD negative samples ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 13

Table 4. Distribution of Rh Phenotypes in RhD negative

samples ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 13

Table 5. RHD alleles and the zygosity determination

using MLPA assay ∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙∙ 14

1

약

내 RhD 헌 에 DEL

Rh-Hr

RhD 항원 ABO 항원 다 역원 강한 항원 ,

생 anti-D 는 심각한 수 또는 태아신생아

질 킬 수 다. 약 D 극 량 D 항원 가지고

는 DEL 항원 과거에는 RhD 에게 수 어도 anti-

D 가 생 지 않는다고 알 나, 근 RhD 에게

DEL 액 가 수 후 anti-D 가 생 사 들

보고 고 다.

본 연 에 는 본원 공 는 RhD 에

DEL 빈도, DEL 립 하 해

착- 시험과 RHD exon 4, exon 7, exon 10,

promoter 에 한 multiplex polymerase chain reaction (PCR)

검사, Multiplex ligation-dependent probe amplification (MLPA)

RHD exon 9 직 염 열 시행하 다.

RhD 액 100 검체 multiplex PCR 과 MLPA 검사 결과

78 건 RHD 동 합체 결 보 고, 4 건 RHD-CE-D

2

하 브리드 , 18 건 합체 결 보 다.

합체 결 보 18 건 착 시험에 DEL

었고, MLPA 검사 RHD exon 9

직 염 열 한 결과 18 건 에 ‘Asian DEL

type’ RHD (K409K, 1227G>A) 변 가 었다. 또한, DEL

RhCcEe 한 결과 18 건 Ccee 가 14 건 (77.8%),

CcEe 가 4건 (22.2%) 18 건 C 항원 었다.

RhD 액 안 한 수 하여 RhD 액

공 는 액 RHD 검사 통해 순수한 D

액과 DEL 하는 새 운 수 검사 체계 도

필 하다.

핵심 는 말 : RhD , DEL , Multiplex PCR-SSP, RHD (K409K,

1227G>A), MLPA

3

내 RhD 헌 에 DEL

Rh-Hr

<지도 수 신 >

연 학 학원 학과

Ⅰ.

RhD 항원 간 염색체 1p36 에 치하는 RHD 산 RhD

항원 에 상 경우 RhD 양 , RHD

결 나 변 에 해 에 RhD 항원 지 않는 경우

RhD , RHD 변 에 해 RhD 항원 양 또는 질

감 가 어나는 경우 약 D , D 과 같 RhD 변

생한다.1 RhD 항원 ABO 항원 다 역원 강한 항원

RhD 양 액 수 RhD 약 50%에 anti-D 가

생 는 것 알 다.2 생 anti-D 는 심각한

수 또는 태아신생아 질 킬 수 므

4

가 여 포함한 RhD 는 상 에 RhD 액

하지 못하는 경우 하고는 가능한 D 항원에 어 는 안

다.3,4 한 경우 RhD 빈도는 0.15% 알 고, 그

약 75%는 RHD 결실 (deletion)에 해, 9-10%는 RHD

웃하여 치한 RHCE 하 브리드 (RHD-

CE-D hybrid)에 해, 13-16%는 RHD 단 염 다 RHD

(K409K, 1227G>A)에 해 생한다.5,6

약 D 극 량 D 항원 가지고 어 착 시험(adsorption

elution test) 통해 만 D 항원 재가 는 경우 DEL 라

하 과거에는 DEL 처럼 D 항원 수가 경우 DEL 가

RhD 에게 수 어도 anti-D 항체가 생 지 않는다고

알 지만, 근 내 에 RhD 에게 DEL

액 가 수 후 anti-D 가 생 사 들 보고 고 어 RhD

액 DEL 할 수 는 검사 체계 필

고 다.7,8 DEL 검사실에 보편 사 는 청학

검사 는 RhD 못 고 고, 착 시험 나 RHD

검사 등 가 검사 실시하여야 RhD 항원 검 할 수

다.

그간 여러 에 RHD (IVS3+1G>A), RHD (IVS5-38del4), RHD (M295I,

885G>T), RHD (K409K, 1227G>A), RHD (W408R, 1227T>C), RHD (X418L)

등 DEL 립 가 보고 었 , 동양 에 견 DEL

립 는 드 게 RHD (W408R, 1222T>C) 립 가 견 지만

5

경우 RHD exon 9 1227 째 염 G 가 A 치

RHD (K409K, 1227G>A) 립 가 동 는 것 보고 고 다.

5,7,9-12

본 연 에 는 내에 공 는 RhD 액 DEL 빈도,

DEL 립 통하여 RhD 헌 액

신 하고 한 검사체계 새 운 RhD 수 책 시하고

한다.

6

Ⅱ. 재료

한 십 사 액원, 한마 액원 앙 병원 액원

본원에 공 RhD 100 단 수

검사 후 남 액 하여 착 시험, RhCcEe 검사,

multiplex PCR (Polymerase Chain Reaction) 검사, MLPA (Multiplex

Ligation-dependent Probe Amplification) 검사 RHD exon

9 직 염 열 시행하 다.

1. 청학 검사

가. 착 시험(adsorption elution test)

RhD 100 단 액 상

상 착 시험 시행하 다. 동량 단클

anti-D 항체 시약(Bioscot; Millipore, Livingstone, UK) 합

후 37°C 에 60 간 시킨 후, 8 상 척하 다. Acid

elution 하여 만든 액 25 μl ID-DiaCell I-II

(BioRad, Cressier, Switzerland) 50 μl LISS/Coombs card

(BioRad, Cressier, Switzerland)에 주, 37°C 에 15 간

시킨 후 1030 rpm 10 간 원심 리하여 집

찰하 다.

나. RhCcEe

RhD 100 단 액 1%

액 단클 anti-C, anti-c, anti-E, anti-e 항체 시약

7

(BioClone; Ortho-Clinical Diagnostics, Raritan, NY, USA)

하여 RhCcEe 항원 청학 하 다.

2. RHD 검사

가. Multiplex PCR

검체 DNA 키트 QIAamp DSP DNA Blood Mini Kit

(Qiagen, Hilden, Germany) 하여 DNA 하 다. PCR

액 AccuPowerⓇ PCR PreMix (Bioneer, Daejeon, Korea)에

검체 DNA 2 μl, 한 시 체 (primer) 각각 1 μl,

수(distilled water) 16 μl 첨가하여 20 μl 만들어

C1000 Thermal Cycler (BioRad, Cressier, Switzerland)

사 하여 폭하 다(Table 1). 95°C 에 10 간 변 시킨 후

95°C 에 30 , 50°C (set 2 는 60°C) 에 30 , 72°C 에

30 씩 35 폭하고, 마지막 72°C 에 7 간 항 시켰다.

PCR 산 2% agarose gel 에 20 간 동 후 각 primer

set 에 합한 크 PCR 산 하 다.

8

Table 1. Primer sequence for deletion of RHD Gene

Target geneForward or

reverseSequence

Size

(bp)Reference

Set 1

Exon 4 Forward ccacatgaacatgatgcaca127 [13]

Reverse caaactgggtatcgttgctg

Exon 10 Forward taagcaaaagcatccaa186 [14]

Reverse atggtgagattctcct

Set 2

Exon 7 Forward gttgtaaccgagtgctggggattc123 [9]

Reverse tgccggctccgacggtatc

Promoter Forward tccactttccacctccctgc256 [9]

Reverse gcagccaacttcccctgtg

Internal control Forward tgccttcccaaccattccctta434

(Human growth hormone) Reverse ccactcacggatttctgttgtgtttc

나. Multiplex ligation-dependent probe amplification (MLPA)

MLPA 는 SALSA MLPA Probemixes P401-A1, P402-A1, P403-A1 blood

group genotyping kits (MRC-Holland, Amsterdam, the

Netherlands) 하 다(Table 2). 한 DNA 프 브

합 과 하여 결합시킨 후 PCR 폭 하 , PCR

95°C 에 30 , 60°C 에 30 , 72°C 에 1 씩 35 폭하고,

마지막 72°C 에 20 간 항 시켰다. PCR 폭 산

Applied Biosystems 3130 genetic analyzer (Applied Biosystems,

Foster City, CA, USA) 하 다.

9

Table 2. RHD- and RHCE- specific probes from the RH-MLPA test

Gene Type of probe Allele namePresent in

mix

RHD Mut. specific 609G>A; RHD*Pseudogene/ψ 401

RHD Wild-type Wt 989A; RHD exon 7 401

RHD Mut. specific 8C>G; RHD*weak D type 3 401

RHD Wild-type Wt 1357C; RHD exon 10 401

RHCE Mut. specific 109 nt insert intron 2; RHCE*C 401

RHD Mut. specific 819G>A; RHD*DIIIb, DIII6 401

RHD Mut. specific 885G>T; RHD*weak partial 11 401

RHD Wild-type Wt 787G; RHD exon 5 401

RHD Wild-type Wt 514A; RHD exon 4 401

RHD Mut. specific 410C>T;RHD*DOL3, DIIIa, DIIIb 401

RHCE Mut. specific 676G; RHCE*e 401

RHCE Mut. specific 676G>C; RHCE*E 401

RHD Wild-type Wt 5' UTR-132; RHD 5' UTR 401

RHD Mut. specific 1063G>A; RHD*DNB 401

RHD Mut. specific 1154G>C; RHD*weak D type 2, 2.1 401

RHD Mut. specific 186G>T; RHD*DIIIa, DIII.4, DIVa.1 401

RHD Mut. specific IVS3+1g>a; RHD*DEL8 401

RHD Mut. specific 872C>G; RHD*weak 4.3 402

RHD/ RHCE Mut. specific 48G>C; RHD*weak partial 4.1; RHCE*C 402

RHD Mut. specific 1025T>C; RHD*DIV3, DIV5, DAR1 402

RHCE Mut. specific 122A>G; RHCE*CW 402

RHD Mut. specific 509T>C; RHD*DOL1, DOL2 402

RHD Wild-type Wt 380T; RHD exon 3 402

RHD Wild-type Wt 455A; RHD exon 3 402

RHD Wild-type Wt 1193A; RHD exon 9 402

RHD Mut. specific 809T>G; RHD*weak D type 1 402

RHCE Mut. specific 733C>G; RHCE*VS 402

RHD Wild-type Wt 667T; RHD exon 5 402

RHCE Mut. specific 307C; RHCE*c 402

RHD Wild-type Wt 602C; RHD exon 4 402

RHD Wild-type Wt 932A; RHD exon 6 402

RHD Mut. specific 3G>A; RHD*DEL2 402

RHD Mut. specific 48G>A; RHD*01N.08, (W16X) 403

RHD Wild-type Wt 800A; RHD exon 5 403

RHD Mut. specific 329T>C; RHD*DVII1, DVII2 403

RHD Mut. specific 845G>A; RHD*weak partial 15 403

RHD Mut. specific 807T>G; RHD*Pseudogene/ψ 403

RHD Wild-type Wt 941G; RHD exon 7 403

RHD Wild-type Wt 1061C; RHD exon 7 403

RHD Mut. specific 446C>A; RHD*weak D type 5 403

RHD Wild-type Wt 697G; RHD exon 5 403

RHD Mut. specific 1227G>A; RHD*DEL1 403

RHD Mut. specific 1136C>T; RHD*DAU0-7 403

RHD Mut. specific 270G>A; RHD*01N.10 (W90X) 403

RHD Mut. specific 520G>A; RHD*weak D type 33 403

10

RHD RHCE Softgenetics MLPA 프 그램

(GeneMarker 2.2) 하여 매 실험에 과

비 하여 하 , 과 비 하여 상 값 0 경우

동 합체 결 (homozygote deletion), 0.40-0.65 경우

합체 결 (heterozygote deletion), 0.80-1.20 경우

상, 1.30-1.65 경우 합체 복(heterozygote

duplication), 1.75-2.15 경우 동 합체 복(homozygote

duplication) 보았다.

다. Exon 9 직 염 열

PCR 액 AccuPowerⓇ PCR PreMix (Bioneer, Daejeon,

Korea)에 검체 DNA 2 μl, 한 시 체 (primer) 각각 1 μl,

수(distilled water) 16 μl 첨가하여 20 μl 만들어

C1000 Thermal Cycler (BioRad, Cressier, Switzerland)

사 하여 PCR 시행하 다 (Table 1). 37°C 에 2 간 UDG

킨 후 95°C 에 10 간 변 시켜 95°C 에 30 ,

60°C 에 30 , 72°C 에 60 씩 34 사 클 시행한 후

마지막 72°C 에 5 간 항 시켰다. PCR 산 2% agarose

gel 에 20 간 동 후 각 primer set 에 합한 크 PCR

산 하 다. 염 열 BigDye Terminator V3.1 Cycle

Sequencing Kit (Applied Biosystems, Foster City, CA, USA)

11

후 3730 DNA Analyzer 비(Life Technologies, Grand

Island, NY) 통해 염 열 진행하 다.

12

Ⅲ. 결과

1. RhD 액 착 시험 Multiplex PCR

착 시험 해 DEL 한 결과 100 건 18 건

DEL 할 수 었다 (Table 3). 후 검사한 Multiplex

PCR 검사 결과 Promoter, exon 4, exon 7, exon 10 4 개

가 폭 경우는 18 건 (Group A, 18%) 었고 착-

시험 통해 DEL 경우 치하 다. Exon 4 exon

7 결 보 는 경우는 4 건 (Group B, 4%) 었 , 4 개

가 결 경우는 78 건 (Group C, 78%) 었다

(Figure 1, Table 3).

Figure 1. PCR analysis of exon 4, exon 7, exon 10 and promoter of

the RHD gene. (A) Non deletion type (Group A) - all RHD exons are

shown. (B) Partial deletion type (Group B) – promoter and exon 10

of RHD is present. (C) Total deletion type (Group C) – all RHD

exons tested, except for internal control, are absent.

13

Table 3. Results of adsorption elution test and PCR in RhD negative

samples

Group No. of samplesAdsorption

Elution test

PCR result in different RHD genomic region

Promoter Exon 4 Exon 7 Exon 10

A 18 + + + + +

B 4 - + - - +

C 78 - - - - -

Total 100

2. RhCeEe

검사한 RhD 액 100 검체 RhCcEe Table 4 같다.

DEL (Group A) 18 건 Ccee CcEe 각각 14 건(77.8%),

4 건(22.2%) 었 , C 항원 었다. Exon 4 exon 7

결 보 는 group B 는 4 건 Ccee (100%) , promoter,

exon 4, 7, 10 결 보 는 group C 는 78 건 ccee

64 건(82.1%), ccEe 8 건(10.2%), Ccee 6 건 (7.7%) 순 었다.

Table 4. Distribution of Rh Phenotypes in RhD negative samples

Group No. of samplesRh Phenotype

CcEe Ccee ccEe ccee

A 18 4 (22.2) 14 (77.8) 0 (0.0) 0 (0.0)

B 4 0 (0.0) 4 (100) 0 (0.0) 0 (0.0)

C 78 0 (0.0) 6 (7.7) 8 (10.2) 64 (82.1)

Total 100

14

3. MLPA

MLPA 검사상 group A 는 5’UTR 과 exon 3, 4, 5, 6, 7, 9, 10

합체 결 보 다 (Table 5). Group B 는 exon 3, 4, 5,

6, 7, 9 동 합체 결 보 고, 5’UTR 과 exon 10

합체 결 나타났다. Group C 는 RHD 든 에

동 합체 결 보 다. Group A 에 exon 9 1227G>A

돌연변 폭 찰 었 , 1227G>A RHD

돌연변 는 찰 지 않았다(Figure 2).

Table 5. RHD alleles and the zygosity determination using MLPA

assay

GroupNo. of

samples

Probe ratio of probe combinations in RH allele

RHD alleleWild-type allele in different exonsMutaion-specific

allele

5'UTR E3 E4 E5 E6 E7 E9 E10 1227A

A 18 H H H H H H H H >2 1227G>A

B 4 H 0 0 0 0 0 0 H 0 RHD-CE-D

C 78 0 0 0 0 0 0 0 0 0 RHD deletion

Total 100

Abbreviation: H, heterozygote

15

Figure 2. Multiplex ligation-dependent probe amplification (MLPA)

analysis results. RHD 1227G>A was detected in all of Group A and 2

exons (exons 5, 7, 7 and 5 in this order) with half the copy number

were identified (arrow).

4. Exon 9 직 염 열

Group A exon 9 PCR 폭한 후 직 염 열 한

결과 18 검체 exon 9 에 한 폭산 할 수 었 ,

16

MLPA 결과 동 하게 RHD exon 9 1227 째 염 G가 A

치 DEL 할 수 었다(Figure 3).

Figure 3. PCR and sequencing analysis of exon 9 of the RHD gene. (A)

a 463-bp fragment was amplified, representing the exon 9. (B)

Direct sequencing revealed a presence of a homozygous G to A

transition at nucleotide position 1227 at the exon 9/intron 9

junction.

17

Ⅳ. 고찰

Anti-D 가 생 RhD 는 RhD 양 액 수 시

수 킬 수 어 RhD 양 액 수 는 것

상 다. 근 RhD 액 수 후 anti-D 가 생

사 들 재 검사 체계 는 RhD 변 벽 검 하지 못하고

RhD 못 하고 시사한다. 안 한 수 체계

해 는 RhD 액과 RhD 변 하는 새 운 검사 체계

도 필 하다. 본 연 에 는 청학 검사 에

지 않는 DEL 빈도 착- 시험, RhD 검사,

RhCcEe 검사 통해 하 다. RHD 는 RHCE

동 하게 10 개 exon 어 , 들 는 1 염색체

1p34.1-1p36 에 치해 고, 90 % 상 동 한 염 열 가지므

시 해야 한다. 15 RHD 는 간에 변

빈도에 차 보 에 특 고 하여 RHD

하여야 한다. RHD 시 10 개 exon 과 intron

하는 것 비 므 택 검사하여야

한다. 간 차 에 해 Flegel 등 exon 4

또는 intron 4 exon 7 하여야 한다고 했다. 16 Rouillac-Le

등도 893 산 RHD 한 결과 26 D

산 가 RHD Ψ pseudogene 가지고 고, 5 산 가 RHD-CE-D

가지고 어, 2 상 택하여

하여야 한다고 했다.17 Luettringhaus 등 한 에 합한 RHD

18

검사 하여 RHD intron 4, exon 7, exon 10,

promoter 택 하여 보고하 다.6 본 연 에 도 RhD

액 RHD 체 결 , RHD-CE-D DEL

감별하 RHD exon 4, 7, 10 promoter 하 다.

또한, exon 4, 7, 10 에 exon 3, 5, 9 결 여 exon 9

직 염 열에 할 수 는 RHD (K409K, 1227G>A) 변

다 RHD 변 검 하 해 MLPA 검사 가 시행하 다.

실험에 exon 4,7,10 promoter 가 결 경우는 체 100

건 78 건 었고, exon 4 7 만 폭 지 않 경우는 100 건

4 건 착 시험에 RhD 할 수

었다. 착 시험에 양 보 고 multiplex-PCR MLPA

검사에 에 폭산 찰 group A 18

검체 MLPA exon 9 직 염 열 결과 Asian DEL 라

리는 RHD (K409K, 1227G>A) 변 할 수 었다. D

사람 DEL 립 는 럽 에 는 드 게 나타나고,

아프리카 에 는 재하지 않 나, 아시아 에 는 10%~33%

다양하게 보고 고 다. 9,18 한 에 는 15~17%가 DEL

보고 고 , RHD (K409K, 1227G>A)가 DEL 립

견 다. 5, 6 연 에 도 사한 빈도 헌 RhD 액

검체 100 개 18 개가 DEL 었고, 18 건 exon 9 1227G>A

변 가 견 었다. RHD (K409K, 1227G>A)는 아미 산 변 가 없는

동 치 (synonymous substitution) 지만, mRNA 사과

19

켜 exon 9 실 해 매우 낮 D 항원 는 것

알 다.16,19

연 에 사한 Rh 액 C/c/E/e 18 건

Ccee 가 14 건 (77.8%), CeEe 가 4 건 (22.2%) 었다. Luettringhaus

등 보고에 하 Asian DEL 16 15 Ccee, 1 CcEe

C 항원 었다.6 많 연 에 도 C 항원

DEL 과 연 어 는 것 알 어, 재 본원에 는 C 항원

검사 통해 실 수 시 C 항원 는 헌 액 RhD

에게 수 하지 않고 다. 하지만, C 항원 지 않는 ccEe

에 도 RHD (K409K, 1227G>A) 립 동 한 경우가 보고

어, C 만 DEL 할 수 없 므 , DEL

한 감별 해 RHD 검사가 가 시행 어야 할 것

사료 다.5

재 내에 는 항-D 시약과 시켜 RhD 액 검사

시행하 , 집 보 지 않 약-D 검사 가 시행한다. 또한,

D 검 하 해 사가 다 2 가지 시약

사 하 도 한다. 하지만 러한 검사 체계만 는 DEL 검 할 수

없 므 DEL 검 하 해 착 시험 나 RHD 검사

실시하여야 한다. 하지만 착 검사는 검사에 는

시간과 동 많 들 , 검사 숙 도에도 향 많 는

것 알 어, RHD 검사 통해 DEL 진하는

욱 할 것 다. 또한, 액공 에 는 RhD 헌 RHD

20

검사 통해 스 하여 DEL 액 RhD

에게 공 는 것 에 할 수 것 다.

Asian DEL RhD 양 액 수 거나 RhD 양 아

신하여도 anti-D 항체 생 하지 않는다고 보고 었다. 는 Asian

DEL 벽한 항원결 (epitope) 가지고 알

다.20,21 에 라, 료 에 는 액 공 원 하지 않거나

상 경우 가 여 나 미 anti-D 가진 같

고 험 하고 Asia DEL 는 RhD 양

액 수 고 할 수 것 다.

21

Ⅴ. 결

약 D 극 량 D 항원 가지고 어 착- 시험 통해 만

D 항원 재가 는 경우 DEL 라 하 , 근 RhD

에게 DEL 액 가 수 후 anti-D 가 생 사 들

보고 고 어, RhD 헌 액 DEL 할 수 는

검사 체계 필 고 다.

본 연 에 는 RhD 헌 액 100 건 18 건 착 과

exon 4, exon 7, exon 10, Promoter multiplex PCR 검사 MLPA

검사 통해 DEL 었다. DEL 18 검체

exon 9 MLPA 직 염 열 결과 18 건 에 RHD (K409K,

1227G>A) 변 가 었 , C/c/E/e 18 건 Ccee 가 14 건

(77.8%), CeEe 가 3건 (22.2%) 18 건 C 항원 었다.

안 한 수 하여 RHD 검사 통해 순수한 D 액과

DEL 하는 검사 체계 도 필 할 것 생각 어 진다.

22

참고 헌

1. Fung MK, Grossman BJ, Hillyer C, Westhoff CM. Technical manual.

18th ed. BethesDa: American Association of Blood Banks, 2014:

317-36.

2. Shirey RS, Edwards RE, Ness PM. The risk of alloimmunization to

c (Rh4) in R1R1 patients who present with anti-E. Transfusion

1994;34:756-8.

3. Urbaniak SJ, Greiss MA. RhD haemolytic disease of the fetus and

the newborn. Blood Rev 2000;14:44-61.

4. Daniels G, Poole J, de Silva M, Callaghan T, MacLennan S, Smith

N. The clinical significance of blood group antibodies. Transfus

Med 2002;12:287-95.

5. Kim JY, Kim SY, Kim CA, Yon GS, Park SS. Molecular characteriza

-tion of D-Korean persons: development of a diagnostic strategy.

Transfusion 2005;45:345-52.

6. Luettringhaus TA, Cho D, Ryang DW, Flegel WA. An easy

RHD genotyping strategy for D- East Asian persons applied

to Korean blood donors. Transfusion 2006;46:2128-37.

7. Wagner T, Kormoczi GF, Buchta C, Vadon M, Lanzer G, Mayr WR, et

al. Anti-D immunization by DEL red blood cells. Transfusion

2005;45:520-26.

8. Yasuda H, Ohto H, Sakuma S, Ishikawa Y. Secondary anti-D

23

immunization by Del red blood cells. Transfusion 2005;45:1581-4.

9. Wagner FF, Frohmajer A, Flegel WA. RHD positive haplotypes in D

negative Europeans. BMC Genet 2001;2:10.

10. Gassner C, Doescher A, Drnovsek TD, Rozman P, Eicher NI, Legler

TJ, et al. Presence of RHD in serologically D-, C/E+ individ

-uals: a European multicenter study. Transfusion 2005;45:527-38.

11. Shao CP, Maas JH, Su YQ, Kohler M, Legler TJ. Molecular

background of Rh D-positive, D-negative, Del and weak D

phenotypes in Chinese. Vox Sang 2002;83:156-61.

12. Chen JC, Lin TM, Chen YL, Wang YH, Jin YT, Yue CT. RHD 1227A is

an important genetic marker for RhDel individuals. Am J Clin

Pathol 2004;122:193-8.

13. Aubin JT, Le Van Kim C, Mouro I, Colin Y, Biqnozzi C, Brossard

Y, et al. Specificity and sensitivity of RHD genotyping methods

by PCR-based DNA amplification. Br J Haematol 1997;98:356-64.

14. Kim KH, Kim KE, Woo KS, Han JY, Kim JM, Park KU. Primary anti-D

immunization by DEL red blood cells. Korean J Lab Med

2009;29:361-5.

15. Okuda H, Suganuma H, Kamesaki T, Kumada M, Tsudo N, Omi T, et

al. The analysis of nucleotide substitutions, gaps, and

recombination events between RHD and RHCE genes through

complete sequencing. Biochem Biophys Res Commun 2000;274:670-83.

24

16. Flegel WA, Wagner FF. Molecular biology of partial D

and weak D: implications for blood bank practice. Clin

Lab 2002;48:53-9.

17. Rouillac-Le SC, Puillandre P, Gillot R, Baulard C, Metral S, Le

Van Kim C, et al. Large-scale pre-diagnosis study of fetal RHD

genotyping by PCR on plasma DNA from RhD-negative pregnant

women. Mol. Diagn. 2004;8:23-31.

18. Shao CP, Xiong W, Zhou YY. Multiple isoforms excluding normal

RhD mRNA detected in Rh blood group Del phenotype with RHD

1227A allele. Transfus Apher Sci 2006;34:145-52.

19. Liu HC, Eng HL, Yang YF, Wang YH, Lin KT, Wu HL, et al.

Aberrant RNA splicing in RHD 7-9 exons of DEL individuals in

Taiwan: a mechanism study. Biochim Biophys Acta 2010;1800:565-

73.

20. Shao CP. Transfusion of RhD-positive blood in “Asia type” DEL

recipients. N Engl J Med 2010;263:472-3.

21. Lee WM, Kim JH, Ha JS, Ryoo NH, Jeon DS, Kim JR, et al. A RhD

negative patient failed to produce detectable anti-D after

transfusion of 35 units of RhD positive red blood cells. Korean

J Lab Med 2007;27:369-72.

25

Abstract

Rh-Hr phenotype and genotype on the DEL variant of

RhD negative blood donors in Korea

Banseok Kim

Department of Medicine

The Graduate School, Yonsei University

(Directed by Professor Sinyoung Kim)

The RhD antigen, which is a highly immunogenic following ABO antigen,

can lead to severe hemolytic transfusion reactions and hemolytic disease of

the fetus and newborn. It has been known in the past that DEL antigen,

which contains very small amount of D antigen does not create anti-D

antibodies when transfused to an RhD negative recipient. However, recent

reports show that there have been some cases of anti-D antibodies production

in an RhD negative patient after having been transfused with DEL type blood

component.

In this study, we studied RhD negative red blood cells supplied to our

hospital for analyzing the prevalence, phenotype, allele of DEL antigen.

Adsorption-elution test, multiplex-polymerase chain reaction (PCR)

26

including exon 4, exon 7, exon 10 and promoter of RHD gene, multiplex

ligation-dependent probe amplification (MLPA) and direct sequencing of

exon 9 of RHD gene were performed.

In 100 Rhd negative samples with multiplex PCR and MLPA test, 78

showed RHD gene homozygote deletion, 4 showed the RHD-CE-D hybrid,

and 18 showed RHD gene heterozygote deletion. In 18 cases with the RHD

gene heterozygote deletion were confirmed by adsorption-elution test to be

DEL type and the ‘Asian DEL type’ RHD (K409K, 1227G>A)

polymorphism was detected by MLPA and direct sequencing of exon 9 of

RHD gene in all of 18 cases. In addition, C antigen were expressed in all 18

DEL type in RhCE phenotype analysis (Ccee 14 (77.8%), CcEe 4 (22.2%)).

It is necessary for a newly developed transfusion exanination system, which

distinguishes between purely D negative and DEL type blood through RHD

gene examination for safer transfusion of RhD negative blood products.

Key words : RhD negative, DEL, multiplex PCR, RHD (K409K, 1227G>A),

adsorption elution test, MLPA