development of a loop-mediated isothermal amplification method for rapid detection of...
TRANSCRIPT
![Page 1: Development of a loop-mediated isothermal amplification method for rapid detection of reticuloendotheliosis virus](https://reader030.vdocuments.site/reader030/viewer/2022020202/575073e31a28abdd2e91afd3/html5/thumbnails/1.jpg)
Dd
XLa
b
T
ARRAA
KL(RD
1
mnsRscbRa((1tres
cu
0d
Journal of Virological Methods 168 (2010) 82–86
Contents lists available at ScienceDirect
Journal of Virological Methods
journa l homepage: www.e lsev ier .com/ locate / jv i romet
evelopment of a loop-mediated isothermal amplification method for rapidetection of reticuloendotheliosis virus
iaoyun Denga,b,1, Xiaole Qib,1, Yulong Gaob, Yongqiang Wangb, Liting Qinb, Honglei Gaob,i Gaob, Xiaomei Wangb,∗
College of Veterinary Medicine, Northeast Agricultural University, Harbin 150030, ChinaDivision of Avian Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute,he Chinese Academy of Agricultural Sciences, Harbin 150001, China
rticle history:eceived 12 February 2010eceived in revised form 20 April 2010
a b s t r a c t
A loop-mediated isothermal amplification (LAMP) method for rapid detection of reticuloendotheliosisvirus (REV) was developed. The method used a set of two pairs of primers to amplify the pol gene fordetecting REV, showing high specificity and sensitivity. The REV LAMP method did not cross-react with
ccepted 22 April 2010vailable online 6 May 2010
eywords:oop-mediated isothermal amplificationLAMP)
common avian DNA viruses (Marek’s disease virus, chicken anaemia virus, avian leucosis virus of sub-group J). Additionally, the assay could detect different REV strains and had a detection limit of five copiesand therefore a higher sensitivity than traditional PCR methods. Furthermore, the efficiency of LAMP fordetection REV in clinical samples was comparable to PCR and viral isolation. The procedure of LAMP issimple and does not rely on any special equipment. The detection of REV by LAMP will be useful for
retic
eticuloendotheliosis virus (REV)etectiondetecting and controlling
. Introduction
Reticuloendotheliosis virus (REV) is a member of Gam-aretrovirus with a variety of strains, including defective REV-T,on-defective REV-A, chick syncytial virus (CSV), and spleen necro-is virus (SNV) (Witter and Fadly, 2003). The genetic sequences ofEV show little variation (Bohls et al., 2006). REV causes immuno-uppressive and runting disease in a variety of avian hosts includinghickens, turkeys, ducks, geese, pheasants, peafowl, and some otherird species (Bohls et al., 2006; Witter and Fadly, 2003). In addition,EV integrates easily into the host genome and is associated withnumber of hematopoietic cell tumors. Its long terminal repeat
LTR) region could be integrated into the MDV and the FPV genomeHertig et al., 1997; Isfort et al., 1992; Jones et al., 1996; Kost et al.,993; Witter et al., 1997). Therefore, REV poses a serious threat tohe commercial poultry industry. The development of a simple andapid diagnostic method which can detect REV from infected chick-ns is necessary. This development will allow for epidemiological
urveillance and predicting the severity of REV.Loop-mediated isothermal amplification (LAMP) is an amplifi-ation method developed by Notomi et al. (2000). The techniqueses four or six primers which recognize six or eight regions of
∗ Corresponding author. Tel.: +86 451 85935004; fax: +86 451 85935049.E-mail address: [email protected] (X. Wang).
1 They contributed equally to this manuscript.
166-0934/$ – see front matter © 2010 Elsevier B.V. All rights reserved.oi:10.1016/j.jviromet.2010.04.021
uloendotheliosis.© 2010 Elsevier B.V. All rights reserved.
the target DNA, respectively, in conjunction with the enzyme Bstpolymerase, which has strand-displacement activity. The most sig-nificant advantages of LAMP are the ability to amplify specific DNAsequences under isothermal conditions between 60 ◦C and 65 ◦Cand a visible result within 30–60 min. This method has been appliedsuccessfully for the detection of many viruses, including influenzaA virus (Jayawardena et al., 2007; Poon et al., 2005), infectious bur-sal disease virus (Xu et al., 2009), porcine circovirus type 2 (Chen etal., 2008), porcine parvovirus (Chen and Cui, 2009), and pseudora-bies virus (En et al., 2008). However, the use of LAMP for detectingREV has not been reported. In this study, we designed primers tothe conserved pol gene of REV and evaluated the potential of LAMPas a simple and rapid detection system for REV.
2. Materials and methods
2.1. Viral strains and reagents
REV (HLJR0901 strain), Marek’s disease virus (MDV), chickenanaemia virus (CAV) and avian leucosis virus of subgroup J (ALV-J)were isolated and stored at the Harbin Veterinary Research Insti-
tute of the Chinese Academy of Agricultural Science (CAAS) at−70 ◦C. Bst DNA polymerase large fragment and MgSO4 (100 mM)were purchased from NEB Biotechnology (Ipswich, England). DNApolymerase and DNA marker were purchased from TaKaRa Biotech-nology (Dalian, China).![Page 2: Development of a loop-mediated isothermal amplification method for rapid detection of reticuloendotheliosis virus](https://reader030.vdocuments.site/reader030/viewer/2022020202/575073e31a28abdd2e91afd3/html5/thumbnails/2.jpg)
X. Deng et al. / Journal of Virologica
Table 1Details of LAMP, PCR primers designed for REV.
Primer name Sequence
FIP 5′TGTCAGGAGGGGATCGCAGC-AAACTTACCTTCGGGCAGGA3′
BIP 5′GCATCACGCAGTACCAGGTACT-AGGGTAGCCGGATTGAGG3′
F3 5′AGCCGCTCTTCTCACAAGA 3′
B3 5′AGCGTATCGTCTGTCTCGG 3′
LTRU 5′CATACTGGAGCCAATGGTT 3′
LTRL 5′AATGTTGTAGCGAAGTAC 3′
2
iaht4wap
2
(1S15n(lwfTwDsao(
The genomic DNA of REV (HLJR0901 strain) was used as the positivecontrol. To evaluate the ability of LAMP to detect REV in sam-
TD
PU 5′CAGGAATTCATGGACTGTCTCACC 3′
PL 5′AGAGTCGACTGCCCTCTTATGACG 3′
.2. Design and synthesis of the LAMP primers
Nucleic acid sequences of different REV strains and other sim-lar viruses were obtained from GenBank, and the homology wasnalyzed using DNAStar software. The conserved fragment withigh homology was chosen to be the target region which was usedo design the REV LAMP primers by the Primer Explorer version(http://primerexplorer.jp/lamp4.0.0/index.html) and Oligo6 soft-are. These primers included two pairs of LAMP primers (FIP/BIP
nd F3/B3), a pair of PCR primers (LTRU/LTRL) and a pair of gp90rimers (PU/PL; Table 1).
.3. Template preparation and extraction of DNA
Total DNA was extracted from cell cultures or tissue samplesliver and spleen). After being frozen and thawed for three times,00 �l of the cell cultures or tissue samples were mixed with 400 �lDS extraction buffer (10 mM Tris–HCl, 150 mM NaCl, 2 mM EDTA,% SDS, pH 8.0) and 5 �l proteinase K (30 mg/ml), incubated at6 ◦C for 3 h. After centrifugation (10 min, 15,000 × g), the super-atant was extracted with an equal volume of phenol–chloroform1:1, v/v). After centrifugation at 12,000 × g for 5 min, the upperayer was transferred to a new Eppendorf tube. Isopropanol (200 �l)
as added to each tube, and tubes were then incubated at −20 ◦Cor 1 h. The tubes were then centrifuged at 12,000 × g for 10 min.he supernatant was discarded, and the pellet was washed onceith 75% ice-cold ethanol, and dried in a laminar flow cabinet. TheNA precipitate was dissolved in 30 �l of sterile water and then
tored at −20 ◦C for later use. DNA copy number was calculated
s followed: copies/ml = 6.02 × 1023 (copies/mol) × concentrationf nucleic acid (g/�l)/average molecular weight of nucleic acidg/mol).able 2etection of REV 15 clinical samples by LAMP, PCR and virus isolation.
Sample Collection date Host LAMP
JSRD0701 2007.8 Duck +a
JSR0801 2008.8 Layer +HLJR0801 2008.10 Layer +HLJR0902 2009.1 Layer +HLJR0903 2009.1 Layer +HLJR0905 2009.5 Layer +JLR0801 2008.5 Layer +JLR0802 2008.9 Layer +JLR0803 2008.8 Layer +JLR0901 2009.2 Layer +JLR0902 2009.4 Layer +JLR0903 2009.2 Layer +LNR0801 2008.11 Layer +LNR0802 2008.11 Layer +HB09XT15 2009.9 Layer −a Positive.b Negative.c Not done.
l Methods 168 (2010) 82–86 83
2.4. Polymerase chain reaction (PCR)
PCR was carried out in a 25 �l reaction volume containing2.5 mM of each deoxynucleoside triphosphate (dNTP), 2.5 �l of 10×PCR buffer, 5 U of Taq polymerase, 0.5 pM of primers LTRU and LTRL,and 1 �l serial dilutions of 50–56 copies of DNA (HLJR0901 strain).The PCR condition was 5 min at 95 ◦C; followed by 30 cycles of 94 ◦Cfor 30 s, 58 ◦C for 30 s, and 72 ◦C for 30 s; and a final elongation for10 min at 72 ◦C. PCR products were subjected to electrophoresisanalysis on a 2% agarose gel.
2.5. LAMP reaction and optimization of the LAMP protocol
Based on previous reports (Blomstrom et al., 2008; Chen etal., 2008; Chen and Cui, 2009; En et al., 2008; Jayawardena et al.,2007; Yamada et al., 2006), the LAMP reaction was carried out in aconventional water bath, and the following factors in the LAMP pro-cedure were optimized: the concentration of primer, dNTP, betaine,MgSO4, Bst polymerase and the amount of REV DNA template(HLJR0901 strain). 1 �l of SYBR Green I dye (Invitrogen, Wisconsin,USA) was also added to the tube. The amplification reaction wasperformed from 59 ◦C to 65 ◦C for 60 min and at 65 ◦C for 50 min,60 min, 70 min, 80 min, and then terminated by heating at 80 ◦C for5 min. The amplified products were analyzed on a 2% agarose geland were visualized by staining with ethidium bromide. The resultcould also be observed directly without SYBR Green I dye becauseof the white precipitate from the magnesium pyrophosphate.
2.6. Sensitivity of the LAMP method relative to PCR for thedetection of REV
The sensitivity of LAMP vs. PCR for the detection of REV wasdetermined using 5-fold serial dilutions of REV DNA template(HLJR0901 strain), spanning from 50 to 56 copies/tube.
2.7. Specificity of the LAMP method
To assess the specificity of LAMP for REV, potential cross-reactions with DNA sample of MDV, ALV and CAV were examined.
ples, the test was performed in 5 clinical samples isolated in 2008.The amplification results were observed after electrophoresis andstained to verify the specificity.
PCR Virus isolation No. of GenBank
+ + GQ415647−b + NDc
+ + GU012640+ + GU012638+ + GQ415643+ + GU012643+ − GQ415644+ − GU969140+ + GU012644+ − GU012646+ + GQ415645+ − GU012645+ + GU012641+ + GU012642− − ND
![Page 3: Development of a loop-mediated isothermal amplification method for rapid detection of reticuloendotheliosis virus](https://reader030.vdocuments.site/reader030/viewer/2022020202/575073e31a28abdd2e91afd3/html5/thumbnails/3.jpg)
84 X. Deng et al. / Journal of Virological Methods 168 (2010) 82–86
F ductso withn the re
2i
iiLCePa
2
ttfilbw7mtLw3T
3
3
iBppsstfpt
REV was isolated from 10 of the 15 clinical samples and viralidentity was confirmed by PCR, immunofluorescence assay (IFA),
ig. 1. The visual inspection detection of REV with LAMP. Detection of the LAMP prof bands) (A), direct visual inspection (white precipitate) (B) and visual inspectionegative control. (For interpretation of the references to color in this figure legend,
.8. Detection of REV in clinical samples by LAMP, PCR, and virussolation
To evaluate the ability of LAMP to detect REV in samples fromnfected animals and diverse isolates of REV, the test was performedn 15 clinical samples collected from Jiangsu, Heilongjiang, Jilin,iaoning and Hubei provinces in China from 2007 to 2009 (Table 2).linical samples were stored at −70 ◦C. The extracted DNA fromach sample (see Section 2.3) was used as template for LAMP andCR. The 15 clinical samples were processed for viral isolation toscertain our findings (see Section 2.9).
.9. Isolation and sequencing of REV
To validate the LAMP results, virus isolation was performed fromhe 15 clinical samples described in Section 2.8. After freezing andhawing three times, the supernatants from the 15 samples wereltered through a 0.22 �m filter and inoculated onto CEF mono-
ayer to isolate the virus. The infected cells were then identifiedy immunofluorescence assay (IFA), and electron microscopy. IFAas directed by chicken anti-REV antibody (Charles River, USA). Atdays post-infection, the ultra-thin section of the infected CEF cellonolayer was examined with electron microscopy. At the same
ime, DNA was extracted from the CEF and subjected to PCR andAMP assays. The PCR conditions to amplify the gene fragment gp90as 5 min at 95 ◦C; followed by 30 cycles of 94 ◦C for 30 s, 53 ◦C for
0 s, and 72 ◦C for 90 s; and a final elongation for 10 min at 72 ◦C.he amplified PCR products of gp90 were reclaimed and sequenced.
. Results
.1. Optimal reaction for REV LAMP assay
The optimum volumes of components in the reaction mixturencluded 1.6 mM each of FIP and BIP primers, 0.2 mM each F3 and3 primers, 1.2 mM dNTP, 8 mM MgSO4, 0.2 M betaine, 8 U Bst DNAolymerase large fragment, and 1 �l target DNA. The LAMP reactionroduced several bands of different sizes upon agar electrophore-is because the LAMP products consisted of several inverted-repeat
tructures. The amplification by LAMP produced a ladder-like pat-ern, whereas the PCR product was a specific DNA band. At 65 ◦Cor 70 min, the product from REV LAMP was better than other tem-eratures and time. Therefore 65 ◦C and 70 min was considered ashe optimal temperature and time for REV LAMP. The results of theof HLJR0901 strain was confirmed by 2% agar electrophoresis (a ladder-like patternaddition of SYBR Green I dye (green color) (C). M, Marker DL2000; 1, HLJR0901; 2,ader is referred to the web version of this article.)
LAMP reaction were determined by visual inspection and also afterthe addition of SYBR Green I (Fig. 1).
3.2. Sensitivity of LAMP for the detection of REV
The sensitivities of LAMP and PCR for detecting REV were com-pared using 5-fold serial dilutions of DNA template extracted fromthe HLJR0901 strain. The detection limit of REV LAMP and REVPCR was 5 and 125 copies per reaction, respectively (Fig. 2). Theseresults indicate that LAMP was 25 times more sensitive than PCRfor detecting REV.
3.3. Specificity of LAMP for the detection of REV
The LAMP reaction was carried out using 5 REV strains isolated in2008 and three other chicken viruses (MDV, ALV and CAV) strains.All 5 REV strains produced positive results as positive control, whileall the other viruses produced negative results (Fig. 3). This demon-strated that the LAMP assay was specific, with no cross-reactionwith other avian viruses in DNA level, and could detect diverseisolates of REV.
3.4. Evaluation of clinical samples
The 15 clinical samples that had been collected from Jiangsu,Heilongjiang, Jilin, Liaoning and Hubei province in China between2007 and 2009 for diagnostic purposes were subjected to LAMP,PCR, and viral isolation. The positive rates after LAMP, PCR, and viralisolation were 93% (14/15), 87% (13/15), and 67% (10/15), respec-tively (Table 2). Similarity between LAMP and PCR was 93% (sameresult with 14 of 15 samples). Agreement between LAMP and viralisolation was 73% (same result with 11 of 15 samples).
3.5. Isolation of the REV and sequencing
and electron microscopy (data not shown). The gp90 nucleic acidsequences of 12 strains were submitted to GenBank (Table 2).Alignment of these sequences showed similarities with the pub-lished thus confirming the LAMP results from analysis of nucleotidesequences.
![Page 4: Development of a loop-mediated isothermal amplification method for rapid detection of reticuloendotheliosis virus](https://reader030.vdocuments.site/reader030/viewer/2022020202/575073e31a28abdd2e91afd3/html5/thumbnails/4.jpg)
X. Deng et al. / Journal of Virological Methods 168 (2010) 82–86 85
Fig. 2. Sensitivity of LAMP and PCR for the detection of REV. (A) and (B) were theresults of PCR and LAMP by 2% agar electrophoresis. (C) was the visual inspectionr5a
4
dmmtqpawtmePb
rtaeA
Fig. 3. Specificity of LAMP for the detection of REV. Detection of the LAMP productswas confirmed by 2% agar electrophoresis (A) and visual inspection (B). DNAs werefrom different viruses. All 5 REV strains produced positive results, while the otherviruses all produced negative results. M, DL2000; 1, MDV; 2, ALV; 3, CAV; 4, neg-ative control; 5, positive control; 6–10, different REV strains isolated in 2008. Thisdemonstrated that the LAMP assay had no cross-reaction with other avian viruses
esults of LAMP. M, Marker DL2000; Lanes 1–7, serial dilution of REV DNA copy (50,1, 52, 53, 54, 55 and 56 copies/tube, respectively). The detection limit of REV LAMPnd REV PCR was 51 and 53 copies per reaction, respectively.
. Discussion
Antigen detection and viral isolation are used routinely for theiagnosis of REV. Although virus isolation is the most reliableethod, it is time consuming and labor intensive. A number ofethods have been established that are well optimized with sensi-
ivity, specificity, and repeatability. This includes methods such asuantitative multiplex real-time PCR assay to determine the REV-roviral load of FPV strains (Hauck et al., 2009), PCR of REV envelopend 3′ LTR to test live virus vaccines of poultry for contaminationith REV (Fadly and Garcia, 2006), and RT-PCR to detect contamina-
ion of MD vaccine with REV (Masami et al., 1996). However, theseethods require a thermal cycler to amplify target sequences, other
xpensive equipment and skilled personnel. In particular, real-timeCR requires an additional probe. Moreover, the PCR products muste analyzed by agars.
In contrast, LAMP is a diagnostic method that is simple and only
equires a conventional water bath or heat block for amplifyingemplate DNA under isothermal conditions. This remarkable abilityllows the method to be performed with simple and cost-effectivequipments, which is a significant advantage for small laboratories.nother useful feature of LAMP is that its products can be observedin DNA level.
directly by the unaided eye because a white precipitate of magne-sium pyrophosphate can be observed in the reaction tube. AddingSYBR Green I to LAMP reactions could increase the ease and sen-sitivity of detection by the unaided eye (Chen et al., 2008; Mori etal., 2001). To date, LAMP technology has not been used to diagnoseREV.
In this study, a LAMP method with high specificity and sensi-tivity for detecting REV was developed. REV is a retrovirus, andproviral DNA provides better target for diagnosis than viral RNA.In the REV genome, the pol gene was the most conserved region(Barbosa et al., 2007). Therefore, using the proviral DNA and thepol gene as the target detecting material will simplify the proce-dure and boost the efficiency of REV LAMP. As expected, the REVLAMP has a detection limit of 5 copies, which has higher sensitivitythan the common PCR method. In addition, there is no cross-reaction with MDV, CAV and ALV, suggesting that this techniquehas high specificity among some common avian viruses at the DNAlevel.
The LAMP method was also used to detect REV in clinical sam-ples. REV LAMP is consistent with common PCR methods. However,in our study, viral isolation sometimes failed to detect REV in sam-ples, whereas the LAMP test and the PCR showed positive resultsin the absence of infectious virus. This indicated that the nucleicacid released from the virus could be detected. Therefore, we con-cluded that PCR and LAMP can be used to detect REV from viral DNA,and viral isolation for REV of viable virus. The sequencing resultsalso confirmed the REV LAMP results. Therefore, REV LAMP may besuperior to PCR and viral isolation.
In summary, a REV LAMP method was developed that is highlysensitive, simple, specific, stable, reproducible and timesaving. TheREV vaccine has not been used in most of the countries includingChina. The REV LAMP method can be used as a visual diagnostictool in rural diagnostic centers. Therefore, results from the present
study show that the LAMP method is useful for the detection ofREV.![Page 5: Development of a loop-mediated isothermal amplification method for rapid detection of reticuloendotheliosis virus](https://reader030.vdocuments.site/reader030/viewer/2022020202/575073e31a28abdd2e91afd3/html5/thumbnails/5.jpg)
8 logica
A
AG
R
B
B
B
C
C
E
F
H
H
6 X. Deng et al. / Journal of Viro
cknowledgement
This study was supported by the earmarked fund for Moderngro-industry Technology Research System of China (nycytx-42-3-01).
eferences
arbosa, T., Zavala, G., Cheng, S., Villegas, P., 2007. Full genome sequence and somebiological properties of reticuloendotheliosis virus strain APC-566 isolated fromendangered Attwater’s prairie chickens. Virus Res. 124, 68–77.
lomstrom, A.L., Hakhverdyan, M., Reid, S.M., Dukes, J.P., King, D.P., Belak, S., Berg, M.,2008. A one-step reverse transcriptase loop-mediated isothermal amplificationassay for simple and rapid detection of swine vesicular disease virus. J. Virol.Methods 147, 188–193.
ohls, R.L., Linares, J.A., Gross, S.L., Ferro, P.J., Silvy, N.J., Collisson, E.W., 2006. Phy-logenetic analyses indicate little variation among reticuloendotheliosis virusesinfecting avian species, including the endangered Attwater’s prairie chicken.Virus Res. 119, 187–194.
hen, C.M., Cui, S.J., 2009. Detection of porcine parvovirus by loop-mediated isother-mal amplification. J. Virol. Methods 155, 122–125.
hen, H.T., Zhang, J., Sun, D.H., Chu, Y.F., Cai, X.P., Liu, X.T., Luo, X.N., Liu, Q., Liu, Y.S.,2008. Rapid detection of porcine circovirus type 2 by loop-mediated isothermalamplification. J. Virol. Methods 149, 264–268.
n, F.X., Wei, X., Jian, L., Qin, C., 2008. Loop-mediated isothermal amplification estab-lishment for detection of pseudorabies virus. J. Virol. Methods 151, 35–39.
adly, A., Garcia, M.C., 2006. Detection of reticuloendotheliosis virus in live virusvaccines of poultry. Dev. Biol. (Basel) 126, 301–305.
auck, R., Prusas, C., Hafez, H.M., Luschow, D., 2009. Quantitative PCR as a tool todetermine the reticuloendotheliosis virus-proviral load of fowl poxvirus. AvianDis. 53 (2), 211–215.
ertig, C., Coupar, B.E., Gould, A.R., Boyle, D.B., 1997. Field and vaccine strains offowlpox virus carry integrated sequences from the avian retrovirus, reticuloen-dotheliosis virus. Virology 235, 367–376.
l Methods 168 (2010) 82–86
Isfort, R., Jones, D., Kost, R., Witter, R., Kung, H.J., 1992. Retrovirus insertion intoherpesvirus in vitro and in vivo. Proc. Natl. Acad. Sci. U.S.A. 89, 991–995.
Jayawardena, S., Cheung, C.Y., Barr, I., Chan, K.H., Chen, H., Guan, Y., Peiris, J.S., Poon,L.L., 2007. Loop-mediated isothermal amplification for influenza A (H5N1) virus.Emerg. Infect. Dis. 13, 899–901.
Jones, D., Brunovskis, P., Witter, R., Kung, H.J., 1996. Retroviral insertional activationin a herpesvirus: transcriptional activation of US genes by an integrated longterminal repeat in a Marek’s disease virus clone. J. Virol. 70, 2460–2467.
Kost, R., Jones, D., Isfort, R., Witter, R., Kung, H.J., 1993. Retrovirus insertion intoherpesvirus: characterization of a Marek′ s disease virus harboring a solo LTR.Virology 192, 161–169.
Masami, T., Kiyoyasu, I., Hideki, N., Takusi, S., Kisako, G., Hiroyuki, K., 1996. Detectionof contamination of vaccines with the reticuloendotheliosis virus by reversetranscriptase polymerase chain reaction (RT-PCR). Virus Res. 40, 113–121.
Mori, Y., Nagamine, K., Tomita, N., Notomi, T., 2001. Detection of loop-mediatedisothermal amplification reaction by turbidity derived from magnesiumpyrophosphate formation. Biochem. Biophys. Res. Commun. 289, 150–154.
Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase,T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28,e63.
Poon, L.L.M., Leung, C.S.W., Chan, K.H., Lee, J.H.C., Yuen, K.Y., Guan, Y., Peiris, J.S.M.,2005. Detection of human influenza A viruses by loopmediated isothermalamplification. J. Clin. Microbiol. 43, 427–430.
Witter, R.L., Fadly, A.M., 2003. Reticuloendotheliosis. In: Saif, Y.M., Barnes, H.J., Glis-son, J.R., Fadly, A.M., McDougal, L.R., Swayne, D.E. (Eds.), Diseases of Poultry, 11thed. Iowa State University Press, Ames, IA, pp. 517–535.
Witter, R.L., Li, D., Jones, D., Lee, L.F., Kung, H.J., 1997. Retroviral insertional mutagen-esis of a herpesvirus: a Marek′ s disease virus mutant attenuated for oncogenicitybut not for immunosuppression or in vivo replication. Avian Dis. 41, 407–421.
Xu, J.T., Zhang, Z.M., Yin, Y.B., Cui, S.J., Xu, S.Z., Guo, Y.Y., Li, J.D., Wang, J.L., Liu, X.C.,
Han, L.M., 2009. Development of reverse-transcription loop-mediated isother-mal amplification for the detection of infectious bursal disease virus. J. Virol.Methods 162, 267–271.Yamada, Y., Itoh, M., Yoshida, M., 2006. Sensitive and rapid diagnosis of human par-vovirus B19 infection by loop-mediated isothermalamplification. Br. J. Dermatol.155, 50–55.