developemnt of a multiplex sequence …research-repository.uwa.edu.au/files/3248158/hitchen...1...
TRANSCRIPT
1
DEVELOPEMNT OF A MULTIPLEX
SEQUENCE SPECIFIC PRIMER (SSP)-PCR
SYSTEM TO IDENTIFY FORENSICALLY
RELEVANT CALLIPHORIDAE
Yvette Hitchen (BSc, GDipForSci)
Centre for Forensic Science
University of Western Australia
This thesis is presented in partial fulfilment of the requirements for the
Master of Forensic Science
2
2008 I declare that the research presented in this 36 point thesis, as part of the 96 point Master
degree in Forensic Science, at the University of Western Australia, is my own work. The
results of the work have not been submitted for assessment, in full or part, within any
other tertiary institute, except where due acknowledgement has been made in the text.
…………………………………………………
Yvette Hitchen
3
Acknowledgments
I would like to thank my supervisors Dr Silvana Gaudieri and Associate Professor Ian
Dadour. Thank you Silvana for your expert knowledge, time and effort for the duration
of my thesis and especially these final weeks. Thank you Ian for providing the facilities,
funds and specimens in the completion of this thesis.
I would like to thank all the members of the laboratory who have provided both
friendship and support. Padillah Yahya, Ha Nguyen, Alison Pitt and Nik Elena Nik
Mohamed without you I would not have been able to face the lab everyday. Thank you
Catherine Rinaldi for being my sensei within the laboratory and providing endless
technical information, friendship and humour.
To Danielle Molan for keeping on top of the administration side of my thesis.
To Rhian Williams, Simone Claassen, Gemma Fitzpatrick and all my friends who
reminded me there was a life outside of the laboratory.
Finally to my family who have provided endless support and love throughout the entirety
of this thesis. Without you all I would not have made it to the end of this journey.
4
TABLE OF CONTENTS
ACKNOWLEDGEMENTS i
TABLE OF CONTENTS ii
GLOSSARY 1
LIST OF TABLES 5
LIST OF FIGURES 6
CHAPTER 1: ABSTRACT 7
CHAPTER 2: INTRODUCTION 10
2.1 Forensic Entomology – General Background 11
2.1.1 Urban Entomology 11
2.1.2 Stored Product Entomology 12
2.1.3 Medico-Criminal Entomology 12
2.2 Medico-Criminal entomology – Historical Background 13
2.3 The Diptera 15
2.4 The Calliphoridae 15
2.4.1 Calliphora dubia 17
2.4.2 Calliphora albifrontalis 17
2.4.3 Chrysomya rufifacies 18
2.4.4 Chrysomya megacephala 18
2.4.5 Lucilia sericata 19
2.5 Succession of Invertebrate Activity on the Corpse Environment 19
2.6 Post-Mortem Interval 23
2.7 Forensic Entomology – Morphological Identification 25
2.8 Alternative Approaches to Identification 26
2.8.1 Scanning Electron Microscopy (SEM) 26
2.8.2 Potassium Permanganate Staining Technique 27
2.9 Deoxyribonucleic Acid – General Background 27
2.10 DNA-Based Methods of Identification 28
5
2.10.1 Random Amplified Polymorphic DNA 28
2.10.2 PCR – Restricted Fragment Length Polymorphism 29
2.10.3 Ribosomal Genes 29
2.10.4 Cytochrome Oxidase Genes of the Mitochondrial DNA 30
2.10.5 Sequence Specific Primers (SSP) 32
2.11 Polymerase Chain Reaction (PCR) 34
2.11.1 PCR protocol 35
2.11.2 PCR Reaction Reagents and Their Optimisation 37
2.11.3 Specific PCR Primer Design 39
2.12 Multiplex PCR 41
2.12.1 Optimisation of Multiplex PCR 43
2.13 Aims of Thesis 45
CHAPTER 3: Design of a Sequence Specific Primer Set for the Identification of
Forensically Important Calliphoridae 47
3.1 Introduction 48
3.2 Methods 51
3.2.1 DNA Extraction 51
3.2.2 Primers 52
3.2.3 PCR 53
3.2.4 PCR optimisation 53
3.3 Results and Discussion 54
3.3.1 Re-Design of SSP Set 66
3.4 Conclusion 70
CHAPTER 4: Optimisation of a Modified Set of Sequence Specific Primers for
The Identification of Forensically Important Calliphoridae Species 71
4.1 Introduction 72
4.2 Methods 73
4.2.1 DNA Extraction 73
4.2.2 Primers 73
6
4.2.3 PCR 73
4.2.4 PCR Optimisation 74
4.2.5 PCR Clean-Up 74
4.2.6 Direct Sequencing 74
4.3 Results and Discussion 75
4.3.1 Verification of Quality of Extracted DNA Samples 75
4.3.2 Optimisation of SSP Pairs 76
4.3.3 Analysis of Sequenced SSP-PCR Products 89
4.4 Conclusion 98
CHAPTER 5: Development of Two Multiplex SSP-PCRs for the Identification of
Forensically Important Calliphoridae 100
5.1 Introduction 101
5.2 Methods 103
5.2.1 DNA Extraction 103
5.2.2 Primers 103
5.2.3 Multiplex PCR 103
5.3 Results and Discussion 104
5.4 Conclusions 111
CHAPTER 6: Discussion and Conclusions 112
CHAPTER 7: References 117
APPENDICIES 131
APPENDIX 1 132
APPENDIX 2 134
APPENDIX 3 135
APPENDIX 4 150
APPENDIX 5 152
7
GLOSSARY
A Adenine. Nucleotide base.
bp Base pairs. Make-up DNA sequence.
BSA Bovine Serum Albumin. Reduces the effect of
inhibitors within the PCR.
C Cytosine. Nucleotide base.
Calliphoridae Commonly known as blowflies and are amongst the
first species to locate and colonise a corpse.
Calliphora albifrontalis Western brown blowfly. Located throughout the
South-West of Australia and has a robust golden-
brown colouration.
Calliphora dubia Blue-bodied blowfly, located throughout the South-
West of Australia. Yellowish in colouration with a
purple stripe down abdomen
Chrysomya megacephala Oriental latrine fly, located throughout the whole of
Australia, Asia, South Africa and Afro-tropic Island
regions. Bright metallic green in colouration with
black margins on abdomen.
Chrysomya rufifacies Hairy maggot blowfly, it is located Australia-wide
and is metallic green in colouration with dark blue
margins on abdomen.
8
COI Cytochrome Oxidase I. A gene within the mtDNA
involved in the terminal catalyst for the respiratory
mitochondrial chain.
COII Cytochrome Oxidase II. A component of the
respiratory chain, located within the mitochondrial
inner membrane.
Cyt-b Cytochrome b. A component of the respiratory
chain, located in the mitochondria of the cell.
DNA Deoxyribonucleic Acid. Genetic material of all
living organisms found within the nucleus of cells.
DNA Sequencing Determination of nucleotide order of a selected
DNA molecule.
dNTPs Deoxynucleotide triphosphates. The four
nucleotides that make-up DNA. Involved in the
synthesis of complementary strands in PCR.
ddNTPs Dideoxynucelotide triphosphates. Chain
termination nucleotides involved in DNA
sequencing.
Forensic Entomology Scientific study of invertebrate succession upon a
corpse.
G Guanine. Nucleotide base.
Instar Development Instars are the stage of successive molts
experienced by the fly, which are split into 3
developmental stages, 1st, 2
nd and 3
rd.
9
IUPAC-IUB International Union of Pure and Applied Chemistry
– International Union of Biochemistry for mixtures.
Lucilia sericata Sheep blowfly, it is located throughout the whole of
Australia in urban and sub-urban environments. It
is metallic in colouration varying from blue-green
to green-bronze.
MtDNA Mitochondrial DNA. DNA genome located within
the mitochondria of the cell.
Multiplex PCR Variant of standard PCR that relies on multiple
primer sets.
Nucleotides The smallest unit of the DNA molecule, which are
Adenine (A), Thymine (T), Cytosine (C) and
Guanine (G).
PCR Polymerase Chain Reaction. Technique for the
exponential amplification of a selected region
within a DNA molecule.
PMI Post-mortem interval. Estimated time since death.
Primers Short oligo-nucleotide strands that anneal to the
DNA from which the polymerase enzyme can
extend in the PCR.
R =A+G mixtures in DNA sequence as per IUPAC-
IUB classification.
R2 Correlation coefficient reflects line of best fit in
standard curves. Value range from +1 to –1.
10
rDNA Ribosomal DNA. Sequences of encoding rRNA.
rRNA Ribosomal RNA. Central component of ribosomes,
involved in the manufacture of cell proteins.
SSP Sequence Specific Primers. Identify species based
on the presence of unique nucleotide(s) at the 3‟ end
of the primer sequence.
Succession Succession relies on predictable patterns of insect
colonisation upon a corpse based on the physical,
biological and chemical changes a body undergoes
during decomposition.
T Thymine. Nucleotide base.
Taq DNA Polymerase Enzyme from a thermophilic eubacterial micro-
organism involved in the extension of
complementary DNA strands in PCR.
W =A+T mixtures in DNA sequence as per IUPAC-
IUB classification.
Y =T+C mixtures in DNA sequence as per IUPAC-
IUB classification.
mm Millimetres.
µ Micro.
ºC Degrees Celsius.
11
LIST OF TABLES
Table 2.1 Decomposition stages and associating Calliphoridae
activity. 21
Table 3.1 Original SSP primer set designed for the identification of
forensically important Calliphoridae. 52
Table 3.2 Expected and observed amplicons of original SSP primer
set. 53
Table 3.3 Matrix of annealing temperatures tested in optimisation of
original SSP primer set. 56
Table 3.4 Matrix of MgCl2 concentrations tested in optimisation of
original SSP primer set. 57
Table 3.5 Matrix of primer concentrations tested in optimisation of
original SSP primer set. 58
Table 3.6 Non-concordance between expected and observed results
for original SSP primer set. 59
Table 3.7 Re-designed SSP primer pairs. 68
Table 4.1 Annealing temperature matrix for the optimisation of newly
designed SSP primer set. 78
Table 4.2 Optimised annealing temperatures for newly designed SSP
primer set. 90
Table 5.1 Multiplex PCR SSP pair grouping, expected amplified
species and amplicon lengths. 105
Table 8.1 Purity values of newly extracted DNA samples prior to
testing. 134
Table 8.2 List of sequences and region of origin utilised in
phylogenetic analysis. 150
12
LIST OF FIGURES
Figure 2.1 Image of C. dubia. 17
Figure 2.2 Image of C. albifrontalis. 17
Figure 2.3 Image of Ch. rufifacies. 18
Figure 2.4 Image of Ch. megacephala. 18
Figure 2.5 Image of L. sericata. 19
Figure 2.6 Diagrammatic representation of a typical Dipteran
lifecycle. 22
Figure 2.7 Schematic of a standard PCR. 37
Figure 2.8 Comparison of PCR and multiplex PCR. 42
Figure 3.1 Alignment of sequences for re-design of SSP set. 61
Figure 4.1 Electrophoresis gel image of COI amplification. 77
Figure 4.2 Electrophoresis gel image of SSP 1b at 48ºC. 80
Figure 4.3 Electrophoresis gel image of SSP 1b at 62ºC. 81
Figure 4.4 Electrophoresis gel image of SSP 2b at 50ºC. 82
Figure 4.5 Electrophoresis gel image of SSP 4b at 58ºC. 83
Figure 4.6 Electrophoresis gel image of SSP 5b at 60ºC. 84
Figure 4.7 Electrophoresis gel image of SSP 6b at 62ºC. 85
Figure 4.8 Electrophoresis gel image of SSP 7b at 52ºC. 86
Figure 4.9 Electrophoresis gel image of SSP 8 at 60ºC. 87
Figure 4.10 Electrophoresis gel image of SSP 9 at 48ºC. 88
Figure 4.11 Electrophoresis gel image of SSP 9 at 58ºC. 89
Figure 4.12 Alignment of sequenced data from SSP 2b, 4b, 5b, 7b and 8
against known sequenced information. 91
Figure 4.13 Neighbour-joining phylogenetic tree. 96
Figure 4.14 Alignment of sequenced data from SSP 1b and 9 against
known sequenced information. 97
Figure 5.1 Electrophoresis gel image of SSP 4b stock at 58ºC. 106
Figure 5.2 Electrophoresis gel image of Multiplex PCR 1 at 62ºC 107
Figure 5.3 Electrophoresis gel image of Multiplex PCR 2 at 50ºC 108
Figure 5.4 Electrophoresis gel image of SSP 2b stock at 50ºC. 110
13
Chapter 1
Abstract
14
From the entomological evidence occurring on and around a corpse it is possible to
determine an estimated post-mortem interval (PMI). The critical step in this examination
is the accurate identification of specimens collected ensuring the application of
appropriate species-specific developmental data. Current molecular techniques in the
identification of forensically important Calliphoridae species from the Australian region
have been explored and found to be a highly significant and valuable area of research.
The cytochrome oxidase genes in the mitochondrial genome have been shown to have
sufficient sequence diversity to distinguish forensically relevant Calliphoridae species.
In order to target the observed sequence diversity within relevant regions of the nuclear
or mitochondrial genomes, sequence specific primer (SSP) pairs are used to target
polymorphisms, resulting in the amplification of specific species. This technique has
proven to be both a rapid and successful identification tool in the analysis of insect taxa,
especially Culicidae. SSP typing is particularly useful, as it requires no subsequent
sequencing or restriction with enzymes, both of which require additional time and
reagents.
The aim of this research was to develop a multiplex SSP reaction for the identification of
forensically important Calliphoridae species. Seven SSP pairs preliminarily designed by
Harvey (2006) were utilised in the identification of Calliphora dubia, Calliphora
albifrontalis, Chrysomya rufifacies, Chrysomya megacephala and Lucilia sericata. Once
optimised the SSP pairs were developed into two multiplex PCR reactions. This thesis
presents the experiments performed, analysis conducted and results obtained through the
development of the multiplex SSP-PCR system.
Initial testing of the seven preliminarily designed SSP pairs conveyed non-concordance
between expected and observed results. Additional species were continually amplified,
even after extensive optimisation attempts, including alternations to annealing
temperature, MgCl2 and primer concentration. Of the 7 SSP pairs, 6 were re-designed to
improve specificity, whilst one was removed from further testing and replaced with 2
newly designed primer pairs.
15
Continual testing of 8 SSP pairs was conducted, but only 6 could be successfully
optimised. Optimisation was limited to alterations to annealing temperature, to allow for
potential multiplexing. To confirm the regions and species amplified, sequencing of the
PCR products was performed. Though only partial sequences were obtained for most
samples the alignment shows the expected region amplified with specific species
variations. Using the remaining 6 SSP pairs all species tested were identifiable, allowing
for multiplexing potential to be tested.
Multiplex PCR is a cost effective and efficient technique that is becoming increasing
popular within a wide range of scientific disciplines. To date there has been no recorded
use of this technique in relation to either forensic entomology or the analysis of
forensically important Calliphoridae species. The 6 SSP pairs were manipulated to
produce one successful multiplex PCR system using 3 SSP pairs to identify L. sericata,
Ch. rufifacies and Ch. megacephala, and one unsuccessful multiplex PCR that amplified
a single SSP pair for the identification of C. dubia and Ch. rufifacies. When both
reactions are utilised, it is possible to identify all 5 forensically important Calliphoridae
species tested.
16
Chapter 2
Introduction
17
2.1 Forensic Entomology - General Background
Forensic entomology is a field of science that interacts directly with the law, as a means
to reach conclusive results in litigations of both criminal and community-based cases
(Byrd and Castner, 2001). As a means to assist medico-legal investigations, research and
wildlife violations, the use of forensic entomology has in recent years become routine
(Benecke, 2001). Although in the majority of cases the focus relating to forensic
entomology is associated with crime scenes, there are three principle areas of
applications: urban entomology, stored products entomology and medico-criminal
(medico-legal) entomology (Byrd and Castner, 2001).
2.1.1 Urban Entomology
Urban entomology relates to situations in which insects have disrupted human
environments (Byrd and Castner, 2001). Such disruptions include the activities of
termites, cockroaches and evidence of an excess of insects as a result of livestock or
farms (Byrd and Castner, 2001). Cases involving the effect of termites usually relate to
the presence of infestations, costs of extermination and the damage caused by colonies
and the resulting cost and loss of property (Byrd and Castner, 2001). In many cases this
is the result of the lack of precautionary implementations to prevent infestations (Frankie
and Koehler, 1978).
Even on a small scale, flies cause a number of grievances within a person‟s environment.
Increase the number of flies and it follows that the annoyance they cause is exponentially
increased. Potential breeding and feeding grounds provided by large livestock holders,
including bovine and poultry, inevitably attract flies to the area (Byrd and Castner, 2001).
This increased number of flies can spread to surrounding areas, which can result in an
increasing number of lawsuits (Byrd and Castner, 2001).
Another serious example associated with urban entomology is evidence of neglect (Byrd
and Castner, 2001). The presence of arthropod activity upon a person‟s living body
indicates that there is a lack of hygienic conditions and that they have not been cared for
appropriately. Nursing homes and hospital patients have been known to suffer neglect
18
through myiasis (infestation) of flies, resulting in companies being taken to Court and
charged with neglect (Byrd and Castner, 2001).
2.1.2 Stored Product Entomology
Another application of forensic entomology is the presence and effect of arthropod
activity within stored products. Although extensive precautions are maintained to ensure
such infestations do not occur, maggots, caterpillars, insect debris within stored foods is a
common complaint (Byrd and Castner, 2001). The maintenance fees of upholding a pest-
free storage environment are very high, but pale in comparison to the potential costs of
insect infestations (Rees, 2004). Fines, detrimental publicity, loss of consumers trust and
potential legal actions are some of the possibilities associated with the presence of a
single insect or insect by product within consumables (Rees, 2004).
2.1.3 Medico-Criminal Entomology
Medico-criminal entomology is where arthropods are utilised to help solve crimes (Byrd
and Castner, 2001). The majority of crimes associated with medico-criminal entomology
involve violence (Hall, 2001) including murder, manslaughter and assault. These crimes
are not isolated to humans and forensic entomologists can be required to assist in
resolving questions associated with the death or mistreatment of livestock and
endangered animals (Byrd and Castner, 2001).
Entomological-based post mortem interval (PMI) can be one of the most important pieces
of information associated with a crime. Forensic pathologists utilise three natural
decomposition processes to determine an estimated PMI (Erzinclioglu, 2000). The
presence or absence of rigor mortis (stiffening of the body), time taken for a body to
reach a certain temperature, taking into consideration surrounding conditions, and the
order of organ decomposition (Erzinclioglu, 2000). These conditions can only be
manipulated to estimate PMI within two or three days since death. Beyond this interval
other methods must be used, the foremost of which is forensic entomology (Erzinclioglu,
2000).
19
With violent crimes that exhibit entomological evidence two main questions are central
for the forensic entomologist. Based on the entomological evidence what is the estimated
time since death (PMI)? And is there any possibility that the body has been moved from
a different location?
Medico-criminal entomology makes conclusions based on the examination and
identification of arthropods collected from both on and surrounding the corpse (Catts and
Haskell, 1997). By assessing the developmental stage of the species present and utilising
knowledge of successive colonisation; conclusions can be drawn (Catts and Haskell,
1997). For this information to be manipulated a forensic entomologist needs to have
extensive understanding and skill in sampling, identification, analysing and specific
species knowledge including geographical spread and biology (Catts and Haskell, 1997).
Using this knowledge a forensic entomologist is able to identify the specimens collected
from a corpse, determine the stage of development and, taking into consideration
surrounding environmental conditions, determine the time taken for the specimen to have
reached the stage of development based on the predictable succession of a corpse.
2.2 Medico-Criminal Entomology - Historical Background
Forensic entomology was first documented in the His Yüan Chi lu (“The washing away
of wrongs”) in 13th
century China (Benecke, 2001a). The recorded case involved a
stabbing at a farm (Benecke, 2001a). The investigator Sung Tźu utilised a flies ability to
detect blood to identify the murder weapon, which resulted in the owner confessing to his
crimes (Benecke, 2001a).
The observation of maggots feeding on corpses has been described through sculptures,
paintings and poems throughout the middle ages, reflecting the long history of forensic
entomology. In the 18th
and 19th
centuries, medico-legal doctors furthered the
understanding of the relationship that exists between decomposition and arthropod
activity. French medical doctor Orfila, observed the abundance of maggots, after
20
viewing a large number of exhumations, understanding that the maggots and other
arthropods played an important role in decomposition (Benecke, 2001a).
In 1855 after the observation of maggots on a corpse, French Doctor Bergeret explored
the idea of PMI determination from arthropod activity and development (Benecke,
2001a). PMI is the estimated time since death based on the stage of development of the
arthropods present at the scene (Benecke, 2001b). Bergeret used the idea of PMI to
determine the time interval between birth and death of a child found in a flat (Benecke,
2001b). Though Bergeret misunderstood the developmental rates of the insects and
produced a hugely inaccurate PMI, this is the first recorded case of modern forensic
entomology.
French medical doctor Jean Pierre Mégnin published in 1894 his most important work la
faune des cadavers based on 60 years of experience in the forensic utility of entomology
(Byrd and Castner, 2001). This book developed the theory of predictable waves of
arthropods upon a corpse, highlighting the eight stages of decomposition and the fauna
associated with them (Benecke, 2001). The book also dealt with the identity of larval and
adult forms of the different species present and 19 cases that had relied on forensic
entomology (Hall, 2001). Whilst popularising the subject, Mégnin‟s work also greatly
advanced the science of forensic entomology.
Through the 1900s, continued research revealed species lists of fauna associated with
corpses, circumstances of death affecting decomposition and the seasonality of species
present at decomposition (Benecke, 2001a). In the 1950s Hubert Caspers investigated a
case where a murdered woman was found in a water mill, naked except for a pair of red
socks and wrapped in a sack (Benecke, 2001a). Caspers use of entomological evidence
allowed him to identify the specimens collected from the corpse originated from a
different geographical region and as a results exhibited an alternative rate and time of
development (Benecke, 2001a). Subsequent to these advances in forensic entomology,
Leclecq (1969) and Nuorteva (1977) have maintained the movement of forensic
entomology into the future (Benecke, 2001a).
21
Though convincing the local authorities and other scientists of the benefits of forensic
entomology was initially difficult, the 150-year-old discipline has now become an
accepted practical method of investigation. Books by Byrd and Castner (2001), Goff
(2000) and Smith (1986) and continual research have cemented the use of forensic
entomology as a decisive tool in the search for conclusive legal evidence.
Of the arthropods that have the potential to be considered forensically important, it is the
Diptera and from this group, specifically the Calliphoridae that are by far the most
applicable and frequently researched. This is due to their direct involvement in forensic
entomological investigations including the determination of time since death, evidence of
neglect and the movement of corpses (Rees, 2004).
2.3 The Diptera
Insects are by far the most abundant animals on earth, found on every continent including
Antarctica; making up 85% of the worlds‟ known species (Erzinclioglu, 2000). This
equates to ~1,000,000 species worldwide, with more species being identified and
recorded daily (Erzinclioglu, 2000). Flies are one of the largest orders of insects and are
most forensically significant.
Flies are from the order Diptera and worldwide there are over 86,000 known recorded
species (Byrd and Castner, 2001). Within their respective environments flies are
considered scavengers, decomposers, active pollinators, parasites and predators (Byrd
and Castner, 2001). Of these the most forensically significant species are those
associated with scavenging and decomposition, generally from the family Calliphoridae.
2.4 The Calliphoridae
The family Calliphoridae, commonly called blowflies, comprise more than 1000 species
(Byrd and Castner, 2001), and contains Lucilia (Phaenicia) (green bottle flies),
Chrysomya, Calliphora (blue bottle flies) and Cochliomyia (screwworm flies) (Byrd and
Castner, 2001).
22
Adult Calliphoridae range in size between 6-14mm and have antennae with three
segments and a hair located on the final segment (Byrd and Castner, 2001). One of the
most characteristic traits of this species is a distinct metallic colouration that can range
from green, blue, bronze or black (Byrd and Castner, 2001). In the endemic
Calliphoridae species of Australia, the metallic colour is commonly dulled by a covering
of fine dust (Harvey, 2006).
The Calliphoridae species are amongst the first to locate a corpse and have been known
to appear within minutes of death (Byrd and Castner, 2001). Once located, the flies begin
oviposition, instigating the process of colonising the remains. The most frequently
sought sites on a corpse are the nose, mouth, eyes, ears, other exposed body orifices and
open wounds (Erzinclioglu, 2000). The flies target these areas due to the moist and
shaded conditions, which prevent the eggs from becoming dehydrated and desiccated
(Erzinclioglu, 2000).
Once the eggs have hatched, maggots develop, which range in length from 8 to 23mm
and are white or cream in colouration (Byrd and Castner, 2001). The larval body has a
terminal segment that includes the site of the spiracles and identifiable cone shaped
tubercles about its perimeter (Byrd and Castner, 2001). The spiracles are used to identify
the instar development stage (to be discussed in detail on page 22), for breathing, and as
an identification feature, as the slits within the spiracles slant towards the centre of the
larvae. In contrast, the spiracles of the Sarcophagidae maggots slat outwards or
downwards (Byrd and Castner, 2001). As the maggots are the most important specimens
for the determination of PMI these features can be of distinct importance in early
identification.
For a forensic entomologist the early appearance of the Calliphoridae species in the
decomposition of a body is forensically the most important evidence and essential for the
determination of PMI. For an accurate PMI to be determined species-specific
information is required. Below are the characteristics, common names and distribution
23
throughout Australia of the species, which were tested in this research. Permission for
use of pictures for figures was obtained from Associate Professor Ian Dadour (2008)
2.4.1 Calliphora dubia
Calliphora dubia (Macquart) commonly referred to as the blue-bodied blowfly is
distributed throughout the South-West of Australia (Dadour et al., 2001). The Western
Australian agriculture department describes the C. dubia as yellowish in colouration with
a purple stripe on its abdomen. Its size can vary from 5-10mm in length and is most
abundant during winter and spring.
Figure 2.1 Picture of C. dubia, commonly referred to as the blue-bodied blowfly.
2.4.2 Calliphora albifrontalis
Calliphora albifrontalis (Malloch) is commonly referred to as the Western Australian
brown blowfly. It is a robust golden-brown blowfly that can reach a length of 13mm.
Like C. dubia its distribution is through the South-West of Western Australia and it is
most predominant during winter and spring seasons (Smith, 1986).
Figure 2.2 Picture of C. albifrontalis commonly referred to as the Western Australian
brown blowfly.
24
2.4.3 Chrysomya rufifacies
Known as the hairy maggot blowfly, the Chrysomya rufifacies (Macquart) is a green
metallic blowfly, with dark blue margins on its abdomen. It can reach a length of 10mm,
and has a known Australia-wide distribution (Smith, 1986). Its activity is mainly
observed in the seasons of summer through to autumn.
Figure 2.3 Picture of Ch. rufifacies commonly referred to as the hairy maggot blowfly.
2.4.4 Chrysomya megacephala
Commonly known as the oriental latrine fly, Chrysomya megacephala (Fabricius) is
found throughout the whole of the Australia, Asia, South Africa and Afro tropic Islands
region (Smith, 1986). They are an urban species aggregating near human dwellings,
making them more likely to be encountered in forensic investigations (Smith, 1986). It
is bright metallic green in colouration with black margins on the 2nd
and 3rd
abdomen
(DuPonte et al., 2003). The most distinctive feature of this species is the presence of
large red eyes in the adult, see Figure 2.4 (DuPonte et al., 2003).
Figure 2.4 Picture of Ch. megacephala commonly referred to as the oriental latrine fly.
25
2.4.5 Lucilia sericata
Lucilia sericata (Meigen) is a widespread species within Australia and is commonly
found in urban or sub-urban districts (Smith, 1986). Its common name is the sheep
blowfly. It reaches a length between 6 to 9 mm and has a metallic blue-green, yellow-
green, green or green-bronze colouration (Byrd and Castner, 2001).
Figure 2.5 Picture of L. sericata commonly referred to as the sheep blowfly.
2.5 Succession of Invertebrate activity on the corpse environment
As mentioned forensic entomology involves the study of the successive colonisation of
invertebrate activity on and surrounding a corpse. When this information is coupled with
the species-specific environmentally based developmental information and the scientific
equation of accumulated degree-days (ADD calculation) an approximate PMI can be
determined.
Succession relies on predictable patterns of insect colonisation upon a corpse based on
the physical, biological and chemical changes a body undergoes during decomposition
(Byrd and Castner, 2001). Each stage of decomposition attracts a different group of
sarcosaprophagous arthropods. During early decomposition insects are attracted to the
abundant food source of the corpse and the suitable oviposition site it provides (Byrd and
Castner, 2001). Later species are attracted by the abundant quantity of other insect
activity, which also provides them with a food source (Byrd and Castner, 2001).
The predictability of succession is dependent on numerous factors that could potentially
affect the corpse. Factors such as environment (urban verses rural), season, rainfall, sun,
26
temperature, orientation of the body (hanging, burnt, buried or in an enclosed space) and
the geographic region in which the body is found are taken into account (where possible)
to ensure that accurate species development information is used (Byrd and Castner,
2001).
Examples of different urban versus rural environment effects have been observed by
Galloway (1989). After analysis of 189 cadavers found at different decomposition stages
within the Arizona desert, Galloway (1989) observed that onset of decomposition and
mummification occurred faster, than if within indoor conditions. Another example is the
effect of low temperatures on insect activity. Bass (1997) found that insect activity was
maintained between temperatures of 5ºC and 13ºC, but if the temperature dropped to 0ºC,
maggots were unable to survive, which would result in a longer decomposition period.
As mentioned Calliphoridae are amongst the first species to arrive at a corpse, with some
research suggesting they can arrive within minutes of death. The idea of succession is
dependant on the knowledge of the time of arrival of each species, and the temperature-
dependant time required to reach a developmental stage. Table 2.1 represents a broad
timeframe of the deposition of Calliphoridae (blowflies) upon a corpse. It is clear from
Table 2.1 that colonisation continues from the start of decomposition through to the later
stages of putrefaction. This colonisation length makes Calliphoridae one of the most
forensically important species to be collected from a corpse (Gunn, 2006).
27
Table 2.1: The decompositions stages that occur after death and the associated
Calliphoridae activity observed at each stage.
Stage of Decomposition
Calliphoridae (blowfly) Development Stage Observed
Fresh Blowfly eggs. 1st Instar Larvae.
Bloat Blowfly eggs. 1st, 2nd and 3rd Instar Larvae.
Putrefaction (Advanced Decay)
No eggs or 1st Instar Larvae. 2nd and 3rd Instar Larvae. Pupae in Surrounding environment.
Putrid Dry Remains
No Larvae Observed. Small number of pupae in surrounding environment.
An understanding of arthropod succession upon a corpse needs to be coupled with
detailed information of the life cycle of the species visiting the corpse. Figure 2.6 is a
diagrammatic representation of the life cycle of Calliphoridae including the specific
stages of larvae development (Goff, 2000). Each species follows a typical cycle, it is
only the specific time taken to arrive at a body and length of time spent at the body
reproducing and development of young that change between species (Campobasso et al.,
2001).
28
Figure 2.6: Typical life cycle of Diptera, including variations between larval
developmental stages (Goff, 2000, p52).
The first stage of the life cycle of flies is the eggs. Blowflies are typically diurnal, which
means they only deposit their eggs during the day, as their activity is inhibited at night
(Campobasso et al., 2001). The oviposition of Calliphoridae eggs occurs during the fresh
and bloat stages of decomposition, but ends by putrefaction due to the lack of a suitable
food source (Hall, 2001).
The next stage of development is the larvae, which is the immature stage of an insect and
is the most frequently observed stage of development associated with a corpse. The
larvae are split into three developmental stages; 1st, 2
nd and 3
rd instar. Instars are the
stage of successive molts experienced by the fly (Byrd and Castner, 2001). Age of larvae
can be determined by the molt stage of the larvae, which is identified by the number of
spiracles present on the posterior of the larvae (Figure 2.6). First instar larvae have a
29
single slit in the posterior spiracle, whereas the 2nd
instar larvae have two slits on the
posterior spiracle. The larvae of successive species will be present on the corpse from the
fresh stage of decomposition to the putrefaction stage. The extensive duration of larvae
upon a corpse is due to the food source available for the larval species to consume.
Once the larvae are mature they will migrate from the body to shed their skin to form a
pupa. The unusual aspect of this process is that the shedding is done from inside the old
skin, which will shrink and harden to form a protective outer skin called a puparium
(Byrd and Castner, 2001). The morphological features of the larvae are retained on the
puparium and can be used as a means of identification (Byrd and Castner, 2001). Once
the pupae have completed metamorphosis the adult fly will emerge, beginning the cycle
anew.
Succession relies on a predictable sequence of species arrival upon a corpse and has long
been considered an accurate method of PMI. It must be understood though that each
region will have different species, which can arrive in different orders or be present upon
the corpse for variable times. Goff (2000) recorded within the Hawaiian region that the
first species to colonise a corpse was Chrysomya rufifacies, yet within Western Australia
Dadour (2001) found Calliphora dubia to be the primary blowfly collected. The
predicability of succession is limited to detailed species information for a specific
geographical region.
2.6 Post-Mortem Interval
PMI is the determination of the estimated time of death or the time elapse between death
and locating the body (Dix et al, 2001). PMI can be applied to numerous areas of
forensic work but investigation of homicide is of critical importance. Elimination of
suspects or the connection of victims to a missing person‟s records can be determined via
the information provided through PMI (Byrd et al, 2001). Unfortunately unless death is
witnessed the exact PMI cannot be determined, but there can be sufficient forensic
entomological evidence for an estimation to be made (Dix et al, 2001).
30
In the determination of PMI specific steps must be followed.
1. Collect specimens from on and around corpse, collecting eggs, larvae, pupae and
adult flies if present.
2. Record temperature of scene and maggot masses, location of body (inside or
outside), surrounding environment (urban or rural) and any information that may
be relevant during analysis (presence of animals, disturbance of site or partial or
full burial).
3. Identification of specimens collected.
4. Obtain climatic data for approximately a month prior to discovery of corpse and
several days after. The mean temperature must be determined, making a note of
excessive rainfall or extreme low temperatures.
5. Analysis of larvae, including length and instar stage. This recorded information
should then be compared to databases for the relevant species, with reference to
relevant mean temperature determined previously. This will allow for the age of
the specimens to be determined.
6. Using the mean temperature determined previous and specific-species information
accumulate degree days (ADD) can be determined. ADD is simply the
calculation of multiplying the hours taken for a species to reach a developmental
stage by the mean temperature (Amendt et al., 2007). The resulting number is
then divided by 24 to reach the estimated number of days between death and
location of the body. It must be noted that succession patterns will have to be
considered within the final analysis.
Cases that have utilised the above methodology include neglect of elderly people in the
form of misconduct by carers (Benecke et al., 2004), neglect of children (Benecke et al.,
2001b), suicides (Arnaldos et al., 2005) and homicides (Catts et al., 1990, Arnaldos et al.,
2005, Goff, 2001 and Erzinclioglu, 2000).
By far the most important aspect prior to the determination of PMI in all forensic
entomology cases is the accurate identification of the specimens collected from the
corpse. False identification would lead to the application of incorrect developmental data
31
and succession information resulting in an inaccurate PMI. Below is the traditional
method of species identification, followed by the variety of modern techniques available
as an alternative means of identification.
2.7 Forensic Entomology - Morphological Identification
Traditionally the identity of a specimen was determined using morphology.
Morphological techniques rely on taxonomic keys and illustrations coupled with an
extensive knowledge of entomology (Smith, 1986). Identification can be complicated by
many underlying problems, including quality of samples, lack of identification key for
immature specimens, loss of diagnostic features (during extraction), subtle differences
between species and foreign species.
The quality of a specimen collected can vary greatly, from whole larvae, to only a
fragment of a single fly wing (Ames et al., 2006), affecting the ability of the taxonomist
to morphologically identify the species. If the specimen is poorly preserved or damaged,
the diagnostic features can be lost, thus making an accurate identification impossible
(Harvey et al, 2003). Subtle differences between species are common, which can result
in the false identification through lack of knowledge or mis-judgment of a feature.
Furthermore, if the feature exhibiting the only difference between species is lost or
damaged, identification and therefore PMI cannot be determined. Wallman (2001) has
suggested that the third instar of some species is unable to be separated diagnostically,
thereby making them impossible to identify without the rearing of larvae to adults.
Rearing is a time consuming process, which is dependent on larvae not having been
preserved, and thus killed, prior to identification attempts (Stevens et al., 2001).
Though there is an extensive collection worldwide of taxonomic literature (Smith, 1986),
this does not extend into immature stages of development, such as eggs and larvae. In
relation to Australian species this is particularly evident (Harvey et al, 2003). The
majority of specimens collected from on or around a corpse are larvae (maggots) making
this lack of diagnostic information of great significance, as PMI initially relies solely on
this information (Wallman et al, 2001).
32
For the diagnostic keys available, the complex wording of morphological features
requires an extensive knowledge of insect morphology and numerous years of experience
for a positive identification to be possible. The closer the diagnostic keys are to
identifying a species, the more complicated and subtle the descriptions become. Below is
an example of the detailed entomological language utilised. The description is used in
the identification of L. sericata from L. cuprina (Smith, 1986).
Upper margin of anal segment in end view with the inner tubercule (i) separated
from each other by a distance approximately equal to the distance between the
inner (i) and median (m) tubercules. Lucilia sericata
Another problem that is becoming more frequent is the presence of foreign carrion
breeding blowflies (Wallman et al, 2001).
Due to these problems, an alterative method of identification is imperative for
entomological evidence to be used as a frequent and acceptable tool in criminal cases.
The new diagnostic identification technique must fulfil certain criteria to be accepted
over tradition methods.
Identification from any stage of development.
No reliance on a single feature that can be easily damaged.
Distinction between local and exotic species.
Reproducibility of tests.
Relatively easy to perform.
Taking into consideration all these factors alternative techniques have been tested to
deem the most appropriate replacement for morphological identification of forensically
important arthropods.
2.8 Alternative Approaches to Identification
2.8.1 Scanning Electron Microscopy (SEM)
The idea of morphological identification, though highly problematic, still has merit to
warrant continual research with advanced techniques. SEM allows for the visualisation
33
of an abundance of features previously not considered (Sukontason et al., 2004a).
Sukontason (2006) used SEM to morphologically differentiate Chrysomya rufifacies and
Chrysomya villeneuvi via elaborate tubercles and the number of globules at the dorsal-
lateral membrane border. Sukontason (2004a) furthered the application of SEM to more
species by observing morphological differences between antennal sensilla (sensory
organs). Sukontason (2007) also targeted the identification of forensically important eggs
via the use of SEM, and found the split of the plastron differed between Lucilia cuprina
and Lucilia ibis and could be used for identification.
2.8.2 Potassium Permanganate staining technique
Potassium permanganate staining has been utilised by Sukontason (2004b) as an
alternative method of identification for the sometimes problematic but forensically
important eggs. The staining enhances features so that they can be observed under light
microscopes. Sukontason (2004b) found that the eggs from the Calliphoridae species
Chrysomya nigripes, Chrysomya pacifica, Aldrichina grahami, Lucilia cuprina, Musca
domestica and Megaseli. Scalaris could be distinguished subsequent to staining. This
distinction was not reflected by Chrysomya rufifacies or Chrysomya megacephala.
Though the technique shows potential as a simple and relatively inexpensive method of
morphological identification, the lack of universal distinction between species is a key
limitation.
2.9 Deoxyribonucleic acid (DNA) - General Background
DNA is the genetic material of living things, located within every cell of the body (Glick
et al., 2003). Friedreich Miescher, a Swiss Biochemist, made the discovery of DNA in
1869, which was obtained from pus stained bandages and fish sperm (Tobin, et al.,
1997). In 1944, Oswald Avery, determined that DNA was the genetic material, which
had been encoded with information for the establishment and maintaining of cellular and
biochemical functions within organisms (Glick et al., 2003).
In the 1920s biochemist P.A. Levene found that no matter the source of DNA the
chemical structure was the same (Tobin et al., 1997). The chemical structure of DNA
34
consists of four nucleotide bases, which are Adenine (A) and Guanine (G) (purines), and
Thymine (T) and Cytosine (C) (pyrimidines). The nucleotides are complementary such
that adenine binds to thymine with a double hydrogen bond, whilst guanine binds to
cytosine with a triple hydrogen bond (Griffith et al., 2005). The backbone to which the
nucleotides attach is a phospho-sugar component arranged in a double helix structure,
which was discovered in 1953 by James Watson and Francis Crick (Rudin et al., 2002).
DNA is the vehicle by which traits are transferred through each generation and is now
referred to as the „blue-print of life‟ (Rudin et al., 2002). The specific arrangement of
nucleotide bases is what provides distinction between species (Griffith et al., 2002). The
challenge has been the identification of species based on the variation between species.
Below are examples of the uses of DNA for the identification of forensically important
Calliphoridae.
2.10 DNA Based Methods of Identification
2.10.1 Random Amplified Polymorphic (RAPD) DNA
RAPD requires limited knowledge of the DNA sequence of an organism/species and
instead relies on the use of several arbitrary short oligonucleotide primers, 8-12 base in
length (Otranto et al., 2002). The arbitrary primers randomly amplify segments of DNA
producing a pattern (fingerprints) that can be used as a means of identification (Benecke,
1998). The discriminating power and efficiency of RAPD‟s has been utilised in
commercial breeding, research of endangered species, bacteria, plants and several insects
and inbreeding in wildlife (Benecke, 1998). Benecke (1998) has shown the potential of
the technique in the identification of forensically related arthropod species and found that
distinct profiles could be developed. The main limitations associated with the technique
were the variation in both the height and width of peaks within the fingerprint under
different parameters. These parameters include the brand of PCR thermocycler, the DNA
concentration and the specific primers utilised (Benecke, 1998). Due to these limitations,
the technique was utilised as a species-identification test for urgent cases, where further
testing was to be conducted.
35
2.10.2 PCR-Restricted Fragment Length Polymorphism (PCR-RFLP)
PCR-RFLP is another method for species identification. PCR-RFLP involves the
amplification of specific regions of DNA using target primers (Schroeder et al., 2003).
The resulting product is then further digested with restriction enzymes and then the
resulting bands are viewed using gel electrophoresis (Noel et al, 2004 and Schroeder et
al., 2003). Restriction enzymes cut at specific nucleotide combinations within the
genome. These cutting sites (usually 4-6 nucleotides in length) cover variations in the
region that distinguish species (Schroeder et al., 2003). The technique is both rapid and
accurate and has been used to distinguish species from U.S, Canada and Germany (Noel
et al, 2004 and Schroeder et al., 2003). Noel (2004) used the technique to confirm the
identification of museum specimens and found that molecular testing conveyed mistaken
morphological identity of more than one specimen. Schroeder (2003) researched the use
of PCR-RFLP in the differentiation of Calliphoridae and found a degree of distinction but
also similarity between species. The regions targeted using this technique include the
cytochrome oxidase I (COI) and cytochrome oxidase II (COII) genes in the mitochondrial
DNA (mtDNA) and the tRNA leucine gene (Schroeder et al., 2003). Though a
potentially viable technique, the additional step of identifying restriction enzymes sites
for the production of unique PCR-RFLP patterns (Ratcliffe et al., 2003); which is both
time and resource consuming has resulted in its reduced application within the field of
forensic entomology in favour of more advanced techniques.
2.10.3 Ribosomal Genes
Nuclear ribosomal DNA (rDNA) is considered a useful target for the identification of
species as it contains an array of tandemly repeated units (Otranto et al., 2002). Within
the repeat units, internal transcribed spacers (ITS-1 and ITS-2) and associated ribosomal
RNA (rRNA) genes (12S, 18S and 28S) are present (Otranto et al., 2002).
ITS sequences are found within the non-coding regions of the DNA, and exhibit high
substitution rates lending themselves to phylogenetic studies of populations (Otranto et
al., 2002). ITS-1 and ITS-2 typing have also proven useful methods of identification of
arthropods as they have a high degree of interspecific sequence variation coupled with
36
low levels of intraspecific sequence variation (Otranto et al., 2002). Phuc (2003)
determined the ITS-2 sequences to be suitable in the identification of 2 sibling species
and 4 related species of Anopheles.
The rRNA genes have an intrinsically varied degree of genetic evolution, which lends
itself to phylogenetic studies especially in the distinction between older evolutionary
relationships (Stevens et al., 2002 and Stevens, 2003). Within the rRNA there are highly
informative regions that represent potential sites for the development of molecular
markers for the identification of forensically important Calliphoridae (Steven and Wall,
2001). The advantages of rRNA include the high volume of information on the gene
family and the large amount of highly conserved sequence (Kumar et al., 1999).
The 16S and 12S rRNA have been used by Kambhampati and Smith (1995) in the
development of universal primers in the identification of 10 insect taxa due to the high
amount of conserved regions. Stevens and Wall (2001) found the 28S rRNA gene to be
an appropriate region for the development of species-specific molecular markers for the
identification of 9 forensically important species from Britain and Europe. One problem
encountered was the identification of 2 Lucilia species, which required further DNA
sequencing of the 28S rRNA region to establish definitive separation. Though an ideal
method of inter-species identification, intra-specific identification has proven difficult. In
testing of Lucilia cuprina, intra-specific separation was not possible using the 28S rRNA
gene (Stevens et al., 2002). Also tested in that study was the 2.3kb of the COI and COII
region, which instead conveyed a wide variation of differences across all specimens
making separation of the L. sericata and L. cuprina a possibility (Stevens et al., 2002).
2.10.4 Cytochrome Oxidase Genes of the Mitochondrial DNA
Mitochondrial DNA (mtDNA) is the genome located within the mitochondrion. Utilising
a separate set of enzymes to nuclear DNA, the mitochondria is able to code for a number
of functions, including self-replication and genome transcription (Hale et al., 1995). The
mitochondria are considered the site of energy production within a cell and have such
been named the „powerhouses‟ (Hale et al., 1995). The mtDNA is composed of 2 rRNA
37
genes, 13 protein-coding genes and 22 transfer RNA (tRNA) genes (Otranto et al., 2002).
Structurally the mtDNA is a circular, double-stranded molecule generally between 15 to
20kb (Junqueira et al., 2004). Recently, mtDNA has become a common tool of
taxonomy, population analysis and evolutionary investigations because of its high copy
number and high mutation rate, which has led to rapid sequence differences between sub-
species within only a few generations (Malgorn et al., 1999). Another important
characteristic of mtDNA is the large amount of highly conserved sequences, which
allows for the development of universal primers (Otranto et al., 2002).
Genes within the mtDNA are able to accumulate mutations over time, making it a
common target region in the use of phylogenetic studies including the grouping of
blowflies of forensic importance (Wells and Sperling, 2001). Recently the focus of
mtDNA has been the development of molecular markers for the identification of
arthropod species (Noel et al., 2004 and Phuc et al., 2003 and Stewart et al., 2003).
Within the mtDNA the majority of published material focuses on the cytochrome oxidase
genes one and two (COI and COII) and the Cytochrome b gene (Cyt-b). The COI and
COII regions have been extensively studied for their use in the identification of
forensically important species across the world (Ames et al., 2006, Malgorn and Coquoz,
1999, Harvey et al., 2003, Wallman and Donnellan, 2001, Wells and Sperling, 2001,
Zehner et al., 2004, and Saigusa et al., 2005). Areas that have been studied include
Western Australia, South Australia, South Africa, USA, Canada and Europe (Wallman et
al, 2001, Harvey et al., 2003, Wells et al., 2001).
COI is the terminal catalyst in the respiratory mitochondrial chain and has proven to be
one of the most suitable areas for the development of species identifiable markers
(Otranto et al., 2002). The COI is large in size and contains both highly conserved and
variable regions (Otranto et al., 2002). Harvey et al., (2003) utilised a 278bp region of
the COI region in the identification of 5 forensically important species from the Western
Australian region. A problem encountered by Harvey et al., (2003) was the difficulty in
distinguishing between some species, which could only be alleviated through the
sequencing of a larger region of the COI gene. Saigusa et al (2005) extended the region
38
of COI analysed to 304bp and found that 8 forensically important species from Japan
could be successfully identified.
Analysis of the COII gene by Wallman and Donnellan (2001) found the gene to be a
potential developmental site for the identification of forensically important Calliphoridae
species. The majority of research for the identification of Calliphoridae species using the
COII gene has been performed in conjunction with the COI gene (Stevens, 2003, and
Stevens and Wall, 2001). Within other insecta species the use of the COII gene has been
more prominent (Ma et al, 2006 and Goswami et al., 2005).
The use of the Cyt-b gene as a means of species identification is relatively rare due to a
lack of sequences for the region. Ramos de Pablo (2006) has found through preliminary
testing that the Cyt-b gene can differentiate between insect orders and has the potential
for species identification.
The extensive research into the COI gene has made it a useful site for the development of
new primers in an attempt to design an efficient and reliable means of identification.
2.10.5 Sequence Specific Primers
Sequence specific primers (SSP) are designed to identify at least one species based on the
presence of a unique segment of nucleotides within the sequence. Overall the greatest
application of SSP has been in relation to humans (Gonzalez et al., 2003, Clague et al.,
2003, Grahn et al., 2001 and Pantelidis et al., 2003). SSP applications are varied and
when coupled with PCR are considered a rapid and accurate technique.
In the realm of insects the most frequent application of SSPs is in relation to the genus
Anopheles, commonly referred to as the Mosquito (Manonmani et al., 2001, Fettene et
al., 2002, Kampen et al., 2003 and Phuc et al., 2003). The distinct focus associated with
the Anopheles is their interaction with humans and the relating medical implications.
SSPs have been used to identify malaria vectors from non-malaria vectors assisting in
locating only the populations with medical consequences to humans (Phuc et al., 2003).
39
Noel (2004) compared SSP with PCR-RFLP and found identification using both possible,
but SSP had a much higher success rate than PCR-RFLP.
The human forensic application of SSP has been shown in the analysis of bloodstains
upon cloth (Ota et al, 2006). Ota (2006) describes how SSP can be used to type the
highly polymorphic human leukocyte antigen gene(s) from both fresh samples and dried
samples upon cloth ranging from a single day to 3 months. Ota (2006) found the
technique to be highly sensitive and did not require the isolation of DNA prior to
analysis, making it a very useful forensic tool.
Marshall (2007) describes the use of SSP for the forensic discrimination of two species of
scallops, Placopecten magellanicus and Chlamys islandica. The mis-identification of
seafood has many forensic implications including the breach of fishing regulations,
pressure on endangered species and fraud of commercial products (Marshall et al., 2007).
Marshall (2007) describes the difficulties associated with visual identification of species
due to loss of identifiable features and how the use of SSP is both rapid and relatively
inexpensive.
SSPs have been used both forensically and non-forensically, on both insects and humans
on the basis that identification using morphological methods is unreliable and not ideally
suited for forensic situations. Though the use of SSP in relation to Calliphoridae has not
been applied, the results obtained in research on other insects demonstrate its potential as
an identification tool of forensically important Calliphoridae.
The use of SSPs relies on the concept that where there is a difference between species in
a particular segment of the sequence, it can be used to identify species based on the
presence or absence of amplification. This method depends on careful and accurate
design of the SSP for it to be an effective identification tool. The tools utilised in the
amplification of the SSP pairs from the study are polymerase chain reaction (PCR) and
multiplex PCR.
40
These techniques presented are a selection of the increasing application of DNA based
approaches to the area of forensic and specifically forensic entomology. Additional
techniques to these mentioned above include sequencing, which is applied to multiple
DNA techniques and allows for whole sequences to be viewed, analysed and manipulated
for identification (Malgorn et al., 1999), development of molecular phylogenies (Nei,
1996) and population structuring (Lessinger et al., 2000). Other techniques also include
inter simple sequence repeats (ISSR) (He et al., 2007) and sequence-characterised
amplified regions (SCAR‟s) in the development of universal markers for identification
(He et al., 2007 and Vidal et al., 2000). DNA based area of research are continually
developing and advancing towards greater efficiency and specificity and subsequently
improving and increasing the application of forensics within the society. A common
methodology occurring between the majorities of the DNA techniques mentioned above
is the polymerase chain reaction.
2.11 Polymerase Chain Reaction (PCR)
DNA within a cell is naturally copied prior to the division of the cell. The laboratory
replication of this method is the process called the polymerase chain reaction (PCR).
PCR is an in-vitro reproduction technique of specific DNA sequences in analysable
amounts (Hoy, 1994) and following its introduction, PCR has become one of the most
significant techniques in biology. PCR is an enzymatic process that facilitates a specific
segment of the DNA molecule to be isolated and amplified (Gunn, 2006). Since its
introduction, PCR has been applied to a large range of scientific disciplines and has since
become a widespread research technique. The amplification of low copy numbers of
DNA, isolation of DNA fragments, cloning DNA and genomic DNA, sequencing of
DNA and the mutagenesis of specific DNA sequences are examples of some of the
applications of the PCR reaction (Hoy, 1994). Predominantly the samples commonly
encountered in the forensic application of PCR include saliva residues on envelopes…
(Withrow et al., 2003), blood (Pizzamiglio et al., 2004) and fingerprints (Balogh et al.,
2003); allowing for DNA profiling to be conducted as a means of exclusion or conviction
of suspects.
41
2.11.1 PCR Protocol
Three main steps are involved in the PCR process allowing the amplification of a specific
target DNA sequence. These are denaturation, annealing and synthesis, which are cycled
to allow for an exponential increase in the DNA template quantity. After a certain
number of cycles the PCR will no longer exponentially accumulate amplification
fragments and will enter a linear stage (Saiki, 1989). The greater the concentration of
DNA the fewer cycles required in reaching an amplification plateau (Hoy, 1994). A
standard PCR will have approximately 30-35 cycles, but if the DNA concentration is
extremely low 40-45 cycles may be required (Hoy, 1994). Below is a detailed
description and diagrammatic representation (Figure 2.7) of each step involved in the
PCR.
Prior to PCR cycling, the initial step is the thermal denaturation of the double-stranded
DNA into single-stranded DNA at an optimal temperature of 94-95ºC (Glick et al.,
2003). This step is maintained for approximately 1 to 3 minutes and ensures that the
entire DNA template within the reaction is separated into single strands (Hoy, 1994). If
complete initial denaturation is not obtained, it will result in the inefficient utilisation of
the template, causing overall final yield of PCR products to be poor (Hoy, 1994). After
the completion of the initial denaturation step, the temperature will be maintained and the
first denaturation of the PCR cycles will begin. This initial doubling of denaturation only
occurs once within a reaction and further ensures complete template separation. During
cycling the denaturation step is reduced to 30 seconds, and separates the newly
synthesised double-stranded DNA sequences and activates the Taq polymerase (Erlich,
1993).
The second step of the cycle is primer annealing or attachment to the complementary
single-stranded DNA sequence. For this step the temperature of the reaction is slowly
cooled to the optimal annealing temperature, which is determined using the base
composition of the primer (Glick et al., 2003). In a standard PCR this step occurs for
approximately 20 to 30 seconds (Hoy, 1994). During the first cycles, the primer will scan
the template to locate the correct target sequence for amplification (Hoy, 1994). Once the
42
newly synthesised product is selected it will become the preferred template for primer
attachment (Hoy, 1994).
The third step is the synthesis of the complementary DNA using the 3‟ end of the
previously attached primer as a marker for extension (Glick et al, 2003). This is
accomplished using Taq DNA polymerase and free nucleotides present within the
reaction (Hoy, 1994). The synthesis of the new template strand occurs in a 5‟ to 3‟
direction (Hoy, 1994), under the standard conditions of 72ºC for 30 seconds (Erlich,
1993). It is during this step that complementary double-stranded DNA is produced ready
for the cycling process of PCR to recommence.
After the cycling of the above three steps has ended there is a final extension period. The
final extension ensures that all the protruding ends of the newly synthesised PCR
products are filled in, resulting in the presence of double-stranded DNA sequence of the
accurate length determined by the primers (Glick et al., 2003). Within a standard
reaction the final extension occurs at 72ºC for 5 minutes (Hoy, 1994).
43
Figure 2.7: Schematic representations of a standard PCR in the amplification of target
DNA using specific primers. Included are the reagents involved, the three PCR steps and
the exponential increase of DNA following each cycle (from Hoy, 1994, p206)
2.11.2 PCR Reagents and Optimisation
PCR requires specific reagents to be combined in exact amounts to ensure accurate and
efficient amplification of a specified segment of the DNA sequence. The standard
reagents included within a PCR are a DNA sample or template, deoxynucleotide
triphosphates (dNTPs), Taq DNA polymerase, DNA polymerase buffer, MgCl2, and
specific primers (Saiki, 1993). Each reagent has a specific role to play within the PCR
and its concentration within the final volume should be optimised.
DNA can be obtained from various sources, but the samples must have a sufficient
amount of intact DNA for the PCR to amplify the specific DNA sequence (Ridgwell,
44
2004). A standard PCR ideally requires 105 to 10
6 target molecules for primer-template
binding (Hoy, 1994). If the template concentration is too low there is limited target
regions for primer-binding, results in limited or inhibited amplification in the PCR.
Alternatively if the template concentration within the reaction is too high it can promote
the production of non-specific bands or inhibit the reaction entirely.
The dNTPs are the four nucleotides that make up DNA (dATP, dTTP, dCTP, dGTP).
Free dNTPs are required in the synthesis of a complementary sequence of the template
DNA (Ridgwell, 2004). It is important that all dNTPs are present in equal amounts
within the reaction for efficient precursors during synthesis (Saiki, 1993). The amount of
dNTPs within the reaction should be between 50 to 200µm as they directly reflect the
amount of free Mg2+
(Saiki, 1993).
Taq DNA polymerase is involved in the extension of the complementary DNA replicated
within the PCR (Hoy, 1994). Originally in 1985 an Escherichia coli DNA polymerase I
was utilised, which synthesised DNA at 37ºC, resulting in the addition of new DNA
polymerase every cycle (Hoy, 1994). This was not an efficient process and an alternative
DNA polymerase was sought. Taq DNA polymerase is from a thermophilic eubacterial
microorganism Thermus aquaticus (T. aquaticus) isolated from a hot spring in
Yellowstone National Park (Gelfand, 1989). The distinct advantage of Taq was its
thermostable abilities to withstand repeated exposure to temperatures up to 94-95ºC
required in the denaturation of double-stranded DNA (Hoy, 1994). This feature allowed
for a single application of Taq DNA polymerase within a PCR, greatly improving the
efficiency, specificity and yield of the reaction.
MgCl2 concentration affects the ability of the primer to anneal to the specific site of the
template DNA sample and hence can affect both specificity and yield of the PCR (Saiki,
1989). Raising the MgCl2 concentration lowers specificity, which is roughly comparable
to the lowering of the annealing temperature (Hoy, 1994). If there is an excess
concentration of Mg2+
it will result in an accumulation of non-selected product,
alternatively if the concentration is too low, the overall yield of the reaction will be
45
reduced (Hoy, 1994). The MgCl2 concentration affects both the Taq DNA polymerase
and dNTP amounts within the PCR, the recommended standard concentration within a
reaction are 1.5mM of MgCl2 with 200µM of each dNTP, which provides sufficient free
Mg2+
for primer-binding without inhibiting the Taq DNA polymerase activity (Saiki,
1989).
Primers determine the length, specificity and nature of the amplified DNA (Hoy, 1994).
Within a standard reaction, there is both a forward and reverse primer, which flank the
segment of DNA to be amplified (Hoy, 1994). As visible in Figure 2.7 the primer
anneals to the single-stranded DNA and provides the starting point for the extension of
the complementary sequence identified for replication (Hoy, 1994). If primer
concentration is in excess within the reaction, non-selected products will be amplified
(Gunson et al., 2003). Alternatively if the primer concentration is low, the overall yield
of the reaction will be reduced (Gunson et al., 2003).
2.11.3 Specific PCR Primer Design
Primer design provides the distinct specificity required to amplify only the segment of
DNA required for the analysis. In the design of a stable, specific primer the following
guidelines must be taken into consideration (Hoy, 1994):
1. A unique primer sequence
2. GC content between 45-55%
3. Primer length between 18-25 oligonucleotides
4. No self-complementarity
5. No antisense complementarity
The initial guideline in primer design is that the primers are composed of a unique set of
nucleotides (Sharrocks, 1994). The most important region requiring unique nucleotides
is the 3‟ end, as this is where synthesis begins (Sharrocks, 1994). A method for
increasing the specificity of the 3‟ end of the primer is the addition of a mismatch base,
which is located at the second nucleotide position from the 3‟ end of the primer and does
46
not exhibit complementarity with the template sequence. This lack of complementarity
ensures to a degree that only the specified segment of the template can bind with the
primer.
The distribution of unique nucleotides within the primer sequence includes an optimal
GC content of 45-55% and an avoidance of purine and pyrimidine stretches (Saiki, 1989).
By utilising the individual base composition within the primer sequence it is possible for
an approximate annealing temperature (Tm) to be determined via the equation: Tm =
2AT + 4GC (Suggs et al., 1981). Calliphoridae DNA has proven to be difficult in the
development of specific primers, due to an average GC-content of only 30% (Junqueira et
al., 2004). Even with this limitation, successful primers have been designed and proven
both efficient and stable for specific amplification (Ames et al., 2006, Malgorn and
Coquoz, 1999, Harvey et al., 2003, Wallman and Donnellan, 2001, Wells and Sperling,
2001, Zehner et al., 2004, and Saigusa et al., 2005).
The average recommended length of a primer is 18-25 nucleotides, but this can vary
depending on the specific region to be amplified from the template DNA sequence (Hoy,
1994). The length of the primer is dependant on the amount of specificity required by the
primer in the amplification reaction (Hurley et al., 1993). Primers 18-25 nucleotides in
length are generally recommended, as it provides both primer stability and specificity
(Sharrocks, 1994). In the use of multiple primers, it is recommended that all primer be of
the same or similar length (Hurley et al 1993).
Secondary products are unexpected amplification artefacts caused by the mis-annealing
of the primer, either via self-complementarity or antisense complementarity (Saiki,
1989). Self-complementarity is where the primer hybridises to itself instead of the
template (Hurley et al., 1993). This occurs when the 3‟ end of the primer anneals to its
own 5‟ end resulting in the folding of the primer into a hairpin structure to be formed
(Hurley et al., 1993). These secondary product hairpins will be the favoured product in
the PCR, overwhelming the reaction and masking the desired primer amplification
47
(Hurley et al., 1993). Ensuring long stretches of a single base within the primer sequence
are avoided can prevent self-complementarity (Sharrocks, 1994).
Antisense complementarity is where the primer exhibits homology with the antisense
primer within the reaction (Sharrocks, 1994). The secondary product resulting from this
is the formation of primer-dimers (Sharrocks, 1994). Primer-dimers are the partial
hybridisation between primer pairs resulting in the formation of a double-stranded
fragment with a length close to the sum of the two primers involved (Saiki, 1989). As
with the hairpin structures, primer-dimers can overwhelm a reaction becoming the
predominant product, masking the expected amplified amplicon (Saiki, 1989).
The above recommendations and guidelines usually result in the design of primers with a
relatively high degree of success due to the removal or prevention of potential
problematic features. These guidelines are not foolproof and it is possible for potential
primers that are designed accurately and carefully to still result in failed amplification.
For all primer-design conducted within this study, these guidelines and recommendations
were applied to ensure high-quality primer design for subsequent testing.
2.12 Multiplex PCR
Multiplex PCR is a variant of the standard PCR in which two or more DNA targets are
simultaneously amplified within a single reaction (Henegariu et al, 1997). Figure 2. 8
shows the difference between a standard PCR, which utilises a single primer pair, and the
multiplex PCR, which uses numerous primer pairs each with a specific region to amplify.
The obvious advantage of this technique is the considerable time, effort and resources
that can be saved and is consequently becoming a popular technique within the realm of
forensic science.
48
Figure 2.8: Diagrammatic representation of the difference between standard PCR primer
binding (a) and multiplex primer binding (b). The standard PCR involves a single
forward and reverse primer. Multiplex PCR can be composed of multiple reverse primer
pairs and a single forward primer, where only the expected primer will bind to its selected
species.
Multiplex PCR was first described by Chamberlain in 1988 and has since been adapted to
varied areas of DNA analysis (Markoulatos et al, 2002). These areas include gene
deletion analysis (Cagliani et al., 2004), mutation and polymorphism analysis (Barker,
2000), quantitative analysis (Bombieri et al., 2005) and reverse transcription PCR (Morin
et al, 2004). Multiplex PCR has also become a tool in the identification of viruses
(Heredia et al., 1996), bacteria (Malkawi et al., 2003 and Kawaguchi et al., 2005),
parasites (Orlandi et al., 2003), insects (Pavan et al., 2007 and Dang et al., 2005) and
medically important insecta (Phuc et al., 2003, Kengne et al., 2001 and Noel et al.,
2004).
Pavan (2007) utilised the multiplex PCR technique for the diagnostic identification of the
cryptic species complex of Rhodnius prolixus and Rhodnius robustus (Hemiptera).
Pavan (2007) found the multiplex PCR component to be simple, objective and cost-
efficient. Dang (2005) has also utilised multiplex PCR as a rapid and powerful method in
the identification of Trichogramma wasps. Dang (2005) found multiplex PCR to be fast
and required low quantities of DNA. Dang (2005) also found it was possible to design a
multiplex PCR that avoided false negative results via the presence of at least one band for
every species.
49
Though the above examples represent the application of multiplex PCR to insects, the
species they utilised are not pertinent to this study. Noel (2004) has explored the
application of the technique in relation to Calliphoridae in the identification of two
species of Cuterebra, which are known to cause myiasis. Noel (2004) found the
technique to be efficient and to have a high identification success rate, when compared to
alternative methods.
The common forensic application of multiplex PCR is in relation to wildlife forensics.
McInnes (2005) developed two multiplex PCRs for the identification of the Australian
black cockatoo, which are under-threat from poachers and exotic pet traders. Frasier
(2006) has explored the application of multiplex PCR as a means of identifying North-
Atlantic Right whales. Frasier (2006) was able to develop a rapid, reliable and cost-
effective multiplex PCR that has the potential as a forensic identification marker in illegal
trading of whale meat. Another example is the development of a multiplex PCR for
forensic discrimination of two species of scallops (Marshall et al., 2006). The objective
of multiplex PCR is to eliminate the necessity of secondary testing including DNA
sequencing, RFLP mapping and fingerprinting, all of which are time-consuming and
expensive (Marshall et al., 2006). Marshall (2006) found the multiplex PCR technique
provided a direct means of identification and has the potential to be adapted to other
DNA regions and species.
The extensive advantages of this technique are hindered by a single limitation, which is
the optimisation of all reagents, temperatures and specific primers used to amplify target
regions.
2.12.1 Optimisation of Multiplex PCR
Though the same reagents are used within a multiplex PCR as within a standard PCR, the
effect of altering the primer and Mg+2
concentration, or the annealing temperature, can be
dramatically different. As the purpose of each reagent has previously been described,
this section will focus on their individual effect upon a multiplex PCR.
50
The optimisation stage of the multiplex PCR is one of the most difficult areas of
development due to several associated problems including poor sensitivity and
specificity, preferential amplification of one target over another and the amplification of
secondary products such as primer-dimers (Markoulatos et al., 2002). Primer-template
ratio is very important in preventing the problems mentioned above. If the primer-
template ratio is too high, primer-dimer will form, which is caused by the primers binding
together due to low template concentration (Markoulatos et al., 2002). Alternatively if
the primer to template ratio is too low the template will re-anneal after denaturation due
to lack of primer concentration within the reaction.
As there are numerous primer sequences within the multiplex PCR, optimisation of
individual primer concentrations is required. Initial testing should utilise equimolar
primer amounts with a concentration range of 0.2µM to 0.4µM to determine the degree of
uneven amplification between primer pairs (Henegariu et al., 1997). After reviewing
amplification, changes to the proportions of various primers within the reaction can be
made by increasing the concentration of weaker primers, whilst decreasing the
concentration of the stronger primers (Henegariu et al., 1997).
The amounts of dNTP and MgCl2 concentration have significant effects upon the
multiplex PCR optimisation. The dNTP concentration should be increased to an amount
between 200 and 400 µM of each primer until an optimum concentration is reached
(Markoulatos et al., 2002). If the concentration of dNTP is below 100µM the amplified
product yield can be low, whereas if the dNTP concentration is above 500µM the
reaction may be inhibited (Henegariu et al., 1997). Markoulatos (2002) recommends that
the dNTP not be thawed and frozen more than 3 to 4 times as the dNTPs are sensitive and
will lose their stability resulting in a less efficient multiplex PCR. To prevent this dNTPs
should be made into small aliquots that are frozen at -20ºC.
The MgCl2, as in the standard reaction, is very important and should be carefully
optimised, as it is the co-factor for Taq DNA polymerase enzyme activity (Lawyer et al.,
1993), whilst also affecting the dNTPs, the template and the primers efficiency within the
51
reaction (Markoulatos et al., 2002). If the concentration is too high the double-stranded
DNA will become stabilised and will not separate during the denaturation step, resulting
in reduced overall yield (Markoulatos et al., 2002). Excessive MgCl2 can also affect the
stabilisation of annealing primers to incorrect sites within the sequence, causing non-
selected amplicons to be amplified. If the MgCl2 concentration is too low the overall
amount of amplified product is reduced (Markoulatos et al., 2002).
The limited supply of reagents within a reaction containing numerous competing primers
makes the optimisation of the annealing temperature essential for a balance to exist
between all primer pairs. Henegariu (1997) found that the optimal annealing temperature
required by a single primer pair, needed to be reduced by 4ºC to 6ºC for it to be
successfully amplified. This reduction to the annealing temperature balances the
difference between the more efficient and less efficient primer pairs.
Ultimately multiplex PCR is an efficient testing technique that reduces the expenditure of
both time and funds within the laboratory. Though optimisation can be problematic and
time-consuming, the eventual reaction provides both specificity and efficiency within a
single reaction. Multiplex PCR to date had not been utilised as a means of identifying
forensically important Calliphoridae species and is therefore applicable to this research.
2.13 Aims of Thesis
The ultimate objective of this project was the development of a multiplex PCR-SSP
reaction that can be utilised in the identification of 5 forensically important Calliphoridae.
In an attempt to obtain this outcome specific aims were identified and have been
separated into the successive chapters (3-5). The original aims of this project are as
follows.
1. Optimising and re-design of the original SSP set obtained from a preliminary
project conducted by Harvey (2006) (Chapter 3). Included in this chapter are the
original optimisation results, observed non-concordance of expected results,
52
alignment of species sequences tested and the initial and re-designed primer
sequences positions.
2. Individual optimisation of newly designed primers, altering only the annealing
temperature to allow for potential multiplexing (Chapter 4). Alignment of
expected amplified regions for each species has been confirmed via the inclusion
of PCR product sequence analysis.
3. Development of a multiplex PCR reaction for the identification of the five
forensically important Calliphoridae species selected for testing (Chapter 5).
Utilising the optimised SSP pairs two multiplex PCRs were developed, one fully
optimal, whilst the other only partially.
All laboratory work performed in the completion of this thesis was conducted by me,
including the extraction of all samples, except where specifically mentioned, all PCRs,
multiplex PCRs and electrophoresis analysis within this thesis.
53
Chapter 3
Design Of A Sequence
Specific Primer Set For The Identification Of Forensically
Important Calliphoridae
54
3.1 Introduction
Forensic entomology is the study of arthropod activity on a corpse and surrounding crime
scene. The main focus of forensic entomology is to determine the approximate time
since death using species-specific information including the rate of development and
environmental conditions (Benecke, 2001). After specimens have been collected from on
and around a corpse the primary information that needs to be obtained is the identity of
these specimens (Benecke, 2001). Once the species have been identified the necessary
developmental information can be applied to determine post-mortem interval (PMI). Due
to numerous problems associated with the use of morphology in the identification of flies,
molecular techniques have been developed (Wallman et al., 2001, Harvey et al., 2003a,
Harvey, 2003b). Molecular techniques based on the extraction of DNA provide an
accurate and rapid test to assist in the area of forensic identification of entomological
activity present on and around a corpse (Wallman et al., 2001).
Calliphoridae are generally the first insects to arrive and colonise a corpse, making them
one of the most useful specimens in the determination of PMI (Harvey, 2006). By far the
most common molecular techniques target the mitochondrial DNA (mtDNA), specifically
the cytochrome oxidase I (COI) and, to a lesser extent, the cytochrome oxidase II (COII)
genes. MtDNA is present in an abundance of copies within every cell, making it easy to
extract (Malgorn et al., 1999). It also has a high mutation rate within certain regions such
as the COI and Cytochrome b genes, which provides the necessary sequence distinction
in only a few generations (Malgorn et al., 1999). Accordingly, it is possible via
amplification and sequencing to analyse nucleotide changes in these regions that
distinguish between sub-species. Though a high mutation rate over only a few
generations would seem disadvantageous to sequences based taxonomic identification,
mtDNA also maintains highly conserved regions such as the control or D-loop gene,
which exhibits a low number of variations and is suitable for the development of
universal primers across species (Otranto et al., 2002).
The COI region has been extensively studied and found to posses areas that can
distinguish between species at the DNA level (Wallman et al, 2001, Harvey et al., 2003,
55
Wells et al., 2001, Malgorn et al., 1999). This makes it suitable for the development of
sequence specific primers (SSPs)(Otranto et al., 2002).
SSPs target sequence difference(s) between species within a certain region. SSPs are
designed directly from the sequence and usually rely on single nucleotide substitutions,
located at the 3‟ end of the priming site such that extension from a primer in the PCR is
limited to selected species that match the primer, particularly at the critical 3‟ end. Using
a single forward primer C1-J-1718 (Simon et al, 1990), which binds to all Calliphoridae
species, and by varying the position of the reverse primer to a site containing nucleotide
changes specific to a species (or set of species) it is possible to design primer pairs that
identify species based on the presence or absence of a PCR amplicon. To date the
application of SSPs has been relatively limited to Culicide (mosquitoes) due to their
medical applications (Manonmani et al., 2001, Fettene et al., 2002, Kampen et al., 2003
and Phuc et al., 2003), yet they have also been applied in the identification of forensically
significant Cuterebra, which are parasitic and forensically important flies presenting the
usefulness of the SSP technique (Noel et al., 2004).
The initial set of SSP pairs to be tested in this study, were developed for the COI region
based on previous research and extensive information gathered for sequence-based
identification of the Calliphoridae (Wallman et al, 2001, Harvey et al., 2003, Wells et al.,
2001). Previous techniques have relied on sequencing to identify unknown species by
direct comparison with sequence databases of known species. The advantage of a PCR-
based assay for distinction based on the presence or absence of an expected PCR
amplicon is that it is both rapid and relatively inexpensive when compared to direct DNA
sequencing techniques.
In designing SSP pairs, general guidelines are recommended to enhance primer stability
and specificity to particular sequence(s): i) for stable attachment a primer length of 18-25
oligonucleotides is optimal (Sharrocks, 1994) and ii) GC-content between 45-55%
stabilises primer attachment and reflects a primer‟s estimated annealing temperature
(Sharrocks, 1994) (refer to Chapter 2 for details). This can prove difficult in relation to
56
fly DNA as it contains a high A-T content, making it problematic when trying to locate
multiple sites of a high G-C content (Harvey, 2006). This is important for potential
multiplex optimisation, as similar annealing temperatures between SSP pairs is required
(Hurley et al., 1993). To further ensure specificity it is essential that a match occur at the
3‟ end, which increases specific primer binding (Marshall et al., 2006). Specificity can
be further increased through the addition of a mismatch oligonucleotide at the second
position from the 3‟ end (Marshall et al., 2006).
There are several known primer design obstacles that need to be addressed in SSP design,
including self-complementarity, which can be prevented by avoiding long runs of a single
base, antisense complementarity, which results in the formation of primer-dimers that
become the predominant product during amplification (Sharrocks, 1994), and a suitable
annealing temperature, formulated using Tm = 2AT + 4GC (Suggs et al., 1981).
Optimisation is the process of variable testing of PCR reagents to selected species and
fragment sizes are amplified efficiently and specifically (Erlich, H., 1993). The
conditions that are optimised include annealing temperature, primer concentration, MgCl2
concentration and the amount of template DNA. The effect of these conditions on the
amplification of specific products has been previously discussed in Chapter 2.
Additional to the optimisation of the above parameters, general guidelines in the care of
reagents should be followed. Included is the use of dNTP aliquots to prevent degradation
through repeated thawing. The DNA buffer, MgCl2 and primers should be mixed prior to
addition to the master-mix to ensure total dispersion of chemicals, and DNA should be
maintained short-term at 4ºC and long-term at -20ºC to prevent degradation.
The initial aim of this research was to test each of the original SSP pairs designed by
Harvey (2006) to ensure that they produce the expected results and to optimise the
primers to their most appropriate annealing temperature and reagent conditions.
Although it was known that the design of these primers was not optimal, the 7 SSP pairs
to be tested had previously shown promising results in the separation of species and
57
amplification of expected fragment sizes during initial testing by Harvey (2006). This
chapter will describe the method used to optimise these original primers, results
produced, a sequence analysis of the SSP primers to determine why they did not work as
expected and their re-design.
3.2 Methods
3.2.1 DNA Extraction
DNA was extracted from C. dubia (Macquart), Ch. rufifacies (Macquart), C. albifrontalis
(Malloch), Ch. megacephala (Fabricius) and L. sericata (Meigen) using the Qiagen
DNeasy Tissue Kit as described by Harvey (2006) with some modifications. The
extraction technique used by Harvey (2006) included a minimum 3-hour incubation
period, which related to the purification of total DNA from animal tissue protocol in this
kit. Due to the low DNA yields obtained, the protocol was modified according to the
manufacturer‟s instructions with specific reference to the purification of genomic DNA
from insects.
For DNA extraction from blowflies, the flight muscle was removed and placed in a 1.5ml
microcentrifuge tube with Phosphate Buffered Saline (PBS) and homogenised using a
microtube pestle. During the course of study the amount of Proteinase K added was
increased from 20µl (12mAU) to 30µl (18mAU) to improve overall yield. Following the
addition of buffer ATL, the sample was vortexed and incubated at 56ºC for 10 minutes.
After removal from a water bath, 96-100% ethanol was added and then the sample was
vortexed and transferred into a spin column. The solution was centrifuged and the flow-
through discarded. The elution and storage buffer AE was added and the sample
incubated at room temperature and then centrifuged to elute extracted DNA, which was
stored at -20ºC. All other reagent amounts and steps were followed as per
manufacturer‟s instructions with the exception of the use of 100µl of buffer AE instead of
200µl, to increase final DNA concentration.
58
Quantitation of extracted DNA was performed using the NanoDrop ND-1000
spectrophotometer and purity determined using the 260/280nm ratio. The 260/280-ratio
for pure DNA is approximately 1.8. This value is based on the equal distribution of each
base within the sequence. Due to the high concentration of A and T within fly DNA the
ratio was expected to be higher at approximately 2.1 to 2.4. Results from 260/280 ratio
analysis are provided in the Appendix 2 (Table 8.1). The quality of the DNA sample was
determined by UV transillumination following ethidium bromide staining.
3.2.2 Primers
All originally designed SSPs are shown in Table 3.1. The generic forward primer C1-J-
1718 (Simon et al., 1990) was paired with all reverse SSPs. The reverse primers were
taken from Harvey (2006), which presented an alternative method for rapid identification
of forensically important Calliphoridae species. The expected amplicon size, the
calculated annealing temperatures (Tm) and selected and observed species (Harvey,
2006) for each SSP are shown in Table 3.2.
Table 3.1: Original set of SSPs designed by M. Harvey (2006).
Primer Name Sequence (5'→3') ^
SSP 1 GGTATTCGGTCAAAAGTTACA
SSP 2 ATTCTTGRCTAATAATATGTG
SSP 3 CAATWGAAATWGAAATTACG
SSP 4 CTAAACTTTCTCAAAYAATAC
SSP 5 GCAGTAATAACTACAGATCAT
SSP 6 CCTAAAGCTCATAAAGTAGCA
SSP 7 GCTCGAGTATCTACATCTATA
C1-J-1718 * GGAGGATTTGGAAATTGATTAGTTCC
* Forward primer used for all PCR. ^ Use of International Union of Pure and Applied Chemistry
– International Union of Biochemistry (IUPAC-IUB) for mixtures where R=A+G; W=A+T;
Y=T+C.
59
Table 3.2: Expected and observed amplicons for original SSP pairs designed and tested
by M. Harvey (2006).
Primer Name SSP 1 SSP 2 SSP 3 SSP 4 SSP 5 SSP 6 SSP 7
Optimised Annealing Temperature (Tm) (ºC) 52 54 58 54 58 58 58
Product Size (bp) 320 557 1130 1203 350 803 683
Species
C. albifrontalis X X X X
C. dubia √ √ X X √
Ch. megacephala X (X) √ X X
Ch. rufifacies X √ X X
L. sericata X (X) X √
X denotes the species that were amplified during testing by M. Harvey (2006). A √ denotes the
expected amplification results of the selected species, which had been determined via primer
design and sequence alignment. (X) is a selected species that did not amplify during testing.
3.2.3 PCR
PCR master-mix conditions were followed from the initial works of Harvey (2006) and
the final PCR reaction mix consisted of: 1x PCR buffer (Fisher Biotec), 200µM of dNTP
mix (Fisher Biotec), 25pM each primer, 1 unit of Taq polymerase (Fisher Biotec), 5µl of
5% BSA, 1.5mM MgCl2, 10-150ng of template DNA and water added to a total volume
of 50µl.
3.2.4 PCR Optimisation
During testing, modifications to the concentration of MgCl2 and primer, and annealing
temperatures were made as indicated in Table 3.3, Table 3.4 and Table 3.5. The range of
MgCl2 concentration tested was between 1.5mM and 5mM. Primer concentration varied
from 25pmol to 50pmol at 5pmol increments. The annealing temperature range tested
was from 50ºC to 58ºC with 2ºC increments.
All PCR were performed using a BioRad iCycler or GeneAmp PCR system 2700
(Applied Biosystems). Cycling conditions were 90 seconds at 94ºC initial denaturation,
followed by 36 cycles of 94ºC for 22 seconds denaturation, annealing temperature (refer
60
to Table 3.2) for 30 seconds and extension at 72ºC for 1 minute 20 seconds. A final
extension period of 72ºC for 1 minute was used followed by holding at 4ºC. Products
were visualised on a 2% agarose gel with ethidium bromide staining and UV
transillumination. Length of fragment was visually measured from gel image.
The DNA samples utilised as positive controls within the optimisation testing of SSP
pairs were previously extracted DNA samples that had been tested by Harvey (Pers.
Comm.). Besides confirmation of DNA quality and quantity using the
spectrophotometer, no alternative confirmational testing was performed on the newly
extracted DNA.
3.3 Results and Discussion
The original primers by Harvey (2006) (Table 3.1) were known to be sub-optimal but
initial testing had produced a degree of concordance with expected results. Table 3.2
shows the species tested, the specific species the primers were designed to amplify and
the species observed during initial testing. The discrepancies in specific species
amplification were reproduced during the initial testing phase. Though deviation of
expected species amplified occurred, the amplicons produced were of an expected
fragment size, confirming the potential of the primer pairs. These initial results
warranted further optimisation of the SSP pairs. Table 3.2 also shows the expected
amplicon length for each SSP pair and the annealing temperature used during initial
testing by Harvey (2006).
The original primers were tested over a range of conditions using a matrix set-up. The
conditions included annealing temperature, MgCl2 and primer concentration. Table 3.3,
Table 3.4 and Table 3.5 represents the testing matrixes for the conditions annealing
temperature, MgCl2 gradient and primer concentration respectively. Each table shows
the attempted optimisations of the SSP pairs and the results from each reaction.
61
Table 3.3: Matrix of annealing temperature optimisation of original SSP set. A 0 denotes
where the conditions tested showed no results. 1 to 4 represents the intensity of bands
produced. 1 denotes band is possibly present; 2 a band of low intensity; 3 a band of
medium intensity and 4 a band of high intensity. A blank box signifies that testing did
not occur using this condition. All band lengths indicated were determined via visual
analysis using a 100bp DNA ladder marker.
Annealing Temperature (Tm) (ºC)
50 52 54 56 58
Primer Name Species
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
SSP 1
C. dubia 0 0 3 300-350
C. albifrontalis 0 0 3 300-350
Ch. megacephala 0 0 3 300-350
L. sericata 2 300-350 3 300-350
Ch. rufifacies 0 0 3 300-350
SSP 2
C. dubia 3 550-600 4 550-600
C. albifrontalis 3 550-600 2 550-600
Ch. megacephala 3 550-600 4 550-600
L. sericata 3 550-600 4 550-600
Ch. rufifacies 3 550-600 4 550-600
SSP 3
C. dubia 0 0 0 0
C. albifrontalis 0 0 0 0
Ch. megacephala 0 0 0 0
L. sericata 0 0 0 0
Ch. rufifacies 0 0 0 0
SSP4
C. dubia 0 0 3 1100-1200
C. albifrontalis 2 1100-1200 3 1100-1200
Ch. megacephala 0 0 0 0
L. sericata 0 0 3 1100-1200
Ch. rufifacies 0 0 0 0
SSP5
C. dubia 2 300-350
C. albifrontalis 4 300-350
Ch. megacephala 4 300-350
L. sericata 3 300-350
Ch. rufifacies 2 300-350
SSP 6
C. dubia 2 800-850
C. albifrontalis 0 0
Ch. megacephala 0 0
L. sericata 4 800-850
Ch. rufifacies 2 800-850
SSP 7
C. dubia 3 650-700
C. albifrontalis 2 650-700
Ch. megacephala 0 0
L. sericata 0 0
Ch. rufifacies 3 650-700
62
Table 3.4 Matrix of MgCl2 concentration optimisation of original SSP set. A 0 denotes
where the conditions tested showed no results. 1 to 4 represents the intensity of bands
produced. 1 denotes band is possibly present; 2 a band of low intensity; 3 a band of
medium intensity and 4 a band of high intensity. A blank box signifies that testing did
not occur using this condition. All band lengths indicated were determined via visual
analysis using a 100bp DNA ladder marker.
MgCl2 Gradient (mM)
1. 5 1.75 2.25 3.75 4.25
Primer Name Species
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
SSP 1
C. dubia 3 300-350
C. albifrontalis 3 300-350
Ch. megacephala 3 300-350
L. sericata 3 300-350
Ch. rufifacies 3 300-350
SSP 2
C. dubia 4 550-600 3 550-600
C. albifrontalis 2 550-600 3 550-600
Ch. megacephala 4 550-600 0 0 3 550-600 0 0 0 0
L. sericata 4 550-600 3 550-600
Ch. rufifacies 4 550-600 3 550-600
SSP 3
C. dubia 0 0 0 0
C. albifrontalis 0 0 0 0
Ch. megacephala 0 0 0 0
L. sericata 0 0 0 0 0 0 0 0 0 0
Ch. rufifacies 0 0 0 0
SSP4
C. dubia 3 1100-1200 3 1100-1200 3 1100-1200 3 1100-1200 3 1100-1200
C. albifrontalis 0 0 3 1100-1200 3 1100-1200 3 1100-1200 3 1100-1200
Ch. megacephala 0 0 0 0
L. sericata 0 0 3 1100-1200
Ch. rufifacies 0 0 0 0
SSP5
C. dubia 2 300-350 3 300-350
C. albifrontalis 4 300-350 3 300-350
Ch. megacephala 4 300-350 3 300-350
L. sericata 3 300-350 3 300-350
Ch. rufifacies 2 300-350 3 300-350
SSP 6
C. dubia 2 800-850
C. albifrontalis 0 0
Ch. megacephala 0 0
L. sericata 4 800-850
Ch. rufifacies 2 800-850
SSP 7
C. dubia 0 0 0 0 0 0 1 650-700 3 650-700
C. albifrontalis 0 0 1 650-700 2 650-700 2 650-700 2 650-700
Ch. megacephala 0 0 0 0 0 0 0 0 0 0
L. sericata 0 0 0 0 0 0 0 0 0 0
Ch. rufifacies 2 650-700 2 650-700 3 650-700 3 650-700 3 650-700
63
Table 3.5 Matrix of primer concentration optimisation of original SSP set. A 0 denotes
where the conditions tested showed no results. 1 to 4 represents the intensity of bands
produced. 1 denotes band is possibly present; 2 a band of low intensity; 3 a band of
medium intensity and 4 a band of high intensity. A blank box signifies that testing did
not occur using this condition. All band lengths indicated were determined via visual
analysis using a 100bp DNA ladder marker.
Primer Concentration (pmol)
25 30 35 40 45 50
Primer Name Species
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
Band Intensity
Band Size (bp)
SSP 1
C. dubia 3 300-350
C. albifrontalis 3 300-350
Ch. megacephala 3 300-350
L. sericata 3 300-350
Ch. rufifacies 3 300-350
SSP 2
C. dubia 4 550-600 4 550-600 4 550-600 3 550-600
C. albifrontalis 2 550-600 3 550-600
Ch. megacephala 4 550-600 3 550-600
L. sericata 4 550-600 3 550-600
Ch. rufifacies 4 550-600 3 550-600
SSP 3
C. dubia 0 0 0 0
C. albifrontalis 0 0 0 0
Ch. megacephala 0 0 0 0
L. sericata 0 0 0 0
Ch. rufifacies 0 0 0 0
SSP4
C. dubia 0 0 0 0 3 1100-1200
C. albifrontalis 0 0 0 0 0 0 0 0 0 0 3 1100-1200
Ch. megacephala 0 0 0 0
L. sericata 0 0 3 1100-1200
Ch. rufifacies 0 0 0 0
SSP5
C. dubia 0 0 2 300-350
C. albifrontalis 0 0 4 300-350
Ch. megacephala 4 300-350 4 300-350 4 300-350 3 300-350 4 300-350 4 300-350
L. sericata 1 300-350 3 300-350
Ch. rufifacies 2 300-350 4 300-350
SSP 6
C. dubia 0 0 2 800-850 0 0
C. albifrontalis 0 0 0 0 0 0
Ch. megacephala 0 0 0 0 0 0
L. sericata 0 0 4 800-850 0 0
Ch. rufifacies 0 0 2 800-850 0 0
SSP 7
C. dubia 0 0 0 3 650-700
C. albifrontalis 0 0 0 2 650-700
Ch. megacephala 0 0 0 0 0
L. sericata 0 0 0 0 0
Ch. rufifacies 0 0 3 650-700 1 650-700
64
The non-concordance recorded between the selected species and the observed results for
each SSP pair after optimisation is shown in Table 3.6. The band fragments observed
were measured by visual comparison between the DNA ladder marker and the resulting
amplicon band. An amplicon size range has been provided to compensate for the low
resolution of the gel electrophoresis technique used in the experiment.
Table 3.6: Non-concordance between expected and observed results. Expected selected
species and fragment length are based on M. Harvey‟s (2006) initial analysis of primer
alignment of original SSP pairs. Observed amplified species were recorded following
optimisation testing. Amplicon length was determined from visual analysis of
electrophoresis gels.
Primer Name
Annealing Temperature
(ºC)
Expected Fragment
Length (bp)
Observed Fragment
Length (bp)
Expected Selected Species
Observed Amplified Species
SSP 1 52 320 340 C. dubia
C. dubia, C. albifrontalis, Ch. megacephala L. sericata, Ch. rufifacies
SSP 2 54 557 580 C. dubia
C. dubia, C. albifrontalis, Ch. megacephala L. sericata, Ch. rufifacies
SSP 3 58 1130 No Product Ch. megacephala Not Applicable
SSP 4 54 1203 1150 L. sericata C. dubia, C. albifrontalis,
SSP 5 58 350 330 Ch. megacephala Ch. rufifacies
C. dubia, C. albifrontalis, Ch. megacephala L. sericata, Ch. rufifacies
SSP 6 58 803 830 L. sericata
C. dubia L. sericata Ch. rufifacies
SSP 7 58 683 660 C. dubia
C. dubia C. albifrontalis Ch. rufifacies
65
From the results, it is clear that the primers were not working as expected (Table 3.6) due
to the non-concordance between expected and observed results. The amplicons produced
were of an expected size for each SSP pair, but the species amplified varied from what
was predicted. This result continued subsequent to extensive optimisation attempts.
Possible reasons for the lack of concordance between the expected and observed
outcomes were limited to technique within the laboratory or the design of the primers.
Due to the availability of COI sequence information relating to the species, the design of
the primers was reviewed and re-evaluated.
Figure 3.1 represents the positions of the original 7 SSP pairs tested. The sequence
information used was obtained from Genbank via the National Centre for Biotechnology
Information (NCBI) (http://www.ncbi.nlm.nih.gov). Accession numbers utilised were
EU418556 (C. dubia), EU418566 (C. albifrontalis), AB112833 (L. sericata), AB112845
(Ch. rufifacies) and AB112847 (Ch. megacephala). The C. augur sequence (DQ345074)
is added to show the position of the forward primer CI-J-1718 (Simon et al., 1990) for the
determination of the expected fragment lengths.
66
C1-J-1718
GGAGGATTTGGAAATTGATTAGTTCC
C_Augur_DQ345074 GGAGGATTTGGAAATTGATTAGTTCCTTTAATGCTAGGAGCTCCAGATAT 50
L_sericata_AB112833 --------------------------------------------------
Ch_rufifacies_AB112845 --------------------------------------------------
C_megacephala_AB112847 --------------------------------------------------
C_albifrontalis_EU418566 --------------------------------------------------
C_dubia_EU418556 --------------------------------------------------
**************************************************
C_Augur_DQ345074 AGCATCCCCTCGATTAAATAATATAAGTTTCTGACTTTTACCTCCTGCAT 100
L_sericata_AB112833 ---------------------------------ACTTTTACCTCCTGCAT
Ch_rufifacies_AB112845 ---------------------------------ACTTTTACCCCCTGCAT
C_megacephala_AB112847 ---------------------------------ACTTTTACCTCCTGCAT
C_albifrontalis_EU418566 ---------------------------------ATTACTACCTCCCGCAT
C_dubia_EU418556 ---------------------------------ACTTTTACCTCCTGCAT
********************************** * **** ** ****
C_Augur_DQ345074 TAACACTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGA 150
L_sericata_AB112833 TAACTTTATTATTAGTTAGTAGTATAGTAGAAAACGGAGCTGGAACAGGA
Ch_rufifacies_AB112845 TAACTTTACTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGA
C_megacephala_AB112847 TAACTTTATTATTAGTAAGTAGTATAGTAGAAAATGGGGCTGGAACAGGA
C_albifrontalis_EU418566 TAACTTTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGGACAGGA
C_dubia_EU418556 TAACACTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGA
**** ** ******* ***************** ** ***** ******
C_Augur_DQ345074 TGAACTGTTTACCCCCCTTTATCTTCTAATATCGCTCATGGAGGAGCTTC 200
L_sericata_AB112833 TGAACAGTTTACCCTCCTCTATCTTCTAATATTGCTCATGGAGGAGCTTC
Ch_rufifacies_AB112845 TGAACTGTTTATCCACCTTTATCATCTAATATTGCACATGGTGGAGCATC
C_megacephala_AB112847 TGAACTGTTTACCCACCTTTATCTTCTAATATTGCTCATGGAGGAGCATC
C_albifrontalis_EU418566 TGAACTGTTTACCCTCCTTTATCTTCTAATATTGCTCATGGAGGAGCTTC
C_dubia_EU418556 TGAACTGTTTACCCCCCTTTATCTTCTAATATCGCTCATGGAGGAGCTTC
***** ***** ** *** **** ******** ** ***** ***** **
C_Augur_DQ345074 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTT 250
L_sericata_AB112833 TGTTGATTTAGCTATTTTCTCTCTTCATTTAGCAGGAATTTCTTCAATTT
Ch_rufifacies_AB112845 AGTTGATTTAGCTATTTTTTCTTTACACTTAGCTGGAATTTCATCAATTT
C_megacephala_AB112847 AGTTGATTTAGCTATTTTCTCTTTACACTTAGCAGGAATTTCTTCAATTT
C_albifrontalis_EU418566 TGTTGATTTAGCTATTTTTTCACTTCATTTAGCTGGAATTTCTTCAATTT
C_dubia_EU418556 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTT
***************** ** * ** ***** ******** *******
New SSP 9 ATCTGTAATTAATATACGATC T
T
C_Augur_DQ345074 TAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCAACAGGT 300
L_sericata_AB112833 TAGGAGCTGTAAATTTTATTACTACAGTTATTAATATACGATCAACAGGA
Ch_rufifacies_AB112845 TAGGGGCCGTAAATTTTATTACAACTGTTATTAATATACGATCTACAGGA
C_megacephala_AB112847 TAGGAGCTGTAAATTTTATTACAACTGTAATTAATATACGATCTACAGGA
C_albifrontalis_EU418566 TAGGAGCAGTAAATTTTATTACTACCGTAATTAATATGCGATCAACAGGG
C_dubia_EU418556 TAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCAACAGGT
**** ** ************** ** ** ******** ***** *****
Modified SSP 1b GTAACTTTTGACCGAATACC AAGATCTGTAGTTATTACTGC Modified SSP 5b
SSP 1 GTAACTTTTGAC GAATACC ATGATCTGTAGTTATTACTGC SSP 5
C_Augur_DQ345074 GTAACTTTTGACCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGC 350
L_sericata_AB112833 ATTACTTTTGATCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGC
Ch_rufifacies_AB112845 ATTACATTTGATCGAATACCTTTATTTGTATGATCTGTAGTTATTACTGC
C_megacephala_AB112847 ATTACATTTGATCGAATACCTTTATTTGTATGATCTGTAGTTATTACTGC
C_albifrontalis_EU418566 ATTACCTTTGATCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGC
C_dubia_EU418556 GTAACTTTTGACCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGC
* ** ***** ***************** ***** ***** ***** **
67
C_Augur_DQ345074 TTTATTACTTTTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATAT 400
L_sericata_AB112833 TTTATTACTTTTATTATCATTACCAGTATTAGCAGGAGCTATTACAATAC
Ch_rufifacies_AB112845 TCTTCTTTTATTATTATCATTACCAGTATTAGCAGGTGCAATTACTATAT
C_megacephala_AB112847 TCTATTATTATTATTATCTTTACCAGTATTAGCTGGAGCTATTACTATAT
C_albifrontalis_EU418566 TCTATTACTTCTATTATCTTTACCAGTATTAGCAGGAGCTATTACAATAT
C_dubia_EU418556 TTTATTACTTTTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATAT
* * * * ******* ************** ** ** ***** ***
C_Augur_DQ345074 TATTAACAGATCGAAATCTTAATACTTCATTCTTTGACCCAGCAGGAGGA 450
L_sericata_AB112833 TTTTAACAGACCGAAATCTTAATACATCATTCTTTGACCCTGCAGGAGGA
Ch_rufifacies_AB112845 TATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCAGCAGGAGGG
C_megacephala_AB112847 TATTAACTGACCGAAATCTAAATACTTCATTCTTTGATCCAGCAGGAGGA
C_albifrontalis_EU418566 TATTAACAGATCGAAACCTTAATACTTCATTTTTTGACCCTGCTGGAGGA
C_dubia_EU418556 TATTAACAGATCGAAATCTTAATACTTCATTCTTTGACCCAGCAGGAGGA
* ***** ** ***** * ***** ***** ***** ** ** *****
C_Augur_DQ345074 GGAGATCCTATTTTATATCAACACTTATTTTGATTTTTTGGTCACCCTGA 500
L_sericata_AB112833 GGAGATCCAATTTTATACCAACATTTATTTTGATTCTTTGGACACCCTGA
Ch_rufifacies_AB112845 GGAGACCCTATTTTATATCAACACTTATTTTGATTCTTTGGTCATCCAGA
C_megacephala_AB112847 GGAGATCCTATTTTATATCAACATTTATTTTGATTCTTTGGACATCCTGA
C_albifrontalis_EU418566 GGAGATCCTATTTTATACCAACATTTATTTTGATTTTTTGGTCACCCAGA
C_dubia_EU418556 GGAGATCCTATTTTATATCAACACTTATTTTGATTTTTTGGTCACCCTGA
***** ** ******** ***** *********** ***** ** ** **
Modified SSP 2b AGATATTATTA
SSP 2 CACATATTATTA
C_Augur_DQ345074 AGTTTATATTTTAATTTTACCGGGATTTGGAATAATTTCACATATTATTA 550
L_sericata_AB112833 AGTTTATATTTTAATTTTACCTGGATTTGGAATAATTTCTCATATTATTA
Ch_rufifacies_AB112845 AGTTTATATTTTAATTTTACCTGGATTCGGAATAATTTCTCATATCATTA
C_megacephala_AB112847 AGTTTATATTTTAATTTTACCTGGATTCGGAATAATTTCTCATATTATTA
C_albifrontalis_EU418566 AGTATATATTTTAATTTTACCAGGATTTGGAATAATTTCTCACATTATTA
C_dubia_EU418556 AGTTTATATTTTAATTTTACCGGGATTTGGAATAATTTCACATATTATTA
*** ***************** ***** *********** ** ** ****
GTCAAGAAT
GRCAAGAAT
C_Augur_DQ345074 GTCAAGAATCAGGAAAAAAGGAAACTTTCGGGTCATTAGGAATAATTTAT 600
L_sericata_AB112833 GTCAAGAATCAGGTAAAAAGGAAACATTCGGTTCATTAGGGATGATTTAT
Ch_rufifacies_AB112845 GTCAAGAATCAGGAAAAAAGGAAACCTTTGGATCTTTAGGAATAATTTAT
C_megacephala_AB112847 GTCAAGAATCAGGAAAAAAGGAAACTTTCGGATCTTTAGGAATGATTTAT
C_albifrontalis_EU418566 GTCAAGAATCAGGTAAAAAGGAAACTTTCGGGTCACTAGGAATAATTTAT
C_dubia_EU418556 GTCAAGAATCAGGAAAAAAGGAAACTTTCGGGTCATTAGGAATAATTTAT
************* *********** ** ** ** **** ** ******
C_Augur_DQ345074 GCCATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCCCACCATAT 650
L_sericata_AB112833 GCCATATTAGCTATTGGATTATTAGGATTTATTGTTTGAGCTCATCATAT
Ch_rufifacies_AB112845 GCAATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCTCATCATAT
C_megacephala_AB112847 GCTATACTAGCTATTGGTCTATTAGGATTTATTGTATGAGCTCACCACAT
C_albifrontalis_EU418566 GCTATACTAGCTATTGGTTTATTAGGATTCATTGTATGAGCTCATCATAT
C_dubia_EU418556 GCCATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCCCACCATAT
** *** ********** ********** ***** ***** ** ** **
68
Modified SSP 7b TCTAGATACCCGAGCTTA
SSP 7 TATAGATGTAGATACTCGAGC
C_Augur_DQ345074 ATCTACAGTAGGAATAGATGTAGATACCCGAGCTTATTTTACCTCAGCTA 700
L_sericata_AB112833 ATTTACAGTAGGAATAGACGTTGATACACGAGCTTACTTTACTTCAGCTA
Ch_rufifacies_AB112845 ATTCACTGTAGGAATGGATGTAGATACTCGAGCATATTTCACTTCAGCTA
C_megacephala_AB112847 GTTTACTGTTGGAATAGACGTAGACACACGAGCTTATTTCACTTCAGCTA
C_albifrontalis_EU418566 ATTTACAGTAGGAATAGACGTAGATACTCGAGCTTATTTTACATCAGCAA
C_dubia_EU418556 ATTTACAGTAGGAATAGATGTAGATACCCGAGCTTATTTTACCTCAGCTA
* ** ** ***** ** ** ** ** ***** ** ** ** ***** *
C_Augur_DQ345074 CTATAATTATTGCGGTACCAACTGGAATTAAAATTTTCAGTTGATTAGCA 750
L_sericata_AB112833 CTATAATTATTGCTGTACCAACTGGAATTAAGATTTTTAGTTGATTAGCA
Ch_rufifacies_AB112845 CAATAATTATTGCTGTACCAACTGGAATTAAAATTTTTAGTTGATTAGCA
C_megacephala_AB112847 CAATAATTATTGCTGTACCAACTGGAATTAAGATTTTCAGTTGATTAGCA
C_albifrontalis_EU418566 CTATAATTATTGCTGTTCCAACTGGAATTAAAATTTTCAGTTGATTAGCC
C_dubia_EU418556 CTATAATTATTGCGGTACCAACTGGAATTAAAATTTTCAGTTGATTAGCA
* *********** ** ************** ***** ***********
Modified SSP 6b TCCTACTTTATGAGCTTT
SSP 6 TGCTACTTTATGAGCTTT
C_Augur_DQ345074 ACTCTTTATGGAACTCAATTAAACTATTCACCAGCTACTTTATGAGCTTT 800
L_sericata_AB112833 ACTCTTTATGGAACTCAATTAAACTATTCCCCTGCTACTTTATGAGCTTT
Ch_rufifacies_AB112845 ACTCTTTATGGAACTCAATTAAATTATTCTCCAGCTACTTTATGAGCCTT
C_megacephala_AB112847 ACTCTTTACGGAACACAATTAAATTATTCTCCAGCTACTTTATGAGCTTT
C_albifrontalis_EU418566 ACTCTTTATGGAACTCAATTAAATTATTCCCCAGCTACTTTATGAGCATT
C_dubia_EU418556 ACTCTTTATGGAACTCAATTAAACTATTCACCAGCTACTTTATGAGCTTT
******** ***** ******** ***** ** ************** **
AGG CTTTTCACAGTAGGAGGATTAA New SSP 8
AGG
C_Augur_DQ345074 AGGATTTGTATTTTTATTTACAGTAGGAGGATTAACTGGAGTTGTTTTAG 850
L_sericata_AB112833 AGGATTTGTATTTTTATTCACTGTAGGAGGTTTAACTGGAGTTGTTTTAG
Ch_rufifacies_AB112845 AGGGTTTGTATTTTTATTTACTGTAGGAGGATTAACTGGAGTAGTTTTAG
C_megacephala_AB112847 AGGATTTGTATTTTTATTTACTGTAGGAGGATTAACTGGAGTTGTTTTAG
C_albifrontalis_EU418566 AGGGTTTGTATTCCTTTTCACAGTAGGAGGATTAACTGGAGTTGTTTTAG
C_dubia_EU418556 AGGATTTGTATTTTTATTTACAGTAGGAGGATTAACTGGAGTTGTTTTAG
*** ******** * ** ** ******** *********** *******
C_Augur_DQ345074 CTAACTCATCTGTAGATATTATCCTTCATGATACTTATTATGTAGTTGCT 900
L_sericata_AB112833 CTAACTCTTCAGTTGATATTATTTTACATGATACATACTATGTAGTAGCT
Ch_rufifacies_AB112845 CTAATTCATCTATTGATATTATTTTACATGACACATACTATGTAGTAGCT
C_megacephala_AB112847 CTAATTCATCAATTGACATTATTTTACATGATACATATTATGTAGTAGCT
C_albifrontalis_EU418566 CTAATTCTTCTGTTGATATTATCCTTCATGATACATACTATGTAGTTGCT
C_dubia_EU418556 CTAACTCTTCTGTAGATATTATCCTTCATGATACTTATTATGTAGTTGCT
**** ** ** * ** ***** * ***** ** ** ******** ***
C_Augur_DQ345074 CATTTCCATTATGTTTTATCAATAGGAGCTGTATTTGCCATTATAGCAGG 950
L_sericata_AB112833 CACTTCCATTATGTTTTATCAATGGGAGCTGTATTTGCTATTATAGCAGG
Ch_rufifacies_AB112845 CACTTCCATTATGTTCTTTCAATAGGAGCTGTATTTGCTATTATAGCAGG
C_megacephala_AB112847 CACTTCCATTATGTTCTATCAATGGGAGCTGTATTTGCTATTATAGCAGG
C_albifrontalis_EU418566 CATTTCCATTATGTTCTATCTATAGGAGCTGTATTTGCTATTATAGCCGG
C_dubia_EU418556 CATTTCCATTATGTTTTATCAATAGGAGCTGTATTTGCCATTATAGCAGG
** ************ * ** ** ************** ******** **
C_Augur_DQ345074 ATTTGTTCATTGATACCCTCTATTTACAGGTTTAACTTTAAATGGAAAAA 1000
L_sericata_AB112833 ATTTGTTCACTGATATCCTTTATTTACAGGATTAACTTTAAATACTAAGA
Ch_rufifacies_AB112845 ATTTGTACATTGATTCCCATTATTTACTGGATTAACCTTAAATAATAAAA
C_megacephala_AB112847 ATTTGTTCATTGATTCCCTCTATTTACTGGATTAACTTTAAATAGCAAGT
C_albifrontalis_EU418566 ATTTGTACACTGATACCCTCTATTTACAGGATTAACTTTAAATGGAAAAA
69
C_dubia_EU418556 ATTTGTTCATTGATACCCTCTATTTACAGGTTTAACTTTAAATGGAAAAA
****** ** **** ** ******* ** ***** ****** **
C_Augur_DQ345074 TACTAAAAAGTCAATTTACTATTATATTTATTGGAGTAAGTATTACATTT 1050
L_sericata_AB112833 TATTAAAAAGTCAATTTGCTATTATATTTATTGGGGTAAATTTAACATTC
Ch_rufifacies_AB112845 TACTAAAAAGTCAATTTGCTATTATATTTATTGGAGTAAATTTAACATTC
C_megacephala_AB112847 TATTAAAGAGTCAATTTGCTATTATATTTATCGGAGTAAATTTAACATTC
C_albifrontalis_EU418566 TGTTAAAAAGTCAATTTACTATTATATTTATTGGAGTAAATATTACTTTC
C_dubia_EU418556 TACTAAAAAGTCAATTTACTATTATATTTATTGGAGTAAATATTACATTT
* **** ********* ************* ** **** * * ** **
C_Augur_DQ345074 TTCCCTCAACACTTTTTAGGATTAGCAGGAATACCTCGACGATATTCAGA 1100
L_sericata_AB112833 TTCCCTCAACATTTCTTAGGATTAGCAGGAATACCACGACGATATTCAGA
Ch_rufifacies_AB112845 TTCCCTCAACATTTTTTAGGACTAGCTGGTATACCTCGACGATACTCAGA
C_megacephala_AB112847 TTCCCTCAACATTTCTTAGGATTAGCAGGTATACCTCGACGATACTCAGA
C_albifrontalis_EU418566 TTCCCTCAACACTTTTTAGGATTAGCAGGAATACCTCGACGATATTCAGA
C_dubia_EU418556 TTCCCTCAACACTTTTTAGGATTAGCAGGAATACCTCGACGATATTCAGA
*********** ** ****** **** ** ***** ******** *****
SSP 3 CGTAATTTCWATTTCWATTG
C_Augur_DQ345074 TTATCCAGATGCATACACAACTTGAAATGTAATTTCTACTATTGGATCAA 1150
L_sericata_AB112833 CTACCCAGATGCTTACACAACTTGAAATGTAATTTCTACAATTGGGTCAA
Ch_rufifacies_AB112845 CTATCCAGATGCTTACACAACATGAAATGTTATTTCAACAATTGGATCAA
C_megacephala_AB112847 CTATCCAGACGCTTACACAGCTTGAAATGTAATTTCTACAATTGGTTCAA
C_albifrontalis_EU418566 CTACCCAGATGCTTATACAACTTGAAACGTAATTTCTACTATTGGGTCAA
C_dubia_EU418556 TTATCCAGATGCATACACAACTTGAAATGTAATTTCTACTATTGGATCAA
** ***** ** ** *** * ***** ** ***** ** ***** ****
Modified SSP 4b TGTTYTTTGAGAAAGT
SSP 4 GTATTYTTTGAGAAAGT
C_Augur_DQ345074 CAATTTCATTACTAGGAATTTTATTTTTCTTTTTCATTGTTTGAGAAAGT 1200
L_sericata_AB112833 CAATTTCTTTATTAGGAATTTTATTCTTCTTCTTTATTATTTGAGAAAGT
Ch_rufifacies_AB112845 CAATTTCATTATTAGGAATTTTATTTTTCTTTTTCATTATTTGAGAAAGT
C_megacephala_AB112847 CAATTTCATTATTAGGAATTTTATTCTTCTTTTTCATTATTTGAGAAAGT
C_albifrontalis_EU418566 CAATCTCATTACTAGGAATTTTATTTTTCTTTTTCATTGTTTGAGAAAGT
C_dubia_EU418556 CAATTTCATTACTAGGAATTTTATTTTTCTTTTTCATTGTTTGAGAAAGT
**** ** *** ************* ***** ** *** ***********
CTTG
TTAG
C_Augur_DQ345074 TTAG
L_sericata_AB112833 CTTG
Ch_rufifacies_AB112845 TTAG
C_megacephala_AB112847 TTAG
C_albifrontalis_EU418566 TTAG
C_dubia_EU418556 TTAG
* *
Figure 3.1. Alignment of all species tested in the development of SSP pairs
for the amplification of forensically important Calliphoridae. All sequences
were obtained at Genbank http://www.ncbi.nlm.nih.gov. Included are the original
primer sites, modified primer sequences and newly designed SSP pairs. C. augur
is added to represent the position of the forward primer (C1-J-1718), not as a
species tested. * denotes conserved sites. A blank signifies a variable site.
– denotes missing sequence information for a species.
70
SSP 1 was designed to specifically amplify C. dubia and initial testing by Harvey (2006)
confirmed this result. However, subsequent testing using the recommended conditions
by Harvey (2006), resulted in the amplification of all species tested, including C. dubia.
After reviewing the position of the primer it is clear that it was designed with base
distinction at the 3‟ end to select for C. dubia and a mismatch base in the second position
at the 3‟ end to increase specificity. The primer is also a suitable length with 20 bases
and has a GC-content of 38%. However, there is a deletion at position 13 from the 3‟ end
of the primer. This deletion is unlikely to be the cause for the amplification of the non-
selected species tested and it is unclear why this primer is unable to specifically amplify
C. dubia. A possible solution could be an increase of the annealing temperature, which
may have alleviated the amplification of the non-specific species. Though alternative
annealing temperatures were tested, they were perhaps not high enough to prevent the
amplification of the non-specific products.
SSP 2 was again designed to select for only C. dubia, and during initial testing by Harvey
(2006) Ch. megacephala was consistently amplified in addition to C. dubia. The initial
PCR conditions utilised by Harvey were replicated and resulted in the amplification of all
species tested. During subsequent optimisation attempts, the annealing temperature
(52ºC to 54ºC), primer concentration (25pmol to 50pmol) and MgCl2 concentration
(1.5mM to 2.5mM) were all increased to prevent the amplification of non-selected
species. These condition variations resulted in the continual amplification of all species.
Possible explanation for the continual amplification of species tested was a potential
specificity problem in the primer design. After sequence analysis, SSP 2 showed no
distinctive base at the critical 3‟ end of the primer. The specificity of this primer was
designed at the second base from the 3‟ end, which was designed to amplify the selected
species C. dubia. It is likely that the lack of a distinguishing base at the most 3‟ end of
the primer would account for the amplification of all species tested.
Testing of SSP 3 produced no results. This result further persisted after alterations to
conditions including increased MgCl2 concentration from 1.5mM to 2.5mM, annealing
temperature from 56ºC to 58ºC and primer concentration from 25pmol to 50pmol. SSP 3
71
was difficult to align to the expected position in the sequence alignment (Figure 3.1).
There are at least 11 sites of difference between the primer and the sequences for the
expected species to be amplified; reflecting the lack of concordance obtained from the
initial optimisation tests. Hence, SSP 3 was not examined further.
SSP 4 was originally designed to amplify L. sericata, but initial testing by Harvey (2006)
amplified C. albifrontalis. The initial conditions tested by Harvey were replicated, and in
an attempt to amplify only the selected species the annealing temperature, primer
concentration and MgCl2 concentrations were all increased. At 54ºC, with a primer
concentration of 50pmol, and an MgCl2 of 2.25mM the selected species L. sericata was
amplified, in addition to the species C. dubia and C. albifrontalis. SSP 4 had no
distinctive base at the critical 3‟ end of the primer sequence. One mismatch was located
at the second base from the 3‟ end, which was specific for L. sericata instead of the
amplified species C. albifrontalis and C. dubia. This result suggests the primer requires
an additional single base adjustment for specific species identification.
SSP 5 was designed to amplify both Ch. megacephala and Ch. rufifacies. Initial testing
by Harvey (2006) resulted in slightly different results, with the additional amplification
of C. dubia and L. sericata. Optimisation experiments attempted to alleviate this by
increasing the MgCl2 concentration (from 1.5mM to 2.25mM) and primer concentrations
(from 25pmol to 50pmol), yet these extra species were continually amplified, with the
addition of C. albifrontalis. When the primer is aligned with the species‟ sequences, it is
clear that the primer is well designed with only Ch. rufifacies and Ch. megacephala
selected for amplification (Figure 3.1). With the addition of a mismatch base at the
second base from the 3‟ end, the primer has the potential to be distinctive for these
species.
SSP 6 was designed to amplify L. sericata and during initial testing by Harvey (2006) all
species tested amplified. Optimisation testing removed the amplification of both C.
albifrontalis and Ch. megacephala, but the non-selected species Ch. rufifacies and C.
dubia continued to produce an amplicon. A review of the primer sequence conveyed that
72
SSP 6 was specifically designed to amplify L. sericata. The additional amplified species
may be a result of the absence of a mismatch base pair at the second nucleotide from the
3‟ end, which would have increased the specific binding of the primer.
It was expected that SSP 7 would amplify only C. dubia. Original testing by Harvey
(2006) amplified all species except L. sericata. Optimisation included an increase of
MgCl2 concentration from 1.5mM to 4.25mM in an attempt to amplify the selected
species. C. dubia was only observed at the MgCl2 concentration of 4.25mM, which in
addition amplified C. albifrontalis and Ch. rufifacies. The only species to be inhibited
from amplification were Ch. megacephala and L. sericata. Review of the primer position
in the sequence alignment showed that SSP 7 is located in a site of variability between
species but lacked a distinctive base at the critical 3‟ end of the primer (Figure 3.1),
resulting in the amplification of non-selected species.
3.3.1 Re-Design of SSP Set
Following the identification of areas within the original primer sequences that required
modification, alterations to the existing SSP set were made. Additional to the specificity
modifications, mismatch base pairs were added to all SSPs at the second nucleotide from
the 3‟ end to increase specificity. Figure 3.1 represents the original and re-designed
sequences for the 6 retained SSPs and 2 additional SSPs (SSP 8 and SSP 9) that were
designed to replace SSP 3, which was removed from further testing as previously
described.
Table 3.7 shows the new primer sequences, estimated annealing temperatures, expected
amplicon lengths and selected species. Care was taken to ensure that all species were
identified by at least one primer and where possible multiple primers. Multiple species
amplification provides a confirmation of species identification. C. albifrontalis was the
only species to be amplified by a single SSP.
73
Table 3.7: New SSP set following re-design.
Primer Name Sequence (5' - 3')^
Fragment Length (bp)
Estimated Tm (ºC)* Selected Species
SSP 1b GGTATTCGGTCAAAAGTTACA 320 58 C. dubia
SSP 2b ATTCTTGACTAATAATATCT 559 48 C. dubia
SSP 4b CAAGACTTTCTCAAARAACA 1204 54 L. sericata
SSP 5b GCAGTAATAACTACAGATCTT 350 56
Ch. megacephala,
Ch. rufifacies
SSP 6b CCTAAAGCTCATAAAGTAGGA 803 58 L. sericata
SSP 7b TAAGCTCGGGTATCTAGA 686 52
C. dubia,
Ch. rufifacies
SSP 8 TTAATCCTCCTACTGTGAAAAG 835 60 C. albifrontalis
SSP 9 GATCGTATATTAATTACAGAT 293 52
Ch. megacephala,
Ch. rufifacies
^ Use of International Union of Pure and Applied Chemistry – International Union of
Biochemistry (IUPAC-IUB) for mixtures where R=A+G. *Estimated annealing
temperature calculated using Tm=2AT+4GC.
SSP 1 required a single modification of the addition of the 13th
base that had previously
been excluded. The length of the primer was increased to 21 base pairs to account for
this addition, but the GC-content remained at 38%, both of which follow the
recommended guidelines of primer design. Though there is a string of 4 T bases that
could result in self-complementarity, due to initial results the sequence position was
maintained. SSP 1 is now expected to amplify only C. dubia at an estimated annealing
temperature of 58ºC, producing an expected amplicon size of 320bp.
SSP 2 lacked a diagnostic base at the 3‟ end, which resulted in a lack of specificity to a
single species. In the re-design of SSP 2, the non-distinctive base at the 3‟ end was
removed. The newly designated first nucleotide at the 3‟ end provided unique base
specificity to C. dubia. The primer length was reduced to 20bp, which is still suitable for
specific attachment. The GC-content is relatively low at 20%, but as mentioned it is
difficult to locate regions of high GC-content in fly DNA. A mismatch base pair was
added to the second position from the 3‟ end to further increase specificity. At position
13 the base was changed from an R=(A+G) to a T: based on Figure 3.1 all species tested
exhibit a T at this position resulting in additional primer specificity. After modifications
74
it was expected that C. dubia would be the only species amplified, with an amplicon
length of 559bp and an estimated annealing temperature of 48ºC.
SSP 4, like SSP 2, lacked a diagnostic base at the 3‟ end. To correct for this the most 3‟
base was removed and specificity was provided by the second base at the 3‟ end.
Additional to this a mismatch base was added to the 2nd
last position of the primer to
increase specific primer-binding. The new primer length was reduced to 20bp, yet the
GC-content was increased from 23% to 30%, which will assist with specificity of
attachment. L. sericata is the only species expected to amplify, with a band of 1204bp at
an estimated annealing temperature of 54ºC.
SSP 5 required a single modification, which was the addition of a mismatch base pair to
increase specific binding to C. dubia and L. sericata. The length and GC-content
remained the same and both are within the range recommended by design guidelines. C.
dubia and L. sericata are expected to produce an amplicon of 350bp at an estimated
annealing temperature of 56ºC
SSP 6, like SSP 5, required a single modification in the addition of a mismatch base to
increase specificity towards the amplification of L. sericata. A mismatch base pair was
added to the second base from the 3‟ end, to further increase specific binding and prevent
amplification of non-specific products. No other modifications to length or GC-content
were made. The expected fragment length is 803bp at an annealing temperature of 58ºC.
The initial positioning of SSP 7 lacked the specificity required for sequence specific
identification. Re-designing of SSP 7 required the primer to be moved 6 base pairs
upstream in the sequence, to a position that provides specificity to both Ch. rufifacies and
C. dubia. Complementing the unique first base at the 3‟ end, the second base from the 3‟
end was altered to be a mismatch base for all species, increasing both specificity and
stability of the primer. The new primer length is 18bp, with a GC-content of 44%. The
expected fragment length is 686bp at an estimated annealing temperature of 52ºC.
75
SSP 8 and SSP 9 were newly designed primers to replace the removal of SSP 3. In
designing SSP 8 the aim was to find a region unique for the identification of C.
albifrontalis, as the previous primers were not specific for this species. The region
chosen is located at position 835bp, where C. albifrontalis has a unique base substitution
relative to the other known species (Figure 3.1). A mismatch is also located at the third
base from the 3‟ end, increasing the specificity of the primer. With a GC-content of 36%
and a primer length of 22bp, the primer design guidelines were followed where possible.
The expected fragment length of the PCR is 835bp using an annealing temperature of
60ºC.
SSP 9 was designed to give secondary amplifications for both Ch. megacephala and Ch.
rufifacies. Located within the 5‟ end of the COI sequence, the primer targets a unique
base for the identification of Ch. megacephala and Ch. rufifacies. This unique diagnostic
base is enhanced via the addition of a mismatch base at the second base from the 3‟ end.
The expected length of the amplified product is 293bp and the annealing temperature for
optimisation testing is 52ºC.
If the estimated annealing temperatures are accurate, the development of a single
multiplex PCR utilising all SSP pairs is unlikely due to the annealing temperatures
ranging from 48ºC to 60ºC. Alternatively two multiplex PCRs may need to be
developed. The first multiplex PCR will utilise the SSP pairs 1b, 5b, 6b and 8, which
have an annealing temperature range from 56ºC to 60ºC. This multiplex PCR would
allow for all tested species to be identified. A potential problem is the amplicon sizes for
SSP 1b and 5b, which are 320bp and 350bp respectively, which could make positive
identification difficult. This is also observed with SSP 6b and 8, which are expected to
produce amplicons of 803bp and 835bp respectively. A possible solution to this problem
is the separate amplification of all species except C. albifrontalis with the second
multiplex PCR. Alternatively 3% agarose electrophoresis gel or poly acrylamide gel
electrophoresis could be utilised for clearer distinction between similarly sized products.
Utilising SSP pairs 2b, 4b, 7b and 9 with an annealing temperature range from 48ºC to
54ºC the identification of unknown species can be confirmed. The fragment lengths
76
expected within this multiplex PCR are varied and identification would be relatively easy
as both an initial and confirmation test.
Alternatively, if the two multiplex PCR were unable to be optimised by varying the
annealing temperature alone, extending the primer length would be a potential solution,
as it would increase the Tm of the primer. This would limit the effects of the annealing
temperature, therefore allowing for optimisation to be focussed on other parameters such
as MgCl2, DNA and primer concentration.
3.4 Conclusion
The preliminary SSP pairs designed for a multiplex assay conveyed non-concordance
between the observed and expected results. After a comparison between primer
positioning and available sequence information from relevant species, it was clear SSP 1,
2, 4, 5, 6 and 7 required only minor adjustments to increase specificity and stability. SSP
3 was removed from further testing. In the re-design of the original SSP pairs, the aim
was to ensure the presence of a unique diagnostic feature at the 3‟ end of the primer and
the addition of a mismatch base at the second base from the 3‟ end. During the re-design,
SSP 8 and SSP 9 were added as replacements for SSP 3. Care was taken to amplify all
species tested with at least one primer pair and where possible multiple primer pairs.
Though a preliminary study, the potential of the SSP pairs as a means of identifying the
forensically important Calliphoridae species tested is evident. This is further observed in
the possibility of grouping primers based on their annealing temperature, which would
allow for the development of a multiplex PCR.
77
Chapter 4
Optimisation Of A Modified Set Of Sequence Specific Primers For
The Identification Of Forensically Important Calliphoridae Species
78
4.1 Introduction
Sequence Specific Primers (SSPs) rely on the concept of distinction based on nucleotide
differences between species in a particular segment of DNA. This technique can be used
in the identification of species based on the presence or absence of an amplicon using
PCR. SSP analysis has been applied in the identification of mosquitos because of their
human interaction and medical implications (Manonmani et al., 2001, Fettene et al.,
2002, Kampen et al., 2003 and Phuc et al., 2003). The successful applicability of SSPs in
other families of insects, indicates that the technique is valid for the identification of
Calliphoridae.
Optimisation is the testing of all reagents at variable amounts until a specific, efficient
and reproducible PCR is obtained (Erlich, 1993). The conditions that are commonly
optimised are annealing temperature, primer concentration, MgCl2 concentration and the
amount of template DNA. For this study the only condition altered was the annealing
temperature. The annealing temperature (Tm) is the temperature at which the primer
binds to the template and is a critical condition varied during optimisation. The
annealing temperature can be estimated from the number of G+C and A+T nucleotides
within the primer sequence (Hoy, 1994). The simple calculation used is Tm = 2AT +
4GC, which shows the greater the GC-content, the higher the annealing temperature. If
the annealing temperature of the PCR is too low the resulting amplification will likely
contain non-specific DNA fragments (Rychlik et al., 1990). Alternatively if the
temperature is too high the primer is unable to bind efficiently to the template, which
results in reduced yield and purity of the product (Rychlik et al., 1990).
In the development of a multiplex PCR, similarity between annealing temperatures of
individual primers is essential to ensure potential efficiency of each primer. Additionally,
the other reagents within the reaction should exhibit similarities to make multiplexing
possible. Due to this the initial condition altered was the annealing temperature, whilst
keeping all other conditions and reagents the same.
79
4.2 Methods
4.2.1 DNA Extraction
DNA was extracted from C. dubia (Macquart), Ch. rufifacies (Macquart), C. albifrontalis
(Malloch), Ch. megacephala (Fabricius) and L. sericata (Meigen) using the Qiagen
DNeasy Tissue Kit as described by Harvey (2006) with some modifications as specified
in Chapter 3.
The DNA extraction method and quantitation of resultant DNA samples were performed
as described in Chapter 3 and the Appendix 1. Results of quantitation of DNA purity are
presented in Appendix 2.
4.2.2 Primers
Several species were identified based on the presence or absence of an amplified band
using the single forward primer C1-J-1718 (Simon et al., 1990) and 8 new reverse
primers were designed from within the COI region. The forward primer C1-J-1718 was
paired with all reverse SSPs.
Extracted DNA quality was confirmed through the amplification of a 1270bp fragment of
the COI gene using the forward primer C1-J-1718
(5‟GGAGGATTTGGAAATTGATTAGTTCC 3‟) (Simon et al., 1990) and the reverse
primer TL2-N-3014 (5‟TCCAATGCACTAATCTGCCATATTA 3‟) (Simon et al.,
1994).
4.2.3 PCR
PCR master-mix conditions were followed from Harvey (2006). Final PCR reaction mix
consisted of: 1x PCR buffer (Fisher Biotec), 200µM of dNTP mix (Fisher Biotec), 25pM
each primer, 1 unit of Taq polymerase (Fisher Biotec), 5µl of 25mg/ml BSA, 3mM of
MgCl2, 10-150ng of template DNA and water added to a total volume of 50µl. All
reagent amounts were followed as prescribed, except BSA was modified from 5µl of 5%
BSA, to 5µl of 25mg/ml BSA, as it was readily available, and MgCl2 concentration was
80
increased from 1.5mM to 3mM to increase the primer specificity towards the target DNA
sequence.
4.2.4 PCR Optimisation
To allow for later development of a multiplex PCR, during optimisation the reagent
concentrations were kept the same unless changes to the annealing temperature proved
ineffective in optimisation of PCRs. During testing, modifications to the annealing
temperatures were made as indicated in Table 4.1. The annealing temperatures tested
ranged from 48ºC to 62ºC with 2ºC increments.
All PCRs were performed using a BioRad iCycler or GeneAmp PCR system 2700
(Applied Biosystems). Cycling conditions were 90 seconds at 94ºC initial denaturation,
followed by 36 cycles of 94ºC for 22 seconds denaturation, annealing temperature (refer
to Table 3.7) for 30 seconds and extension at 72ºC for 1 minute 20 seconds. A final
extension period of 72ºC for 1 minute was used followed by holding at 4ºC. Products
were visualised on a 2% agarose gel with ethidium bromide staining and UV
transillumination. Due to the difficulties in obtaining an exact fragment band length from
visual analysis alone, an expected range has been given. Standard curves for all SSP tests
were produced (see Appendix 3) to confirm the amplicon fell within the visually
expected size range.
4.2.5 PCR Clean-Up
The PCR products are purified to remove excess nucleotides and primer. The resulting
PCR product were utilised in direct sequencing. The Wizard SV Gel and PCR Clean-Up
System (Promega) kit was used in the purification of PCR products. Detailed instructions
for the clean-up kit are described in the Appendix 1.
4.2.6 Direct Sequencing
The ABI PRISM® Big Dye
® Terminator v 3.1 Cycle Sequencing Kit was utilised
according to manufactures‟ instructions. Samples were sequenced on an ABI 3730XL
81
sequencer at the Centre for Clinical Immunology and Biomedical Statistics, at Royal
Perth Hospital.
Each sequencing reaction contains 8µL of the BigDye terminator ready reaction mix,
3.2pmol of the primer (forward and reverse primers were used), template (amount
dependant on the expected amplicon size) and de-ionized water to make the reaction mix
up to 20µl.
All sequencing reactions were performed using the BioRad iCycler. Cycling conditions
were 96ºC for 1 minute initial pre-heat, followed by 25 cycles of 96ºC for 15 seconds
denaturation, annealing temperature (refer to Table 4.2) for 15 seconds and extension at
60ºC for 4 minutes followed by holding at 4ºC.
4.3 Results and Discussion
4.3.1 Verification of Quality of Extracted DNA Samples
Prior to the testing of the new SSP pairs, extracted DNA was tested using an established
PCR method that utilises the COI primer pairs C1-J-1718 and TL2-N-3014. This primer
pair amplifies a 1270bp region of the COI gene and was used to confirm that the
extracted Calliphoridae DNA was not degraded, does not contain excessive amounts of
inhibitors and is insect DNA. Figure 4.1 shows the COI amplification of C. dubia, Ch.
megacephala, Ch. rufifacies and L. sericata. All bands have the expected fragment
length within the range of 1100bp to 1300bp (fragment length position within range was
confirmed using a standard curve, see Appendix 3) and were of high intensity, reflecting
that a large quantity of high quality DNA was present. These results confirm that the
DNA extracted was of good quality and suitable for use in testing the newly designed
SSP pairs.
82
1 2 3 4 5 6
1400bp
1000bp
100bp
Figure 4.1: Electrophoresis gel image of COI amplification. Lane 1 is DNA ladder.
Lane 2 is C. dubia. Lane 3 is Ch. megacephala. Lane 4 is Ch. rufifacies. Lane 5 is L.
sericata and Lane 6 is the negative control. The expected fragment size is 1270bp in
length. Arrows indicate the 100bp, 1000bp and 1400bp fragments.
4.3.2 Optimisation of SSP Pairs
Table 4.1 represents the matrix of annealing temperatures utilised in the optimisation
steps of the newly designed SSP pairs. Two independent readers scored the intensity and
size of the resultant amplicons. For all electrophoresis gels displayed in this thesis a
standard curve was developed to obtain an accurate measurement of the selected
amplicons. This information is provided in Appendix 3.
83
Table 4. 1: Annealing temperature matrix for the testing of newly designed SSP pairs. 0 denotes where condition
was tested but no result was observed. 1 to 4 represents the intensity of bands produced. 1 denotes band possibly present;
2 a band of low intensity; 3 a band of medium intensity and 4 a band of high intensity. The sizes of the bands were
determined using a marker and a standard curve (Appendix 3). An expected ± 50bp variation is between expected and
observed band length due to the low resolution of electrophoresis technique gel. Optimum results are highlighted in red.
A blank box signifies that testing did not occur using this condition. (*) denotes expected species to be amplified.
Primer Name and
Expected Length Species Tested
Annealing Temperature (ºC) (Tm)
48 50 52 54 56
Band
Intensity Band Size
(bp) Band
Intensity Band Size
(bp) Band
Intensity Band Size
(bp) Band
Intensity Band Size
(bp) Band
Intensity Band Size
(bp)
SSP 1 (320bp)
C. dubia (*) 4 300-350 4 300-350
C. albifrontalis 2 300-350 2 300-350
Ch.megacephala
1 1 2 1 1 1 1
100 150-200 250-300 300-350 450-500 600-650 700-750
1 1
300-350 100
L. sericata 1 300-350 0 0
Ch. rufifacies 1 1
300-350 100
1 1
300-350 100
SSP 2 (559bp)
C. dubia (*) 3 550-600 3 550-600
C. albifrontalis 0 0 0 0
Ch. megacephala 0 0 0 0
L. sericata 3 550-600 0 0
Ch. rufifacies 0 0 0 0
SSP4 (1204bp)
C. dubia 1 1100-1400 0 0 0 0
C. albifrontalis 4 1100-1400 2 1100-1400 3 1100-1400
Ch. megacephala 1 1100-1400 0 0 0 0
L. sericata (*) 4 1100-1400 3 1100-1400 3 1100-1400
Ch. rufifacies 2 1100-1400 3 1100-1400
SSP5 (350bp)
C. dubia 0 0
C. albifrontalis 0 0
Ch.megacephala(*) 4 300-370
L. sericata 4 300-370
Ch. rufifacies (*) 4 300-370
SSP 6 (803bp)
C. dubia
C. albifrontalis
Ch. megacephala
L. sericata (*)
Ch. rufifacies
SSP 7 (686bp)
C. dubia (*) 4 650-700 4 650-700
C. albifrontalis 0 0 0 0
Ch. megacephala 0 0 0 0
L. sericata 1 650-700 0 0
Ch. rufifacies (*) 2 650-700 4 650-700
SSP 8 (835bp)
C. dubia
C. albifrontalis (*)
Ch. megacephala
L. sericata
Ch. rufifacies
SSP 9 (293bp)
C. dubia 2 290-320 0 0 1 290-320 1 290-320
C. albifrontalis 0 0 0 0 0 0 0 0
Ch. megacephala(*) 4 290-320 4 290-320 4 290-320 4 290-320
L. sericata 4 290-320 4 290-320 4 290-320 4 290-320
Ch. rufifacies (*) 4 290-320 4 290-320 4 290-320 3 290-320
84
Annealing Temperature (ºC) (Tm)
Primer Name and Expected
Length Species 57 58 60 62
Band
Intensity Band Size
(bp) Band
Intensity Band Size
(bp) Band
Intensity Band Size
(bp) Band
Intensity Band Size
(bp)
SSP 1 (320bp)
C. dubia (*) 4 300-350 4 300-350 4 300-350
C. albifrontalis 2 300-350 2 300-350 1 1
300-350 100
Ch. megacephala 2 250-300 2 300-350 2 100-150
L. sericata 2 300-350 4 1
300-350 100 2 100-150
Ch. rufifacies 2 300-350 2 1
300-350 100
3 2
300-350 100-150
SSP 2 (559bp)
C. dubia (*)
C. albifrontalis
Ch. megacephala
L. sericata
Ch. rufifacies
SSP4 (1204bp)
C. dubia 0 0 0 0 0 0
C. albifrontalis 2 1100-1400 0 0 0 0
Ch. megacephala 0 0 0 0 0 0
L. sericata (*) 3 1100-1400 2 1100-1400 0 0
Ch. rufifacies 0 0 0 0 0 0
SSP5 (350bp)
C. dubia 0 0 0 0 0 0
C. albifrontalis 0 0 0 0 0 0
Ch. megacephala (*) 4 300-370 3 300-370 2 300-370
L. sericata 3 300-370 0 0 0 0
Ch. rufifacies (*) 4 300-370 3 300-370 2 300-370
SSP 6 (803bp)
C. dubia 1 700-750 0 800-850 0 0
C. albifrontalis 1 700-750 4 800-850 0 0
Ch. megacephala 0 700-750 1 800-850 0 0
L. sericata (*) 3 700-750 3 800-850 2 770-820
Ch. rufifacies 0 0
SSP 7 (686bp)
C. dubia (*)
C. albifrontalis
Ch. megacephala
L. sericata
Ch. rufifacies (*)
SSP 8 (835bp)
C. dubia 0 0 0 0 0 0
C. albifrontalis (*) 4 850-900 4 770-850 2 800-850
Ch. megacephala 0 0 0 0
L. sericata 0 0 0 0
Ch. rufifacies 0 0 0 0
SSP 9 (293bp)
C. dubia 0 0 0 0
C. albifrontalis 0 0 0 0
Ch. megacephala (*) 3 290-320 0 0
L. sericata 2 290-320 0 0
Ch. rufifacies (*) 3 290-320 0 0
85
Based on primer design and sequence information SSP 1b was expected to produce an
amplicon of 320bp in length for only C. dubia, yet consistently during testing other species
were amplified. SSP 1b was tested at a range of annealing temperatures including 48ºC,
52ºC, 58ºC, 60ºC and 62ºC. Figure 4.2 represents the non-concordance obtained for SSP
1b at 48ºC. All species tested produced a PCR amplicon of the expected amplicon size of
approximately 300 to 350bp (Appendix 3). Additionally, Ch. megacephala and Ch.
rufifacies produced extra fragments varying in length between 80bp and 730bp (Appendix
3).
1 2 3 4 5 6 7
1000bp
500bp
100bp
Figure 4.2: Electrophoresis gel image of SSP 1b amplification at 48ºC. Lane 1 is a 100bp
DNA ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala.
Lane 5 is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. Fragment
of 320bp in length was expected for only Lane 2 C. dubia. All additional bands are non-
targeted products. Arrows indicate the 100bp, 500bp and 1000bp fragments.
86
A possible explanation for the amplification of non-specific bands is the annealing
temperatures of 48ºC and 52ºC are too low. In an attempt to alleviate the amplification of
additional bands the temperature was increased to 58ºC, 60ºC, and 62ºC. At the higher
temperatures all species continued to be amplified. Figure 4.3 represents the
electrophoresis gel produced at 62ºC. If the temperature had been too high for primer
binding the resulting outcome would have been reduced yield and limited amplification,
which did not occur.
1 2 3 4 5 6 7
1000bp
300bp
100bp
Figure 4.3: Electrophoresis gel image of SSP 1b amplification at 62ºC. Lane 1 is the DNA
ladder. Lane 2 is C. dubia. Lane 3 is C. albifrontalis. Lane 4 is Ch. megacephala. Lane 5
is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. Fragment of
320bp in length was expected for only Lane 2 C. dubia. All additional bands are non-
targeted products. Arrows indicate the 100bp, 300bp and 1000bp fragments.
The continual amplification of all species over a 14ºC temperature range suggests an error
within the primer design or that the MgCl2 concentration was too high, as excess Mg++ can
result in the amplification of non-specific amplicons. As the primer had recently been
redesigned, MgCl2 concentration was lowered to 1.5mM, which resulted in no bands for a
87
single species tested. This lack of amplification at a reduced MgCl2 concentration, and the
results from altering the annealing temperatures (discussed above), resulted in SSP 1b
being removed from further testing. This result was not unexpected, as the original primer
design was determined to require a single modification in the addition of a base at the 13th
position from the 3‟ end. This additional base is unlikely to have affected primer
specificity over a wide temperature range. SSP 1b should be redesigned to amplify an
alternative region of the COI gene.
SSP 2b is expected to amplify only C. dubia with a fragment size of 559bp in length. The
initial temperature tested was 48ºC. The result from this reaction was the amplification of
both C. dubia and L. sericata. The temperature was increased to 50ºC to prevent the
amplification of L. sericata. Figure 4.4 shows a clear single medium intensity band for C.
dubia at approximately 550bp to 600bp in length.
1 2 3 4 5 6 7
1000bp
500bp
100bp
Figure 4.4: The electrophoresis gel image of SSP 2b amplification at 50ºC. Lane 1 is the
DNA ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala.
Lane 5 is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. The
selected species was C. dubia with an expected fragment of 559bp. Arrows indicate the
100bp, 500bp and 1000bp fragments.
88
SSP 4b is expected to amplify L. sericata, producing a fragment size of 1204bp in length.
SSP 4b was tested at 52ºC, 54ºC, 56ºC, 57ºC, 58ºC and 60ºC. At 52ºC, 54ºC and 57ºC
non-selected species were amplified. In an attempt to remove non-selected species, the
temperature was increased to 58ºC, which resulted in the amplification of only L. sericata
with an amplicon size of approximately 1100bp to 1400bp (Figure 4.5). The annealing
temperature was raised to 60ºC, but no fragments were produced suggesting that the 60ºC
was too high for the primer to bind and therefore 58ºC was concluded to be the optimal
annealing temperature for SSP 4b.
1 2 3 4 5 6 7
1000bp
500bp
100bp
Figure 4.5: Electrophoresis gel image of SSP 4b amplification at 58ºC. Lane 1 is the DNA
ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala. Lane 5
is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. The expected
fragment length is 1204bp (approximately 1200bp) and should only be amplified by L.
sericata as shown in the gel. Arrows indicate the 100bp, 500bp, 1000bp and L. sericata
fragments.
89
SSP 5b is expected to produce a fragment of 350bp in length for both Ch. megacephala and
Ch. rufifacies. Initial temperatures tested were 56ºC and 58ºC, which amplified Ch.
megacephala, Ch. rufifacies and L. sericata. To optimise the reaction and prevent the
amplification of L. sericata, the annealing temperature was increased to 60ºC. Figure 4.6
shows the results obtained at 60ºC where it is clearly observed that a medium intensity
band of approximately 300bp to 370bp is present for both Ch. rufifacies and Ch.
megacephala. All other species showed no amplified products as expected, and thus 60ºC
was concluded to be the optimal annealing temperature.
1 2 3 4 5 6 7
1000bp
400bp
100bp
Figure 4.6: Electrophoresis gel image of SSP 5b amplification at 60ºC. Lane 1 is the DNA
ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala. Lane 5
is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. The expected
amplified fragment is 350bp for both Ch. megacephala and Ch. rufifacies, which is visible
from the gel. Arrows indicate the 100bp, 500bp and 1000bp fragments.
90
SSP 6b is expected to produce an 803bp fragment for the species L. sericata. The initial
estimated annealing temperature tested for SSP 6b was 58ºC, which amplified all species
tested. To prevent the amplification of the non-selected species the temperature was
increased to 60ºC, which produced the same results. The temperature was further increased
to 62ºC, which was the optimal temperature for specific amplification of a low intensity
band fragment at approximately 770bp to 820bp using SSP 6b (Figure 4.7).
1 2 3 4 5 6 7
1100bp
500bp
100bp
Figure 4.7: Electrophoresis gel image of SSP 6b amplification at 62ºC. Lane 1 is the DNA
ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala. Lane 5
is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. L. sericata is the
only species expected to amplify, producing an amplicon of 803bp in length. Arrows
indicate the 100bp, 500bp, 1100bp and L. sericata fragments.
91
SSP 7b is expected to produce a fragment of 686bp in length for C. dubia and Ch.
rufifacies. The estimated annealing temperature for SSP 7b was determined to be 52ºC,
which when tested produced a high intensity band of approximately 650bp to 700bp for C.
dubia and Ch. rufifacies (Figure 4.8). Though this produced good results extra conditions
were tested to determine if 52ºCwas optimum for this SSP pair. Decreasing the
temperature to 48ºC produced non-specific products, which confirmed the optimal
annealing temperature as 52ºC.
1 2 3 4 5 6 7
1100bp
600bp
100bp
Figure 4.8: Electrophoresis gel image of SSP 7b amplification at 52ºC. Lane 1 is the DNA
ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala. Lane 5
is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. C. dubia and Ch.
rufifacies are the only species expected to amplify a 686bp fragment. Arrows indicate the
100bp, 500bp and 1100bp fragments.
92
SSP 8 is expected to produce an 835bp fragment for C. albifrontalis. The estimated
annealing temperature was 60ºC. Testing at this temperature produced a single high
intensity band for only C. albifrontalis, measured at approximately 770bp to 850bp in
length (Figure 4.9). The temperatures of 62ºC and 58ºC were tested and produced the
expected results; the only difference was the intensity of the bands. As the highest
intensity band was obtained at 60ºC, this was determined to be the optimal annealing
temperature for SSP 8.
1 2 3 4 5 6 7
1000bp
500bp
100bp
Figure 4.9: Electrophoresis gel image of SSP 8 amplification at 60ºC. Lane 1 is the DNA
ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala. Lane 5
is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. Only C.
albifrontalis is expected to produce a band fragment of 835bp in length. Arrows indicate
the 100bp, 500bp and 1000bp fragments.
93
Similar results were obtained for SSP 9 as SSP 1b. Specifically SSP 9 produced non-
concordance between expected and observed results over a temperature range of 12ºC.
Based on sequence information and primer design SSP 9 was expected to produce a 293bp
fragment for Ch. rufifacies and Ch. megacephala. Consistently during testing non-selected
species amplified an amplicon of approximately 290bp to 320bp in length. Figure 4.10
shows the species amplified at 48ºC, which can be viewed in comparison with Figure 4.11,
where the annealing temperature was 58ºC. These figures convey the observed continual
amplification of non-expected species. The temperature was further increased to 60ºC,
which resulted in no amplified products, suggesting the temperature was too high.
1 2 3 4 5 6 7
500bp
100bp
Figure 4.10: Electrophoresis gel image of SSP 9 amplification at 48ºC. Lane 1 is the DNA
ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch. megacephala. Lane 5
is Ch. rufifacies. Lane 6 is L. sericata and Lane 7 is the negative control. The expected
species to be amplified were Ch. megacephala and Ch. rufifacies with a band fragment of
293bp in length. Arrows indicate the 100bp and 500bp fragments.
94
1 2 3 4 5 6 7
500bp
100bp
Figure 4.11: Electrophoresis gel image for SSP 9 amplification at 58ºC. Lane 1 is the
negative control. Lane 2 is L. sericata. Lane 3 is Ch. rufifacies. Lane 4 is Ch.
megacephala. Lane 5 is C. dubia. Lane 6 is C. albifrontalis and Lane 7 is the DNA ladder.
Arrows indicate the 100bp and 500bp fragments.
As excess Mg++
can result in the amplification of non-selected products, the MgCl2
concentration was reduced to 1.5mM as was done with SSP 1b. This resulted in no
amplified fragments, which suggests 1.5mM of Mg++
was insufficient to support the
binding of SSP 9. Due to the lack of optimisation, SSP 9 was removed from further
testing.
In summary, of the results obtained from optimisation of annealing temperatures, 6 of the 8
SSP pairs required the alteration of annealing temperature for adequate optimisation. Table
4.2 shows the optimised annealing temperatures of each SSP pair. SSP 1b and SSP 9 were
unable to be optimised by varying the annealing temperature and were removed from the
primer set. Three of the five Calliphoridae species tested were amplified by more than one
SSP pair, enabling a secondary confirmation test for identification.
95
Table 4.2: Optimised annealing temperatures and selected species amplification for newly
designed SSP pairs.
Primer Name SSP 2b SSP 4b SSP 5b SSP 6b SSP 7b SSP 8
Optimal Annealing Temperature (ºC) 50 58 60 62 52 60
Fragment Size (bp) 550-600 1100-1400 300-370 770-820 650-700 770-850
Species Tested
C. albifrontalis X
C. dubia X X
Ch. megacephala X
Ch. rufifacies X X
L. sericata X X
4.3.3 Analysis of sequenced SSP-PCR products
Using the sequence results obtained from the PCR amplicon products for SSP pairs 2b, 4b,
5b, 7b and 8 a sequence alignment was performed to confirm the expected regions were
amplified. Sequence information from tested samples and known published sequences
(Genbank database accessible from the National Centre for Biotechnology Information
(NCBI) website at http://www.ncbi.nlm.nih.gov) were utilised in the comparison.
Accession numbers utilised in the alignment were EU418556 (C. dubia), EU418566 (C.
albifrontalis), AB112833.1 (L. sericata), AB112845.1 (Ch. rufifacies), AB112847.14 (Ch.
megacephala) (Figure 4.12). DQ345074 (C. augur) is added not as a species tested, but to
indicate the position of the forward primer.
The purpose of the alignment was to confirm the primer sequence, species and regions
amplified. Due to the lack of sequence at some of the 5‟ and 3‟ end of the products, only
confirmation of the species and the region was possible. Figure 4.12 highlights the variable
nucleotides between the species and confirms the presence of distinctive nucleotides in the
amplified regions. The sequenced data for SSP 2b, 5b, 7b and 8 aligned accurately for all
species sequenced, confirming the correct species and regions expected were amplified.
SSP 6b failed to produce a resulting sequence and was therefore not aligned. L. sericata
96
portrayed some variation between the published species sequence and the sequenced data.
These points have been highlighted in Figure 4.12, where there are 20 differences between
the species sequence and the SSP sequenced data. These variations are observed between
450bp to 1050bp
C1-J-1718
GGAGGATTTGGAAATTGATTAGTTCC
Seq SSP 8 C. albifrontalis --------------TTGATTAGTTCC-T----GT-------T--------
Seq SSP 7b C. dubia ----------GAAATTGATTAGTTCC-T----GC-------T--------
Seq SSP 7b Ch. rufifacies --------------TTGATTAGTTCC-T----AC-------C--------
Seq SSP 5b Ch. megacephala -------TTGGAAATTGATTAGTTCC-T----GT-------T--------
Seq SSP 5b Ch. rufifacies -------TTGGAAATTGATTAGTTCC-C----AC-------C--------
Seq SSP 4b L. sericata ºººººººººººººººººººººººººººººººººººººººººººººººººº
Seq SSP 2b C. dubia -GAGGATTTGGAAATTGATTAGTTCC-T----GC-------T--------
C_Augur_DQ345074 GGAGGATTTGGAAATTGATTAGTTCCTTTAATGCTAGGAGCTCCAGATAT 50
L_sericata_AB112833 --------------------------------------------------
Ch_rufifacies_AB112845 --------------------------------------------------
Ch_megacephala_AB112847 --------------------------------------------------
C_albifrontalis_EU418566 --------------------------------------------------
C_dubia_EU418556 --------------------------------------------------
Seq SSP 8 C. albifrontalis G--A-T---T---T----------------T---T-AC----T--C---T
Seq SSP 7b C. dubia A--A-T---T---T----------------C---C-TT----T--T---T
Seq SSP 7b Ch. rufifacies G--T-T---A---A----------------T---C-TT----C--T---C
Seq SSP 5b Ch. megacephala A--T-T---A---A----------------C---C-TT----T--T---T
Seq SSP 5b Ch. rufifacies G--T-T---A---A----------------T---C-TT----C--T---T
Seq SSP 4 L. sericata ºººººººººººººººººººººººººººººººººººººººººººººººººº
Seq SSP 2 C. dubia A--A-T---T---T----------------C---C-TT----T--T---T
C_Augur_DQ345074 AGCATCCCCTCGATTAAATAATATAAGTTTCTGACTTTTACCTCCTGCAT 100
L_sericata_AB112833 ----------------------------------C-TT----T--T----
Ch_rufifacies_AB112845 ----------------------------------C-TT----C--T----
Ch_megacephala_AB112847 ----------------------------------C-TT----T--T----
C_albifrontalis_EU418566 ----------------------------------T-AC----T--C----
C_dubia_EU418556 ----------------------------------C-TT----T--T----
* * **** ** ****
Seq SSP 8 C. albifrontalis ----TT--T-------A-----------------T--A------------
Seq SSP 7b C. dubia ----AC--T-------A-----------------T--A------------
Seq SSP 7b Ch. rufifacies ----TT--C-------A-----------------T--A------------
Seq SSP 5b Ch. megacephala ----TT--T-------A-----------------T--G------------
Seq SSP 5b Ch. rufifacies ----TT--C-------A-----------------T--A--//
Seq SSP 4b L. sericata ºººººººººººººººººººººººººººººººººººººººººººººººººº
Seq SSP 2b C. dubia ----AC--T-------A-----------------T--A------------
C_Augur_DQ345074 TAACACTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGA 150
L_sericata_AB112833 ----TT--T-------T-----------------C--A------------
Ch_rufifacies_AB112845 ----TT--C-------A-----------------T--A------------
Ch_megacephala_AB112847 ----TT--T-------A-----------------T--G------------
C_albifrontalis_EU418566 ----TT--T-------A-----------------T--A------------
C_dubia_EU418556 ----AC--T-------A-----------------T--A------------
**** ** ******* ***************** ** ***** ******
Seq SSP 8 C. albifrontalis -----T-----C--T---T----T--------T--T-----A-----T--
Seq SSP 7b C. dubia -----T-----C--C---T----T--------C--T-----A-----T--
Seq SSP 7b Ch. rufifacies -----T-----T--A---T----A--------T--A-----T-----A--
Seq SSP 5b Ch. megacephala -----T-----C--A---T----T--------T--T-----A-----A--
Seq SSP 4b L. sericata ºººººººººººººººººººººººººººººººººººººººººººººººººº
Seq SSP 2b C. dubia -----T-----C--C---T----T--------C--T-----A-----T--
C_Augur_DQ345074 TGAACTGTTTACCCCCCTTTATCTTCTAATATCGCTCATGGAGGAGCTTC 200
L_sericata_AB112833 -----A-----C--T---C----T--------T--T-----A-----T--
97
Ch_rufifacies_AB112845 -----T-----T--A---T----A--------T--A-----T-----A--
Ch_megacephala_AB112847 -----T-----C--A---T----T--------T--T-----A-----A--
C_albifrontalis_EU418566 -----T-----C--T---T----T--------T--T-----A-----T--
C_dubia_EU418556 -----T-----C--C---T----T--------C--T-----A-----T--
***** ***** ** *** **** ******** ** ***** ***** **
Seq SSP 8 C. albifrontalis T-----------------T--AC-T--T-----T--------T-------
Seq SSP 7b C. dubia T-----------------T--TT-A--T-----A--------C-------
Seq SSP 7b Ch. rufifacies A-----------------T--TT-A--C-----T--------A-------
Seq SSP 5b Ch. megacephala A-----------------C--TT-A--C-----A--------T-------
Seq SSP 4b L. sericata ºººººººººººººººººººººººººººººººººººººººººººººººººº
Seq SSP 2b C. dubia T-----------------T--TT-A--T-----A--------C-------
C_Augur_DQ345074 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTT 250
L_sericata_AB112833 T-----------------C--TC-T--T-----A--------T-------
Ch_rufifacies_AB112845 A-----------------T--TT-A--C-----T--------A-------
Ch_megacephala_AB112847 A-----------------C--TT-A--C-----A--------T-------
C_albifrontalis_EU418566 T-----------------T--AC-T--T-----T--------T-------
C_dubia_EU418556 T-----------------T--TT-A--T-----A--------C-------
***************** ** * ** ***** ******** *******
Seq SSP 8 C. albifrontalis ----A--A--------------T--C--A--------G-----A-----G
Seq SSP 7b C. dubia ----A--T--------------T--T--A--------A-----A-----T
Seq SSP 7b Ch. rufifacies ----G--C--------------A--T--T--------A-----T-----A
Seq SSP 5b Ch. megacephala ----A--T--------------A--T--A--------A-----T-----A
Seq SSP 4b L. sericata ºººººººººººººººººººººººººººººººººººººººººººººººººº
Seq SSP 2b C. dubia ----A--T--------------T--T--A--------A-----A-----T
C_Augur_DQ345074 TAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCAACAGGT 300
L_sericata_AB112833 ----A--T--------------T--A--T--------A-----A-----A
Ch_rufifacies_AB112845 ----G--C--------------A--T--T--------A-----T-----A
Ch_megacephala_AB112847 ----A--T--------------A--T--A--------A-----T-----A
C_albifrontalis_EU418566 ----A--A--------------T--C--A--------G-----A-----G
C_dubia_EU418556 ----A--T--------------T--T--A--------A-----A-----T
**** ** ************** ** ** ******** ***** *****
Seq SSP 8 C. albifrontalis A-T--C-----T-----------------T-----A-----A-----A--
Seq SSP 7b C. dubia G-A--T-----C-----------------T-----A-----A-----A--
Seq SSP 7b Ch. rufifacies A-T--A-----T-----------------A-----T-----T-----T--
Seq SSP 5b Ch. megacephala A-T--A-----T--------//
Seq SSP 4b L. sericata ºººººººººººººººººººººººººººººººººººA-----A-----A--
Seq SSP 2b C. dubia G-A--T-----C-----------------T-----A-----A-----A--
C_Augur_DQ345074 GTAACTTTTGACCGAATACCTTTATTTGTTTGATCAGTAGTAATTACAGC 350
L_sericata_AB112833 A-T--T-----T-----------------T-----A-----A-----A--
Ch_rufifacies_AB112845 A-T--A-----T-----------------A-----T-----T-----T--
Ch_megacephala_AB112847 A-T--A-----T-----------------A-----T-----T-----T--
C_albifrontalis_EU418566 A-T--C-----T-----------------T-----A-----A-----A--
C_dubia_EU418556 G-A--T-----C-----------------T-----A-----A-----A--
* ** ***** ***************** ***** ***** ***** **
Seq SSP 8 C. albifrontalis –C-AT-AC-TC-------T--------------A--A--T-----A---T
Seq SSP 7b C. dubia -T-AT-AC-TT-------T--------------A--A--T-----T---T
Seq SSP 7b Ch. rufifacies -C-TC-TT-AT-------A--------------A--T--A-----T---T
Seq SSP 4b L. sericata -T-AT-AC-TT-------A--------------T--A--T-----A---C
Seq SSP 2b C. dubia -T-AT-AC-TT-------T--------------A--A--T-----T---T
C_Augur_DQ345074 TTTATTACTTTTATTATCTTTACCAGTATTAGCAGGAGCTATTACTATAT 400
L_sericata_AB112833 -T-AT-AC-TT-------A--------------A--A--T-----A---C
Ch_rufifacies_AB112845 -C-TC-TT-AT-------A--------------A--T--A-----T---T
Ch_megacephala_AB112847 -C-AT-AT-AT-------T--------------T--A--T-----T---T
C_albifrontalis_EU418566 -C-AT-AC-TC-------T--------------A--A--T-----A---T
C_dubia_EU418556 -T-AT-AC-TT-------T--------------A--A--T-----T---T
* * * * ******* ************** ** ** ***** ***
Seq SSP 8 C. albifrontalis –A-----A--T-----CC-T-----T-----T-----C--T--T-----A
Seq SSP 7b C. dubia -A-----A--T-----TC-T-----T-----C-----C--A--A-----A
98
Seq SSP 7b Ch. rufifacies -A-----T--T-----TT-A-----T-----C-----T--A--A-----G
Seq SSP 4b L. sericata -T-----A--T-----TC-T-----A-----C-----C--A--A-----A
Seq SSP 2b C. dubia -A-----A--T-----TC-T-----T-----C-----C--A--A-----A
C_Augur_DQ345074 TATTAACAGATCGAAATCTTAATACTTCATTCTTTGACCCAGCAGGAGGA 450
L_sericata_AB112833 -T-----A--C-----TC-T-----A-----C-----C--T--A-----A
Ch_rufifacies_AB112845 -A-----T--T-----TT-A-----T-----C-----T--A--A-----G
Ch_megacephala_AB112847 -A-----T--C-----TC-A-----T-----C-----T--A--A-----A
C_albifrontalis_EU418566 -A-----A--T-----CC-T-----T-----T-----C--T--T-----A
C_dubia_EU418556 -A-----A--T-----TC-T-----T-----C-----C--A--A-----A
* ***** ** ***** * ***** ***** ***** ** ** *****
Seq SSP 8 C. albifrontalis -----T--T--------C-----T-----------T-----T--C--A--
Seq SSP 7b C. dubia -----T--T--------T-----C-----------T-----T--C--T--
Seq SSP 7b Ch. rufifacies -----C--T--------T-----C-----------C-----T--T--A--
Seq SSP 4b L. sericata -----C--A--------T-----T-----------C-----A--T--T--
Seq SSP 2b C. dubia -----T--T--------T-----C-----------T-----T--C--T--
C_Augur_DQ345074 GGAGATCCTATTTTATATCAACACTTATTTTGATTTTTTGGTCACCCTGA 500
L_sericata_AB112833 -----T--A--------C-----T-----------C-----A--C--T--
Ch_rufifacies_AB112845 -----C--T--------T-----C-----------C-----T--T--A--
Ch_megacephala_AB112847 -----T--T--------T-----T-----------C-----A--T--T--
C_albifrontalis_EU418566 -----T--T--------C-----T-----------T-----T--C--A--
C_dubia_EU418556 -----T--T--------T-----C-----------T-----T--C--T--
***** ** ******** ***** *********** ***** ** ** **
Seq SSP 8 C. albifrontalis ---A-----------------A-----T-----------T--C--T----
Seq SSP 7b C. dubia ---T-----------------//
Seq SSP 7b Ch. rufifacies ---T--------------//
Seq SSP 4b L. sericata ---T-----------------T-----T-----------T--T--T----
Seq SSP 2b C. dubia ---T--//
C_Augur_DQ345074 AGTTTATATTTTAATTTTACCGGGATTTGGAATAATTTCACATATTATTA 550
L_sericata_AB112833 ---T-----------------T-----T-----------T--T--T----
Ch_rufifacies_AB112845 ---T-----------------T-----C-----------T--T--C----
Ch_megacephala_AB112847 ---T-----------------T-----C-----------T--T--T----
C_albifrontalis_EU418566 ---A-----------------A-----T-----------T--C--T----
C_dubia_EU418556 ---T-----------------G-----T-----------A--T--T----
*** ***************** ***** *********** ** ** ****
Seq SSP 8 C. albifrontalis -------------T-----------T--C--G--AC----A--A------
Seq SSP 4b L. sericata -------------A-----------A--C--T--AT----A--A------
C_Augur_DQ345074 GTCAAGAATCAGGAAAAAAGGAAACTTTCGGGTCATTAGGAATAATTTAT 600
L_sericata_AB112833 -------------T-----------A--C--T--AT----G--G------
Ch_rufifacies_AB112845 -------------A-----------C--T--A--TT----A--A------
Ch_megacephala_AB112847 -------------A-----------T--C--A--TT----A--G------
C_albifrontalis_EU418566 -------------T-----------T--C--G--AC----A--A------
C_dubia_EU418556 -------------A-----------T--C--G--AT----A--A------
************* *********** ** ** ** **** ** ******
Seq SSP 8 C. albifrontalis --T---C----------TT----------C-----A-----Y--T--T--
Seq SSP 4b L. sericata --T---T----------AT----------T-----T-----T--T--T--
C_Augur_DQ345074 GCCATATTAGCTATTGGATTATTAGGATTTATTGTATGAGCCCACCATAT 650
L_sericata_AB112833 --C---T----------AT----------T-----T-----T--T--T--
Ch_rufifacies_AB112845 --A---T----------AT----------T-----A-----T--T--T--
Ch_megacephala_AB112847 --T---C----------TC----------T-----A-----T--C--C--
C_albifrontalis_EU418566 --T---C----------TT----------C-----A-----T--T--T--
C_dubia_EU418556 --C---T----------AT----------T-----A-----C--C--T--
** *** ********** ********** ***** ***** ** ** **
Seq SSP 8 C. albifrontalis A-TT--A--A-----A--C--A--T--T-----T--T--T--A-//
Seq SSP 4b L. sericata A-TT--A--A-----A--C--T--T--A-----T--T--T--T-----T-
C_Augur_DQ345074 ATCTACAGTAGGAATAGATGTAGATACCCGAGCTTATTTTACCTCAGCTA 700
L_sericata_AB112833 A-TT--A--A-----A--C--T--T--A-----T--C--T--T-----T-
Ch_rufifacies_AB112845 A-TC--T--A-----G--T--A--T--T-----A--T--C--T-----T-
Ch_megacephala_AB112847 G-TT--T--T-----A--C--A--C--A-----T--T--C--T-----T-
99
C_albifrontalis_EU418566 A-TT--A--A-----A--C--A--T--T-----T--T--T--A-----A-
C_dubia_EU418556 A-TT--A--A-----A--T--A--T--C-----T--T--T--C-----T-
* ** ** ***** ** ** ** ** ***** ** ** ** ***** *
Seq SSP 4b L. sericata -T-----------T--A--------------A-----C-----------A
C_Augur_DQ345074 CTATAATTATTGCGGTACCAACTGGAATTAAAATTTTCAGTTGATTAGCA 750
L_sericata_AB112833 -T-----------T--A--------------G-----T-----------A
Ch_rufifacies_AB112845 -A-----------T--A--------------A-----T-----------A
Ch_megacephala_AB112847 -A-----------T--A--------------G-----C-----------A
C_albifrontalis_EU418566 -T-----------T--T--------------A-----C-----------C
C_dubia_EU418556 -T-----------G--A--------------A-----C-----------A
* *********** ** ************** ***** ***********
Seq SSP 4b L. sericata --------T-----T--------C-----T--T--------------T--
C_Augur_DQ345074 ACTCTTTATGGAACTCAATTAAACTATTCACCAGCTACTTTATGAGCTTT 800
L_sericata_AB112833 --------T-----T--------C-----C--T--------------T--
Ch_rufifacies_AB112845 --------T-----T--------T-----T--A--------------C--
Ch_megacephala_AB112847 --------C-----A--------T-----T--A--------------T--
C_albifrontalis_EU418566 --------T-----T--------T-----C--A--------------A--
C_dubia_EU418556 --------T-----T--------C-----A--A--------------T--
******** ***** ******** ***** ** ************** **
Seq SSP 4b L. sericata ---A--------TT-A--T--T--------T-----------T-------
C_Augur_DQ345074 AGGATTTGTATTTTTATTTACAGTAGGAGGATTAACTGGAGTTGTTTTAG 850
L_sericata_AB112833 ---A--------TT-A--C--T--------T-----------T-------
Ch_rufifacies_AB112845 ---G--------TT-A--T--T--------A-----------A-------
Ch_megacephala_AB112847 ---A--------TT-A--T--T--------A-----------T-------
C_albifrontalis_EU418566 ---G--------CC-T--C--A--------A-----------T-------
C_dubia_EU418556 ---A--------TT-A--T--A--------A-----------T-------
*** ******** * ** ** ******** *********** *******
Seq SSP 4b L. sericata ----C--T--AA-T--T-----TC-A-----T--T--T--------A---
C_Augur_DQ345074 CTAACTCATCTGTAGATATTATCCTTCATGATACTTATTATGTAGTTGCT 900
L_sericata_AB112833 ----C--T--AG-T--T-----TT-A-----T--A--C--------A---
Ch_rufifacies_AB112845 ----T--A--TA-T--T-----TT-A-----C--A--C--------A---
Ch_megacephala_AB112847 ----T--A--AA-T--C-----TT-A-----T--A--T--------A---
C_albifrontalis_EU418566 ----T--T--TG-T--T-----CC-T-----T--A--C--------T---
C_dubia_EU418556 ----C--T--TG-A--T-----CC-T-----T--T--T--------T---
**** ** ** * ** ***** * ***** ** ** ******** ***
Seq SSP 4b L. sericata --C------------T-A--A--A--------------T--------A--
C_Augur_DQ345074 CATTTCCATTATGTTTTATCAATAGGAGCTGTATTTGCCATTATAGCAGG 950
L_sericata_AB112833 --C------------T-A--A--G--------------T--------A--
Ch_rufifacies_AB112845 --C------------C-T--A--A--------------T--------A--
Ch_megacephala_AB112847 --C------------C-A--A--G--------------T--------A--
C_albifrontalis_EU418566 --T------------C-A--T--A--------------T--------C--
C_dubia_EU418556 --T------------T-A--A--A--------------C--------A--
** ************ * ** ** ************** ******** **
Seq SSP 4b L. sericata ------T--T----AC--TT-------A--A-----T------ACT--GA
C_Augur_DQ345074 ATTTGTTCATTGATACCCTCTATTTACAGGTTTAACTTTAAATGGAAAAA
1000
L_sericata_AB112833 ------T--C----AT--TT-------A--A-----T------ACT--GA
Ch_rufifacies_AB112845 ------A--T----TC--AT-------T--A-----C------AAT--AA
Ch_megacephala_AB112847 ------T--T----TC--TC-------T--A-----T------AGC--GT
C_albifrontalis_EU418566 ------A--C----AC--TC-------A--A-----T------GGA--AA
C_dubia_EU418556 ------T--T----AC--TC-------A--T-----T------GGA--AA
****** ** **** ** ******* ** ***** ****** **
100
Seq SSP 4b L. sericata -AT----A---------G-------------T--A----A-T-A--A--//
C_augur_DQ345074 TACTAAAAAGTCAATTTACTATTATATTTATTGGAGTAAGTATTACATTT
1050
L_sericata_AB112833 -AT----A---------G-------------T--G----A-T-A--A--C
Ch_rufifacies_AB112845 -AC----A---------G-------------T--A----A-T-A--A--C
Ch_megacephala_AB112847 -AT----G---------G-------------C--A----A-T-A--A--C
C_albifrontalis_EU418566 -GT----A---------A-------------T--A----A-A-T--T--C
C_dubia_EU418556 -AC----A---------A-------------T--A----A-A-T--A--T
* **** ********* ************* ** **** * * ** **
Figure 4.12: Representation of the sequenced data obtained from optimised SSP pairs. The
identifying nucleotides for each species and the corresponding nucleotide within the
sequence data are highlighted as follows C. dubia -, C. albifrontalis -, Ch. megacephala -,
Ch. rufifacies – and L. sericata -. Variation between a species and sequence data alignment
is identified with -. End of sequenced data is signified by //. * denotes conserved sites. A
blank signifies a variable site. º denotes missing sequence not obtained using the Big Dye
terminator kit. – denotes conserved sequence information.
Phylogenetic analysis was performed to determine if the variation observed in the sequence
data for L. sericata was the result of contamination during testing. To confirm this
sequences for all species tested were selected from Genbank (http://www.ncbi.nlm.nih.gov)
(full list of sequences utilised is provided in the Appendix 4) to be grouped, based on the
similarity and differences between chosen characters. All species sequences were aligned
with the test L. sericata sequence to determine if the variation observed were due to
intraspecific or interspecific difference. Using this alignment a pair-wise comparison of all
selected sequences was performed using the MEGA 3.1 programme to produce a
neighbour-joining phylogenetic tree (Figure 4.13). From Figure 4.13 it is clear that the test
L. sericata sequence groups with the other L. sericata sequences, confirming that the
variations observed were not the result of contamination. It is also evident from Figure
4.13 that intraspecific variation is exhibited within the L. sericata complex, which accounts
for the variation observed during sequence analysis. The statistical reliability of the
inferred tree was determined via the random resampling of nucleotide sites within the
sequence (bootstrapping). This gives an indication as to the proportion of replication in
which a specific clustering occurred. For Figure 4.13, 500 bootstrap replications were
performed resulting in a clustering percentage of 97 for the L. sericata group being the
species of origin for the test sequence.
101
EU418579 L sericata AB112844 L sericata AB112864 L sericata AB112859 L sericata AB112843 L sericata AB112833 L sericata
EF531193 L sericata AY092814 L sericata AY092818 L sericata AY092817 L sericata AY092816 L sericata AY092815 L sericata
EU418578 L sericata AB112850 L sericata
L sericata TEST SEQ EU418568 C albifrontalis EU418567 C albifrontalis
EU418566 C albifrontalis EU418553 C dubia EU418556 C dubia EU418555 C dubia EU418554 C dubia EU418552 C dubia
DQ119593 Ch megacephala DQ119592 Ch megacephala DQ279746 Ch megacephala
DQ345076 Ch megacephala AB112841 Ch megacephala
AY092761 Ch megacephala EU418537 Ch megacephala
DQ647350 Ch megacephala DQ647352 Ch megacephala
DQ647353 Ch megacephala DQ647351 Ch megacephala
AB112848 Ch megacephala EU418535 Ch megacephala AB112846 Ch megacephala AB112830 Ch megacephala EU418536 Ch megacephala AB112856 Ch megacephala AB112861 Ch megacephala AB112847 Ch megacephala
AY092760 Ch rufifacies DQ345079 Ch rufifacies
DQ647359 Ch rufifacies DQ647358 Ch rufifacies DQ647360 Ch rufifacies
DQ647361 Ch rufifacies DQ647357 Ch rufifacies
AB112845 Ch rufifacies AB112828 Ch rufifacies
EU418549 Ch rufifacies EU418548 Ch rufifacies EU418547 Ch rufifacies
DQ098943 Ch rufifacies DQ098942 Ch rufifacies
DQ0989451 Ch rufifacies DQ098944 Ch rufifacies
AH015279 Ch rufifacies AH015278 Ch rufifacies
AH015277 Ch rufifacies AH015276 Ch rufifacies 99
81 99
64 81
13 5
7
6
50
27
47
42
80
68
20 44
51
41
34
23
37
32
72
95 99
87 36 42
99
89
99 52
9
85
97
0.02 Figure 4.13: Neighbouring joining phylogenetic tree using pair-wise comparison of all
species tested to confirm species grouping of the L. sericata test sequence data. L.
sericata sequence has been identified as L. sericata TEST SEQ. Bootstrap values are
identified at the base of each branch
102
For SSP 1b and SSP 9, the purpose of the direct sequencing was to determine the reason for
the continual amplification of non-selected species after optimisation attempts. Direct
sequencing data for these SSP pairs were aligned with all species tested and the nucleotide
variations were isolated and identified (Figure 4.14). SSP 1b (C. dubia) and SSP 9 (Ch.
megacephala) sequenced data, amplified both the forward and reverse primer and were
aligned accurately. This alignment confirmed the successful amplification of the selected
region, species and fragment length. The partial sequence data for the other species tested
using SSP 1b and SSP 9 could only provide information on the region and species amplified.
Comparisons of species-specific nucleotide differences within the sequence were identified
and appear to align accurately suggesting both accurate regions and species amplified. From
this information it is not possible for a reason to be determined that would explain the
continual non-selected amplification of these species during PCR.
C1-J-1718
GGAGGATTTGGAAATTGATTAGTTCC
Seq SSP 9 L. sericata -GAGGATTTGGAAATTGATTAGTTCC-T----GT-------T--------
Seq SSP 9 Ch. rufifacies --AGGATTTGGAAATTGATTAGTTCC-C----AC-------C--------
Seq SSP 9 Ch. megacephala --AGGATTTGGAAATTGATTAGTTCC-T----GT-------T--------
Seq SSP 1b C. dubia ---GGATTTGGAAATTGATTAGTTCC-T----GC-------T--------
Seq SSP 1b Ch. megacephala -GAGGATTTGGAAATTGATTAGTTCC-T----GT-------T--------
C_augur_DQ345074 GGAGGATTTGGAAATTGATTAGTTCCTTTAATGCTAGGAGCTCCAGATAT 50
Ch_megacephala_AB112847 --------------------------------------------------
L_sericata_AB112833 --------------------------------------------------
C_rufifacies_AB112845 --------------------------------------------------
C_albifrontalis_EU418566 --------------------------------------------------
C_dubia_EU418556 --------------------------------------------------
******************************** ******* ********
Seq SSP 9 L. sericata -G-T-T---A---A----------------C---C-TT----T--T----
Seq SSP 9 Ch. rufifacies -G-T-T---A---A----------------T---C-TT----C--T----
Seq SSP 9 Ch. megacephala -G-T-T---A---A----------------C---C-TT----T--T----
Seq SSP 1b C. dubia -G-A-T---T---T----------------C---C-TT----T--T----
Seq SSP 1b Ch. megacephala -G-T-T---A---A----------------C---C-TT----T--T----
C_augur_DQ345074 AGCATCCCCTCGATTAAATAATATAAGTTTCTGACTTTTACCTCCTGCAT 100
C_megacephala_AB112847 ----------------------------------C-TT----T--T----
L_sericata_AB112833 ----------------------------------C-TT----T--T----
C_rufifacies_AB112845 ----------------------------------C-TT----C--T----
C_albifrontalis_EU418566 ----------------------------------T-AC----T--C----
C_dubia_EU418556 ----------------------------------C-TT----T--T----
** * *** *** ******************** * **** ** ****
Seq SSP 9 L. sericata ----TT--T-------A------------G----T--G-----A----//
Seq SSP 9 Ch. rufifacies ----TT--C-------A------------G----T--A-----A------
Seq SSP 9 Ch. megacephala ----TT--T-------A------------G----T--G-----A------
Seq SSP 1b C. dubia ----AC--T-------A------------G----T--A-----A------
Seq SSP 1b Ch. megacephala ----TT--T-------A------------G----T--G-----A------
C_augur_DQ345074 TAACACTATTATTAGTAAGTAGTATAGTAGAAAATGGAGCTGGAACAGGA 150
C_megacephala_AB112847 ----TT--T-------A------------C----T--G-----A------
L_sericata_AB112833 ----TT--T-------T------------G----C--A-----A------
C_rufifacies_AB112845 ----TT--C-------A------------G----T--A-----A------
103
C_albifrontalis_EU418566 ----TT--T-------A------------G----T--A-----G------
C_dubia_EU418556 ----AC--T-------A------------G----T--A-----A------
**** ** ******* ************ **** ** ***** ******
Seq SSP 9 Ch. rufifacies -----T-----T--A---T----A--------//
Seq SSP 9 Ch. megacephala -----T-----C--A---T----T--------T--T-----A-----A--
Seq SSP 1b C. dubia -----T-----C--C---T----T--------C--T-----A-----T--
Seq SSP 1b Ch. megacephala -----T-----C--A---T----T//
C_augur_DQ345074 TGAACTGTTTACCCCCCTTTATCTTCTAATATCGCTCATGGAGGAGCTTC 200
Ch_megacephala_AB112847 -----T-----C--A---T----T--------T--T-----A-----A--
L_sericata_AB112833 -----A-----C--T---C----T--------T--T-----A-----T--
Ch_rufifacies_AB112845 -----T-----T--A---T----A--------T--A-----T-----A--
C_albifrontalis_EU418566 -----T-----C--T---T----T--------T--T-----A-----T--
C_dubia_EU418556 -----T-----C--C---T----T--------C--T-----A-----T--
***** ***** ** *** **** ******** ** ***** ***** **
Seq SSP 9 Ch. megacephala A-----------------C--TT-A--C-----A--------T-------
Seq SSP 1b C. dubia T-----------------T--TT-A--T-----A--------C-------
C_augur_DQ345074 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCCTCAATTT 250
Ch_megacephala_AB112847 A-----------------C--TT-A--C-----A--------T-------
L_sericata_AB112833 T-----------------C--TC-T--T-----A--------T-------
Ch_rufifacies_AB112845 A-----------------T--TT-A--C-----T--------A-------
C_albifrontalis_EU418566 T-----------------T--AC-T--T-----T--------T-------
C_dubia_EU418556 T-----------------T--TT-A--T-----A--------C-------
***************** ** * ** ***** ******** *******
SSP 9 ATCTGTAATTAATATACGATC
Seq SSP 9 Ch. megacephala ----A--T--------------ATCTGTAATTAATATAC-----------
Seq SSP 1b C. dubia ----A--T--------------TA-T--A--------A-----A-----T
C_augur_DQ345074 TAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGATCAACAGGT 300
C_megacephala_AB112847 ----A--T--------------AA-T--A--------A-----T-----A
L_sericata_AB112833 ----A--T--------------TA-A--T--------A-----A-----A
Ch_rufifacies_AB112845 ----G--C--------------AA-T--T--------A-----T-----A
C_albifrontalis_EU418566 ----A--A--------------TA-C--A--------G-----A-----G
C_dubia_EU418556 ----A--T--------------TA-T--A--------A-----A-----T
**** ** ************** * ** ******** ***** *****
SSP 1b GTAACTTTTGACCGAATACC
Seq SSP 1b C. dubia GTAACTTTTGACCGAATACC
C_augur_DQ345074 GTAACTTTTGACCGAATACC350
Ch_megacephala_AB112847 A-T--A-----T--------
L_sericata_AB112833 A-T--T-----T--------
Ch_rufifacies_AB112845 A-T--A-----T--------
C_albifrontalis_EU418566 A-T--C-----T--------
C_dubia_EU418556 G-A--T-----C--------
* ** ***** ********
Figure 4.14: Representation of the sequenced data obtained from testing of SSP 1b and SSP
9. The identifying nucleotides for each species and the corresponding nucleotide within the
SSP 1b and SSP 9 sequences are highlighted as follows C. dubia -, C. albifrontalis -, Ch.
megacephala -, Ch. rufifacies – and L. sericata -. Variation between a species and sequence
data alignment is identified with -. End of sequenced data is signified by //. * denotes
conserved sites. A blank signifies a variable site. – denotes conserved available sequence
information from a species to highlight variable regions.
104
The SSP pairs still lack an internal control, which would provide assurance that the PCR
is working and the DNA specimens have been successfully amplified and detected. For
expected results the internal controls provide a secondary signal that confirms successful
amplification. Without an internal control, there is no surety that the lack of an amplified
species, was not instead due to reaction failure. Lack of an internal control does not
detract totally from the results obtained which were found to be reproducible, but would
have provided on extra confirmation test for the results.
From the results of the SSP pair optimisation testing, two multiplex PCR will be
developed due to the range of primer annealing temperatures. One multiplex PCR will be
tested using SSP 2b and 7b, which will amplify C. dubia and C. rufifacies. The second
multiplex PCR will use SSP 4b, 5b, 6b and 8 and should amplify the species C.
albifrontalis, Ch. megacephala, Ch. rufifacies and L. sericata.
4.4 Conclusion
In an attempt to retain similarity between SSP pairs for potential multiplex PCR
development the initial condition altered was the annealing temperature. Altering only
the annealing temperature, 6 of the 8 SSP pairs amplified expected species and region.
SSP 1b and SSP 9 were subjected to further testing but were unable to be optimised and
were removed from further testing. With the remaining SSP pairs two multiplex PCRs
can be developed and tested, which will identify all species tested in this study.
If the primers were to be optimised without multiplexing as a consideration, alternative
conditions could have been tested to obtain optimisation. Analysis of sequence data
obtained for SSP 1b confirms the primer alignment position and the expected species to
be amplified suggesting that the unspecific amplification is due to conditions within the
PCR and not the target sequence. The strength of the amplified product observed for C.
dubia compared to other species tested suggests that further investigation of MgCl2
concentrations between 1.5mM and 3mM in the temperature range 48-62ºC could be
tested.
105
The target region of SSP 9 was similarly analysed via the sequencing data to confirm
primer alignment, design and expected amplified species. As no unexpected variations
were observed, it suggests, as with SSP 1b, that the problem exists with the conditions of
the PCR. Further testing of the temperature in the range of 58-60ºC and MgCl2
concentration of 1.5-3mM may have prevented the amplification of L. sericata and thus
resulted in optimisation of the primer.
The noted intra-specific variation found in L. sericata, occurs mainly at the 5‟ end of the
sequence and at sites of diagnostic inter-specific variation for the other species. The
intra-specific variation has previously been observed within the COI region of the Lucilia
complex, and has the potential to be applicable to forensic entomology. Potential
research could be conducted to determine the degree of variation within the species and
whether the observed variations are specific to geographical regions. If the variation
were geographically specific specimens could be traced back to a specific site instead of a
region such as Western Australia.
106
Chapter 5
Development Of Two Multiplex SSP-PCR Assays
For The Identification Of Forensically Important
Calliphoridae.
107
5.1 Introduction
Multiplex PCR is a variant of the standard PCR, whereby multiple primer pairs are used
instead of a single primer pair. The advantage of this technique is the considerable time,
resources and effort that can be saved. Multiplex PCR has been used as a tool for the
identification of viruses (Heredia et al., 1996), bacteria (Malkawi et al., 2003 and
Kawaguchi et al., 2005), parasites (Orlandi et al., 2003) and insects (Pavan et al., 2007
and Dang et al., 2005, Phuc et al., 2003, Kengne et al., 2001 and Noel et al., 2004).
Within the realm of forensic science the utilisation of the multiplex PCR technique has
become more frequent. The most common application of the multiplex PCR within
forensic science has been in relation to wildlife forensics. This has included the the
prevention of illegal trade, via the identification of endangered species (Frasier et al.,
2006), threatened species (McInnes et al., 2005) and identification of fish species for
fishing regulations (Marshall et al., 2006).
The limitations for this technique is the extensive optimisation of all reagents and
conditions required within the multiplex PCR. Though the same reagents are used both
in the standard and the multiplex PCRs, the reagents influence on the reaction can vary.
The conditions that need to be optimised include the primer-template concentration,
MgCl2 concentration, dNTP concentration and the annealing temperature.
Primer-template concentration is very important as it can affect the efficiency, specificity,
reaction sensitivity, preferential amplification and the formation of primer-dimers
(Markoulatos et al., 2002). If the primer-template ratio is too high the primer will anneal
to itself instead of the template, resulting in the formation of primer-dimers.
Alternatively if the primer-template ratio is too low, re-synthesis of the template will
occur after denaturation, reducing the amount of primer attachment and resulting in a
decrease of the overall yield of the reaction.
To prevent the preferential amplification of one primer over another, optimisation of the
primer concentration is essential. It is recommended by Henegariu (1997) that equimolar
108
amounts of primer should be used in initial optimisation tests. After identification of
weak and strong primers within a multiplex PCR the concentrations can be altered
accordingly.
The concentration of the dNTP and MgCl2 are important during the multiplex PCR
optimisation. If the concentration of dNTPs is too high the overall yield of the reaction
will be inhibited, whereas if the concentration is too low, the overall yield will be reduced
(Henegariu et al., 1997). It is recommended by Henegariu (1997) that the concentration
of dNTPs should be between 100µM and 500µM. The concentration of the MgCl2
affects the activity of the dNTPs, Taq DNA polymerase, template and the primers. If the
Mg++
is in excess the double-stranded DNA will be stabilised preventing denaturation,
resulting in overall reduced yield of the reaction (Markoulatos et al., 2002). If
alternatively the concentration of the MgCl2 is too low the product yield will be reduced
(Markoulatos et al., 2002).
As with standard PCR, the annealing temperature is important and can be difficult to
optimise. The optimal annealing temperature required within single primer reactions can
be reduced by up to 4ºC or 6 ºC for successful amplification (Henegariu et al., 1997).
This can be important if the primers intended for multiplexing vary slightly in their
annealing temperatures.
Reagents used within multiplex PCRs are more susceptible to loss of stability and
efficiency, and care must be taken with their use. All reagents utilised must be
thoroughly mixed to ensure total distribution of chemicals. The dNTPs used in the
multiplex PCR are susceptible to loss of stability through the continual freezing and
thawing of the reagent. It is recommended by Henegariu (1997) that aliquots of dNTPs
be made to ensure the stock dNTPs integrity is maintained as the dNTPs can only be
frozen and thawed no more than 3 or 4 times.
109
5.2 Methods
5.2.1 DNA Extraction
DNA was extracted from C. dubia (Macquart), Ch. rufifacies (Macquart), C. albifrontalis
(Malloch), Ch. megacephala (Fabricius) and L. sericata (Meigen) using the Qiagen
DNeasy Tissue Kit as described by Harvey (2006) with some modifications as specified
in Chapter 3. DNA Extraction method DNA samples was performed as described in
Chapter 3 and the Appendix 1. Purity of DNA samples was confirmed via the 260/280
ratio using a spectrophotometer (Appendix 2).
5.2.2 Primers
Six optimised SSP primer pairs from Chapter 4 (SSP 2b, SSP 4b, SSP 5b, SSP 6b, SSP
7b and SSP 8) were utilised in the development of the two multiplex PCRs.
Extracted DNA quality was confirmed using the forward primer C1-J-1718 (5‟
GGAGGATTTGGAAATTGATTAGTTCC 3‟) (Simon et al., 1990) and the reverse
primer TL2-N-3014 (5‟ TCCAATGCACTAATCTGCCATATTA 3‟) (Simon et al.,
1994) producing a fragment of 1270bp in length (Figure 4.1).
5.2.3 Multiplex PCR
Multiplex PCR master-mix conditions were followed from the Qiagen Multiplex PCR
handbook. Final multiplex PCR mix consisted of: 25µl of Qiagen multiplex PCR master-
mix, 3µl of each primer (2µM), 3µl (< 1 µg DNA/50µl) of template DNA and made-up to
50µl with RNase-free water.
All PCRs were performed using the BioRad iCycler or GeneAmp PCR system 2700
(Applied Biosystems). Cycling conditions were 95ºC for 15 minutes initial activation
step, followed by 36 cycles of 94ºC for 30 seconds denaturation, annealing temperature
(refer to Table 5.1) for 90 seconds and extension at 72ºC for 90 seconds. A final
extension period of 72ºC for 10 minutes was used followed by holding at 4ºC.
110
5.3 Results and Discussion
The original aim of this thesis was the development of a single multiplex PCR for the
identification of forensically important Calliphoridae. Subsequent to optimisation of the
individual SSP primer pairs, SSP pairs were analysed for potential multiplexing. After a
review of the annealing temperatures it was found that a range of 12ºC was present
between the SSP primer pairs (Table 4.2). It became apparent that a single multiplex
PCR would be implausible and alternatively two multiplex PCRs were designed.
Multiplex PCR 1 was developed to include SSP 4b, 5b, 6b and 8, which has a
temperature range from 58ºC to 62ºC and would result in an identifiable band fragment
for C. albifrontalis, Ch. megacephala, Ch. rufifacies and L. sericata. Multiplex PCR 2
will be developed with SSP 2b and 7b, which have annealing temperatures of 50ºC and
52ºC respectively and produce bands for C. dubia and Ch. rufifacies. In the development
of two multiplex PCRs it was essential that all test species were amplified by the
presence of at least one and preferably multiple fragments and all fragments were of
equal intensity.
Multiplex PCR 1 was initially tested to include SSP pairs 4b, 5b, 6b and 8. The expected
fragment sizes and species are represented in Table 5.1. The only species not expected
to amplify with Multiplex PCR 1 is C. dubia. Due to the difficulties associated with
optimisation of multiplex PCRs, initial testing of SSP pairs was done using the Qiagen
Multiplex PCR kit.
111
Table 5.1: SSP pairs associated with each multiplex PCR and the expected species and
fragment lengths to be amplified.
Multiplex PCR 1 Multiplex PCR 2
Primer Name SSP 4b SSP 5b SSP 6b SSP 8 SSP 2b SSP 7b
Expected Fragment Size (bp) 1100-1400 300-370 770-820 770-850 550-600 650-700
Optimised Annealing Temperature of Individual SSP pairs (ºC) (Tm) 58 60 62 60 50 52
Species
C. albifrontalis X
C. dubia X X
Ch. megacephala X
Ch. rufifacies X X
L. sericata X X
During initial testing it became clear that SSP 4b could not be amplified. To alleviate
this the primer concentration of SSP 4b was increased to 50pmol, and the annealing
temperature tested was varied from 58ºC to 62ºC at 2ºC increments, yet no product was
visible. A possible reason for the SSP 4b primers‟ inability to amplify could be due to
degradation of stock primer solution. To confirm this a repeat optimisation test was run,
where SSP 4b produced the expected clear band for L. sericata at approximately 1100-
1400bp in length (Figure 5.1), which established that the SSP 4b primer stock solution
was not degraded. The weak amplification and the large product size of SSP4b suggest
that further optimisation of the singleplex reaction should be conducted. Possible
alterations include increasing the amount of DNA added to 5µl or increasing the
extension time within the PCR from 90 seconds to 2 minutes, to compensate for the large
fragment size. Regrettably due to the inability of the SSP 4b primer to produce a
fragment and that L. sericata could also be identified by SSP 6b, SSP 4b was removed
from further multiplex testing.
112
1 2 3 4 5 6 7
1100bp
400bp
100bp
Figure 5.1: Electrophoresis gel image for the confirmation of SSP 4b primer stock
solution at 58ºC. Lane 1 is the DNA molecular Ladder. Lane 2 is C. albifrontalis. Lane
3 C. dubia. Lane 4 is Ch. megacephala. Lane 5 is Ch. rufifacies. Lane 6 is L. sericata
and Lane 7 is the negative control sample. Arrows indicate the 100bp, 400bp and 1100bp
fragments.
Utilising only SSP pairs 5b, 6b and 8 multiplex PCR 1 was further optimised. Using the
Qiagen multiplex PCR kit the initial conditions were tested with equimolar amounts of
primer (30pmol) at 62ºC. These conditions resulted in the expected amplification for this
reaction (Figure 5.2) with all bands present at the expected length and species. C.
albifrontalis produced a single band between 770-850bp in length, C. dubia produced no
product, Ch. megacephala and Ch. rufifacies produced single bands at approximately
300-370bp in length and L. sericata produced a single band at 770-820bp in length.
These fragment lengths were confirmed within expected range using a standard curve
(Appendix 3).
113
1 2 3 4 5 6 7
1200bp
500bp
100bp
Figure 5.2: Gel electrophoresis image of multiplex PCR 1 at 62ºC using the Qiagen
multiplex PCR kit. Lane 1 is the DNA molecular ladder. Lane 2 is C. albifrontalis.
Lane 3 is C. dubia. Lane 4 is Ch. megacephala. Lane 5 Ch. rufifacies. Lane 6 is L.
sericata. Lane 7 is the negative control. Arrows indicate the 100bp, 500bp and 1200bp
fragments.
An underlying problem with multiplex PCR 1 was that Ch. megacephala and Ch.
rufifacies are both expected to produce an amplicon of 300-370bp, which indicates there
is no distinction between these species within this reaction. To identify the species
present subsequent sequencing would be required. The second multiplex PCR is
designed to only identify two species via the presence of a fragment, which are C. dubia
and Ch. rufifacies. If multiplex PCR 2 could be optimised it would provide the
distinction required between Ch. megacephala and Ch. rufifacies for specific
identification.
114
Multiplex PCR 2 utilises SSP 2b and SSP 7b and is expected to produce two amplicons
for C. dubia (559bp and 686bp) and a single amplicon for Ch. rufifacies (686bp). Using
the Qiagen Multiplex PCR kit, the initial condition tested included equimolar amounts of
primer (30pmol) at 50ºC. These conditions resulted in a single high intensity fragment
for C. dubia and Ch. rufifacies at 650-700bp in length (Figure 5.3). This result is due to
the amplification of SSP 7b. SSP 2b did not produce a fragment. To increase efficiency
of SSP 2b within the multiplex PCR the primer concentration was increased to 50pmol
and SSP 7b was reduced to 10pmol, yet the same result was produced. Further
optimisation testing was conducted including decreasing the annealing temperature to
48ºC and altering the amount of template DNA to 1µl, yet SSP 2b still failed to produce a
product. Alternatively increasing the DNA concentration should have been trial.
1 2 3 4 5 6 7
1000bp
500bp
100bp
Figure 5.3: Electrophoresis gel image of the Multiplex PCR 2 at 50ºC. Lane 1 is the
DNA molecular ladder. Lane 2 is C. albifrontalis. Lane 3 is C. dubia. Lane 4 is Ch.
megacephala. Lane 5 Ch. rufifacies. Lane 6 is L. sericata. Lane 7 is the negative
control. Arrows indicate the 100bp, 500bp and 1000bp fragments.
115
Due to the size of the amplicon exhibited by C. dubia within the multiplex PCR 2 it was
thought that SSP 2b and SSP 7b were not separating properly within a 2% agarose gel,
therefore the percentage was increased to 3% to determine if two bands were present.
The 3% agarose electrophoresis gel failed to indicate the presence of multiple bands.
This lack of amplification of SSP 2b after continual optimisation and separation attempts
suggests that SSP 2b is not binding to the template DNA sequence or that the primer has
degraded.
As with SSP 4b, SSP 2b was re-tested individually to determine the condition of the stock
primer solution (Figure 5.4). The expected species C. dubia and Ch. rufifacies both
amplified with a 550-600bp fragment, which confirmed that the primer stock had not
degraded and that an alternative reason must exist for the lack of amplification of SSP 2b.
An alternative reason is that SSP 2b is unable to maintain its specificity when in the
presence of SSP 7b. This is potentially due to the primers been designed relatively close
together, with SSP 7b exhibiting the greater specificity and therefore preventing
annealing of SSP 2b.
116
1 2 3 4 5 6 7
1100bp
500bp
100bp
Figure 5.4: Electrophoresis gel image for the confirmation of SSP 2b stock solution at
50ºC. Lane 1 is the DNA molecular ladder. Lane 2 is C. albifrontalis. Lane 3 is C.
dubia. Lane 4 is Ch. megacephala. Lane 5 Ch. rufifacies. Lane 6 is L. sericata. Lane 7
is the negative control. Arrows indicate the 100bp, 500bp and 1100bp fragments.
Though Multiplex PCR 2 was unable to be optimised in combination with multiplex PCR
1, every species can be identified. Additionally Ch. rufifacies is amplified by both
multiplex PCR 1 and SSP 7b and could therefore be distinguished from Ch. megacephala
allowing for identification of all species tested.
For this technique to be taken further an internal control should be added. This would
provide a secondary signal to indicate that the reaction functioned correctly and that the
fragments (present or absent) are an accurate representation of the results. Without the
internal control, lack of an amplified product (even if expected) cannot be confirmed, as
there is always potential for false negative results.
117
5.4 Conclusion
After reviewing the annealing temperatures of the individual SSP pairs it was determined
that two multiplex PCR would be developed. Multiplex PCR 1 was initially designed to
include SSP 4b, 5b, 6b and 8, yet after optimisation SSP 4b was removed and the final
multiplex PCR contained only SSP 5b, 6b and 8 (set-up has been summarised in
Appendix 5). The failure of SSP4 may be due to the large fragment size of 1204bp and
the relatively faint initial singleplex amplification that prevented it from working within
the multiplex. This could be resolved through further optimisation trials.
Multiplex PCR 2 was initially intended to contain SSP 2b and 7b, yet during optimisation
it became clear that the SSP 2b primer set did not amplify any products. The lack of
amplification may be the result of poor primer specificity when in the presence of SSP 7b
as primers were designed within a 100bp region. Possible future research would include
designing a new primer set in a different region of the COI, to replace SSP 2b within the
multiplex.
Ultimately only one Multiplex PCR could be fully optimised in the identification of three
forensically important Calliphoridae. With the additional PCR using SSP 7b, it is
possible for all test species to be identified by the presence of at least one specific
fragment.
118
Chapter 6
Discussion And Conclusions
119
The aim of this thesis was the development of a multiplex SSP PCR system for the
identification of forensically important Calliphoridae species. Molecular techniques for
the identification of forensically important arthropods have greatly advanced and are now
considered more reliable than traditional taxonomic identification. DNA-based
techniques are fast, reliable, reproducible and do not require extensive training or
knowledge to apply. The purpose of this thesis was to develop an existing preliminary
study on SSP pairs as a means of identification of forensically important Calliphoridae
and improve on this technique by developing it into a multiplex PCR. The advantage of
this would be a cost-effective, time, and effort efficient technique, which is still reliable
and reproducible. To accomplish this the following steps were followed; i) optimisation
of preliminary designed SSP pairs by Harvey (2006); ii) re-design of sub-optimal SSP
pairs to increase specificity and binding efficiency; iii) optimisation of newly designed
and re-designed SSP pairs; and iv) development of multiplex PCR using optimised SSP
pairs.
SSP utilise unique base pairs at the 3‟ end to identify between different species Harvey
(2006) used this idea to develop 7 SSP pairs (SSP 1, 2, 3, 4, 5, 6 and 7) for the
identification of 5 species and 3 species complexes of forensically important
Calliphoridae. These SSP pairs were known to be sub-optimal and the original aim of
this thesis was to optimise, and re-design where required, these primer pairs for
subsequent multiplex PCR. Re-design included the presence of a species-specific base at
the 3‟ end of the primer sequence of the SSP pairs, addition of a mismatch base pair at
the second position from the 3‟ end, suitable length and GC content and lack of
complementarity to itself and other primers. Taking all these guidelines into
consideration 6 SSP pairs were re-designed (SSP 1b, 2b, 4b, 5b, 6b and 7b) and 2 SSP
pairs were newly designed (SSP 8 and 9) for the identification of 5 forensically important
Calliphoridae species (C. albifrontalis, C. dubia, Ch. megacephala, Ch. rufifacies and L.
sericata).
Optimisation is the process of testing the reaction variables until the expected result is
obtained. Conditions altered included MgCl2 concentration, primer concentration and
120
annealing temperature. Of the 8 re-designed and new SSP pairs tested only 6 could be
optimised (2b, 4b, 5b, 6b, 7b and 8) and therefore utilised in the development of a
multiplex PCR. The two primers removed from further testing were SSP 1b and SSP 9,
both of which failed to be optimised by altering only the annealing temperature. Analysis
of the sequence data showed no unexpected variation, therefore suggesting that the
problem with amplification lies within the PCR conditions. Further testing taking into
consideration alternative parameters such as MgCl2 concentration over ranging
temperatures may result in the optimisation of these primers.
Multiplex PCR is a variant of the standard PCR where instead of using a single primer
pair, multiple primer pairs are utilised. The advantage of this technique is that it is both
cost-effective, due to the reduced amount of reagents required to perform a reaction and
also time and effort efficient due to the requirement of only a single reaction. After
reviewing the annealing temperatures obtained from the individual SSP results, it was
deemed implausible to produce a single multiplex PCR to be designed, and alternatively
two would be developed.
Multiplex PCR 1 originally contained SSP 4b, 5b, 6b and 8, yet after optimisation
attempts SSP 4b was removed from testing. The final multiplex PCR 1 utilised SSP 5b,
6b and 8 at 62ºC for the amplification of C. albifrontalis, Ch. megacephala, Ch. rufifacies
and L. sericata. SSP 4b was removed from the reaction due to lack of amplification
despite optimisation attempts. Possible reasons explaining the failure of the primer to
amplify within the multiplex include the large fragment size of 1204bp for SSP 4b and
the weak amplification of the singleplex product. Further optimisation as both a
singleplex and multiplex reaction utilising alternative parameters, such as MgCl2 and
DNA concentration and increased extension times should be considered in potential re-
trials of this study.
A potential problem associated with multiplex PCR 1 reaction was Ch. megacephala and
Ch. rufifacies both amplified a 350bp product. Therefore confirmation of species identity
could only be made through the use of multiplex PCR 2. The second multiplex PCR was
121
designed to amplify SSP 2b and 7b, for the identification of C. dubia and Ch. rufifacies.
After optimisation attempt it became clear that SSP 2b in the presence of SSP 7b was
unable to anneal to the template and produce a product. Potential further optimisation
attempts should include alternative parameters such as DNA and primer concentrations,
to alleviate the lack of amplification by SSP 2b. Alternatively as SSP 2b and SSP 7b are
located within a similar region of the COI target sequence, re-designing the primer in a
new region will potentially produce an optimal multiplex. Due to this lack of
amplification by SSP 2b multiplex PCR 2 could not be developed further.
Though it was originally intended that two multiplex PCRs would be designed and
optimised, identification of all species tested is still possible. Using the optimised
multiplex PCR 1 in combination with a single SSP 7b reaction it is possible for
identification of all species tested, including the separation of Ch. megacephala and Ch.
rufifacies. This would use the same amount of effort and resources required for two
multiplex PCR, and still allow for the identification of all species tested.
The forensic significance behind the potential of this technique lies in its efficiency and
accuracy of identification. Current technologies are aiming to develop markers for the
identification of a large range of entomologically related species, yet in terms of
efficiency it has become generally accepted that current technique including PCR and
sequencing provide a sufficient identification time. Forensic entomologists require this
initial identification, prior to subsequent testing and resulting conclusions. If the time
taken for an accurate identification is decreased, then so to is the time taken for the
determination of PMI, movement of corpse or evidence of neglect to be determined. By
improving the efficiency of specimen identification through multiplex PCR, the
application of entomology within forensic investigation could be greatly improved.
Future research that can be conducted to further this thesis would include the design and
testing of the proposed internal control to assist in the validation of the multiplex PCR
primer set. In addition, new primer sets could be designed to provide secondary markers
for the species tested, same species from different geographical regions (especially the
122
Eastern states of Australia) and also new species commonly encountered on corpse from
within Australia and around the world. This would allow for a more thorough
representation of the applicability of a multiplex PCR system and its potential to be easily
incorporated into the area of forensic entomology. Furthermore, research into the
observed intra-specific variation of L. sericata could be expanded to determine if
geographical placement of specimens is possible. The potential advantages this could
have to the area of forensic entomology would be significant in identifying where a crime
was committed and also in determining if movement of the body had occurred.
For this technique to be further developed and validated an internal control would be
helpful. An internal control co-amplifies within the reaction, allowing for distinction
between negatives and false negatives. A positive result from the internal control
indicates that amplification was not inhibited therefore validating a negative result. The
internal control could be within the target sequence, which for this thesis would have
been the COI gene or alternatively genes containing highly conserved domains such as
the D-loop (control region) or tRNA genes. It was originally intended during this study
that an internal control would be explored, as this would have provided a secondary
signal confirming the performance of the PCR. As this was not accomplished, the above
thesis is a representation of an attempted experimental improvement of the effectiveness
of both SSP primer pairs as a means of identification and the potential use of multiplex
PCR in relation to forensically important Calliphoridae species.
123
Chapter 7
References
124
Amendt, J., Campobasso, C. P., Gaudry, E., Reiter, C., LeBlanc, H. N., and Hall, M. J. R.
(2007) Best practice in forensic entomology-standards and guidelines. Int. J. Legal. Med,
121, 90-104.
Ames, C., Turner, B., and Daniel, B. (2006) The use of mitochondrial cytochrome
oxidase I gene (COI) to differentiate two UK blowfly species – Calliphora vicina and
Calliphora vomitoria. Forensic Science International, 164, 179-182.
Arnaldos, M. I., Garcia, M. D., Romera, E., Presa, J. J., and Luna, A. (2005) Estimation
of postmortem interval in real cases based on experimentally obtained entomological
evidence. Forensic Science International, 149, 57-65.
Balogh, M. K., Burger, J., Bender, K., Schneider, P. M., and Alt, K. W. (2003) STR
genotyping and mtDNA sequencing of latent fingerprints on paper. Forensic Science
International, 137, 188-195.
Barker, D. F. (2000) Direct genomic multiplex PCR for BRCAI and application to
mutation detection by single-stranded conformation and heteroduplex analysis. Human
Mutations, 16, 334-344.
Bass, W. M. (1997) Outdoor decomposition rates in Tennessee. In Forensic Taphonomy:
The post-mortem fate of human remains, (Eds. Haglund, W. D., and Sorg, M. A). CRC
Press, Boston, 181-186.
Benecke, M. (1998) Random amplified polymorphic DNA (RAPD) typing of
necrophagous insecta (Diptera, Coleoptera) in criminal forensic studies: validation and
use in practice. Forensic Science International, 98, 157-168.
Benecke, M. (2001) A brief history of forensic entomology. Forensic Science
International, 120, 2-14.
125
Benecke, M., and Lessig, R. (2001b) Child neglect and forensic entomology. Forensic
Science International, 120, 155-159.
Benecke, M., Josephi, E., and Zweihoff, R. (2004) Neglect of the elderly: forensic
entomology cases and considerations. Forensic Science International, 146, 195-199.
Bombieri, C., Bonizzato, A., Castellani, C., Assael, B. M., and Pignatti, P. F. (2005)
Frequency of large CFTR gene rearrangements in Italian CF patients. European Journal
of Human Genetics: EJHG, 13(5), 687-689.
Byrd, J. H. and Castner, J. L. (2001) Forensic entomology the utility of arthropods in
legal investigations. CRC Press, New York, 43-81.
Cagliani, R., Sironi, M., Ciafaloni, E., Bardoni, A., Fortunato, F., Prelle, A., Serafini, M.,
Bresolin, N., and Comi, G. P. (2004) An intragenic deletion/inversion event in the DMD
gene determines a novel exon creation and results in a BMB phenotype. Human Genetics,
115(1), 13.
Campobasso, C. P., Vella, G. D., and Introna, F. (2001) Factors affecting decomposition
and Diptera colonization. Forensic Science International, 120, 18-27.
Catts, E. P., and Haskell, N. H. (1990) Entomology and death. A procedural guide.
Joyce‟s Print Shop Inc. USA, 9-37.
Clague, H. D., Fung, Y. L., and Minchinton, R. M. (2003) Human neutrophil antigen-4a
gene frequencies in an Australian population, determined by a new polymerase chain
reaction method using sequence specific primers. Transfusion Medicine, 13, 149-152.
Dadour, I. R., Cook, D. F., Fissioli, J. N., and Bailey, W. J. (2001) Forensic entomology:
application, education and research in Western Australia. Forensic Science International,
120, 48-52.
126
Dang, X. L., Wen, S. Y., He, X. F., and Pang, X. F. (2005) M-PCR: a powerful method
for rapid molecular identification of Trichogramma wasps (Hymenoptera:
Trichogrammatidae). Insect Science, 12, 77-85.
Dix, J., and Graham, M. (2001) Time of death, decomposition and identification An atlas.
CRC Press, London, 1.
DuPonte, M. W and Larish, L. B. (2003) Oriental blow fly. Livestock Management Insect
Pests, 1.
Erlich, H. (1993) How to optimize, modify and/or troubleshoot PCR reactions. Clinical
Immunology, 13 (12), 163.
Erzinclioglu, Z. (2000) Maggots, murder and men. Memories and reflections of a forensic
entomologist. Harley Book, England, p 23.
Fettene, M., Kockemoer, L., Hunt, R. and Coetzee, M. (2002) PCR assay for
identification of Anopheles quadriannulatus species B from Ethiopia and other sibling
species of the Anopheles gambiae complex. Medical and Veterinary Entomology, 16,
214-217.
Frankie, G. W., and Koehler. (1978) Perspectives in urban entomology. Academic Press,
New York, ix.
Frasier, T. R., Rastogi, T. R., Brown, M. W., Hamilton, P. K., Kraus, S. D., and White, B.
N. (2006) Characterisation of tetranucleotide microsatellite loci and development and
validation of multiplex reaction for the study of right whale species (genus Eubalaena).
Molecular Ecology Notes, 6, 1025-1029.
127
Galloway, A., Birkby, W. H., Jones, A. M., Henry, T. E., and Parks, B. O. (1989) Decay
rates of human remains in an arid environment. Journal of Forensic Science, 34, 607-
616.
Gelfand, D. H. (1989) Taq DNA polymerase. In PCR technology. Principles and
applications for DNA amplification (Ed Erlich, H. A) M Stockton Press, New York, 17-
23.
Glick, B. R. and Pasternak, J. J. (2003) Molecular biotechnology. Principles and
applications of recombinant DNA. Third edition. ASM Press, Washington D.C. 23-42.
Goff, M. L. (2000), A fly for the prosecution. How insect evidence helps solve crimes.
Harvard University Press, Cambridge, p52.
Gonzalez, S., Rodriguez-Rodero, S., Martinez-Borra, J., Lopez-Vazquez, A., Rodrigo, L.,
and Lopez-Larrea, C. (2003) MICB typing by PCR amplification with sequence specific
primers. Immunogenetics, 54, 850-855.
Goswami, G., Raghavendra, K., Nanda, N., Gakhar, S. K., and Subbarao, S. K. (2005)
PCR-RFLP of mitochondrial cytochrome oxidase subunit II and ITS2 of ribosomal DNA:
Markers for the identification of members of the Anopheles cullicifacies complex
(Diptera: Culicidae). Acta Tropica, 95, 92-99.
Grahn, A., Elmgren, A., Aberg, L., Svensson, L., Jansson, P., Lonnroth, P., and Larson,
G. (2001) Determination of Lewis FUT3 gene mutation by PCR using sequence-specific
primers enables efficient genotyping clinical samples. Human Mutation, Mutation In
Brief, 450, 1-8.
Griffith, A. J. F., Wessler, S. R., Lewontin, R. C., Gelbart, W. M., Suzuki, D. T. and
Miller, J. H. (2005) Introduction to genetic analysis. Eighth edition. W. H. Freeman and
Company, New York, 227-255.
128
Gunn, A. (2006) Essential Forensic Biology. John Wiley &Sons, Ltd. England, 14-18.
Gunson, R., Gillespie, G., and Carmen, W. F. (2003) Optimisation of PCR reactions
using primer chessboarding. Journal Of Virology, 26, 369-373.
Hale, W. G., Margham, J. P. and Saunders, V. A. (1994) Collins dictionary of biology.
Second edition. Harper Collins Publishers, Glasgow, 214, 411.
Hall, R. D. (2001) Introduction: Perceptions and status of forensic entomology. In
Forensic Entomology. The utility of arthropods in legal investigations (Eds. Byrd, J. H.,
and Castner, J. L). CRC Press, New York, 1-16.
Harvey, M., Dadour, I. and Gaudieri, S. (2003) Mitochondrial DNA cytochrome oxidase
I gene: potential for distinction between immature stages of some forensically important
fly species (Diptera) in Western Australia. Forensic Science International, 131, 134-139.
Harvey, M. (2006) Thesis; A molecular study of the forensically important Calliphoridae
(Diptera): Implications and applications for the future of forensic entomology. University
of Western Australia.
He, L., Wang, S., Miao, X., Wu, H., and Huang, Y. (2007) Identification of necrophagous
fly species using ISSR and SCAR markers. Forensic Science International, 168, 148-
153.
Henegariu, O., Heerema, N. A., Dlouhy, S. R., Vance, G. H., and Vogt, P. H. (1997)
Multiplex PCR: Critical parameters and step-by-step protocols. Bio Techniques, 23, 504-
511.
Heredia, A., Soriano, V., Weiss, S. H., Bravo,R., Valleju, A., Denny, T. N., Epstein, J. S.,
and Hewlett, K. (1996) Development of a multiplex PCR assay for the simultaneous
129
detection and discrimination of HIV-1, HIV-2, HTLV-I and HTLV-II. Clinical and
Diagnostic Virology, 7, 85-92.
Hoy, M. A. (1994) Insect molecular genetics. An introduction to principles and
applications. Academic Press, New York, 201-212.
Hurley, C. K. and Kukuruga, D. (1993) How to design and optimize PCR primers and
sequence-specific oligonucleotide probes for DNA typing. Clinical Immunology, 13(12),
157-163.
Junqueira, A. C. M., Lessinger, A. C., Torres, T. T., da Silva, F. R., Vettore, A. L.,
Arrunda, P., and Azeredo Espin, A. M. L. (2004) The mitochondrial genome of the
blowfly Chrysomya chloropyga (Diptera: Calliphoridae). Gene, 339, 7-15.
Kambhampati, S., and Smith, P. T. (1995) PCR primers for the amplification of four
insect mitochondrial gene fragments. Insect Molecular Biology, 4(4), 233-236.
Kampne, H., Sternberg, A., Proft, J., Bastian, S., Schaffner, F., Maier, W. and Seitz, H.
(2003) Polymerase chain reaction based differentiation of the mosquito sibling species
Anopheles claviger s.s. and Anopheles petragnami (Diptera: Culicidae). American
Journal of Tropical Medicine and Hygiene, 69, 195-199.
Kawaguchi, A., Sawada, H., Inoue, K., and Nasu, H. (2005) Multiplex PCR for the
identification of Agrobacterium biovar 3 strains. Journal of Genetic Plant Pathology, 71,
54-59.
Kengne, P., Trung, H. D., Baimai, V., Coosemans, M., and Manguin, S. (2001) A
multiplex PCR-based method derived from random amplified polymorphic DNA
(RAPDS) markers for the identification of species of the Anopheles minimus group in
Southeast Asia. Insect Molecular Biology, 10(5), 427-435.
130
Kumar, P. L., Fenton, B., and Jones, A. T. (1999) Identification of Cecidophyopsis mites
(Acari: Eriophyidae) based on variable simple sequence repeats of ribosomal DNA
internal transcribed spacer-1 sequence via multiplex PCR. Insect Molecular Biology 8(3),
347-357.
Kwok, S., Chang, S. Y., Sninsky, J. J., and Wang, A. (1994) A guide to the design and
use of mismatched and degenerate primers. PCR Methods Appl. 3, 39-47.
Lawyer, F. C., Stoffel, S., Saiki, R. K., Chang, S., Landre, P. A., Abramson, R. D and
Gelfand, D. H. (1993) High-level expression, purification, and enzymatic characterization
of full-length Thermus aquaticus DNA polymerase and a truncated form deficient in 5‟ to
3‟ exonuclease activity. PCR Methods Appl. 2 (4), 275-287.
Lessinger, A. C., and Azeredo-Espin, M. L. (2000) Evolution and structural organisation
of mitochondrial DNA control region of myiasis-causing flies. Medical and Veterinary
Entomology, 14, 71-80.
Lunt, D., Zhang, D. X., Szymura, J. and Hewitt, G. (1996) The insect cytochrome
oxidase I gene: evolutionary patterns and conserved primers for phylogenetic study.
Insect Molecular Biology, 5, 153-165.
Ma, Y., Li, S., and Xu, J. (2006) Molecular identification and phylogeny of the
Maculatus group of Anopheles mosquitoes (Diptera: Culicidae) based on nuclear and
mitochondrial DNA sequences. Acta Tropica, 99(2-3), 272-280.
Malgorn, Y. and Coquoz, R. (1999) DNA typing for identification of some species of
Calliphoridae: an interest in forensic entomology. Forensic Science International, 102,
111-119.
131
Malkawi, H. I., and Gharaibeh, R. (2003) Multiplex PCR for the direct detection of
Salmonella enterica from chicken, lamb and beef food products. Journal of Basic
Microbiology, 4, 328-336.
Manonmani, A., Townson, H., Adeniran, T., Jambulingam, P., Sahu, S. and Vijayakumar,
T. (2001) rDNA-ITS2 polymerase chain reaction assay for the sibling species Anopheles
fluviatilis. Acta Tropica, 78, 3-9.
Markoulatos, P., Siafakas, N., and Moncany, M. (2002) Multiplex polymerase chain
reaction: A practical approach. Journal Of Clinical Laboratory Analysis, 16, 47-51.
Marshall, H.D., Johnstone, K.A. and Carr, S.M. (2007) Species-specific oligonucleotides
and multiplex PCR for forensic discrimination of two species of scallops, Placopecten
magellanicus and Chlamys islandica. Forensic Science International, 167 (1), 1-7.
McInnes, L. M., Dadour, I. R., Stewart, M. E., Ditcham, W. G. F., Mawson, D., and
Spencer, P. B. S. (2005) Characterisation of polymorphic microsatellite markers for the
Carnaby‟s cockatoo (Calyptor hynchus latirostris) and related black cockatoo species.
Molecular Ecology Notes, 5, 504-506.
Morin, N. J., Gong, Z., and Li, X. F. (2004) Reverse transcription-Multiplex PCR assay
for simultaneous deletion of Escherichia coli 0157:H7, Vibrio cholerae O‟, and
Salmonella typhi. Clinical Chemistry, 50(11), 2037-2045.
Nei, M. (1996) Phylogenetic analysis in molecular evolutionary genetics. Annuals
Reviews of Genetics, 30, 371-403.
Noel, S., Tessier, N., Angers, B., Wood, D.M. and Lapointe, F. -J. (2004) Molecular
identification of two species of myiasis causing Cuterebra by multiplex PCR and RFLP.
Medical and Veterinary Entomology, 18, 161-166.
132
Ota, M., Shimada, K., Asamura, H., Takayanagi, K., Katsuyama, Y., and Fukushima, H.
(2006) Validation of sensitive human leukocyte antigen-sequence-specific primer and
probe typing in forensic DNA examination. Legal Medicine, 8, 203-209.
Orlandi, P. A., Carter, L., Brinker, A. M., da Silva, A. J., Chu, D. M., Lampel, K. A., and
Monday, S. R. (2003) Targeting single-nucleotide polymorphisms in the 18S rRNA gene
to differentiate Cyclospora species from Eimeria species by multiplex PCR. Applied and
Environmental Microbiology, 69(8), 4806-4813.
Otranto, D., and Stevens, J. R. (2002) Molecular approaches to the study of myiasis-
causing larvae. International Journal for Parasitology, 32, 1345-1360.
Pantelidis, P., Lambert-Hammill, M., and Wierzbicki, A. S. (2003) Simple sequence-
specific-primer-PCR method to identify the three main apolipoprotein E haplotypes.
Clinical Chemistry, 49(11), 1945-1948.
Pavan, M. G., and Monteiro, F. A. (2007) A multiplex PCR assay that separates Rhodnius
prolixus from members of the Rhodnius robustus cryptic species complex (Hemiptera:
Reduviidae). Tropical Medicine and International Health, 12(6), 751-758.
Phuc, H., Ball, A., Son, L., Hanh, N., Tu, N., Lien, N., Verardi, A. and Townson, H.
(2003) Multiplex PCR assay for malaria vector Anopheles minimus and four related
species in the Myzomyia series from Southeast Asia. Medical and Veterinary
Entomology, 17, 423-428.
Pizzamiglio, M., Mameli, A., My, D., and Garofano, L. (2004) Forensic identification of
a murder by LCN DNA collected from the inside of the victims car. International
Congress Series, 1261, 437-439.
Ramose de Pablo, R., Salona, M., Sarasola, E., Cardoso, S., and Martinez de Pancorbo,
M. (2006) Molecular identification of Stearibia nigriceps: An examples of the usefulness
133
of cytochrome b gene for the identification of entomofauna species. International
Congress Series, 1288, 864-868.
Ratcliffe, S. T., Webb, D. W., Weinzievr, R. A., and Robertson, H. M (2003) PCR-RFLP
identification of Diptera (Calliphoridae, Muscidae and Sarcophagidae) - A generally
applicable method. Journal of Forensic Science, 48(4), 1-3
Rees, D. (2004) Insects of stored products. Manson Publishing, Victoria, 1-6.
Ridgwell, K. (2004) Genetic tools: PCR and sequencing. Vox Sanguinis, 87, 6-12.
Rudin, N., and Inman, K. (2002). An Introduction to Forensic DNA Analysis Second
Edition. CRC Press LLC, London.
Rychlik, W., Spencer, W. J., and Rhoads, R. E. (1990) Optimization of the annealing
temperature for DNA amplification in vitro. Nucleic Acid Research, 18 (21), 6409-6412.
Saigusa, K., Takamiya, M., and Aoki, Y. (2005) Species identification of the forensically
important flies in Iwate prefecture, Japan based on mitochondrial cytochrome oxidase
gene sub-unit I (COI) sequence. Legal Medicine, 7, 175-178.
Saiki, R. K. (1989) The design and optimisation of the PCR In PCR technology.
Principles and applications for DNA amplification (Ed Erlich, H. A). Stockton Press,
U.S.A, 7-16.
Schroeder, H., Klotzbach, H., Elias, S., Augustin, C. and Pueschel, K. (2003) Use of
PCR-RFLP for differentiation of calliphorid larvae (Diptera, Calliphoridae) on human
corpses. Forensic Science International, 132, 76-81.
Sharrocks, A. D. (1994) The design of primers for PCR. In PCR technology, current
innovations (Eds. Griffin, H. G., and Griffin, A. M). CRC Press, London, 5-9.
134
Simon, C. (1990) In Molecular Techniques in Taxonomy, Vol 57 (Eds. Hewitt, G.M.,
Johnston, A.W.B. and Young, J.P.W.) Springer-Verlag, Berlin, pp. 33-71.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. and Flook, P. (1994) Evolution,
weighting and phylogenetic utility of mitochondrial gene-sequences and a compilation of
conserved polymerase chain-reaction primers. Annals of the Entomological Society of
America, 87.
Smith, K. G. V. (1986) A manual of forensic entomology. Cornell University Press,
Ithaca.
Stevens, J., and Wall, R. (2001) Genetic relationship between blowflies (Calliphoridae)
of forensic importance. Forensic Science International, 120, 116-123.
Stevens, J. R., Wall, R., and Wells, J. D. (2002) Paraphyly in Hawaiian hybrid blowfly
populations and the evolutionary history of anthropophilic species. Insect Molecular
Biology, 11(2), 141-148.
Stevens, J. R. (2003) The evolution of myiasis in blowflies (Calliphoridae). International
Journal of Parasitology, 33, 1105-1113.
Stewart, J. B., and Beckenbach, A. T. (2003) Phylogenetic and genomic analysis of the
complete mitochondrial DNA sequence of the spotted asparagus beetle Crioceris
duodecimpunctata. Molecular Phylogenetics and Evolution, 26(3), 513-526.
Suggs, S. V., Hirose, T., Miyake, E. H., Kawashima, M. J., Johnson, K. I. and Wallace,
R. B. (1981) Using purified genes, in ICN-UCLA. Symp. Developmental Biology, 23,
683.
135
Sukontason, K., Sukontason, K. L., Piangjai, S., Boonchu, N., Chaiwong, T., Ngern-
Klun, R., Sripakdee, D., Vogtsberger, R. C., and Olson, J. (2004a) Antennal sensilla of
some forensically important flies in families Calliphoridae, Sarcophagidae and Muscidae.
Micron, 35, 67-679.
Sukontason, K., Sukontason, K. L., Piangjai, S., Boonchu, N., Kurahashi, H., Hope, M.,
and Olson, J. (2004b) Identification of forensically important fly eggs using potassium
permanganate staining technique. Micron, 35, 391-395.
Sukontason, K. L., Narongchai, P., Kanchai, C., Vichairat, K., Piangjai, S., Boonsriwong,
W., Bunchu, N., Sripakdee, D., Chaiwong, T., Kuntalue, B., Siriwattanarungsee, S., and
Sukontason, K. (2006) Morphological comparison between Chrysomya rufifacies
(Macquart) and Chrysomya villeneuvi Patton (Diptera: Calliphoridae) puparia,
forensically important blow flies. Forensic Science International, 164, 230-234.
Sukontason, K. L., Bunchu, N., Chaiwong, T., Kuntalue, B., and Sukontason, K. (2007)
Fine structure of the eggshell of the blowfly, Lucilia cuprina. Journal of Insect Science, 7
(9), 1-8.
Tobin, A. J. and Morel, R. E. (1997) Asking about cells. Saunders College Publishing,
New York, 332-355.
Vidal, J. R., Delavault, P., Coarer, M. and Defontaine, A. (2000) Design of grapevine
(Vitis Vinifera L.) cultivar-specific SCAR primers for PCR fingerprinting. Theory of
Applied Genetics, 101, 1194-1201.
Wallman, J. and Donnellan, S. (2001) The Utility of mitochondrial DNA sequences for
the identification of forensically important blowflies (Diptera: Calliphoridae) in
Southeast Australia. Forensic Science International, 120, 60-67.
136
Withrow, A. G., Sikorsky, J., Downs, J. C. U., and Fenger, T. (2003) Extraction and
analysis of human nuclear and mitochondrial DNA from electron beam irradiated
envelopes. Journal of Forensic Science, 48, 1302-1308.
Wells, J. and Sperling, F. (2001) DNA-based identification of forensically important
Chrysomyinae (Diptera: Calliphoridae). Forensic Science International, 120, 110-115.
Zehner, R., Amendt, J., Schutt, S., Sauer, J., Krettek, R., and Povolny, D. (2004) Genetic
identification of forensically important flesh flies (Diptera: Sarcophagidae). Int. J. Legal.
Med, 118, 245-247.
137
APPENDICIES
138
APPENDIX 1
Purification of genomic DNA from insects, using the DNeasy Tissue Kit.
1. Place up to 50mg insects in 1.5ml microcentrifuge tube.
2. Add 180µl PBS (Phosphate Buffered Saline) and homogenize the sample using an
electric homogenizer or a disposable microtube pestle.
3. Add 30µl proteinase K and 200µl Buffer AL to the sample, mix thoroughly by
vortexing, and incubate at 70ºC for 10 minutes.
4. Add 200µl ethanol (96-100%) to the sample, and mix thoroughly by vortexing.
5. Pipet the mixture from step 4 (including any precipitate) into the DNeasy Mini
spin column placed in a 2ml collection tube. Centrifuge at >6000 x g (8000rpm)
for 1 minute. Discard the flow-through and collection tube.
6. Place the DNeasy Mini spin column in a new 2ml collection tube, add 500µl
Buffer AW1, and centrifuge for 1 minute at >6000 x g (8000rpm). Discard flow-
through and collection tube.
7. Place the DNeasy Mini spin column in a new 2ml collection tube, add 500µl
Buffer AW2, and centrifuge for 3 minutes at 20,000 x g (14,000rpm) to dry the
DNeasy membrane. Discard flow-through and collection tube.
8. Place the DNeasy Mini spin column in a clean 1.5ml or 2ml microcentrifuge tube
and pipet 100µl Buffer AE directly onto the DNeasy membrane. Incubate at
room temperature for 1 minute, and the centrifuge for 1 minute at 6000 x g
(8000rpm) to elute.
9. Repeat elution once as described in step 8. Purified DNA is stored at -20ºC until
required.
139
Extraction and purification of previously amplified DNA fragments using the Wizard SV
Gel and PCR Clean-Up systems.
1. Amplify target of choice using standard amplification conditions.
2. Add an equal volume of Membrane Binding Solution to the PCR reaction.
3. Place one SV Minicolumn in a collection tube for each PCR reaction.
4. Transfer the prepared PCR product to the SV Minicolumn assembly and incubate
for 1 minute at room temperature.
5. Centrifuge the SV Minicolumn assembly in a microcentrifuge at 16,000 x g
(14,000rpm) for 1 minute. Remove the SV Minicolumn from the Spin Column
assembly and discard the liquid in the collection tube. Return the SV Minicolumn
to the Collection Tube.
6. Wash the column by adding 700µl of Membrane Wash Solution, to the SV
Minicolumn. Centrifuge the SV Minicolumn assembly for 1 minute at 16,000 x g
(14,000rpm). Empty the collection tube as before and place the SV Minicolumn
back in the collection tube. Repeat the wash with 500µl of Membrane Wash
Solution and centrifuge the SV Minicolumn assembly for 5 minutes at 16,000 x g
(14,000rpm).
7. Remove the SV Minicolumn assembly from the centrifuge, being careful not to
wet the bottom of the column with the flow-through. Empty the collection tube
and recentrifuge the column assembly or 1 minute with the microcentrifuge lid
open to allow for the evaporation of residual ethanol.
8. Carefully transfer the SV Minicolumn to a clean 1.5ml microcentrifuge tube.
Apply 50µl of Nuclease Free Water directly to the centre of the column without
touching the membrane with the pipette tip. Incubate at room temperature for 1
minute. Centrifuge for 1 minute at 16,000 x g (14, 000rpm).
9. Discard the SV Minicolumn and store the microcentrifuge tube containing the
eluted DNA at 4ºC or -20ºC
140
APPENDIX 2
Table 8.1: Purity of newly extracted DNA samples prior to testing. Value measured is
the 268/280 ratios using the spectrophotometer. Expected ratio is 1.8, yet due to high
content of A and T within fly DNA sequence this ratio is increase to be between 2.1 and
2.4.
Extraction1 Extraction 2 Extraction 3
Species ng/µl 260/280 ratio ng/µl 260/280 ratio ng/µl 260/280 ratio
C. albifrontalis 20.4 2.35 43.3 2.35
C. dubia 44.7 2.17 23.3 2.08 140 2.17
Ch. megacephala 428.5 2.2 54.8 2.37 125.2 2.14
Ch. rufifacies 7 2.22 118.6 2.43
L. sericata 42.6 2.18 10.3 2.17
141
APPENDIX 3
Standard curve for DNA quality test using
universal COI primers
100
1000
10000
0 10 20 30 40 50 60 70 80 90 100 110
Distance from well (mm)
DN
A l
ad
de
r fr
ag
me
nt
siz
e (
bp
)
Data Points Line of Best Fit
Standard curve for determination of COI fragment sizes (Figure 4.1). Included are the
measurements of DNA ladder marker used to develop standard curve, equation for
determining unknown fragment length, R2 value, calculated fragment size and
confirmation of size within expected fragment size range.
Distance from well (mm)
DNA Ladder Fragment Size (bp)
46 1400
47.4 1300
49.5 1200
51.2 1100
53.5 1000
55.8 900
58.5 800
61.8 700
65.8 600
69.6 500
75.2 400
81.2 300
88.5 200
99 100
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
C. dubia 49.5 1225 1100-1300
Ch. megacephala 50.4 1174 1100-1300
Ch. rufifacies 49 1254 1100-1300
L. sericata 49.8 1208 1100-1300
Equation Y = 12737e-0.0473x
R2 Value R
2 = 0.9927
142
Standard curve for SSP 1b at 48oC
100
1000
10000
0 10 20 30 40 50 60 70 80
Distance from well (mm)
DN
A l
ad
de
r fr
ag
me
nt
siz
e (
bp
)
Data Points Line of Best Fit
Standard curve for determination of SSP 1b fragment sizes at 48ºC (Figure 4.2).
Included are the measurements of DNA ladder marker used to develop standard curve,
equation for determining unknown fragment length, R2 value, calculated fragment size
and confirmation of size within expected fragment size range.
Distance from well (mm)
DNA Ladder Fragment Size (bp)
30.5 900
32 800
34 700
36.2 600
39.5 500
43.6 400
49 300
57.5 200
66.4 100
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
C. albifrontalis 48.4 299 300-350
C. dubia 51.4 257 250-350
Ch. megacephala 33.6 726 700-750
36.5 613 600-650
40.5 485 450-500
46.6 340 300-350
49.4 289 250-300
57.2 183 150-200
66.5 106 100
Ch. rufifacies 46 352 300-350
66.2 108 100
L. sericata 45.8 356 300-350 Equation Y = 5150.2e
-0.0583x
R2 Value R
2 =0.9952
143
Standard curve for SSP 1b at 62oC
100
1000
10000
0 10 20 30 40 50 60 70 80
Distance from well (mm)
DN
A lad
der
frag
men
t siz
e (
bp
)
Data Points Line of Best Fit
Distance from well (mm)
DNA Ladder Fragment Size (bp)
51 200
43.4 300
38.4 400
34.2 500
31 600
28.6 700
26.8 800
25.2 900
24.8 1000
Equation Y= 3963.8e-0.0594x
R2 Value R
2 = 0.9929
Standard curve for determination of SSP 1b fragment sizes at 62ºC (Figure 4.3).
Included are the measurements of DNA ladder marker used to develop standard curve,
equation for determining unknown fragment length, R2 value, calculated fragment size
and confirmation of size within expected fragment size range.
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
C. dubia 40.8 351 300-350
C. albifrontalis 41.6 334 300-350
60.6 108 100
Ch. megacephala 60 112 100-150
Ch. rufifacies 43.5 299 300-350
59.4 116 100-150
L. sericata 59.2 117 100-150
144
Standard curve for SSP 2b at 50oC
100
1000
10000
0 10 20 30 40 50 60 70 80 90
Distance from well (mm)
DN
A l
ad
de
r fr
ag
me
nt
siz
e (
bp
)
Data Points Line of Best Fit
Standard curve for determination of SSP 2b fragment sizes at 50ºC (Figure 4.4).
Included are the measurements of DNA ladder marker used to develop standard curve,
equation for determining unknown fragment length, R2 value, calculated fragment size
and confirmation of size within expected fragment size range.
Distance from well (mm)
DNA ladder fragment size (bp)
43 1000
44 900
46.5 800
49.3 700
52.5 600
55.5 500
61 400
66 300
72 200
81.5 100
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
C. dubia 53.7 551 550-600
Equation Y = 11718e-0.0569x
R2 Value R
2 = 0.9918
145
Standard curve for SSP 4b at 58oC
100
1000
10000
0 10 20 30 40 50 60 70 80 90
Distance from well (mm)
DN
A l
ad
de
r fr
ag
me
nt
siz
e (
bp
)
Data Points Line of Best Fit
Distance from well (mm)
DNA ladder fragment size (bp)
33 1300
34.4 1200
36 1100
43 1000
44 900
46.5 800
49.3 700
52.5 600
55.5 500
61 400
66 300
72 200
81.5 100
Standard curve for determination of SSP 4b fragment sizes at 58ºC (Figure 4.5).
Included are the measurements of DNA ladder marker used to develop standard curve,
equation for determining unknown fragment length, R2 value, calculated fragment size
and confirmation of size within expected range.
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
L. sericata 34.7 1355 1100-1400
Equation Y = 7874.9e-0.0507x
R2 Value R
2 = 0.9759
146
Standard curve for SSP 5b at 60oC
100
1000
10000
0 10 20 30 40 50 60 70 80 90
Distance from well (mm)
DN
A lad
der
frag
men
t siz
e (
bp
)
Data Points Line of Best Fit
Standard curve for determination of SSP 5b fragment sizes at 60ºC (Figure 4.6).
Included are the measurements of DNA ladder marker used to develop standard curve,
equation for determining unknown fragment length, R2 value, calculated fragment size
and confirmation of size within expected range.
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
Ch. megacephala 62 308 300-370
Ch. rufifacies 62 308 300-370
Equation Y = 13388e-0.0608x
R2 Value R
2 = 0.992
Distance from well (mm)
DNA ladder fragment size (bp)
78.6 100
69.5 200
64.5 300
59 400
54.4 500
50.8 600
48.4 700
45.8 800
43.8 900
42.4 1000
147
Standard curve for SSP 6b at 62oC
100
1000
10000
0 10 20 30 40 50 60 70 80 90 100
Distance from well (mm)
DN
A lad
er
frag
men
t siz
e (
bp
)
Data Points Line of Best Fit
Distance from well (mm)
DNA ladder fragment size (bp)
86.8 100
76.2 200
69.8 300
63.2 400
58.2 500
54.6 600
50.8 700
48 800
45.5 900
43.8 1000
Standard curve for determination of SSP 6b fragment sizes at 62ºC (Figure 4.7).
Included are the measurements of DNA ladder marker used to develop standard curve,
equation for determining unknown fragment length, R2 value, calculated fragment size
and confirmation of size within expected range.
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
L. sericata 48 824 770-820
Equation Y = 9718.3e-0.0514x
R2 Value R
2 = 0.9929
148
Standard curve for SSP 7b at 52oC
100
1000
10000
0 10 20 30 40 50 60 70 80 90
Distance from well (mm)
DN
A l
ad
de
r fr
ag
me
nt
siz
e (
bp
)
Data Points Line of Best Fit
Standard curve for determination of SSP 7b fragment sizes at 52ºC (Figure 4.8).
Included are the measurements of DNA ladder marker used to develop standard curve,
equation for determining unknown fragment length, R2 value, calculated fragment size
and confirmation of size within expected range.
Distance from well (mm)
DNA ladder fragment size (bp)
79.6 100
70.4 200
64.8 300
59.4 400
54.5 500
51 600
48 700
45 800
43.3 900
41.6 1000
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
C. dubia 49.6 647 650-700
Ch. rufifacies 49.6 647 650-700
Equation Y = 11378e-0.0578x
R2 Value R
2 = 0.991
149
Standrd curve for SSP 8 at 60oC
100
1000
10000
0 10 20 30 40 50 60 70 80 90
Distance from well (mm)
DN
A lad
der
frag
men
t siz
e (
bp
)
Data Points Line of Best Fit
Standard curve for determination of SSP 8 fragment sizes at 60ºC (Figure 4.9). Included
are the measurements of DNA ladder marker used to develop standard curve, equation for
determining unknown fragment length, R2 value, calculated fragment size and
confirmation of size within expected range.
Distance from well (mm)
DNA ladder fragment size (bp)
80 100
70.5 200
63.8 300
57.8 400
52.8 500
49 600
45.6 700
42.8 800
40.5 900
38.8 1000
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
C. albifrontalis 43 820 770-850
Equation Y = 8078.5e-0.0532x
R2 Value R
2 = 0.9916
150
Standard curve for SSP 9 at 48oC
100
1000
10000
0 10 20 30 40 50 60 70 80 90
Distance from well (mm)
DN
A l
ad
de
r fr
ag
me
nt
siz
e (
bp
)
Data Points Line of Best Fit
Standard curve for determination of SSP 9 fragment sizes at 48ºC (Figure 4.10).
Included are the measurements of DNA ladder marker used to develop standard curve,
equation for determining unknown fragment length, R2 value, calculated fragment size
and confirmation of size within expected range.
Distance from well (mm)
DNA ladder fragment size (bp)
82.8 100
69.6 200
59.8 300
52.8 400
47.4 500
43.6 600
40.5 700
37.4 800
35.2 900
34.2 1000
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
C. dubia 59.4 300 290-320
Ch. megacephala 60.8 281 290-320
Ch. rufifacies 58.5 312 290-320
L. sericata 62.2 264 290-320
Equation Y = 4477.6e-0.0455x
R2 Value R
2 = 0.9978
151
Standard curve for SSP 9 at 58oC
100
1000
10000
0 10 20 30 40 50 60 70 80
Distance from well (mm)
DN
A lad
der
frag
men
t siz
e (
bp
)
Data Points Line of Best Fit
Standard curve for determination of SSP 9 fragment sizes at 58ºC (Figure 4.11).
Included are the measurements of DNA ladder marker used to develop standard curve,
equation for determining unknown fragment length, R2 value, calculated fragment size
and confirmation of size within expected range.
Distance from well (mm)
DNA ladder fragment size (bp)
67.5 100
55.8 200
49.6 300
43.6 400
39 500
36.6 600
32.5 700
30.4 800
28.8 900
28.2 1000
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
Ch. megacephala 48.6 298 290-320
Ch. rufifacies 48 308 290-320
L. sericata 47.4 319 290-320
Equation Y = 4602.6e-0.0563x
R2 Value R2 = 0.9971
152
Standard curve for SSP 4b stock test
100
1000
10000
0 10 20 30 40 50 60 70 80
Distance from well (mm)
DN
A lad
der
frag
men
t siz
e (
bp
)
Data Points Line of Best Fit
Standard curve for confirmation of SSP 4b stock solution (Figure 5.1). Included are the
measurements of DNA ladder marker used to develop standard curve, equation for
determining unknown fragment length, R2 value, calculated fragment size and
confirmation of size within expected range.
Distance from well (mm)
DNA ladder fragment size (bp)
23.2 1200
24.2 1100
26 1000
27 900
28.8 800
30.6 700
33.5 600
37.2 500
42 400
49 300
58.2 200
71.2 100
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
L. sericata 22.4 1131 1100-1400
Equation Y = 3484.3e-0.0502x
R2 Value R
2 = 0.9934
153
Standard curve for Multiplex PCR 1
100
1000
10000
0 10 20 30 40 50 60 70 80 90 100
Distance from well (mm)
DN
A lad
der
frag
men
t siz
e (
bp
)
Data Points Line of Best Fit
Standard curve for the measurement of amplicon sizes obtained using Multiplex PCR 1 at
62ºC (Figure 5.2). Included are the measurements of DNA ladder marker used to
develop standard curve, equation for determining unknown fragment length, R2 value,
calculated fragment size and confirmation of size within expected range.
Distance from well (mm)
DNA ladder fragment size (bp)
31.2 1000
33 900
35 800
38.2 700
41.5 600
45.8 500
51.6 400
60 300
71.2 200
89 100
Species
Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
C. albifrontalis 35.8 777 770-850
Ch. megacephala 55.5 360 300-350
Ch. rufifacies 55.5 360 300-350
L. sericata 34.6 814 770-820
Equation Y = 3141.6e-0.039x
R2 Value R
2 = 0.9971
154
Standard curve for Multiplex PCR 2
100
1000
10000
0 10 20 30 40 50 60 70 80 90 100 110
Distance from well (mm)
DN
A lad
der
frag
men
t siz
e (
bp
)
Data points Line of Best Fit
Standard curve for the measurement of amplicon sizes obtained from using Multiplex
PCR 2 at 50ºC (Figure 5.3). Included are the measurements of DNA ladder marker used
to develop standard curve, equation for determining unknown fragment length, R2 value,
calculated fragment size and confirmation of size within expected range.
Distance from well (mm)
DNA ladder fragment size (bp)
36.2 1000
38.4 900
41.2 800
44.6 700
49.2 600
55.2 500
63 400
71.2 300
85 200
103.2 100
Species Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
C. dubia 46.4 682 650-700
Ch. rufifacies 46.4 682 650-700
Equation Y = 3185.9e-0.0332x
R2 Value R
2 = 0.998
155
Standard curve SSP 2b stock test
100
1000
10000
0 10 20 30 40 50 60 70 80 90
Distance from well (mm)
DN
A lad
der
frag
men
t siz
e (
bp
)
Data Points Line of Best Fit
Distance from well (mm)
DNA ladder fragment size (bp)
28.2 1000
29.5 900
31.8 800
34.2 700
37.4 600
41.8 500
47.4 400
55.8 300
66.2 200
81 100
Standard curve for confirmation of SSP 2b stock solution (Figure 5.4). Included are the
measurements of DNA ladder marker used to develop standard curve, equation for
determining unknown fragment length, R2 value, calculated fragment size and
confirmation of size within expected range.
Species Distance from well (mm)
Calculated fragment size (bp) using below equation
Expected fragment size based on visual analysis of electrophoresis gel (bp)
C. dubia 39 589 550-600
Equation Y = 3022e-0.0419x
R2 Value R
2 = 0.9963
156
APPENDIX 4
Table 8.2: Accession number and locality of sequences utilised in the construction of
neighbour-joining phylogenetic tree. Information was obtained from Genbank at
http://www.ncbi.nlm.nih.gov
Species Locality Accession Number
C. dubia Australia, Toodyay EU418556
Australia, Western Australia EU418555
Australia, New Norcia EU418554
Australia, Perth EU418553
Australia, Geralton EU418552
C. albifrontalis Australia, New Norcia EU418566
Australia, Perth EU418567
Australia, Perth EU418568
Ch. rufifacies India DQ098943
India DQ098942
India DQ0989451
India DQ098944
India AH015277
India AH015276
India AH015279
India AH015278
Taiwan AY092760
Australia, Perth AB112845
Australia, Perth AB112828
USA, Hawaii EU418549
USA, Tennessee EU418548
Australia, Tasmania EU418547
China DQ345079
Australia, Black Mountains, ACT DQ647361
Australia, Kuranda, QLD DQ647360
Australia, Mt. Sampson, QLD DQ647359
Australia, Tinaroo Falls, QLD DQ647358
Australia, Mt. Stuart, QLD DQ647357
Ch. megacephala Malaysia EU418537
USA, Hawaii EU418536
Australia, Sydney EU418535
South Korea DQ279746
China DQ345076
Australia, Kuranda, QLD DQ647353
Australia, Karuah, NSW DQ647352
Australia, Mt. Stuart, QLD DQ647351
Australia, Hornsby Heights, NSW DQ647350
157
India DQ119593
India DQ119592
Taiwan AY092761
Zambia, Kitwe AB112861
Zambia, Kitwe AB112856
South Africa, Pretoria AB112848
Australia, Perth AB112847
Australia, Perth AB112846
Australia, Brisbane AB112841
Australia, Natal AB112830
L. sericata France EU418579
France EU418578
Denmark EF531193
South Africa, Pretoria AB112864
South Africa, Pretoria AB112859
South Africa, Graaf-Reinet AB112850
South Africa, Graaf-Reinet AB112843
Zimbabwe, Harare AB112844
Australia, Perth AB112833
United Kingdom, London, England AY092818
United Kingdom, London, England AY092817
United Kingdom, London, England AY092816
United Kingdom, London, England AY092815
United Kingdom, London, England AY092814
Australia AY842612
USA, California, Davis DQ868503
USA, Michigan, East Lansing DQ868523
USA, Michigan, East Lansing DQ868524
USA, West Virginia, Morgantown DQ062660
158
Appendix 5
Summary of multiplex PCR 1; including set-up and PCR conditions.
Forward Primer 5‟ GGAGGATTTGGAAATTGATTAGTTCC 3‟
SSP 5b 5‟ GCAGTAATAACTACAGATCTT 3‟
SSP 6b 5‟ CCTAAAGCTCATAAAGTAGGA 3‟
SSP 8 5‟ TTAATCCTCCTACTGTGAAAAG 3‟
Reagents x1
Qiagen Multiplex PCR master mix 25µl
Forward Primer 3µl
SSP 5b 3µl
SSP 6b 3µl
SSP 8 3µl
Template 3µl
RNase-free Water 10µl
50 µl
PCR Cycling Conditions
1x 95ºC for 15 minutes
36x 94ºC for 30 seconds
62ºC for 90 seconds
72ºC for 90 seconds
1x 72ºC for 10 minutes
4ºC for ∞