development and evaluation of a novel multicopy element...

1

Development and evaluation of a novel multicopy element-targeting 1

triplex PCR for Mycobacterium avium subsp. paratuberculosis detection in 2

feces 3

Iker A. Sevilla#, Joseba M. Garrido, Elena Molina, María V. Geijo, Natalia 4

Elguezabal, Patricia Vázquez and Ramón A. Juste 5

Departamento de Sanidad Animal, NEIKER-Tecnalia, Berreaga 1, 48160 Derio, Bizkaia, 6

Spain 7

8

Running title: 9

IS900 & ISMap02 PCR for M. a. subsp. paratuberculosis 10

11

Email addresses: 12

Joseba M. Garrido: [email protected] 13

Elena Molina: [email protected] 14

María V. Geijo: [email protected] 15

Natalia Elguezabal: [email protected] 16

Patricia Vázquez: [email protected] 17

Ramón A. Juste: [email protected] 18

#Corresponding autor: 19

Iker A. Sevilla: [email protected] 20

21

22

AEM Accepts, published online ahead of print on 11 April 2014Appl. Environ. Microbiol. doi:10.1128/AEM.01026-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on April 30, 2018 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

ABSTRACT 23

The enteropathy that mainly affects ruminants called paratuberculosis (PTB) is 24

caused by Mycobacterium avium subsp. paratuberculosis (Map). This worldwide 25

distributed disease reduces significantly cost-effectiveness of ruminant farms, and therefore 26

reliable and rapid detection methods are needed to control the spread of the bacterium in 27

livestock and in the environment. The aim of this study was to identify a specific and 28

sensitive combination of DNA extraction and amplification to detect Map in feces. 29

Negative bovine fecal samples were inoculated with increasing bacterial concentrations of 30

two different strains (field and reference) to compare the performance of 4 extraction and 5 31

amplification protocols. The best results were obtained using JohnePrep and MagMAX 32

extraction kits combined with an in-house triplex real-time PCR designed to detect 33

simultaneously IS900, ISMap02 and an internal amplification control DNA. These 34

combinations detected 10 Map cells per gram of spiked feces. The triplex PCR detected 1 35

fg of genomic DNA extracted from the reference strain K10. The performance of the 36

robotized version of the MagMAX extraction kit combined with the IS900 & ISMap02 37

PCR was further evaluated using 615 archival fecal samples from the first sampling of 9 38

Friesian cattle herds included in a PTB control program and followed-up for at least 4 39

years. The analysis of the results obtained in this survey demonstrated that the diagnostic 40

method was highly specific and sensitive for the detection of Map in fecal samples from 41

cattle and a very valuable tool to be used in PTB control programs. 42

Keywords: Paratuberculosis, cattle, feces, detection, diagnostic methods, DNA, PCR 43

44


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

INTRODUCTION 45

Paratuberculosis (PTB) is a worldwide distributed infectious enteropathy caused by 46

Mycobacterium avium subsp. paratuberculosis (Map) that mainly affects ruminants. It 47

significantly reduces cost-effectiveness of cattle farms due to reduced milk production and 48

early replacement of infected animals(1-4). Recent studies seem to confirm an association 49

between Crohn’s Disease and the etiological agent of PTB(5), and others have 50

demonstrated the presence of viable Map in milk, dairy products, water and meat(6,7). 51

Therefore reliable and rapid diagnostic methods are needed to detect infected animals that 52

contribute to the maintenance and spread of this pathogen both in livestock and in the 53

environment. 54

ELISA and fecal culture have been the most commonly used methods in the 55

diagnosis of PTB. Compared to fecal culture the sensitivity of ELISA is often under 56

30%(8). On the other hand, traditional fecal culture, though considered the gold standard 57

test, is slow and expensive and usually shows low sensitivity as well. Animals shedding the 58

microorganism in their feces can advantageously be identified by means of real-time PCR. 59

However, the presence of low and variable numbers of bacteria in feces and the co-60

purification of PCR inhibitors during DNA extraction are events that can affect the 61

sensitivity of PCR methods. New and more sensitive extraction methods have been 62

developed to avoid these issues. Commercially available kits include specific reagents to 63

remove PCR inhibitors or have greatly improved their DNA-capture technology by using 64

DNA-binding magnetic beads or DNA filters. A good strategy to rule out false negative 65

results due to PCR inhibition is the inclusion of an internal amplification control (IAC) in 66


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

the reaction. In addition to sensitivity problems, some reports have compromised the 67

specificity of IS900(9), the preferred target for PCR detection due to the high number of 68

copies per Map cell. Other Map specific elements like F57(10), Locus251(11) or HspX(12) 69

have been employed as substitutes or for confirmation. These single-copy targets are very 70

interesting for quantification assays but multi-copy elements are presumably better for 71

detection approaches because they increase the chance to detect the pathogen. ISMav2 and 72

ISMap04 are present in three and four copies respectively in the K10 (sequenced reference 73

strain) genome(13). A multi-copy element called ISMap02 with six repeats inserted in the 74

genome of Map seems to be an adequate candidate to complement IS900 based PCR 75

detection because no homologues have been described in other mycobacteria(13). 76

The aim of the present study was to identify the best combinations of some fecal 77

DNA extraction and real-time amplification methods available for a sensitive and specific 78

PCR diagnosis of bovine PTB. In the first part of the study four DNA extraction methods, a 79

quantitative real-time PCR kit and 4 real-time PCR methods were compared on a set of 80

artificially inoculated fecal samples. Genetic targets used for amplification were F57, 81

IS900, ISMav2 and ISMap02. Afterwards the best performing combination of DNA 82

extraction and real-time PCR was chosen to test archival fecal samples obtained from 615 83

animals from 9 Friesian cattle herds included in a PTB control program. 84

MATERIAL AND METHODS 85

1) Comparison of DNA extraction and amplification methods on spiked fecal samples 86

a) Preparation of spiked feces: 87


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

Feces from a PTB-free cow, confirmed by previous results of fecal and tissue 88

culture, serology, histopathology and fecal and tissue PCR, were collected. A low passage 89

field strain (St764) isolated from bovine feces and the reference strain K10 were used to 90

inoculate the negative feces. These strains represent pulsed-field gel electrophoresis 91

(SnaBI-SpeI-PFGE) and multi-locus short-sequence repeat (G_GGT) genotypes 14_5&1-1 92

and 7_4&2-1, respectively. These profiles cluster into the Cattle type (or Type II) group of 93

Map and are dominant in our area(14,15). Glycerol stocks of the strains were grown in 94

Middlebrook 7H9 broth supplemented with OADC enrichment (Becton, Dickinson and 95

Company, MD, USA) and mycobactin J (Allied Monitor, Inc., Fayette, MO, USA). When 96

sufficient growth was obtained, cells were harvested by centrifugation at 2,800 x g. Pellets 97

were washed twice in phosphate buffered saline (PBS) and finally resuspended in 5 ml of 98

PBS. Bacterial suspensions were mechanically declumped by making the liquid flow up 99

and down through a needle (26G3/8) several times. Cell number in the inocula of both 100

strains was estimated by visual direct count in a Neubauer chamber and concentration 101

adjusted to 108 cells/ml. Ten-fold serial dilutions of this suspension were carried out to a 102

final inoculum containing 100 cells per ml. Suspensions were flowed up and down through 103

the needle in all steps to avoid re-clumping of cells. One-gram fecal aliquots were prepared 104

and spiked with 0.1 ml of the appropriate inoculum to obtain samples ranging from 10 to 105

107 cells/g of feces in triplicate with both strains. Spiked samples were frozen at -20ºC until 106

used. 0.1 ml of each dilution was also plated onto 4 agar solidified-Middlebrook 7H9 flasks 107

to assess colony forming units (CFU) in the original inocula. 108

b) DNA extraction methods 109


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

Four different DNA extraction procedures were used: a modified QIAamp® DNA 110

Stool Mini Kit (Qiagen), the JohnePrepTM kit (Kyoritsu Seyaku, Shimadzu Corp., Kyoto, 111

Japan), the Adiapure ® kit (Adiagene, Saint Brieuc, France) and the manual version of 112

MagMaxTM Total Nucleic Acid Isolation Kit (Ambion - Applied Biosystems, Foster City, 113

CA, USA). Extraction negative controls were included in first, middle and last position of 114

all extractions carried out. All DNA extraction kits were used as indicated by the 115

manufacturer with the exception of the modified QIAamp® DNA Stool Mini Kit (Qiagen) 116

that was used as described previously(16). Aliquots of DNA samples from all extraction 117

methods were prepared and stored at -20ºC until used in downstream PCR assays. 118

c) Real-time PCR methods 119

ParaTB-Kuanti-VK quantitative PCR kit (Vacunek SL, Derio, Spain), TaqMan® 120

MAP (Applied Biosystems) and Adiavet PTB (Adiagene) real-time PCR kits and two 121

home-made triplex real-time PCR methods were employed. The three replicate purified 122

DNA samples derived from all extraction methods were submitted to PCR amplification 123

with ParaTB-Kuanti-VK kit and both home-made PCR systems, while TaqMan® MAP and 124

Adiavet PTB PCR kits were only used with extracts obtained with their corresponding 125

extraction kit (MagMax® and Adiapure). All PCR systems included an internal 126

amplification control (IAC) and ROX dye as passive reference reporter. Samples were 127

always tested in duplicate for every combination. All plates included two negative PCR 128

controls, in the first and last well. A standard amplification program consisting of one 129

denaturation and polymerase activation cycle of 10 minutes at 95ºC , and 45 cycles of 130

denaturation at 95ºC for 15 seconds and annealing/extension at 60ºC for 1 minute was used 131

for every PCR method in a 7500 Real-Time PCR instrument (Applied Biosystems). Results 132


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

were analyzed using the 7500 System SDS software v. 1.4 (Applied Biosystems). Values 133

for threshold cycle (Ct) and baseline were automatically determined by the software and 134

visually confirmed checking amplification plots. 135

c.1) ParaTB-Kuanti-VK quantitative PCR kit 136

This quantitative PCR kit was tested for its ability to detect Map but also served as a 137

reliable indicator of the efficiency of DNA extraction protocols. The targeted genomic 138

sequence is the single-copy gene F57. Five µl of DNA samples were added to 45 µl of PCR 139

premix in duplicate. Dyes for target and IAC probes are 6-FAM-BHQ1 and JOE-BHQ1, 140

respectively. Serial dilutions of a standard control provided with the kit were performed 141

using 10 mM Tris-HCl pH 8. Standard controls with final concentrations ranging from 107 142

to 10 copies of F57 were loaded in triplicate in every plate in order to quantify the number 143

of Map genomes in each sample. Only results obtained in plates with standard curves 144

showing a slope between -3.4 and -3.67 and R2 values above 0.998 were considered. In 145

order to estimate the number of genome copies quantified in one gram of feces for each 146

sample the following mathematical operations were done assuming an ideal homogeneous 147

distribution of Map in spiked samples: quantification results were divided by 5 (5 μl of 148

DNA extract loaded into each PCR reaction) and multiplied by the total volume of elution 149

(modified QIAmp® DNA stool kit: 200 μl; JohnePrep: 50 μl; Adiapure: 100 μl; MagMax: 150

50 μl) to assess the number of F57 copies estimated for the whole volume of DNA extract. 151

Extracts represented different volumes of resuspended fecal material according to each 152

DNA extraction protocol (modified QIAmp® DNA stool kit: each DNA extract represented 153

1.3 ml of a mixture containing 1 g of feces resuspended in 5 ml; JohnePrep: extracts 154

represented 1 ml of a mixture containing 1 g of feces resuspended in 20 ml; Adiapure: 155


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

extracts represented 0.3 ml of a mixture containing 1 g of feces resuspended in 20 ml; 156

MagMax: extracts represented 0.175 ml of a mixture containing 1 g of feces resuspended in 157

3.33 ml. Thus, the number of copies calculated for DNA extracts was multiplied by the 158

corresponding volume used to resuspend 1 g of feces and divided by the starting volume 159

used in each case. 160

c.2) F57 & ISMav2 real-time PCR system 161

This triplex PCR was performed under conditions previously described by 162

Schonenbrucher et al.(16). Locked nucleic acid (LNA; Sigma-Aldrich Co. Ltd., Haverhill, 163

UK) and minor groove binder (MGB; Applied Biosystems) probes were used for this assay. 164

Reactions included 1X TaqMan Universal PCR MasterMix no amperase UNG (Applied 165

Biosystems), 0.3 µM of F57 forward and reverse primers, 0.2 µM of ISMav2 forward and 166

reverse primers, 0.25 µM of F57 LNA probe (JOE-cCt gAc Cac CctT-BHQ1), 0.25 µM of 167

F57 IAC MGB probe (NED-CGA GTT ACA TGA TCC C-MGB), 0.25 µM of ISMav2 168

LNA probe (FAM-cGc tGa GtT cCt TaG-BHQ1), 175 copies of IAC DNA and 5 µl of 169

DNA extract in a total volume of 50 µl. 170

c.3) IS900 & ISMap02 real-time PCR system 171

This triplex PCR combined the detection of IS900 with previously described 172

primers and probe(17) and detection of ISMap02 with primers and probe that were 173

designed for this study and previously reported(18) assisted by Primer Express® software 174

v. 3 (Applied Biosystems) (Table 2). ISMap02 consensus sequence was determined by the 175

alignment of all ISMap02 sequences available in public DNA sequence databases. 176

Oligonucleotides were designed and checked by BLAST procedure (National Center for 177


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

9

Biotechnology Information) in order to avoid possible homologies with other sequences. 178

DNA of different Map strains and DNA of other mycobacteria and other non-mycobacterial 179

species were submitted to PCR using these probes and primers to assess the specificity of 180

the assay (See Table 1). 181

An IAC was designed and constructed to be co-amplified with ISMap02 primers. 182

Briefly, two complementary single stranded DNA molecules containing the sequences for 183

ISMap02 forward and reverse primers in their 5’ ends were synthesized (Sigma-Aldrich) 184

and annealed. This double stranded molecule was amplified under standard PCR conditions 185

using ISMap02 primers. The amplicon was purified after visualization in a 3% agarose gel 186

stained with GelRedTM (Biotium, Inc., Hayward, CA, USA) using QIAquick Gel Extraction 187

Kit (QIAGEN). The purified product was then cloned into a pCR®4-TOPO® plasmid 188

vector using the TOPO TA Cloning® Kit (Invitrogen, Ltd., Paisley, UK). The plasmid was 189

purified from transformed E. coli cells with illustra™ plasmidPrep Mini Spin Kit (GE 190

Healthcare Europe GmbH, Barcelona, Spain) and linearized using SnaBI endonuclease 191

(New England Biolabs, Inc., Beverly, MA, USA). After re-purification of the digested 192

plasmid DNA concentration was measured. Appropriate amount of plasmid yielding Ct 193

values between 33 and 36 in non-inhibited triplex PCR assays was calculated doing serial 194

dilutions of the purified plasmid. 195

Final PCR mixture contained 1X TaqMan Universal PCR MasterMix no amperase 196

UNG (Applied Biosystems), 0.4 µM of ISMap02 primers (each), 0.3 µM of IS900 primers 197

(each), 0.2 µM of ISMap02, IAC and IS900 probes (each), 20 copies of IAC DNA and 5 µl 198

of extracted DNA in a total volume of 50 µl. Sequences of primers and probes used in this 199

PCR are shown in Table 2. 200


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

10

The analytical sensitivity of this PCR was additionally assessed using 10-fold serial 201

dilutions of a solution containing 10 ng/µl of DNA extracted from K10 reference strain as 202

measured on a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc., 203

Wilmington, DE, USA). DNA concentration was used to calculate the number of Map 204

genomes present by the following formula and taking into account that one genome of Map 205

K10 is 4,829,781 bp in length and that it contains 17 copies of IS900 and 6 copies of 206

ISMap02(13): 207

DNA molecule copy no. = (DNA ng x 6,023E+23) / (bp length x 1E+09 x 660) 208

c.4) TaqMan® MAP real-time PCR kit 209

The assay targets a unique sequence element in the Map genome other than IS900, 210

but it is not specified in the kit. The reaction mixture consisted of 25 µl containing 1X 211

qPCR Master Mix, 1X MAP Primer Probe Mix and 2.5 µl of DNA extract. TaqMan® 212

reporter dyes and quenchers are FAMTM-BHQ1 and Cal Fluor® Orange 560-BHQ1 for 213

target and IAC (XenoTM DNA control), respectively. 214

c.5) Adiavet PTB real-time PCR kit (Adiagen; previous version) 215

This PCR amplifies a region of IS900 insertion element. Two µl of purified DNA 216

were added to 23 µl of ready-to-use PCR premix. Target and IAC probes are labeled with 217

FAM and VIC dyes. 218

d) Culture of spiked feces 219

Frozen replicates of previously prepared one g fecal aliquots of all levels of 220

inoculation were decontaminated with 0.75% hexadecyl-pyridinium-chloride (w/v) and 221


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

11

cultured on Herrold’s egg yolk (HEY) and agar-Middlebrook 7H9 flasks as described 222

elsewhere(19). Flasks were incubated at 37ºC for 7 months. 223

e) Analysis of PCR results 224

In order to obtain more robust results for both DNA extraction and amplification 225

procedures, duplicate PCR results corresponding to the three DNA extraction replicates 226

were grouped making up a total of 6 DNA extraction-amplification replicates. Mean Ct 227

values and standard deviations corresponding to each inoculated Map/g of feces were 228

calculated for every DNA extraction and PCR system combination. In the case of 229

ParaTBKuanti-VK quantitative PCR these results and linear regression curves were plotted 230

and analyzed with a 95% confidence interval using the SigmaPlot v10.0 software (Systat 231

Software, Inc.). 232

2) Evaluation of the chosen combination using samples from naturally infected cattle 233

To assess the performance of the combination of molecular methods chosen (i. e. 234

MagMax kit for DNA extraction and IS900 & ISMap02 PCR for amplification) archival 235

fecal samples were used. This DNA extraction method was chosen because in the study 236

with spiked feces it was determined to be one of the most sensitive protocols (the same 237

reason as for the PCR system selected) and because an automated version was available. 238

Six-hundred and fifteen bovine fecal samples collected between 2006 and 2007 in a PTB 239

control program were used for this part of the study. Specimens belonged to the first 240

sampling of two control or “test and cull” herds (“TC” group; 319 samples) and 7 241

vaccinated herds (“VH” group; 296 samples). Animals that were in the vaccination group 242

were vaccinated 3 days after the M0 sampling. All herds had previous records of PTB 243


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

12

showing annual incidences of clinical PTB between 2 and 5% (animals with clinical 244

symptoms of PTB confirmed after necropsy). These herds were analyzed using 245

conventional ELISA (Pourquier, Montpelier, France), IS900-PCR (the first version of 246

Adiavet, Adiagene) and culture (home-made HEY and Lowenstein-Jensen media) before 247

the beginning of the project (M0: month 0) and were followed up annually using the same 248

methods for at least 4 years more except for one of the vaccinated herds. Only (-20ºC) 249

stored samples obtained during the first sampling of the control program (M0) were re-250

submitted to DNA extraction and amplification using the combination of methods chosen. 251

Follow-up sensitivity and specificity of IS900 & ISMap02 PCR was estimated for both TC 252

and VH groups comparing the results obtained for M0 samples with a reference result that 253

combined all results of conventional methods for all samplings. Thus, the reference result 254

was considered positive when the animal was positive to at least one of these tests in any of 255

the samplings carried out and negative if all tests performed during the 4-year follow-up 256

were negative. Complete necropsy results were also available for 36 and 33 animals from 257

TC and VH groups, respectively. This information coupled with the data obtained during 258

the follow-up provided a final thorough classification of these 69 animals. 259

In order to make results more informative, triplex real-time PCR, ELISA, 260

conventional fecal PCR, culture, and histopathology results were given a number according 261

to the following categories: IS900 & ISMap02 real-time PCR (mean Ct-s of ISMap02 and 262

IS900): 3 or heavy shedder for Ct values lower than or equal to 31, 2 or intermediate 263

shedder when Ct-s were between 31 and 35, 1 or low shedder if Ct-s were higher than 35 264

and 0 or non-shedder when these values were undetermined (amplification curve not 265

crossing the threshold line or absent). ELISA: 3 or highly reactive when %E/P was higher 266


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

13

than or equal to 180, 2 or intermediate-highly reactive when %E/P was lower than 180 and 267

higher than or equal to 70, 1 or intermediate or inconclusive when %E/P was lower than 70 268

and higher than or equal to 60 and, finally 0 or low/non-reactive if %E/P was lower than 269

60. Conventional PCR results could not be further classified: 1 was used to indicate a PCR 270

positive result (amplicon present) and 0 to indicate a PCR negative result (amplicon 271

absent). Fecal/tissue culture: 3 or heavy shedder or high bacterial burden when 50 or more 272

colonies were counted per tube, 2 or intermediate shedder or intermediate bacterial burden 273

when the colony counts were between 50 and 10, 1 or low shedder or low bacterial burden 274

if there were less than 10 colonies per tube and finally, 0 or non-shedders or culture 275

negative if culture did not yield any colonies. Ileocecal lymph node, ileocecal valve and 276

jejunum were cultured separately for tissue culture. Histopathological findings(20): 2 for 277

patent forms (PF), encompassing diffuse multi-bacillary, diffuse intermediate, diffuse 278

pauci-bacillary lesions and multifocal lesions(21), 1 for latent forms (LF) or focal lesions 279

and 0 for apparently free (AF) of PTB (i.e. when no PTB-compatible lesions were 280

observed). 281

An automated version adapted to the BioSprint 96 workstation (Qiagen) was 282

performed for DNA extraction. Briefly, 0.3 g of sample was mixed with 1 ml of PBS and 283

vigorously vortexed for 3 minutes. The mixture was centrifuged at 100 x g for 1 min to 284

discard the heaviest fecal material. 175 µl of the liquid phase was transferred into tubes 285

containing 235 µl of lysis/binding solution and zirconia beads. Tubes were bead-beaten at 286

30 Hz for 10 minutes in a Tissue Lyser (Qiagen). After centrifugation at 16,000 x g for 3 287

minutes 300 µl of supernatant was transferred into 1.5 ml microcentrifuge tubes. Samples 288

were further clarified by centrifugation at 16,000 x g for 6 minutes and 115 µl of 289


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

14

supernatant was transferred into sample plate wells containing 20 µl of magnetic bead mix. 290

Immediately 65 µl of 100% isopropanol was added and the mixture homogenized. Wash 291

solution plates in duplicate (150 µl of washing reagents per well), elution plate (90 µl of 292

elution buffer per well) and sample plate were prepared according to the instructions of the 293

manufacturer and loaded into the BioSprint workstation. AM1840_DW_50v2 protocol was 294

run and the elution plate containing DNA extracts was stored at -20 ºC until used. Three µl 295

of DNA was used for IS900 & ISMap02 real-time amplification in reactions of 25 µl under 296

the same conditions described before. Three DNA extraction negative controls (distributed 297

in the first, middle and last positions of the processing plate) and two no template PCR 298

negative controls were included in each PCR plate. Two PCR positive controls obtained by 299

diluting DNA extracted from K10 strain and yielding 32-34 Ct values were loaded in each 300

plate and used as a reference of performance. This time only samples yielding Ct values 301

below 40 for both IS900 and ISMap02 probes were considered as positive. 302

RESULTS 303


CFU/ml concentration of stock inocula containing 108 cells/ml according to 305

Neubauer counts was 1.24x107 (standard deviation: 3.33x106) in case of the field strain and 306

2.24x106 (standard deviation: 4.98x105) in case of the reference strain, as assessed by agar-307

7H9 plate counts. A difference of one to two logs was observed between Neubauer and 308

plate counts. 309

a) ParaTB-Kuanti-VK quantitative PCR kit 310


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

15

Quantification results are summarized in Figure 1. With reference to the extraction 311

protocols, JohnePrep and MagMax extraction kits showed the best correlation values 312

between inoculated and quantified cells per gram of feces. The coefficients of correlation 313

(R2) obtained from linear regression curves plotted for both field and reference strains were 314

0.9952 and 0.9742 for the JohnePrep kit, and 0.9922 and 0.9887 for the MagMax kit. 315

According to standard deviation results of replicates and omitting samples with the lowest 316

bacterial burden these kits also provided better reproducibility than the other two kits. 317

Regarding the detection/quantification limits using these DNA extracts, the lowest bacterial 318

concentration at which the PCR quantified copies of F57 was 104 cells per gram of feces or 319

1.24x103 CFU/g of feces (field strain) and 2.24 x102 CFU/g of feces (reference strain), 320

depending on the method used as reference to assess bacterial burden of inocula used to 321

spike negative feces (Neubauer direct counts or CFU plate counts). Overall, ParaTB-322

Kuanti-VK kit quantified Map genome copies 1 log below the number of bacteria 323

inoculated per gram of feces (considering Neubauer direct counts as reference) when DNA 324

extracted with JohnePrep, Adiapure and MagMax kits was tested and at least 2 logs below 325

when the tested DNA was purified with Qiamp Stool Kit. 326

b) F57 & ISMav2 real-time PCR system 327

Results obtained using this PCR are shown in Table 3. Some amplification was 328

detected in extracts obtained with JohnePrep and MagMax kits from feces inoculated with 329

103 cells per gram but the detection limit could only be consistently established at 104 Map 330

cells per gram of feces according to bacterial concentrations assessed by Neubauer counts. 331

DNA samples obtained with JohnePrep and MagMax kits yielded the lowest mean Ct 332


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

16

values at all inoculation levels. Although the difference was not big, mean Ct values 333

obtained for probe F57 were lower than those obtained for probe ISMav2. 334

c) IS900 & ISMap02 real-time PCR system 335

According to the results of all tested bacterial isolates (Table 1), the primers and the 336

probe designed for the sequence ISMap02 were 100% specific. Only Map strains yielded 337

positive results regardless of their origin or genotype. No amplification was obtained with 338

the remaining species and subspecies tested. No cross-hybridization with other 339

oligonucleotides was detected in the triplex PCR containing all the ingredients. 340

Regarding the analytical detection limit and according to the results of the serially 341

diluted DNA of K10 strain, the minimum DNA amount needed to be detected by both 342

IS900 and ISMap02 probes was 1 fg (see bottom of Table 4). This is equivalent to 0.07-343

0.19 organisms or 1.13 copies of ISMap02 and 3.21 copies of IS900. 344

Mean Ct values with standard deviations for all 4 extraction methods and both 345

strains using this PCR are shown in Table 4. Although amplification could be detected in 346

feces inoculated with 10 Map cells per gram of feces extracted with JohnePrep and 347

MagMax kits and according to concentrations calculated on the basis of direct counts, the 348

detection limit was consistently established at 100 cells/g. The lowest Ct values were 349

obtained with JohnePrep and MagMax kits. In general IS900 was detected before ISMap02 350

but the difference was very small. 351

d) TaqMan® MAP and Adiavet PTB kits 352


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

17

These PCR assays were performed only with DNA extracted using the extraction kit 353

recommended and manufactured by the same companies. In Table 5 mean Ct values with 354

standard deviations calculated for every bacterial concentration for both kits and both field 355

and reference strains are shown. MagMax extraction kit combined with TaqMan MAP PCR 356

detected Map 1 level of inoculation earlier than Adiapure & Adiavet PCR combination did. 357

In the case of the feces spiked with the field strain the first combination detected the 358

mycobacteria in one of the 6 PCR replicates containing 100 Map/g of feces. The detection 359

limit for the same combination applied to the reference strain spiked feces was 1,000 Map 360

per gram. Ct values obtained with this combination were always lower than those obtained 361

with the Adiapure & Adiavet combination. 362

e) Culture of spiked feces 363

When the number of bacteria inoculated was calculated according to visual direct 364

counts, only samples inoculated with 105 (field strain) and 106 (reference strain) cells or 365

more yielded visible colonies on HEY and agar-Middlebrook 7H9. According to CFU 366

counts of inocula plating these values will indicate that the detection limit of the culture 367

method employed was approximately 104 spiked CFUs of Map per gram of feces. 368


The combination of MagMax and IS900 & ISMap02 PCR detected 152 positive 370

fecal samples, 87 in TC herds and 65 in VH herds. These results yielded a positive 371

proportion of 27.27% amongst TC herds, 21.96% in the VH group and 24.72% when both 372

animal groups were considered. Previously obtained prevalence values considering an 373

animal as positive when positive to at least one of the techniques used (ELISA, 374


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18

conventional PCR and culture) were 15.12% as a whole, and 12.23% and 18.24% for each 375

group, respectively. 376

Categorized and grouped results together with follow-up sensitivity and specificity 377

estimations for each group are shown in Table 6. In the case of animals that were not 378

vaccinated after M0 (TC group), 66.7% of PCR positives fell within IS900 & ISMap02 379

PCR category 1 (or low shedder), 16.1% within category 2 (or intermediate shedder) and 380

17.2% within category 3 (or heavy shedder). Similarly, these figures were 63.1%, 29.2% 381

and 7.7% in the case of animals that underwent vaccination after M0 sampling (VH). More 382

than 85% and 91% of animals in category 0 from TC and VH herds remained as PTB 383

negative in subsequent samplings, respectively. In the VH group, this proportion does not 384

include 3% of animals that were ELISA positive in M0 and negative in the rest of 385

samplings. At least 43.1% (TC group) and 58.5% (VH group) of animals that fell in 386

category 1 could be confirmed as PTB positive for any of the samplings carried out. With 387

reference to animals included in category 2, 71.4% belonging to the TC group and 84.2% 388

belonging to the VH group got a final classification of PTB positive. The latter percentages 389

do not include 3 cows that could not be deemed as PTB positive because no sample could 390

be collected when they were slaughtered but they did show typical PTB symptoms, so this 391

percentage could rise up to 92.7%. Correspondingly, the percentage for VH herds does not 392

include an extra 10.5% of animals that were positive for conventional PCR and culture at 393

M0 but were PTB negative in successive samplings. 394

Table 7 summarizes case by case whole result panel of the 69 animals necropsied. 395

All PTB negative cases were in the 0 (negative) category of the IS900 & ISMap02 PCR 396

except one particular animal in the vaccinated group (27vh). Eight of the TC animals in this 397


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

19

category (11tc-18tc), although negative also for all conventional tests in M0, turned out to 398

be positive to at least one of these tests in M12. Four of them (11-13tc and 18tc) were only 399

positive after necropsy, carried out between M0 and M12. In the vaccinated group 9 400

animals (13vh-21vh) that fell in category 0 were later confirmed to be PTB positive. All 401

animals included in categories from 1 to 3 got a final classification of PTB positive except 402

the above mentioned particular case (27vh). 403

DISCUSSION 404


The difference observed between Neubauer and plating counts of the inocula 406

prepared to spike the fecal samples could be due to several issues like inaccuracy of visual 407

direct counts in a Neubauer chamber, presence of dead or dormant cells that did not grow 408

or persistence of cell clumps that only yield one CFU. This finding is in agreement with 409

previous reports(22) showing significant differences between distinct quantification 410

techniques. A direct counting method able to distinguish between dead or inactive and 411

viable or active cells could yield a greater agreement between methods. But dead or 412

dormant cells will still pose a problem if the DNA they harbor is intact. 413

With reference to the DNA extraction methods compared, gross differences were 414

observed between methods. According to amplification results of all PCR methods used (all 415

PCR methods were in agreement) MagMax and JohnePrep DNA extraction methods 416

showed the highest sensitivity for the purification of Map’s DNA from bovine feces. In the 417

present study DNA concentration and purity of extracts was not measured because we think 418

this will not lead to the identification of the best methods for the DNA purification of this 419


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

20

pathogen from fecal specimens. Though being valuable information for other purposes, it 420

would only inform about the amount and purity of total DNA purified using different 421

methods. This total DNA includes DNA from the host and from other micro-organisms that 422

are irrelevant to the purpose of this study. Apart from the information obtained from all 423

PCR sets, a quantitative PCR targeting a single-copy gene of Map (ParaTB-kuanti-VK Kit) 424

was used to assess the ability of each DNA extraction method to purify Map’s DNA from 425

feces. In addition this kit also includes an internal amplification control to avoid false 426

negative results and obtain some information on the purity of the extracted DNA. As shown 427

by the results obtained using ParaTB-kuanti-VK quantitative PCR, JohnePrep and MagMax 428

kits were the extraction methods that performed best. This observation is supported by the 429

high R2 values obtained from linear regression curve analyses (Figure 1) and particularly 430

relevant taking into account that these results are from DNAs extracted from spiked fecal 431

samples and not from pure genomic DNA. Other authors have previously demonstrated the 432

good performance of JohnePrep Kit using ovine fecal samples(23). In a recent study the 433

MagMax Kit also exhibited efficient extraction results(24). Conversely, in our study the 434

modified Qiamp Stool Kit did not perform as fine as previously reported by other 435

authors(16,24). The modified protocol was followed as indicated by Schonenbrucher et 436

al.(16). A possible explanation could be the different nature of the negative feces used to 437

inoculate Map in each study or slight differences in handling of samples and reagents by 438

different operators during the extraction process. 439

Although ParaTB-kuanti-VK Kit was not the amplification method showing the 440

highest sensitivity, it was not lower than other systems tested. Overall, ParaTB-Kuanti-VK 441

kit quantified Map genome copies per gram of feces 1 log below the number of bacteria 442


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

21

inoculated when direct count of cells in the inocula used to spike feces are considered the 443

reference. This PCR is able to correctly identify at logarithm level the CFUs of Map present 444

in a sample when working with pure cultures(22). If the origin of the DNA type tested in 445

the present work (inoculated bovine fecal samples) is taken into account, these 446

quantification results can be considered to display a highly acceptable accuracy. 447

The F57 & ISMav2 PCR system was able to detect 103-104 cells per gram of feces 448

according to Nebauer counts but 102-103 CFU per gram of feces according to plate counts. 449

This is partly in agreement with the findings reported in the original study using this 450

amplification system when spiked bovine fecal samples were tested(16). But it seems that 451

this PCR did not show the same efficiency shown previously. In that study different PCR 452

master mixes, oligo vendors and probe chemistries were compared as well. In our study 453

only one of the possible combinations was used with slight differences in probe dye 454

formulation. As stated in the “material and methods” section, we used TaqMan Universal 455

PCR MasterMix No Amperase UNG (Applied Biosystems), forward and reverse primers 456

for each target (Sigma-Aldrich), F57 LNA probe (JOE-BHQ1; Sigma-Aldrich), IAC MGB 457

probe (NED-MGB) and ISMav2 LNA probe (FAM-BHQ1). It is likely that our ingredient 458

combination performed slightly worse than in the previous work. This difference could also 459

explain why F57 (single copy per Map genome) probe exhibited lower Ct values than 460

ISMav2 (at least 3 copies per genome) probe. 461

IS900 & ISMap02 PCR showed the lowest detection limit (up to 10 Map cells as 462

counted in a Neubauer chamber or 1 CFU as assessed CFU plate counts) when combined 463

with MagMax and JohnePrep DNA purification methods. These could be consistently 464

established at 100 inoculated Map cells per gram of feces. When the sensitivity of this 465


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

22

system was analyzed using serial dilutions of genomic DNA extracted from K10 reference 466

strain, the minimum detectable limit was 1 fg. In other terms, the equivalent of less than 467

one Map organism can be detected thanks to the multi-copy nature of the genetic targets 468

used. The analytical sensitivity of this test was similar to or higher than previously 469

published PCR methods for the detection of Map. ISMap02 mean Ct values for samples 470

with the lowest bacterial burden were a bit lower than the ones corresponding to IS900. It 471

could seem striking but if the number of positive replicates and the remaining results are 472

analyzed in minute detail, it is readily regarded to be an effect of a higher amplification 473

efficiency of the ISMap02 component of the system over the IS900 component. It must be 474

taken into consideration that the IS900 component of the assay is a much older design(17) 475

that was not changed because it worked fine in the single-plex format. As far as we know 476

this PCR system is the first triplex real-time PCR that combines the detection of these two 477

multi-copy elements and an IAC for the detection of Map(18). In the most recent study 478

mentioned earlier(24) both IS900 and ISMap02 are used to detect Map, but separate real-479

time PCRs were used to amplify these targets and no control was included to monitor 480

amplification reaction inhibition. In addition, a conventional nested pre-amplification of 481

ISMap02 was carried out followed by a real-time amplification of the products obtained in 482

the first round. As authors stated a nested PCR system is more likely to suffer from cross-483

contamination events and yield false-positive results. 484

During the field evaluation part of the present work several samples yielded 485

repeated IS900 positive results that could not be confirmed as Map positive by the detection 486

of ISMap02. Some cases were considered as a lack of sensitivity of ISMap02 compared to 487

IS900 due to the late Ct values recorded for IS900. But four of these results were deemed as 488


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

23

a lack of specificity of this part of the PCR because Ct values for IS900 were lower and 489

with such values we normally expect positive Ct readings for ISMap02 as well. This fact 490

highlights the usefulness of targeting not only IS900 but also other sequences pertaining to 491

Map. 492

Between the two DNA extraction kits that had proprietary amplification kits, 493

MagMax & TaqMan Map combination yielded the best results. This combination displayed 494

good sensitivity results and performed better than some in-house protocols. However, it 495

should be noted that the Adiavet PCR kit studied here is not the latest version developed by 496

Adiagene, and as far as we know there is a more recent version available. Collectively, it 497

can be concluded that there are interesting ready-to-use commercial tools for the 498

quantification (ParaTBKuanti-VK) and detection of Map available in the market. 499

2) Culture of spiked feces 500

The detection limit observed in the present study seems to be quite high. This lack 501

of sensitivity is likely to be due to cell viability loss, dilution effect during artificially 502

inoculated sample preparation and the use of a relatively insensitive culture protocol. 503

Strains were grown in 7H9, resuspended in PBS and directly inoculated into the fecal 504

material. Spiked samples were then frozen and stored at -20º C until they were processed 505

for culture. They were blended with HCP (1 g of feces in 19 ml of 7,6 g/l HCP) and only 506

the half of this mixture (10 ml) was subjected to decontamination (18 hours) and 507

concentration. No centrifugation steps were carried out for bacterial concentration, material 508

to inoculate tubes was obtained by sedimentation during incubation with HCP. CFU 509

numbers in the inocula indicated by the plating method were lower than those estimated by 510


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

24

direct counting method. This difference is responsible for a reduction of at least 1 to 2 logs 511

in culturable Map spiked in the fecal samples. 512


At first sight it seems that the selected combination of DNA extraction and 514

amplification method is unspecific. But if results are analysed in depth, it is clear that more 515

than a lack of specificity of the selected detection system it could be that old conventional 516

methods failed to detect many Map infected animals thus showing a very low sensitivity. 517

The estimations given in Table 6 for sensitivity and specificity could be misleading because 518

as explained before the results obtained with this method were compared to a “combined 519

reference method” that considered as positive any positive result to the rest of the tests used 520

during all samplings. The vast majority (more than 85%) of animals included in IS900 & 521

ISMap02 PCR category 0 remained as PTB negative during the following years. Most of 522

animals yielding a PCR positive result fell within category 1 or low shedder category 523

(IS900 & ISMap02 PCR). Considering TC and VH herds as a whole, almost 50% of cows 524

that fell in category 1 were confirmed PTB cases during the follow-up. But this proportion 525

could still be much higher because we missed relevant information on the final PTB status 526

of at least 24% of animals in category 1 from TC herds. It could additionally be higher 527

since 12.2 % of animals in this category from VH group were ELISA positive 528

(intermediate-highly reactive) at M0 sampling though they became negative in subsequent 529

samplings. This could be attributed to the beneficial effect of vaccination against the 530

progression of PTB and is applicable to all follow-up data obtained from VH herds. In case 531

of animals included in category 2, if the three cattle (3 of 14) from TC group suspected of 532

being slaughtered for PTB that could not be tested and the two cows (2 of 19) from VH 533


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

25

group that were positive to fecal culture and conventional PCR at M0 are considered as 534

PTB positive, only one cow per group yielded negative results in the remaining samplings. 535

The negative results obtained during the following 4 years for the cow belonging to the VH 536

herd could be attributed to the vaccine as suggested above. But the case in TC group seems 537

more difficult to explain with reliability. Reasons that could account for this apparent lack 538

of specificity other than an unlikely identification error when samples were collected, 539

stored or processed, include a potential cross-contamination during processing of samples 540

(although controls were always included) and the possibility of being an atypical case. 541

Other researchers have shown higher positive proportion values than those expected 542

according to previous results or to those obtained by the use of conventional tests and have 543

attributed this effect to the low sensitivity of such diagnostic methods(23). It is also 544

accepted that cells of this persistent pathogen can be ingested and shed passively or be 545

considered as “pass through” bacteria that go through the gut of the host and are shed for 546

some days after being ingested(23,25,26). As shown by other authors most Map infected or 547

carrier cattle seem to show only focal lesions according to careful anatomopathological 548

processing after necropsy(20), probably because the majority of Map infected animals fall 549

in the latent category (LF) and are more or less resistant and able to contain the propagation 550

of bacteria in their tissues especially when the bacterial load of the contact has been low. 551

The specific and sensitive performance of the detection method used is further 552

confirmed with data of the 69 animals that could be followed up throughout their life until 553

they were slaughtered and necropsied (see Table 7). All animals that were considered 554

positive by this system were sooner or later confirmed as positive except for one case (27v). 555

This particular animal fell within category 1 in M0 sampling. It was vaccinated after being 556


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

26

sampled at M0 and was slaughtered between M0 and M12. This positive result is more 557

likely to be a true positive, more than an unspecific result because the rest of results suggest 558

that animals can be detected by this method but not always by the ELISA, conventional 559

PCR and culture methods used and can only be confirmed after several samplings or at 560

necropsy. Additionally, vaccination against Map has been shown to reduce the bacterial 561

load in tissues and feces and the lesions produced by this bacterium(27-29). There were 562

mainly 8 TC and 9 VH cases that could slightly compromise the high sensitivity attributed 563

to this molecular test. But these were only confirmed to be PTB positive in subsequent 564

samplings or after necropsy. Moreover, the majority of cases only confirmed after necropsy 565

exhibited low and/or 0 culture and histopathology scoring. 566

Overall comparison of sensitivity and specificity suggest a better performance of the 567

test in vaccinated herds than in control herds. This fact leads us to think that the problem in 568

control herds is more a lack of detection of infected animals that later were shown to be 569

positive, than a lack of specificity in vaccinated herds. A reliable explanation could be that 570

animals undergoing vaccination strategy display a more constant immune status and 571

shedding pattern during following samplings as an effect of vaccine administration 572

compared to the more variable immune status and intermittent shedding in animals from 573

control herds. This deserves further research that falls out of the scope of the present report. 574

Results obtained with this detection method showed very high sensitivity and 575

specificity in a blind ring-trial carried out during the ParaTBTools international Specific 576

Targeted Research Project (FOOD-2004-T5.4.6.10, The final report, Dowe Bakker et al., in 577

preparation). Fourteen negative and 22 positive fecal specimens were tested by each partner 578

laboratory. All negative samples were negative to this detection method and 21 were 579


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

27

identified as positive. The remaining sample was considered inconclusive because the Ct 580

values obtained were above 40. 581

When taking all information into consideration, it must be noted that fecal real-time 582

PCR results should be analysed with caution because all animals identified as Map 583

shedders might not develop clinical signs of PTB, especially those in which Map has been 584

detected at very low concentrations. A positive result will always indicate the presence of 585

the pathogen in the sample, the animal, the herd or the area tested but not necessarily the 586

disease status of an animal. Conclusively, we present a reliable, specific and sensitive 587

combination of DNA extraction and amplification to detect Map in feces. On top of that, 588

the classification of animals according to their fecal PCR result in different categories that 589

we have used in this work, though not being important to confirm PTB of suspicious cases, 590

provides researchers with a very interesting tool to be used in PTB control programs, 591

especially when the control strategy includes vaccination. 592

ACKNOWLEDGEMENTS 593

Part of this study was funded by the European Commission (ParaTBTools Specific 594

Targeted Research Project; FOOD-2004-T5.4.6.10). Many of the samples and follow-up 595

results from herds included in the PTB control program and used in the present work were 596

obtained during the IparGenBov Research Project (AGL2006-14315) supported by the 597

Ministerio de Economía y Competitividad of the Spanish Governement. The study was 598

partially supported with funds from the Departamento de Medio Ambiente, Planificación 599

Territorial, Agricultura y Pesca and the Departamento de Educación, Universidades e 600

Investigación of the Basque Government. 601

602


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

28

603

REFERENCES 604 605

1. Hendrick SH, Kelton DF, Leslie KE, Lissemore KD, Archambault M, Duffield 606 TF. 2005. Effect of paratuberculosis on culling, milk production, and milk quality in 607 dairy herds. J. Am. Vet. Med. Assoc. 227:1302-1308. 608

2. Lombard JE. 2011. Epidemiology and economics of paratuberculosis. Vet. Clin. 609 North Am. Food Anim Pract. 27:525-535. 610

3. Losinger WC. 2005. Economic impact of reduced milk production associated with 611 Johne's disease on dairy operations in the USA. J. Dairy Res. 72:425-432. 612

4. Nielsen SS, Toft N. 2009. A review of prevalences of paratuberculosis in farmed 613 animals in Europe. Prev. Vet. Med. 88:1-14. 614

5. Chiodini RJ, Chamberlin WM, Sarosiek J, McCallum RW. 2012. Crohn's disease 615 and the mycobacterioses: a quarter century later. Causation or simple association? 616 Crit. Rev. Microbiol. 38:52-93. 617

6. Alonso-Hearn M, Molina E, Geijo M, Vazquez P, Sevilla I, Garrido JM, Juste 618 RA. 2009. Isolation of Mycobacterium avium subsp. paratuberculosis from muscle 619 tissue of naturally infected cattle. Foodborne. Pathog. Dis 6:513-518. 620

7. Eltholth MM, Marsh VR, Van Winden S, Guitian FJ. 2009. Contamination of 621 food products with Mycobacterium avium paratuberculosis: a systematic review. J. 622 Appl. Microbiol. 107:1061-1071. 623

8. Collins MT, Wells SJ, Petrini KR, Collins JE, Schultz RD, Whitlock RH. 2005. 624 Evaluation of five antibody detection tests for diagnosis of bovine paratuberculosis. 625 Clin. Diagn. Lab. Immunol. 12:685-692. 626

9. Semret M, Turenne CY, Behr MA. 2006. Insertion sequence IS900 revisited. J. 627 Clin. Microbiol. 44:1081-1083. 628

10. Poupart P, Coene M, Van Heuverswyn H, Cocito C. 1993. Preparation of a 629 specific RNA probe for detection of Mycobacterium paratuberculosis and diagnosis 630 of Johne's disease. J. Clin. Microbiol. 31:1601-1605. 631

11. Rajeev S, Zhang Y, Sreevatsan S, Motiwala AS, Byrum B. 2005. Evaluation of 632 multiple genomic targets for identification and confirmation of Mycobacterium avium 633 subsp. paratuberculosis isolates using real-time PCR. Vet. Microbiol. 105:215-221. 634

12. Ellingson JL, Bolin CA, Stabel JR. 1998. Identification of a gene unique to 635 Mycobacterium avium subespecies paratuberculosis and application to diagnosis of 636 paratuberculosis. Mol. Cell. Probes 12:133-142. 637


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

29

13. Li L, Bannantine JP, Zhang Q, Amonsin A, May BJ, Alt D, Banerji N, Kanjilal 638 S, Kapur V. 2005. The complete genome sequence of Mycobacterium avium 639 subspecies paratuberculosis. Proc. Natl. Acad. Sci. U. S. A. 102:12344-12349. 640

14. Sevilla I, Garrido JM, Geijo M, Juste RA. 2007. Pulsed-field gel electrophoresis 641 profile homogeneity of Mycobacterium avium subsp. paratuberculosis isolates from 642 cattle and heterogeneity of those from sheep and goats. BMC Microbiol 7:18. 643

15. Sevilla I, Li L, Amonsin A, Garrido JM, Geijo MV, Kapur V, Juste RA. 2008. 644 Comparative analysis of Mycobacterium avium subsp. paratuberculosis isolates from 645 cattle, sheep and goats by short sequence repeat and pulsed-field gel electrophoresis 646 typing. BMC Microbiol. 8:204. 647

16. Schonenbrucher H, Abdulmawjood A, Failing K, Bulte M. 2008. A new triplex 648 real time-PCR-assay for detection of Mycobacterium avium ssp. paratuberculosis in 649 bovine faeces. Appl. Environ. Microbiol. 74:2751-2758. 650

17. Herthnek D, Bolske G. 2006. New PCR systems to confirm real-time PCR detection 651 of Mycobacterium avium subsp. paratuberculosis. BMC Microbiol. 6:87. 652

18. Sevilla IA, Garrido JM, Sánchez I, Molina E, Bastida F, Juste RA. 2010. 653 Mycobacterium avium subsp. paratuberculosis detected and quantified using different 654 DNA extraction and real-time amplification methods in artificially inoculated fecal 655 samples from cattle, p 89. In Nielsen SS (ed), Proceedings of the 10th International 656 Colloquium on Paratuberculosis. International Association for Paratuberculosis, 657 Minneapolis, MN, USA. 658

19. Aduriz JJ, Juste RA, Cortabarría N. 1995. Lack of mycobactin dependence of 659 mycobacteria isolated on Middlebrook 7H11 from clinical cases of ovine 660 paratuberculosis. Vet. Microbiol. 45:211-217. 661

20. Vazquez P, Garrido JM, Juste RA. 2013. Specific antibody and interferon-gamma 662 responses associated with immunopathological forms of bovine paratuberculosis in 663 slaughtered Friesian cattle. PLoS. One. 8:e64568. 664

21. González J, Geijo MV, García-Pariente C, Verna A, Corpa JM, Reyes LE, 665 Ferreras MC, Juste RA, Garcia-Marin JF, Pérez V. 2005. Histopathological 666 classification of lesions associated with natural paratuberculosis infection in cattle. J. 667 Comp. Pathol. 133:184-196. 668

22. Elguezabal N, Bastida F, Sevilla IA, Gonzalez N, Molina E, Garrido JM, Juste 669 RA. 2011. Estimation of Mycobacterium avium subsp. paratuberculosis growth 670 parameters: strain characterization and comparison of methods. Appl. Environ. 671 Microbiol. 77:8615-8624. 672

23. Kawaji S, Taylor DL, Mori Y, Whittington RJ. 2007. Detection of Mycobacterium 673 avium subsp. paratuberculosis in ovine faeces by direct quantitative PCR has similar 674 or greater sensitivity compared to radiometric culture. Vet. Microbiol. 125:36-48. 675


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

30

24. Leite FL, Stokes KD, Robbe-Austerman S, Stabel JR. 2013. Comparison of fecal 676 DNA extraction kits for the detection of Mycobacterium avium subsp. 677 paratuberculosis by polymerase chain reaction. J. Vet. Diagn. Invest 25:27-34. 678

25. Collins MT. 2011. Diagnosis of paratuberculosis. Vet. Clin. North Am. Food Anim 679 Pract. 27:581-91. 680

26. Whitlock RH, Wells SJ, Sweeney RW, Van Tiem J. 2000. ELISA and fecal culture 681 for paratuberculosis (Johne's disease): sensitivity and specificity of each method. Vet. 682 Microbiol. 77:387-398. 683

27. Alonso-Hearn M, Molina E, Geijo M, Vazquez P, Sevilla IA, Garrido JM, Juste 684 RA. 2012. Immunization of adult dairy cattle with a new heat-killed vaccine is 685 associated with longer productive life prior to cows being sent to slaughter with 686 suspected paratuberculosis. J. Dairy Sci. 95:618-629. 687

28. Juste RA, Alonso-Hearn M, Molina E, Geijo M, Vazquez P, Sevilla IA, Garrido 688 JM. 2009. Significant reduction in bacterial shedding and improvement in milk 689 production in dairy farms after the use of a new inactivated paratuberculosis vaccine 690 in a field trial. BMC. Res Notes 2:233. 691

29. Sweeney RW, Whitlock RH, Bowersock TL, Cleary DL, Meinert TR, Habecker 692 PL, Pruitt GW. 2009. Effect of subcutaneous administration of a killed 693 Mycobacterium avium subsp. paratuberculosis vaccine on colonization of tissues 694 following oral exposure to the organism in calves. Am. J. Vet. Res. 70:493-497. 695

696

697

698


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

31

Table 1: Bacterial strains used to assess the specificity of primers and probe designed for 699

ISMap02. 700

Table 2: Sequences of primers and probes used in the IS900 & ISMap02 real-time PCR 701

system. 702

Table 3: Mean Ct values and standard deviations calculated for all inoculation levels and 703

extraction methods with both field and reference strains using the F57 & ISMav2 triplex 704

real-time PCR of Schonenbrucher et al. 705

*Footnote: m Ct= mean Ct value, SD= standard deviation, PR= no. of positive replicates 706

out of the six done. 707

Table 4: Mean Ct values and standard deviations calculated for all inoculation levels and 708

extraction methods with both field and reference strains using the IS900 & ISMap02 triplex 709

real-time PCR. The results belonging to the minimum detectable limit assessed by serial 710

dilutions of genomic DNA are also shown at the bottom. 711



Table 5: Mean Ct values and standard deviations obtained using the combinations of DNA 714

extraction and real-time amplification kits Adiapure & Adiavet and MagMAX & TaqMan 715

MAP. 716




http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

32

Table 6: Number of animals from control herds (TC) and vaccinated herds (VH) included 719

in each IS900 & ISMap02 PCR result category grouped according to their M0 to M48 720

(month 0 to 48) combined results in conventional methods (conventional PCR, fecal culture 721

and ELISA) that was used as the reference to estimate the follow-up sensitivity (fu-Se) and 722

specificity (fu-Sp) of the triplex PCR. With regard to conventional methods animals were 723

considered positive (P) when positive to at least one of the conventional methods used 724

(ELISA, conventional PCR, culture) in any of the 5 annual samplings and the rest were 725

considered negative (N). 726

Table 7: Summary of all the results obtained in the case of animals from TC and VH herds 727

that were followed up until they were slaughtered and necropsied. Cases are arranged 728

according to their IS900 & ISMap02 PCR (RTP) category in M0 (from 0 to 3) and to their 729

results with conventional tests (M0 to M48). A final PTB status score is also included. 730

Table 7 continued: 731

*Footnote: aAutolytic tissue. 732

RTP: IS900 & ISMap02 real-time PCR (3, heavy shedder; 2, intermediate shedder; 1, low 733

shedder; 0, non-shedder). E: ELISA (3, highly reactive; 2, intermediate-highly reactive; 1, 734

intermediate or inconclusive; 0, low/non-reactive). P: conventional PCR (1, positive; 0, 735

negative). C/TC: Fecal culture/Tissue culture (3, heavy shedder/high burden; 2, 736

intermediate shedder/burden; 1, low shedder/burden; 0 non-shedder/culture negative). HP: 737

Histopathology (2 for patent forms; 1 for latent forms; 0, for apparently free of PTB). M0-738

M48: month 0-48 sampling. nd: not done. ac: all tubes contaminated. nc= not considered 739

because they were vaccinated. 740


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

33

Figure 1: ParaTBKuanti-VK results: Mean Map copy number quantified in extracts 741

obtained with different kits at different inoculation levels for both field and reference 742

strains. Standard deviations (error bars) and linear regression lines have a 95% confidence 743

level. 744

745


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

1

Table 1: Bacterial strains used to assess the specificity of primers and probe designed 1

for ISMap02. 2

Strain Type and/or origin ISMap02

Mycobacterium avium subsp. paratuberculosis ATCC 19698 cattle type collection isolate +

Mycobacterium avium subsp. paratuberculosis K10 ATCC BAA-968 cattle type collection isolate +

Mycobacterium avium subsp. paratuberculosis 316F cattle type collection isolate +

Mycobacterium avium subsp. paratuberculosis St 764 cattle type field isolate from bovine feces +

Mycobacterium avium subsp. paratuberculosis St 681 cattle type field isolate from wild boar tissues +

Mycobacterium avium subsp. paratuberculosis St 22G sheep type field isolate from sheep tissues +

Mycobacterium avium subsp. paratuberculosis St ovicap18 sheep type field isolate from caprine tissues +

Mycobacterium avium subsp. paratuberculosis St 332 bison type field isolate from caprine tissues +

Mycobacterium avium subsp. avium ATCC 25291 collection isolate −

Mycobacterium avium subsp. avium St18 collection isolate −

Mycobacterium avium subsp. hominissuis St 104 collection isolate −

Mycobacterium avium subsp. silvaticum ATCC 49884 collection isolate −

Mycobacterium asiaticum St 336 field isolate from caprine feces −

Mycobacterium tuberculosis St H37Ra ATCC 25177 collection isolate −

Mycobacterium bovis BCG ATCC19015 collection isolate −

Mycobacterium bovis St1403 field isolate from wild boar tissues −

Mycobacterium caprae St1491 field isolate from goat tissues −

Mycobacterium microti ATCC 11152 collection isolate −

Mycobacterium chimaera FI1069T collection isolate −

Mycobacterium marinum CECT 7091T collection isolate −

Mycobacterium chelonae St 362 field isolate from bovine tissues −

Mycobacterium flavescens St 9H field isolate from llama tissues −

Mycobacterium intracellulare GM51 field isolate from human blood −

Mycobacterium scrofulaceum SN field isolate from llama feces −

Mycobacterium vaccae ATCC 15483 collection isolate −

Mycobacterium phlei ATCC 11758 collection isolate −

Mycobacterium fortuitum ISCIII field isolate −

Mycobacterium smegmatis St mc2155 ATCC 700084 collection isolate −

Mycobacterium kansasii CECT 3030T collection isolate −

Mycobacterium gordonae CECT 3029 collection isolate −

Mycobacterium genavense ATCC 51234 collection isolate −

Salmonella typhimurium, S. enteritidis field isolates −

Listeria monocytogenes field isolate −

Corynebacterium pseudotuberculosis field isolate −

Nocardia cyriacigeorgica, N. nova, N. farcinica field isolates −

Rhodococcus equi ATCC 33701 collection isolate −

Yersinia enterocolitica, Y. pseudotuberculosis field isolates −

Yersinia ruckeri ATCC29473 collection isolate −

Neospora caninum field isolates −

Actinomyces spp field isolates −

Clostridium spp field isolates −

Staphylococcus pseudointermedius field isolates − Mannheimia haemolytica field isolates − Leuconostoc mesenteroides field isolates − Pseudomonas spp. field isolates − Campylobacter jejuni ATCC33560 collection isolate −

Escherichia coli O1576:H7 ATCC35150 collection isolate −

Erlichia canis field isolates −

3


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

2

Table 2: Sequences of primers and probes used in the IS900 & ISMap02 real-time PCR 4

system. 5

primer/probe 5'-sequence-3' ref

IS900-F CCGCTAATTGAGAGATGCGATT (17) IS900-R CCAGACAGGTTGTGCCACAA

IS900-probe 6-FAM-ACCTCCGTAACCGTCATTGTCCAGATCA-BHQ-1

ISMap02-F CGGCTGGACACGGAATG

(18) ISMap02-R CATGAGCGACAGTATCTTTCGAA

ISMap02-probe JOE-ATCCGTCCCAGTGGCGGAGTCAC-BHQ-1

IAC-probe Cy5-CTCTGACACATGCAGCTCCCGGAGAC- BHQ2

6

7


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

3

Table 3: Mean Ct values and standard deviations calculated for all inoculation levels 8

and extraction methods with both field and reference strains using the F57 & ISMav2 9

triplex real-time PCR of Schonenbrucher et al. 10

Field strain Reference strain

F57 LNA ISMav2 F57 LNA ISMav2

Map/g m Ct (SD) PR m Ct (SD) PR m Ct (SD) PR m Ct (SD) PR

Qiamp Stool

101 0 0 0 0

102 0 0 0 0

103 0 0 0 0

104 40.60 (0) 1 0 0 0 0

105 37.41 (0.64) 6 39.67 (0.65) 6 40.41 (0.89) 5 38.85 (0.92) 4

106 33.95 (0.93) 6 34.29 (0.93) 6 35.96 (0.83) 6 36.31 (0.77) 6

107 29.06 (0.11) 6 29.12 (0.28) 6 31.19 (0.28) 6 31.65 (0.63) 6

JohnePrep

101 0 0 0 0

102 0 0 0 0

103 38.48 (0) 1 41.85 (0) 1 0 0

104 37.20 (0.85) 5 40.30 (1.08) 6 38.92 (0.79) 5 41.50 (1.27) 6

105 33.33 (0.73) 6 34.95 (1.05) 6 34.39 (0.67) 6 35.19 (0.39) 6

106 28.81 (0.50) 6 29.79 (0.57) 6 29.73 (0.82) 6 31.76 (0.80) 6

107 24.58 (0.32) 6 25.83 (0.48) 6 25.17 (0.30) 6 25.98 (0.47) 6

Adiapure

101 0 0 0 0

102 0 0 0 0

103 0 0 0 0

104 42.35 (0.14) 2 0 43.53 (0) 1 0

105 36.92 (0.41) 6 38.32 (0.58) 6 36.40 (0.79) 6 37.68 (1.53) 6

106 32.70 (0.41) 6 33.74 (0.33) 6 34.36 (1.24) 6 35.34 (1.44) 6

107 28.18 (0.69) 6 29.06 (0.78) 6 28.56 (0.52) 6 28.77 (0.43) 6

MagMax

101 0 0 0 0

102 0 0 0 0

103 44.02 (0) 1 0 0 0

104 37.31 (0.07) 6 38.11 (0.54) 6 39.58 (0.43) 6 39.95 (0.06) 6

105 32.38 (0.24) 6 33.18 (0.25) 6 34.70 (0.26) 6 35.60 (0.26) 6

106 28.27 (0.10) 6 28.92 (0.26) 6 30.76 (0.30) 6 31.78 (0.34) 6

107 24.25 (0.13) 6 24.85 (0.22) 6 25.77 (0.32) 6 26.84 (0.20) 6

m Ct= mean Ct value, SD= standard deviation, PR= no. of positive replicates out of the six done. 11

12


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

4

Table 4: Mean Ct values and standard deviations calculated for all inoculation levels 13

and extraction methods with both field and reference strains using the IS900 & 14

ISMap02 triplex real-time PCR. The results belonging to the minimum detectable limit 15

assessed by serial dilutions of genomic DNA are also shown at the bottom. 16


IS900 ISMap02 IS900 ISMap02

Map/g m Ct (SD) PR m Ct (SD) PR m Ct (SD) PR m Ct (SD) PR

Qiamp Stool

101 0 0 0 0

102 0 0 0 0

103 0 0 0 0

104 38.67 (1.55) 6 38.24 (0.57) 6 39.99 (0.94) 6 38.70 (1.12) 5

105 35.06 (0.97) 6 35.79 (0.61) 6 35.01 (0.38) 6 35.24 (0.26) 6

106 30.94 (0.76) 6 31.14 (0.87) 6 32.09 (0.70) 6 32.55 (0.57) 6

107 25.54 (0.26) 6 26.01 (0.19) 6 27.24 (0.14) 6 27.82 (0.03) 6

JohnePrep

101 40.28 (1.81) 3 38.92 (0) 1 41.98 (0) 1 0

102 38.57 (1.45) 6 37.63 (1.21) 6 38.56 (2.05) 5 39.00 (1.92) 4

103 37.21 (0.14) 6 36.55 (0.87) 6 37.62 (0.96) 6 38.57 (0.63) 6

104 35.20 (0.23) 6 35.26 (0.32) 6 36.56 (1.18) 6 35.67 (0.92) 6

105 30.22 (0.35) 6 31.25 (0.29) 6 32.72 (0.30) 6 32.94 (0.06) 6

106 25.86 (0.30) 6 26.99 (0.32) 6 26.13 (0.77) 6 26.44 (0.63) 6

107 21.47 (0.12) 6 22.70 (0.16) 6 21.53 (0.34) 6 22.01 (0.26) 6

Adiapure

101 0 0 0 0

102 0 0 0 0

103 0 0 0 0

104 37.37 (0.52) 6 37.88 (0.27) 6 37.95 (1.65) 6 37.06 (0.69) 6

105 34.38 (0.87) 6 34.79 (1.31) 6 34.31 (1.81) 6 34.96 (1.59) 6

106 29.43 (0.25) 6 30.20 (0.43) 6 32.06 (1.24) 6 32.54 (1.22) 6

107 25.13 (0.56) 6 26.04 (0.49) 6 25.26 (0.76) 6 26.08 (0.61) 6

MagMax

101 41.38 (2.44) 2 38.75 (0) 1 0 0

102 38.52 (0.62) 5 38.03 (0.29) 5 39.83 (1.38) 6 38.06 (0.82) 4

103 37.43 (0.38) 6 37.09 (0.71) 6 38.41 (1.24) 6 38.29 (0.69) 6

104 34.49 (0.12) 6 34.95 0.61) 6 37.11 (0.51) 6 36.63 (0.79) 6

105 29.80 (0.34) 6 30.21 (0.14) 6 31.20 (0.12) 6 31.41 (0.17) 6

106 25.47 (0.04) 6 26.26 (0.05) 6 27.13 (0.31) 6 27.70 (0.26) 6

107 21.42 (0.14) 6 22.35 (0.09) 6 22.05 (0.11) 6 22.66 (0.08) 6

minimum detectable limit assessed by serial dilutions of genomic DNA:

IS900 ISMap02

m Ct (SD) PR Map genomes (IS900 copies)

m Ct (SD) PR Map genomes

(ISMap02 copies) 1 fg of genomic DNA

purified from K10 strain 38.20 (1.16) 5 0.19 (3.21) 37.56 (0.62) 2 0.07 (1.13)


18


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

5

Table 5: Mean Ct values and standard deviations obtained using the combinations of 19

DNA extraction and real-time amplification kits Adiapure & Adiavet and MagMAX & 20

TaqMan MAP. 21


Adiapure

& Adiavet

MagMax &

TaqMan Map

Adiapure &

Adiavet

MagMax &

TaqMan Map Map/g m Ct (SD) PR m Ct (SD) PR m Ct (SD) PR m Ct (SD) PR

101 0 0 0

102 0 37.13 (0) 1 0

103 0 36.75 (0.33) 6 0 38.42 (0) 1

104 39.17 (1.63) 6 35.02 (1.21) 6 41.62 (1.12) 6 37.64 (2.32) 6

105 35.57 (1.45) 6 29.96 (0.26) 6 36.74 (1.18) 6 32.69 (0.26) 6

106 30.19 (0.21) 6 26.15 (0.06) 6 34.55 (1.40) 6 29.02 (0.37) 6

107 25.89 (0.67) 6 22.11 (0.02) 6 27.11 (0.61) 6 23.86 (0.20) 6


23


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

6

Table 6: Number of animals from control herds (TC) and vaccinated herds (VH) 24

included in each IS900 & ISMap02 PCR result category grouped according to their M0 25

to M48 (month 0 to 48) combined results in conventional methods (conventional PCR, 26

fecal culture and ELISA) that was used as the reference to estimate the follow-up 27

sensitivity (fu-Se) and specificity (fu-Sp) of the triplex PCR. With regard to 28

conventional methods animals were considered positive (P) when positive to at least one 29

of the conventional methods used (ELISA, conventional PCR, culture) in any of the 5 30

annual samplings and the rest were considered negative (N). 31

No. of animals (%)

conventional methods (M0 to M48)

IS900 & ISMap02 real-time PCR (M0) N P Total

TC group

0 (non-shedder, Ct>40) 196 (61.44) 36 (11.29) 232 (72.73)

1 (low shedder, Ct>35) 31 (9.72) 27 (8.46) 58 (18.18)

2 (intermediate shedder, 31<Ct≤35) 4 (1.25) 10 (3.13) 14 (4.39)

3 (heavy shedder, Ct≤31) 0 15 (4.7) 15 (4.7)

all positives (1 to 3) 35 (10.97) 52 (16.3) 87 (27.27)

Total 231 (72.41) 88 (27.59) 319

fu-Sp: 84.85 % fu-Se: 59.09%

VH group

0 (non-shedder, Ct>40) 209 (70.61) 22 (7.43) 231 (78.04)

1 (low shedder, Ct>35) 12 (4.05) 29 (9.8) 41 (13.85)

2 (intermediate shedder, 31<Ct≤35) 1 (0.34) 18 (6.08) 19 (6.42)

3 (heavy shedder, Ct≤31) 0 5 (1.69) 5 (1.69)

all positives (1 to 3) 13 (4.39) 52 (17.57) 65 (21.96)

Total 222 (75) 74 (25) 296

fu-Sp: 94.14 % fu-Se: 70.27%

32 33


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

7

Table 7: Summary of all the results obtained in the case of animals from TC and VH 34

herds that were followed up until they were slaughtered and necropsied. Cases are 35

arranged according to their IS900 & ISMap02 PCR (RTP) category in M0 (from 0 to 3) 36

and to their results with conventional tests (M0 to M48). A final PTB status score is also 37

included. 38

Animals from control or test and cull herds (tc)

M0 M12 M24 M36 M48 Necropsy

case RTP E P C E P C E P C E P C E P C HP C TC PTB status

1tc 0 0 0 0 0 0 0 0 0 0 — — — — — — 0 0 0 no PTB

2tc 0 0 0 0 0 0 0 — — — — — — — — — 0 0 0 no PTB

3-6tc 0 0 0 0 — — — — — — — — — — — — 0 nd 0 no PTB

7tc 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 2 nd 3 PTB

8tc 0 0 0 0 0 0 0 0 0 0 — — — — — — 1 0 0 PTB

9tc 0 0 0 0 0 0 0 — — — — — — — — — 0 0 0.3 PTB

10tc 0 0 0 0 0 0 0 — — — — — — — — — 2 2 3 PTB

11tc 0 0 0 0 — — — — — — — — — — — — 1 0 0 PTB

12-13tc 0 0 0 0 — — — — — — — — — — — — 0 0 0.7-1.3 PTB

14-15tc 0 0 0 0 2-3 0 0 3 1 1-2 — — — — — — 1-2 1-2 2.3-2.7 PTB

16-17tc 0 0 0 0 3 1 1-2 — — — — — — — — — 2 1-3 2.5-2.7 PTB

18tc 0 0 0 0 — — — — — — — — — — — — 2 ac 3 PTB

19tc 1 0 0 0 2 1 1 3 1 1 — — — — — — 2 2 2.3 PTB

20tc 1 0 0 0 3 1 3 — — — — — — — — — 2 3 2.7 PTB

21tc 1 0 0 0 3 0 0 — — — — — — — — — 2 3 3 PTB

22tc 1 0 1 0 3 0 0 — — — — — — — — — 2 1 2.3 PTB

23tc 1 1 0 0 3 0 0 — — — — — — — — — 0 2 1 PTB

24tc 1 0 0 0 0 0 0 2 1 1 — — — — — — 2 0 2 PTB

25-27tc 1 0 0 0 0 0 0 — — — — — — — — — 0 0 0.3-1 PTB

28-29tc 2 1-2 0 0 2-3 1 1-2 — — — — — — — — — 2 3 2-3 PTB

30tc 2 0 0 0 3 1 1 — — — — — — — — — 2 3 3 PTB

31tc 2 0 0 0 0 0 0 — — — — — — — — — 0 0 1.3 PTB

32-36tc 3 2-3 0-1 1-2 — — — — — — — — — — — — 2 1-2 2.7-3 PTB

39


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

8

Table 7 continued: 40

Animals from vaccinated herds (vh)

M0 M12 M24 M36 M48 Necropsy

case RTP E P C E P C E P C E P C E P C HP FC TC PTB status

1vh 0 0 0 0 nc 0 0 nc 0 0 nc 0 0 — — — 0 0 0 no PTB

2-4vh 0 0 0 0 nc 0 0 nc 0 0 — — — — — — 0 0 0 no PTB

5-6vh 0 0 0 0 nc 0 0 — — — — — — — — — 0 0 0 no PTB

7-11vh 0 0 0 0 — — — — — — — — — — — — 0 0 0 no PTB

12vh 0 0 1 0 — — — — — — — — — — — — 0 0 0 no PTB

13vh 0 0 0 0 nc 0 0 nc 0 0 — — — — — — 0a 0 0.3 PTB

14vh 0 0 0 0 nc 0 0 — — — — — — — — — 1 0 0.7 PTB

15vh 0 0 1 0 nc 0 0 — — — — — — — — — 0 0 1.3 PTB

16vh 0 0 0 0 — — — — — — — — — — — — 1 0 0 PTB

17-18vh 0 0 0 0 — — — — — — — — — — — — 0 0 0.7-1 PTB

19-20vh 0 0 0 0 — — — — — — — — — — — — 2 1-2 3 PTB

21vh 0 0 0 0 nc 0 0 — — — — — — — — — 2 3 3 PTB

22vh 1 2 0 0 nc 1 1 — — — — — — — — — 2 1 2.7 PTB

23vh 1 3 0 0 nc 0 0 nc 1 2 — — — — — — 2 3 3 PTB

24vh 1 0 0 0 nc 1 0 nc 0 0 nc 0 0 nc 0 0 2 nd 3 PTB

25vh 1 2 0 0 — — — — — — — — — — — — 0 0 0.7 PTB

26vh 1 0 0 0 — — — — — — — — — — — — 1 0 0 PTB

27vh 1 0 0 0 — — — — — — — — — — — — 0 0 0 no PTB

28vh 2 3 0 0 nc 1 1 — — — — — — — — — 2 2 3 PTB

29-30vh 2 3 0 0-2 — — — — — — — — — — — — 2 0-1 2-3 PTB

31vh 2 0 1 0 nc 0 0 nc 1 2 — — — — — — 2 0 3 PTB

32vh 2 0 0 0 nc 0 1 — — — — — — — — — 0 0 0.3 PTB

33vh 3 3 1 2 — — — — — — — — — — — — 2 0 3 PTB 41 aAutolytic tissue. 42

RTP: IS900 & ISMap02 real-time PCR (3, heavy shedder; 2, intermediate shedder; 1, low shedder; 0, non-shedder). E: ELISA (3, 43

highly reactive; 2, intermediate-highly reactive; 1, intermediate or inconclusive; 0, low/non-reactive). P: conventional PCR (1, 44

positive; 0, negative). C/TC: Fecal culture/Tissue culture (3, heavy shedder/high burden; 2, intermediate shedder/burden; 1, low 45

shedder/burden; 0 non-shedder/culture negative). HP: Histopathology (2 for patent forms; 1 for latent forms; 0, for apparently free 46

of PTB). M0-M48: month 0-48 sampling. nd: not done. ac: all tubes contaminated. nc= not considered because they were 47

vaccinated. 48


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

development and evaluation of a novel multicopy element...

Documents