diagnosis of genetic diseases 1. family history* clinical presentation* estimation of haematological...
TRANSCRIPT
![Page 1: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/1.jpg)
Diagnosis of Genetic Diseases
1
![Page 2: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/2.jpg)
Diagnosis of Genetic Diseases
Family History*
ClinicalPresentation*
Estimation of Haematological
parameters
Estimation of Biochemical Parameters
ChromosomalAnalysis
RecombinantDNA
Technology
Determination ofEnzyme Activity
or Specific Protein
* Important for all genetic diseases 2
![Page 3: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/3.jpg)
1. Family History
• Consanguinity of parents.
• Presence of other siblings with the same disorder.
• Occurrence of the disorder in other members of the family.
• Repeated abortions or still births,
• Mother and fathers ages.
• Drawing punnet square helps to determine the mode of inheritance of the genetic disorders.
• Autosomal or X-linked
• Dominant or recessive
3
![Page 4: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/4.jpg)
D d
D
DD
Dd
d
Dd
dd
Punnet Square for Autosomal Dominant Inheritance
D d
D
DD
Dd
d
Dd
dd
25% Affected
50% NormalCarriers
25% Normal Not Carriers
Punnet Square for Autosomal Recessive Inheritance
25% Normal& 75% Affected
4
![Page 5: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/5.jpg)
2. Clinical PresentationCertain clinical features are specific for a disease:• Chronic anaemia:
• Haemoglobinopathies• Thalassaemia• Other genetic anaemias
• Acute anaemia, under certain stressful conditions.• G-6-PD deficiency
• Hypoxia – sickle cell disease.• Dependence on blood transfusion - -thalassaemia (major)• Severe immune deficiency – ADA deficiency; Adenosine deaminase (ADA)
deficiency is an inherited disorder that damages the immune system and causes severe combined immunodeficiency (SCID)
• Emphysema - 1 anti-trypsin deficiency.• Hypercholesterolaemia – familial hypercholesterolaemia.• Delayed blood coagulation – Haemophilia (decrease in factor VIII or IX).• Mental retardation – Fragile syndrome (in X chromosome) or phenylketonuria
(PKU).• Muscular weakness and degeneration – Duchenne muscular dystrophy.
5
![Page 6: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/6.jpg)
Recombinant DNA Technology( Genetic Engineering)
6
![Page 7: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/7.jpg)
Recombinant DNA Technology( Genetic Engineering)
Techniques for cutting
and joining DNA
7
![Page 8: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/8.jpg)
Requirements for DNA technology
Restriction endonucleases
Vectors
Probes
Other enzymese.g ligases,
Taq polymerases
Primers
NTPs
Special chemicals and equipment
DNA
8
![Page 9: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/9.jpg)
• Endonucleases.• Synthesized by procaryotes. Do not
restrict host DNA.• Recognize and cut specific base
sequence of 4-6 bases in double helical DNA.
• The sequence of base pairs is palindromic i.e. it has two fold symmetry and the sequence, if read, from 5’ or 3’ end is the same.
• Endonucleases.• Synthesized by procaryotes. Do not
restrict host DNA.• Recognize and cut specific base
sequence of 4-6 bases in double helical DNA.
• The sequence of base pairs is palindromic i.e. it has two fold symmetry and the sequence, if read, from 5’ or 3’ end is the same.
Restriction Endonuclease
5’-GAATTC-3’3’-CTTAAG-5’ 9
![Page 10: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/10.jpg)
Produce either Blunt Ends or Staggered ends: Produce either Blunt Ends or Staggered ends:
Restriction Endonuclease
5’-GAATTC-3’3’-CTTAAG-5’
5’-GAA TTC-3’ 3’-CTT AAG-5’
5’-G AATTC-3’3’-CTTAA G-5’
5’-GAATTC-3’3’-CTTAAG-5’
Blunt Ends
Staggered Ends
or
10
![Page 11: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/11.jpg)
• Obtaining DNA fragments of interest.• Gene mapping.• Sequencing of DNA fragments.• DNA finger printing• Recombinant DNA technology• Study of gene polymorphism.• Diagnosis of disease.• Prenatal diagnosis
• Obtaining DNA fragments of interest.• Gene mapping.• Sequencing of DNA fragments.• DNA finger printing• Recombinant DNA technology• Study of gene polymorphism.• Diagnosis of disease.• Prenatal diagnosis
Uses of Restriction Endonuclease
11
![Page 12: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/12.jpg)
Sources of DNASources of DNA
GenomicDNA
Synthesis of DNA
cDNA
Using DNA synthesiser
Synthesised from mRNA using Reverse transcriptase
DNA extracted from cells
12
![Page 13: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/13.jpg)
cDNA Synthesis
cDNA Synthesis
mRNA
Poly A tailAAAAAAAAA
Viral reverse transcriptase
AAAAAA
TTTT
NaOH( Hydrolysis of RNA)
DNA polymerase
Hair pin loop
DNA nuclease (single-strand specific)
Double strand cDNA
dNTP
13
![Page 14: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/14.jpg)
• DNA molecules.
• Can replicate in a host e.g bacterial cells or yeast.
• Can be isolated and re-injected in cells.
• Presence can be detected.
• Can be introduced into bacterial cells e.g. E. coli.
• May carry antibiotic resistance genes.
• DNA molecules.
• Can replicate in a host e.g bacterial cells or yeast.
• Can be isolated and re-injected in cells.
• Presence can be detected.
• Can be introduced into bacterial cells e.g. E. coli.
• May carry antibiotic resistance genes.
VectorsVectors
Cloning vesiclesCloning vesicles
14
![Page 15: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/15.jpg)
TypeI. Plasmid : circular, double stranded
cytoplasmic DNA in procaryotic e.g. PBR 3 of Ecoli.
II. Bacteriophage lambda: a bacterial virus infects bacteria.
III. Cosmids: a large circular cytoplasmic double stranded DNA similar to plasmid.
IV. Yeast Artificial Chromosomes (YAC)
TypeI. Plasmid : circular, double stranded
cytoplasmic DNA in procaryotic e.g. PBR 3 of Ecoli.
II. Bacteriophage lambda: a bacterial virus infects bacteria.
III. Cosmids: a large circular cytoplasmic double stranded DNA similar to plasmid.
IV. Yeast Artificial Chromosomes (YAC)
Types of vectorsTypes of vectors
Insert size• <5-10 kb.
•Up to 20kb.
• Up to 50kb.
•~100-1000kb.
15
![Page 16: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/16.jpg)
16
![Page 17: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/17.jpg)
Cloned or synthetic nucleic acids used for DNA:DNA or DNA:RNA hybridization reactions to hybridize to DNA of interest.
• DNA or RNA.
• cDNA.
• Labeling of probes:• 3H Radioactive• 32P
Cloned or synthetic nucleic acids used for DNA:DNA or DNA:RNA hybridization reactions to hybridize to DNA of interest.
• DNA or RNA.
• cDNA.
• Labeling of probes:• 3H Radioactive• 32P
ProbesProbes
17
![Page 18: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/18.jpg)
18
![Page 19: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/19.jpg)
Hybridization
19
![Page 20: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/20.jpg)
DNA cloningDNA cloning
Recombinant DNA TechnologyRecombinant DNA Technology
Polymerase chain reaction
Polymerase chain reaction
Amplification of DNA Study of DNA structureand functions
DGGEDGGE
RT PCRRT PCR
Dot blot analysisDot blot analysis
ARMSARMS
DNA sequencingDNA sequencing
OthersOthers
20
![Page 21: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/21.jpg)
A technique for detecting, analyzing, and identifying proteins, similar to the western blot technique but differing in that protein samples are not separated electrophoretically but are spotted through circular templates directly onto the membrane or paper substrate.
Concentration of proteins in crude preparations (such as culture supernatant) can be estimated semi-quantitatively by using “Dot Blot” method if you have both purified protein and specific antibody against it.
Dot blot analysisDot blot analysis
DGGEDGGE: Denaturing gradient Gel Electrophoresis (DGGE) is used for detection of single
base changes polymorphisms genomic cloned and amplified DNA.
21
![Page 22: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/22.jpg)
Amplification Refractory Mutation System (ARMS)Amplification Refractory Mutation System (ARMS)
It is a way to detect mutations in DNA.
Amplification Refractory Mutation System (ARMS), also called allele-specific polymerase chain reaction (ASP) and polymerase chain reaction amplification of specific alleles (PASA).
Is a method used to detect single base pair mutation.
The PCR-based technique can be used to analyze a wide variety of germ-line and somatic mutations, such as sickle-cell anemia.
ARMS has the ability to isolate low levels of a mutant sequence in a background of wild-type DNA. The system depends on the specificity of a primer for the normal sequence and another primer for the mutation.
22
![Page 23: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/23.jpg)
Principles of Molecular Cloning
Involves:
• Isolation of DNA sequence of interest.
• Insertion of this DNA in the DNA of an organism that grows rapidly and over extended period e.g. bacteria.
• Growing of the bacteria under appropriate condition.
• Obtaining the pure form of DNA in large quantities for molecular analysis.
Involves:
• Isolation of DNA sequence of interest.
• Insertion of this DNA in the DNA of an organism that grows rapidly and over extended period e.g. bacteria.
• Growing of the bacteria under appropriate condition.
• Obtaining the pure form of DNA in large quantities for molecular analysis.
23
![Page 24: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/24.jpg)
24
![Page 25: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/25.jpg)
• Method to amplify a target sequence of DNA or RNA several million folds.
• Based on Enzymatic amplification of DNA fragment flanked by primers i.e. short oligonucleotides fragments complimentary to DNA. Synthesis of DNA initiates at the primers.
• Method to amplify a target sequence of DNA or RNA several million folds.
• Based on Enzymatic amplification of DNA fragment flanked by primers i.e. short oligonucleotides fragments complimentary to DNA. Synthesis of DNA initiates at the primers.
Polymerase Chain Reaction (PCR)
5’ ATCAGGAATTCATGCCAAGGTTGATCGATGATCGATCGATCGATTGAT 3’ 3’AGCTAGCTAGCT 5’
DNA
Primer
![Page 26: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/26.jpg)
![Page 27: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/27.jpg)
• Diagnosis of genetic disease by amplification of the gene of interest, followed by
detection of mutation.
• Detection of infectious agent e.g. bacteria and viruses.
• DNA sequencing.
• In forensic medicine.
• Diagnosis of genetic disease by amplification of the gene of interest, followed by
detection of mutation.
• Detection of infectious agent e.g. bacteria and viruses.
• DNA sequencing.
• In forensic medicine.
Application of PCRApplication of PCR
![Page 28: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/28.jpg)
1. Clinical Chemistry:
• Diagnosis of disease e.g. sickle cell anaemia.
• Prenatal diagnosis,• Premarital “• Presymptomatic “• Neonatal screening
1. Clinical Chemistry:
• Diagnosis of disease e.g. sickle cell anaemia.
• Prenatal diagnosis,• Premarital “• Presymptomatic “• Neonatal screening
Application of Recombinant Application of Recombinant DNA TechnologyDNA Technology
![Page 29: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/29.jpg)
Southern Blotting
![Page 30: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/30.jpg)
BglII
BglII
BamHI BglII
14.5Kb
7.0Kb12.5Kb
BamHI
1 2
L R
Pathogenesis of -Thalassaemia
Extract DNA
Treat with BglII
Electrophoresis
Visualize
Withdrawblood
Southern Blotting
![Page 31: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/31.jpg)
![Page 32: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/32.jpg)
2. Human Genetics• Mutations in genes causing hereditary
3. Analysis of stains of blood, semen.
4. Virology• Detection of viral diseases e.g. hepatitis
5. Microbiology• Using specific gene probes for detection of E.coli
6. Cytology, Histology and Pathology• Used in detection of tumor.
7. Synthesis of protein in bacterial• Insulin• GH• Somatostatin• Interferon
8. Transgenic animal production
2. Human Genetics• Mutations in genes causing hereditary
3. Analysis of stains of blood, semen.
4. Virology• Detection of viral diseases e.g. hepatitis
5. Microbiology• Using specific gene probes for detection of E.coli
6. Cytology, Histology and Pathology• Used in detection of tumor.
7. Synthesis of protein in bacterial• Insulin• GH• Somatostatin• Interferon
8. Transgenic animal production
⇝ ⇝ Application of Recombinant Application of Recombinant DNA TechnologyDNA Technology
![Page 33: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/33.jpg)
![Page 34: Diagnosis of Genetic Diseases 1. Family History* Clinical Presentation* Estimation of Haematological parameters Estimation of Biochemical Parameters Chromosomal](https://reader036.vdocuments.site/reader036/viewer/2022062408/56649e9e5503460f94ba0709/html5/thumbnails/34.jpg)