detection of the bcr-abl leukemia gene fusion …...ii detection of the bcr-abl leukemia gene fusion...
TRANSCRIPT
![Page 1: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/1.jpg)
Detection of the BCR-ABL leukemia gene fusion using
chip-based electrochemical assay
by
Elizaveta Vasilyeva
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Graduate Department of Biochemistry
University of Toronto
© Copyright by Elizaveta Vasilyeva 2010
![Page 2: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/2.jpg)
ii
Detection of the BCR-ABL leukemia gene fusion using chip-based
electrochemical assay
Elizaveta Vasilyeva
Master of Science
Graduate Department of Biochemistry
University of Toronto
2010
Abstract
Ability to diagnose cancer before it progresses into advanced stages is highly
desirable for the best treatment outcome. A sensitive test to analyze complex samples for
specific cancer biomarkers would provide with important prognostic information and
help to select the best treatment regimen. A highly robust, ultra sensitive and cost-
effective electronic chip platform was used to detect nucleic acid biomarkers in
heterogeneous biological samples without any amplification or purification. Chronic
myelogenous leukemia (CML) was chosen as a model disease due to its hallmark genetic
abnormality. This disease state therefore has an ideal market to test the detection of the
fusion transcripts in complex samples, such as blood. It was shown that the CML-related
fusion can be detected from unpurified cell lysates and as low as 10 cells were needed for
detection. Finally, patient samples were analyzed using the assay and the fusion
transcripts were accurately identified in all of them.
![Page 3: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/3.jpg)
iii
ACKNOWLEDGMENTS
I thank my supervisor, Dr. Shana Kelley, for her guidance and continuous support
throughout my work in the group and Dr. Edward Sargent for his great insights. I also
would like to thank my supervisory committee members Dr. John Parkinson and Dr.
Chris Yip for their helpful discussions and numerous suggestions regarding the project. I
want to thank my colleagues for their assistance throughout my work, especially Zhichao
Fang for being a great teacher and Brian Lam for helping with the experiments. Further, I
would like to thank Dr. Mark Minden from the Princess Margaret hospital for providing
the patient samples. In addition I would like to thank the granting agencies including
OICR, CIHR, NSERC, Genome Canada, Ontario Ministry of Research & Innovation, and
Ontario Centres of Excellence, without which the work presented in this thesis would not
be possible.
![Page 4: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/4.jpg)
iv
TABLE OF CONTENTS
ABSTRACT ii
ACKNOWLEDGMENTS iii
TABLE OF CONTENTS iv
LIST OF TABLES vi
LIST OF FIGURES vi
1.0 INTRODUCTION 1
1.1 Cancer diagnostics and biosensors 1
1.2 Electrochemical Assay 5
1.3 Project objectives 11
1.4 Chronic myelogenous leukemia 12
1.5 Techniques for CML diagnosis 15
2.0 MATERIALS AND METHODS 19
2.1 Chip fabrication 19
2.2 Fabrication of nanostructured microelectrodes 19
2.3 Electrochemical measurements 20
2.4 Hybridization protocol 21
2.5 Probe Design 21
2.6 Synthesis and purification of oligonucleotides 22
2.7 Modification of NMEs with DNA or PNA probes 24
2.8 Cell culture 24
2.9 Total mRNA isolation 25
2.10 Gel Electrophoresis 26
2.11 K562 cells and patient samples preparation 26
2.12 Cell lysis 27
2.13 Quantification of bcr-abl in K562 cells 27
2.14 Real-time RT-PCR 28
2.15 Determination of the probes’ thiols activity using Ellman’s reaction 29
3.0 RESULTS AND DISCUSSION 30
3.1 Optimization of the nanostructured microelectrodes (NMEs) 30
![Page 5: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/5.jpg)
v
3.2 Modification of the probe 32
3.3 Validation of the assay with a short synthetic DNA target 36
3.4 Absolute quantification of bcr-abl gene fusion in K562 cells 39
3.5 Optimization of the assay with mRNA target 44
3.6 Detection of fusion transcripts from whole cell lysates 46
3.7 Whole blood spiked with cell lysate 49
3.8 Analysis of CML patient samples 52
4.0 CONCLUSION 58
REFERENCES 60
![Page 6: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/6.jpg)
vi
LIST OF TABLES
Table 1. Detection of protein biomarkers. 2
Table 2. Previous detection platforms compared with the NMEs. 10
Table 3. Comparison of different tests for CML diagnosis. 15
Table 4. Summary of properties of the different probes. 33
Table 5. Cell content of blood and typical hybridization sample. 50
Table 6. Monitoring response to treatment of CML. 59
LIST OF FIGURES
Figure 1.1. Illustration of the microchip-based platform. 3
Figure 1.2. Morphology and size of the NMEs. 4
Figure 1.3. The chip-based electrochemical assay. 5
Figure 1.4. Illustration of the electrocatalytic system. 6
Figure 1.5. DP signal from hybridization of a complementary target. 7
Figure 1.6. A study demonstrating sensitivity and dynamic range of NMEs with
different morphology. 8
Figure 1.7. Validation of the assay using biologically relevant samples. 9
Figure 1.8. Progression of chronic myelogenous leukemia. 13
Figure 1.9. Diagnosis of CML using conventional tests. 16
Figure 2.1. Illustration of a CPFC chip. 19
Figure 2.2. Two different gene fusions e13a2 and e14a2 resulting from the
translocation both leading to CML. 21
Figure 2.3. Addition of a thiol-containing terminal linker to a DNA probe. 22
Figure 2.4. Isolation of total mRNA from K562 cells using the Dynabeads®. 25
Figure 2.5. Schematic illustration of the cell lysis chamber. 27
Figure 3.1. Whitman’s diffusion model. 29
![Page 7: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/7.jpg)
vii
Figure 3.2. Scanning electron microscopy image of the new design of gold NMEs. 30
Figure 3.3. A panel illustrating the different between a DNA, original and
modified PNA probes. 31
Figure 3.4. Ellman’s reaction with the DNA (DP14), PNA (PP14) and modified
PNA (PP14A) probes. 34
Figure 3.5. Electrocatalytic detection of a 20-nucleotide long DNA target. 37
Figure 3.6. Confirmation of specificity of the electrocatalytic assay. 38
Figure 3.7. Amplification of a 275 bp fusion region. 40
Figure 3.8. Cloning with PCR-4 TOPO. 41
Figure 3.9. RT-PCR of the bcr-abl fusion transcript. 42
Figure 3.10. In-vitro RNA synthesis. 43
Figure 3.11. Standard curve for the RT-PCR reaction. 44
Figure 3.12. Isolation of total mRNA from K562 cells and hybridization analysis
using the chip-based electrochemical assay. 45
Figure 3.13. Determination of sensitivity with total isolated mRNA from K562
cells. 45
Figure 3.14. Lysis of the cells was accomplished by applying an electric field. 47
Figure 3.15. Hybridization with unpurified cell lysates. 48
Figure 3.16. Determination of sensitivity of the system with unpurified whole cell
lysates. 49
Figure 3.17. Whole blood spiked with K562 cell lysates. 51
Figure 3.18. Development of CML begins with a mutation in the hematopoietic
stem cell in the bone marrow. 53
Figure 3.19. Confirmation of the fusion type in a patient sample. 54
Figure 3.20. Determination of sensitivity with patient sample 1. 54
Figure 3.21. Determination of a sensitivity and detection limit with two different
patient samples. 55
Figure 3.22. Whole blood spiked with patient sample 3. 57
![Page 8: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/8.jpg)
1
1.0 Introduction
1.1 Cancer diagnostics and biosensors
Early detection of cancer is crucial for a successful outcome. In Canada alone,
171,000 new cancer cases were expected to occur in 2009, representing approximately
470 Canadians diagnosed with some form of cancer each day. It was estimated that over
75,000 deaths will occur due to the disease yearly (Canadian cancer statistics 2009).
Depending on the type of cancer, combating the disease is possible if treatment can be
started as early as possible. In order to take advantage of the available therapies it is
important to detect the cancer before it spreads to other organs and tissue and becomes
untreatable (Etzioni et al. 2003). Great efforts have been put into discovery of cancer
biomarkers that can be used as potential targets for screening (Feng et al., 2006; Negm et
al., 2002). Proteins and nucleic acids, if known to be unique markers of a particular
disease can be used as both diagnostic and prognostic factors (Urbanova et al., 2010). In
diagnostics, two major techniques used to screen for proteins and nucleic acids
biomarkers are immunoassays and PCR-based techniques respectively (Bernarda &
Wittwer 2002). The sensitivity of the former techniques relies on the amplification of the
sample, while the latter depends on the amplification of the signal. However, the
complexities of these testing methods and their cost have been an issue in making these
tests widely available.
The emergence of multiplexed biosensors has led to new possibilities for
diagnostic devices (Sengupta & Sasisekharan, 2007). In particular, nanoscale devices
and structures allow analysis of low levels of biomarkers, which are otherwise
overlooked in the conventional diagnostic tests. Remarkable sensitivity has been
![Page 9: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/9.jpg)
2
accomplished with the detection of protein biomarkers using a wide range of techniques,
which are summarized in Table 1.
Nucleic acids analysis has been explored as well. For example, carbon nanotube
network field-effect transistors (Star et al. 2006) and quantum dots (Bailey et al., 2009)
showed specificity in detecting homogeneous DNA targets; gold (Nam, 2004; Thaxton et
al., 2006) and cupric hexacyanoferrate nanoparticles (Chen et al., 2010) demonstrated
remarkable sensitivity of 500 zeptomolar and 1 femtomolar respectively. Similarly,
sensitive and specific target detection of clinically relevant mRNA can be achieved using
gold nanowires (Zheng et al., 2005; Fang and Kelley, 2009). However, these techniques
have their own limitations either in terms of ability of analyzing complex samples,
attaining high sensitivity, simplicity, or potential of multiplexing. Evidently, a platform
Table 1. Detection of protein biomarkers (Adapted from Giljohann & Mirkin, 2009).
![Page 10: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/10.jpg)
3
that would solve the current short-comings of the different systems would accelerate the
progress in the field of clinical diagnostics.
A cost effective and highly robust microchip-based platform with a straight
forward fabrication process that is easy to operate has been designed in our group (Figure
1.1) (Soleymani et al., 2009).
Figure 1.1. Illustration of the microchip-based platform. A) The chip is made on a
silicon wafer that is fabricated using standard photolithography. B) Nanostructured
sensing elements can be easily electrodeposited in the aperture that is created during
the fabrication process (Adapted from Soleymani et al., 2009).
When a new system is designed, it is essential that it possesses properties that are
desirable for the use in the clinic, especially for the point-of-care diagnostics. Cost
efficiency is one of the limiting factors in introducing new technologies. For this reason
practical fabrication is critical for the development, and for this reason silicon-based
wafers were chosen as a platform. Scalable multiplexing is extremely important for
clinical applications, since it allows for screening for multiple markers or analysis of
more than one sample, which speeds up the diagnosis. (Soleymani et al., 2009).
Previous work has demonstrated that nanostructured sensors exhibit significant
increase of sensitivity. The chip-based platform allows for fabrication of various
A B
![Page 11: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/11.jpg)
4
structures by adjusting the electroplating conditions (Figure 1.2). The panel presents the
possibilities of making the structures either small or large, smooth or having various
degree of roughness. For example, increasing the time or concentration of the metal salt
in the plating solution larger structures are produced. By increasing plating potential from
0 mV to 250 mV, instead of a smooth sphere structure a rough structure with numerous
nanostructured features is obtained. Finally, a choice of the supporting electrolyte affects
the morphology, for instance, hydrochloric, sulfuric or perchloric acids all lead to
different structures. Consequently, this freedom of design makes it possible to optimize
for different nucleic acids targets detection, being that short microRNAs or long and
complex mRNA molecules (Soleymani et al., 2009).
Figure 1.2. Morphology and size of NMEs. Plating parameters, such as time, plating
potential, concentration and choice of supporting electrolyte can be controlled to
fabricate various sensors (Adapted from Soleymani et al., 2009).
Increasing plating time
Larger plating potential
Increasing Palladium/HCl
concentration
Different supporting
electrolytes
5 µm
![Page 12: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/12.jpg)
5
1.2 Electrochemical Assay
Sensitivity of biomarker detection is accomplished through either the target or
signal amplification (Giljohann & Mirkin, 2009). The nucleic acid detection assay
developed in the Kelley group is based on the hybridization of an oligonuleotide probe on
the electrode surface with its complementary target. Attachment of the probe molecules
to the surface of the electrode, such as palladium and gold, is achieved through a covalent
bond between a thiol group on the probe and the metal. For this reason all the probes
used in the assay were designed or modified to contain the thiol at its terminal (Figure
1.3) (Taft et al., 2003).
Figure 1.3. The chip-based electrochemical assay. After electroplating of a
nanostructured microelectrode (NME) the chips are incubated with the probe
molecules, which spontaneously form a monolayer on the surface. The electrode is
then scanned in the electrocatalytic solution containing positive and negative
reporter ions. The sample, containing the target nucleic acid molecules is then
introduced onto the chip and the signal is measured again.
The electrochemical assay involves the detection of the target molecules based on
the negative charge accumulation at the surface of the nanosensor from the nucleic acid
hybridization to the probe (Lapierre et al., 2003). A special reporter system is used for the
signal read-out, based on the increase of the negative charge at the electrode’s surface
(Figure 1.4). This system uses positively charged ruthenium (III) hexamine ions and
excess of negatively charged ferricyanide (III) ions. The cations are attracted to the
negatively charged nucleic acid molecules and concentrate near the surface of the
![Page 13: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/13.jpg)
6
electrode. Upon applying a negative potential, ruthenium (III) hexamine is reduced to
ruthenium (II) hexamine. The excess of ferricyanide (III) in the solution reoxidize
ruthenium (II) hexamine that has diffused away from the electrode surface back to
ruthenium (III) hexamine, which is turn moves back to the electrode surface and gets
reduced again. This regeneration of the positive reporter ion happens many times and
results in signal amplification.
Figure 1.4. Illustration of the electrocatalytic system. B) The electrocatalytic system
includes the positive reporter ruthenium (III) hexamine and negative reporter ferri
(III) cyanide. Positive ions are attracted to nucleic acids at the surface of the
electrode by the electrostatic forces, while the negative reporter ions are repelled
from the surface.
Two techniques used to measure the signal are cyclic voltammetry (CV) and
differential pulse voltammetry (DPV). The basic principle behind the CV is that the
working electrode (eg. NME) is linearly charged with time starting from a potential
where no reaction occurs and moving to a potential where either oxidation or reaction of
the species being studied occurs (eg. ruthenium (III) hexamine) (Evans et al., 1983).
After covering the potential window in which the reaction takes place, the direction of the
linear sweep is reversed and scanned back to the starting potential. In case of the assay
described above, if one was to scan from 0 to -350 mV, a reduction peak at -175 mV,
which corresponds to the reduction of ruthenium (III) hexamine ions to ruthenium (II)
hexamine, would be observed (Figure 1.5). After the scan is reversed, the opposite
![Page 14: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/14.jpg)
7
reaction of oxidation of ruthenium (II)
hexamine ions would occur. However,
due to presence of ferricyanide (III),
which reoxidizes the ruthenium (II)
ions the oxidation peak is much
smaller (CV) than the reduction peak
or absent (DPV). Differential pulse
voltammetry is similar to CV, except
the potential is applied in pulses
(steps) and not linearly, eliminating the effect of the charging current (Osteryoung, 1983).
The reduction peak of ruthenium (III) hexamine is still the same at – 175 mV. The size of
the peak is related to how much reaction occurs at the surface of the electrode and the
more ruthenium (III) hexamine is reduced, the larger the peak. The concentration of
ruthenium (III) hexamine ions in the electrocatalytic solution is relatively low
(micromolar), and if there is no negatively charged nucleic acids at the surface of the
NME, only low background signal is detected. As a result, with the probe molecule alone
only a small number of ruthenium (III) hexamine ions are attracted at the surface, but
with hybridization of the target nucleic acid molecules more cations are drawn to the
surface and the reduction peak increases (Figure 1.5). This change, ∆I is used to measure
hybridization of the target sequences at the electrode surface. On the other hand, non-
complementary nucleic acid targets should not produce an increase in signal compared to
hybridization with the complementary target molecules.
Figure 1.5. DP signal from hybridization of a
complementary target. Delta I is measured by
subtracting peak currents at -175mV.
∆I
![Page 15: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/15.jpg)
8
Combining the chip platform with the nanostructured sensor and the
electrocatalytic assay, the result is an ultra sensitive and selective multiplexed system that
allows for simultaneous screening for multiple targets with no target amplification steps.
As illustrated before, the plating parameters significantly affect the morphology
of the NMEs. Interestingly, these in turn affect the sensitivity of the sensor. Limits of
detection and dynamic ranges have been determined for the three different structures,
smooth, moderately nanostructured and finely nanostructured NMEs (Figure 1.6)
(Soleymani et al., 2009). With the highly and most finely nanostructured NME the
detection limit with a short DNA target was 10 aM or fewer than 100 molecules. As low
as 10 fM and 100 fM of the same target molecule was detected with the moderately
nanostructured and smooth NMEs respectively. It was found that the fine
nanostructuring makes the probe molecule of the surface more accessible, which favours
target hybridization at the NME (Bin & Kelley, 2010). One advantage of the chip
platform, is that a different NME can be fabricated at the each aperture, as a result a
single chip can have more than one structure type. Consequently, by electroplating the
three different NMEs a dynamic range of six to seven orders of magnitude can be
achieved. This feature is unique to the platform, since other array-based systems have
only a single type of a sensor (Soleymani et al., 2009).
![Page 16: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/16.jpg)
9
Figure 1.6. A study demonstrating sensitivity and dynamic ranges of the NMEs with
different morphology. Sensitivity of 10 aM was achieved with the most finely
nanostructured NME. The dynamic range of the three structures combined is about
six to seven logs (Adapted from Soleymani et al., 2009).
To explore the system’s capability of being able to analyze biologically relevant
samples two different cancers were chosen.
First, using this system one of the most difficult targets for analysis, microRNA,
has been successfully detected in a heterogeneous sample with high sensitivity and
selectivity (Yang et al., 2009). Head and neck cancer specific microRNA sequence miR-
21 was titrated using the NMEs and detectable signal changes were observed as low as 10
aM compared with the negative control (Figure 1.7A). RNA extracted from
hypopharyngeal squamous cancer cell line showed positive signals as low as 5 ng of the
sample, with the negative control showing no signal increase up to 20 ng of RNA.
1 um 2 um
200 nm
∆I
(%)
log (concentration (M))
100 molecules detected
![Page 17: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/17.jpg)
10
Figure 1.7. Validation of the assay using biologically relevant samples. A) Sensitivity
and detection limit study with head and neck cancer specific microRNA miR-21. B)
Three prostate cancer cell lines and two patient samples were analyzed for type I,
type III, and type VI gene fusions. PCR and sequencing (positive control) were done
to ensure the validity of the assay (Adapted from Fang et al., 2009).
In addition, a panel of mRNA molecules of prostate cancer related gene fusions
were accurately identified within one hour timeframe (Fang et al., 2009). RNA was
isolated from prostate cancer cell lines as well as tumor samples and screened for the
gene fusions using the chip-based assay. In parallel, PCR and sequencing was performed
as a positive control. The results from the assay were in accordance with both PCR and
sequencing. The detection limit was 1 ng of RNA from the cell lines and 10 ng from the
tumour samples, while retaining its specificity (Figure 1.7B).
Evidently, the electrocatalytic assay has showed potential of being able to analyze
clinically relevant samples. To summarize the advantages of the NMEs over previously
studied electrodes using the same electocatalytic system Table 2 describes some of the
characteristics of each electrode sensor (Lapierre et al., 2003; Gasparac et al., 2004; Fang
et al., 2009; Yang et al., 2009).
A B
![Page 18: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/18.jpg)
11
Table 2. Previous detection platforms compared with the NMEs.
Electrode Size Surface Samples analyzed and
corresponding detection limit
Bulk gold
electrode
A = 0.02 cm2 2D (flat) synthetic oligonucleotides (10 nM),
PCR products, and RNA transcripts
Nanowire
electrode
l= 200 nm
d=10 nm
3D (cylindrical) Synthetic oligonucleotides (100 fM),
RNA transcripts (10 ng from cell line,
100 ng from tissue)
NME d= 5 µm 3D (highly
nanostructured)
Synthetic oligonucleotides (10 aM),
microRNA (10aM), RNA transcripts
(1 ng from cell line, 10 ng from tissue)
Even though the NME-based platform exhibits superior performance relative to
other electrode sensors used (Table 2), it has been optimized using short synthetic nucleic
acid target sequences. For this reason, the detection limit with microRNA and mRNA
varied significantly (100 vs 109 target molecules). Since the mRNA targets are very
important biomarkers, it was important to modify the existing assay to improve
sensitivity of 10 ng to a lower concentration. In addition, the system thus far was used
with purified nucleic acids and was not yet challenged with more complex samples,
therefore more work has to be done to move one step further to utilize the system in
clinical diagnostics.
![Page 19: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/19.jpg)
12
1.3 Project objectives
Analysis of bodily fluids, whole blood, urine or sputum for cancer biomarkers is
very attractive for the point-of-care clinical nucleic acids biomarker analysis (Feng et al.,
2006). Combining all advantages of the existing platform with the ability of screening
these complex samples would allow for rapid results and lead to catching disease at early
stages and allowing for immediate decision on treatment.
In most cancers, tumorigenesis is a complex process involving the disruption of
multiple genes and cellular signaling pathways (Deininger et al., 2000). On the other
hand, chronic myelogenous leukemia (CML) is one of the few cancers in which a single
genetic abnormality causes signaling pathway malfunction leading to a disease. In
addition, in contrast to most solid tumours, for which complex diagnostic procedures
involving biopsies are done, CML can be potentially tested easily using blood samples
analyzing leukocytes for the biomarkers. For these reasons, CML was selected as a model
disease to design an assay to test complex sample, such as whole cells or blood for a
specific gene fusion only found in CML (Deininger et al., 2000).
The objective of the thesis were: i) To improve the sensitivity of the assay with
purified RNA samples, ii) detect target nucleic acids from unpurified samples, such as
whole cell lysate and determine the minimum number of cells needed for detection, and
iii) analyze patient samples for the gene fusion that would as close as possible resemble
the real-life clinical samples.
![Page 20: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/20.jpg)
13
1.4 Chronic myelogenous leukemia
Chronic myelogenous leukemia (CML) is considered the most extensively studied
cancer in humans. The discovery of an abnormal small Philadelphia (Ph) chromosome in
1960, which was consistently present in more than 95% of CML patients, was an
important step forward in cancer biology (Nowell & Hungerford, 1960). More than a
decade later it was found that Ph chromosome was a result of a reciprocal translocation of
a distal segment of the long arm of chromosome 22 to the distal portion of the long arm
of the chromosome 9 [t(9;22) (q34;q11)] resulting in a chimeric bcr-abl oncogene
(Rowley, 1973). The break on the chromosome 22q11.2 usually involves the major
breakpoint cluster region (M-bcr), sometimes in the minor break point cluster region (m-
bcr) and rarely in at the other nearby site, producing 210 kDa (p210), 190 kDa (p210) or
230 kDa (p230) proteins respectively. The break on the chromosome 9q34 occurs in a
gene related to the Abelson murine leukemia viral gene, or abl, that encodes a non-
receptor tyrosine kinase normally expressed in most tissues. The bcr-abl gene fusion
retains the tyrosine kinase domain of the abl gene, and the bcr fragment increases
tyrosine kinase activity making the chimeric protein constitutively active. The oncogenic
bcr-abl protein is localized exclusively in the cytoplasm where it disrupts numerous
membrane and cytosolic pathways (Deininger et al., 2000; Ren, 2005).
The disease begins with the initial chronic phase and can progress into an
accelerated phase and eventually into blast crisis (Figure 1.8). Based on the evidence
available it was concluded that bcr-abl is most likely the primary cause of the chronic
phase and additional genetic alterations are required for the transformation into the blast
phase (Deininger et al., 2000). The initial chronic phase is described by a massive
![Page 21: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/21.jpg)
14
production of granulocytes from the pluripotent haematopoietic stem cell in the bone
marrow, while the production of the other cell types such as B and T cells is
compromised. The overall average survival of the patient in chronic phase varies from 4-
6 years, with a range from one to 20 years. Once the disease progressed into the blast
crisis the prognosis is less than one year. Diagnosis at an earlier stage is crucial for better
prognosis and the successful treatment. In addition, a sensitive tool is important for
monitoring response to treatment and drug therapy (Deininger et al., 2000; Ren, 2005).
Figure 1.8. Progression of chronic myelogenous leukemia.
Prior to early 1980s, drug discovery for cancer treatment targeted almost
exclusively inhibition of DNA synthesis and cell division, involving antimetabolites,
alkylating agents and microtubule destabilizers (Capdeville et al., 2002). Although, these
drugs showed efficacy, their lack of selectivity lead to high toxicity. The discovery of
oncogenes, uniquely associated with cancerous cells was a breakthrough and made the
research to focus of designing selective agents to inhibit the cancer causing proteins. It
was determined that the tyrosine-kinase activity of bcr-abl was responsible for affecting
the signalling pathways. Consequently, it was proposed that inhibiting it could potentially
prevent chronic myelogenous leukemia or at least slow down its development.
![Page 22: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/22.jpg)
15
Therefore, a specific enzyme abl tyrosine kinase became a drug target to look for a
molecule that would selectively inhibit its activity. Using rational drug design approach a
methylpiperazine derivative STI571 (imatinib, also known as Glivec or Gleevec) was
found to be a potent inhibitor of abl tyrosine kinase. By selectively inactivating its target
the cells regain its apoptotic function (Capdeville et al. 2002).
Gleevec is routinely used to treat chronic-phase CML due to its high long-term
response rates and favorable tolerability profile compared with previously used therapies.
Although, resistance to this drug does occur in 2% to 4% of the patients each year, higher
dosages often solve the problem. However, if the patient did not respond to the drug in
the first place due to mutation in the abl tyrosine kinase, imatinib can no longer control
the disease. Fortunately, with emergence of the second generation tyrosine kinase
inhibitors (eg. dasatinib and nilotinib) gave more options to manage CML. When the
initial treatment with a tyrosine kinase inhibitor begins, bone marrow cytogenetics is
measured every 6 months until a complete cytogenic remission (CCyR) is achieved, and
further once every 1 to 3 years as long as major molecular response (MMR) is stable.
MMR is the measure of the bcr-abl transcript level, which should be done at least every 3
months. RT-PCR is currently the test done to measure the response to treatment and
monitor the minimal residual disease (Radich, 2009; Kantarjian et al., 2010).
1.5 Techniques for CML diagnosis
Diagnostic techniques to detect the CML fusion gene include conventional
laboratory tests such as cytogenetics and chromosome binding analysis, fluorescence in
![Page 23: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/23.jpg)
16
situ hybridization (FISH), and southern blot. More advanced techniques include PCR-
based technology, and microarray analysis (Table 3) (Nashed, et. al., 2003).
Table 3. Comparison of different tests for CML diagnosis.
Test Sensitivity Advantages Shortcomings
Cytogenetics 1 in 20 cells
(5%)
Detection of alternate/
additional chromosomal
abnormalities
Viable bone marrow or >
10% blasts in the
peripheral blood, cannot
differentiate types of gene
fusions
FISH 1 in 200 cells
(0.5%)
Apply directly to
leukocytes, detects
complex BCR-ABL
rearrangements
Prone to false positives,
time consuming, requires
viable cells
Southern
blot
Tumor levels
more than
5%
Reliable, used to confirm
the fusion High cost, time consuming
qRT-PCR
1 in 100 000
Detection of minimal
residual disease, accurate,
reproducible
High cost, purified sample
is required , false positives
due to contamination /
negatives due to sample
degradation
Microarray
analysis
Further data
validation is
necessary
Evaluate expression of
thousands of genes
simultaneously, prognosis
prediction and selection of
appropriate therapy
High cost, expensive
instrumentation, trained
personnel, large amount of
sample
In most cases leukemia is diagnosed during a routine blood test by an elevated
level of immature leukocytes, because the disease is generally asymptomatic at the earlier
![Page 24: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/24.jpg)
17
stage. Cytogenetics and chromosome banding, which is a structural analysis of the
chromosomes is performed to screen for the Philadelphia chromosome t(9;22) (Figure
1.9A). To determine the type of the translocation, fluorescence in situ hybridization
(FISH) can be done. This technique requires cells in metaphase or interphase and
employs two fluorescently labelled probes of different colours. One of the probes is made
complementary to the bcr gene, while the second one to the abl. If the fusion is present
the two fluorescent signals overlap then the result is an observed different colour (Figure
1.9B) (Nashed, et. al., 2003; Dewald et al., 1998; Pelz et al., 2002).
Figure 1.9. Diagnosis of CML using conventional tests. (A) Chromosome binding
analysis looks for abnormal chromosomes (Ph) (Image from LHSC). (B) FISH
analysis detects bcr-abl by observing fluorescent signals from two probes (yellow
and green) that overlay and produce yellow-orange colour if the fusion is present
(Adapted from Piazza et al., 2003).
To date, reverse-transcriptase polymerase chain reaction (RT-PCR) is the most
sensitive methods for the bcr-abl diagnosis (Gleissner et al., 2001). In this test, instead of
analyzing DNA, messenger transcript (mRNA) is targeted for the analysis. The reason for
choosing mRNA is that it is present at a high copy number and is not as complex to
analyse as the genomic DNA. One example of a commercially available PCR-based
assay is Cepheid Xpert BCR-ABL Monitor assay (Jobbagy et al., 2007; Dufresne et al.,
2007). Compared to conventional quantitative RT-PCR assays that require time
A B
![Page 25: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/25.jpg)
18
consuming purification and preparation steps, Cepheid was able to design a method using
a single-use cartridge based assay that reduced the hands-on technical time and
minimized potential for contamination. The sensitivity of the assay was reported to a
detection of 1 cultured K562 CML cell in 105 normal cells. Such sensitive technique is
essential for tracking minimal residual disease, since the majority of the patients achieve
CCyR with treatment, and require monitoring the level of the bcr-abl fusion transcript. In
addition, all CML patients are required to take the tyrosine kinase inhibitors indefinitely
to prevent relapse, consequently quantitative RT-PCR is performed at least every six
months to ensure that the treatment is successful. Although PCR-based assays are the
most sensitive available for detecting very small quantities of the fusion transcript,
standardization of the test and the selection of appropriate baselines has been a major
issue across different laboratories (Burmeister et al., 2000; Weisser et al., 2001; Müller et
al., 2004).
In summary, the classical techniques suffer from low sensitivity, lengthy analysis
involving sample preparation, long turn around times, while the modern ones are
complex, expensive, require specialized instrumentation, and as a result need highly
trained personnel to run the tests. It is evident that a new technique that would combine
the sensitivity, reproducibility of some of the current techniques, but would be simple to
perform and cost efficient would be highly beneficial for the medical diagnostic field.
Especially in the developing world where neither of the techniques described above are
accessible, a new tool that would diagnose CML could save many lives. The
electrochemical assays developed in the Kelley group have shown potential for future
applications in the clinical setting to diagnose genetic abnormalities.
![Page 26: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/26.jpg)
19
Figure 2.1. Illustration of a CPFC
chip (Adapted from Soleymani et
al., 2009).
2.0 Materials and Methods
2.1 Chip fabrication
The chips used for all of the experiments
were produced at the Canadian Photonics
Fabrication Center (CPFC). Silicon wafers were
passivated using a thick layer of thermally grown 2
micron silicon dioxide. Following this, a 350-nm
gold layer was deposited on the chip using electron-
beam-assisted gold evaporation. The gold film was
patterned using standard photolithography and a lift-off process. Using chemical vapour
deposition a 500-nm layer of insulating silicon dioxide was deposited. Finally, 5 micron
circular apertures and 2X2 mm bond pads were exposed on the electrodes through the top
layer using standard photolithography (Soleymani et al., 2009).
2.2 Fabrication of nanostructured microelectrodes
Prior to fabrication of nanostructured microelectrodes (NMEs), the chips were
washed in acetone for 5 minutes and sonicated for 2 minutes to remove any organic
material left from the fabrication process. The chips were then rinsed with isopropyl
alcohol and deionized water for 30 s and briefly dried with a flow of nitrogen. All
electrodeposition was performed at room temperature with a Bioanalytical Systems
Epsilon potentiostat with a three-electrode system containing an Ag/AgCl reference
![Page 27: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/27.jpg)
20
electrode and a platinum wire auxiliary electrode. The 5 micron apertures on the chips
were used as the working electrode and were contacted using the exposed bond pads.
Plating solution of H2AuCl4 was prepared by reacting gold (iii) chloride (Sigma)
and 0.5M hydrochloric acid, as a supporting electrolyte to a final concentration of 20
mM. Fabrication of gold NMEs were accomplished by dipping the chip into the plating
solution and applying constant potential of 0 mV for 175 seconds at each lead at a time.
The structures used for experiments with mRNA and cell lysates were fabricated using
the parameters described using d.c. potential amperometry in a three-electrode setup with
Ag/AgCl serving as a reference electrode. When short 20-nucleotide DNA target was
used, the structures were plated for 75 seconds instead to produce a smaller NME. After
all the leads had a NME, the chip was rinsed with the deionized water. NMEs were
etched with 50mM H2SO4 using cyclic voltammetry to activate the surface of the newly
formed electrode.
2.3 Electrochemical measurements
Electrochemical signals were measured in solutions containing 10 µM
[Ru(NH3)6]3+
and 2 mM [Fe(CN)6]3−
in 1XPBS. Cyclic voltammetry (CV) and
differential pulse voltammetry (DPV) signals before and after hybridization were
collected with a scan rate of 100 mV s-1 and scanned from 0mV to -350mV. Results
were quantified by subtracting peak currents in DPV scans as follows, ∆I = Iafter hybridization-
Ibefore hybridization. A negative control was included in all of the experiments, either no
probe, unrelated probe or half-complementary probes were used.
![Page 28: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/28.jpg)
21
2.4 Hybridization protocol
Hybridization solutions typically contained target sequences, either 20-nucleotide
long synthetic DNA, extracted mRNA, or unpurified cell lysate in 50 mM NaCl. Each
chip was incubated with a hybridization solution at 37 °C in a humidity chamber in the
dark for 30 minutes and were washed extensively twice with 50 mM NaCl prior to
electrochemical analysis. Hybridization solution volume was typically 30-40 µL.
2.5 Probe Design
Two types of gene fusions are known to cause CML. Two probes were designed
to distinguish between these gene fusions. Depending where the break in M-BCR b2 or
b3 (also known as exons 13 or 14) (Figure 2.2) occurred, the probes were designed to
contain 10 nucleotides from the bcr and 10 nucleotides from the abl regions to
distinguish from the wild type sequences. The probes were given names corresponding to
the bcr exon present in the fusion, probes DNA 13 or 14 (PD13 and PD14) and probe
PNA 13 or 14 (PP13 and PP14).
Figure 2.2. Two different gene fusions e13a2 and e14a2 resulting from the
translocation both leading to CML (Adapted from Advani et al., 2002).
![Page 29: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/29.jpg)
22
While working with PNA probes it was recognized that by introducing an aspartic
acid residue at both 5’ and 3’ ends the probe formed a much better monolayer and the
probes became PP13A (NH2-Cys-Gly-Asp-TGAAGGGCTTCTTCCTTATT-Asp-
CONH2) and PP14A (NH2-Cys-Gly-Asp-TGAAGGGCTTTTGAACTCTG-Asp-
CONH2). Negative control probe was PP32 (NH2-Cys-Gly-Asp-ATCTGCTCTGTG
GTG TAGTT-Asp-CONH2).
.
2.6 Synthesis and purification of oligonucleotides
Synthetic DNA probes molecules (20-mer) were obtained from ACGT and
remained attached to the CPG-resin that was used for the synthesis step. All DNA probes
were modified to have a thiol linker in-house using a solid phase synthesis approach
(Figure 2.3) (Taft et al., 2003).
Figure 2.3. Addition of a thiol-containing terminal linker to a DNA probe. (a) 1,1′-
Carbonyldiimidazole, dioxane, Ar, 0.5 h; (b) diaminohexane, Ar, 0.5 h; (c) conc.
NH4OH, 8 h, 55 °C; (d) SPDP, CH3CN/0.4 M HEPES (pH 8), 1 h; (e) 1 M DTT, 50
mM sodium phosphate (pH 7), 1 h (Adapted from Taft et al., 2003).
![Page 30: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/30.jpg)
23
DNA probe molecules were stringently purified after steps d) and e) by reversed-
phase high-performance liquid chromatography (Agilent) in acetonitrile/ammonium
acetate as mobile phase at a flow rate of 1ml/min (Figure 2.3).
Peptide nucleic acid probe (PNA) was synthesized in-house using solid-phase
synthesis approach on a Prelude automated peptide synthesizer (Protein Technologies,
Inc.). PNA monomers Fmoc-PNAT-OH, Fmoc-PNA-C(Bhoc)-OH, Fmoc-PNA-
A(Bhoc)-OH, and Fmoc-PNA-G(Bhoc)-OH were purchased from Link technologies and
the PNA oligonucleotides were synthesized on commercially available Knorr resin (LS,
100-200 mesh, 1% DVB)(NovaBiochem). Couplings were performed with 5 equivalents
Fmoc-protected PNA residue or amino acid, 7.5 equivalents of HATU (Protein
Technologies, Inc.), and 10 equivalents N-methylmorpholinein (Protein Technologies,
Inc.) in DMF for 3 hours. The Fmoc protecting group was removed with piperidine (20
%, v/v) in DMF for 10 minutes.
Peptide nucleic acid oligomers were cleaved from the resin and deprotected in a
single step with the solution containing 85% TFA, 10% m-cresol, 2.5% TIPS, 2.5% H2O
at room temperature for 5 hours (Sigma). The solvent was then drained and PNA was
washed by precipitating in ether (10ml) at -80ºC. The precipitated PNA was centrifuged
for 10 minutes at 4000 rpm. The pellet was washed two more times with -80ºC ether
before it was left to air dry (evaporate any remaining ether) overnight in the fumehood.
PNA probe (in powder form) was dissolved to 20% acetonitrile in H2O. To ensure that
the thiol group on cystein remained reduced, 10 µl of 1 M DTT was added for 1 hour.
Prior to chromatography purification the sample was filtered using a 0.2 µm cellulose
acetate microcentrifuge filter. The thiolated PNA probe was HPLC purified using an
![Page 31: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/31.jpg)
24
Agilent 1100 series HPLC on a Varian Microsorb MV 300-5 C18 column (250 mm × 4.6
mm). 0.1% TFA/H2O and 0.1% TFA/H2O served as mobile phases. The PNA probe was
detected by monitoring absorbance at 260 nm and peak fraction was collected into 15ml
falcon tubes and lyophilized.
Before deposition, the PNA probe was resuspended in 20% acetonitrile/H2O. The
molecular weights of the PNA probe were confirmed by mass-spectrometry.
Concentration of all oligonucleotides (DNA, PNA, RNA) was determined by measuring
absorbance at 260 nm using NanoDrop UV-Vis Spectrophotometer (ThermoScientific).
2.7 Modification of NMEs with DNA or PNA probes
A solution containing 5 µM thiolated peptide nucleic acid probe in 50 mM
sodium chloride was added to the NMEs and left in a dark humidity chamber overnight at
room temperature for self-assembly of a monolayer. A solution of 10 µM
mercaptohexanol (MCH) was then added to each chip for 1 hour at room temperature to
block the bare surface of the NME. The chip was then washed twice with 50 mM NaCl.
2.8 Cell culture
K562 cells contain b3a2 gene fusion and originally came from a patient with
chronic myelogenous leukemia in terminal blast crises. The K562cell line was obtained
from the ATCC which population has been characterized as highly undifferentiated and
of the granulocytic series. K562 blasts are hematopoietic malignant multipotential cells
that spontaneously differentiate into identifiable progenitors of the erythrocytic,
![Page 32: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/32.jpg)
25
granulocytic and monocytic cell series (Lozzio & Lozzio, 1975). It was however reported
by ATCC that occurrence of the Philadelphia chromosome was at a low frequency.
K562 cells were cultured in 50 mL suspension cell flasks with vent caps
(Sarstedt) in Iscove's Modified Dulbecco's Medium supplemented with fetal bovine
serum to a final concentration of 10%. The cells were grown in a humidified incubator
(70–95%) at 37.0°C with CO2 (5 %). Cultures can be maintained by the replacement by
fresh medium every 2 to 3 days. Subculture was performed when the cell population
reached 500,000 cells/ml.
2.9 Total mRNA isolation
Total mRNA was isolated using Dynabeads®
(Invitrogen) that relies on A-T base pairing. Short
sequences of oligo-dT are covalently attached to the
surface of the Dynabeads® and will hybridize to the
polyA tail of mRNA (Figure 2.4). Washing steps
ensure RNase inhibition yielding for a pure stable
mRNA from crude samples without the need for
strong chaotropic agents. Elution was achieved in the
last step by heating the sample to 80ºC. Quality of
the mRNA sample was tested using gel
electrophoresis.
Figure 2.4. Isolation of total mRNA
from K562 cells using the
Dynabeads® (Adapted from image at
Invitrogen.com).
![Page 33: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/33.jpg)
26
2.10 Gel Electrophoresis
RNA samples were analysed on 1% agarose gel, prepared form Ultra Pure
Agarose (Sigma) in 1X TBE buffer and run at low voltage setting (90V) for 1 hour. To
visualize the nucleic acid, either ethidium bromide or RedSafe (FroggaBio) was used. For
analysis of PCR products, 2% agarose gel was used.
2.11 K562 cells and patient samples preparation
Once K562 cells reached population of 0.5-1 million cells/ml, the cells in media
were collected and centrifuged at 600 rcf for 5 minutes at 4ºC. The media was then
removed and the cells were washed with equal volume of 1X PBS. The cell pellet was
then resuspended in 1X PBS and used for lysis.
CML patient samples were provided by Dr. Minden, Princess Margaret Hospital.
Patient peripheral blood and/or bone marrow samples were collected at presentation, post
induction, post consolidation and relapse. Mononuclear cells were isolated using Ficoll-
Paque and frozen in liquid nitrogen container. For the analysis, the frozen stocks were
thawed quickly at 37ºC water bath. Immediately, the cells were added to 10 ml of fresh
media (Iscove’s supplemented with 10% FBS) and centrifuged at 400 rcf for 5 minutes at
4C. The pellet was washed fresh media and the pellet was split into two tubes and
centrifuged again. Subsequently, the pellets were resuspended in 1X PBS and were
either used for mRNA isolation or cell lysis.
![Page 34: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/34.jpg)
27
2.12 Cell lysis
Lysis of K562 cells, patient samples (white blood cells) and blood was achieved
using an electrical lysis chamber (Figure 2.5). Pt wires used to produce the electric field
were inserted into PDMS (polydimethylsiloxane) membrane. The channels for the cell
solution to flow through were made with dull end needle and were vented with a N2 for 1
hour prior to use.
Figure 2.5. Schematic illustration of the cell lysis chamber (Adapted from Wang et
al., 2006)
K562 or patient sample cell pellet was resuspended in 1X PBS, 1 ml of cell
suspension (0.5 million/ml) was taken into a 5 ml syringe and loaded into a syringe
pump. In case of whole blood, it was diluted 100 times in 1X PBS/3.2% sodium citrate
and 1 ml was loaded into a 5 ml syringe. Lysis was achieved at a flow rate 25 uL/min,
400 V and 1mA current.
2.13 Quantification of bcr-abl in K562 cells
Primers were designed to be able to distinguish between b2a2 and b3a2 gene
fusions, with the Forward Primer: 5’ TGCAGATGCTGACCAACTCG 3’, and the
Reverse Primer: 5’ GGCCACAAAATCATACAGTGCA 3’.
![Page 35: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/35.jpg)
28
Total mRNA was isolated from K562 cells (DynaBeads®, Invitrogen) and a
reverse transcription reaction using random primers was performed to generate cDNA
(Qiagen). Polymerase chain reaction was done to amplify a 275 bp fragment. It was
subsequently cloned into a PCR-4 TOPO vector and transformed into competent E.coli
cells (Invitrogen). After the vector amplification in the E.coli cells, it was isolated and
linearized with NaeI endonuclease. Sequencing of the vector was done to determine
orientation of the insert and RNA (2751 bp) was transcribed using a T7 in-vitro
transcription system (Epicenter). Integrity of RNA was checked using gel electrophoresis
and concentration of the sample was determined by measuring the absorbance at 260 nm
with a NanoDrop UV-Vis Spectrophotometer.
2.14 Real-time RT-PCR
In order to determine the absolute number of the bcr-abl transcripts quantitative
real-time PCR was done. Standard quantities were prepared over a 5-log range. Unknown
samples were prepared by diluting the isolating total mRNA with RNase free H2O. Same
primers, as the ones to produce cDNA (Forward Primer: 5’
TGCAGATGCTGACCAACTCG 3’, and the Reverse Primer: 5’
GGCCACAAAATCATACAGTGCA 3’) were used to amplify the cloned region of the
vector. One-step RT-PCR was run according to the manufactures protocol (Power
SYBR® Green RNA-to-CT™ 1-Step, Applied Biosystems). All samples were run in
triplicate.
![Page 36: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/36.jpg)
29
2.15 Determination of the probes’ thiols activity using Ellman’s reaction
Ellman’s reagent or DTNB (5-5’-dithio-bis(2-nitrobenzoic acid)) is used to
quantify free thiols in a sample (Figure 2.6) (Sedlak & Lindsay, 1968; Ellman, 1968).
This reaction was performed to compare accessibility of the thiols between PP14, PP14A
and DP14. When DTNB reacts with the thiol group of cystein residues of the probes, it
cleaves the disulfide bond of DTNB producing 2-nitro-5-thiobenzoate which is yellow
and absorbs at 412 nm.
Figure 2.6. Reaction of DTNB with a thiol containing molecule, such as probes
PP14, PP14A and DP14.
DTNB stock solution of 2 mM was prepared in 50 mM sodium acetate in H2O
and stored refrigerated until use. 1 M Tris stock solution was prepared and the pH was
adjusted to 8.0. The experimental reactions were prepared by adding 42 µl of each probe
(stock solution was 90 µM) and 6 µl of DTNB stock solution to 52 µl of Tris pH 8.0
buffer to final reaction volume of 100 µl. The solutions as a result, contained 38 µM
probe (limiting reagent) and 120 µM DTNB, which was in excess. The solutions were left
at room temperature for 15 minutes for the reaction to take place (DTNB reacts
immediately with any accessible free thiols). DTNB in Tris pH 8.0 was used to blank
UV-Vis spectrophotometer at fixed wavelength of 412 nm. The absorbance at 412 was
measured and recorded.
![Page 37: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/37.jpg)
30
3.0 Results and Discussion
3.1 Optimization of the nanostructured microelectrodes (NMEs)
Previously working with short DNA targets, a detection limit of 100 molecules
was achieved, however with extracted mRNA 10 ng of sample corresponding to 109
molecules was the limit, a considerably lower sensitivity (Soleymani et al., 2009; Fang et
al., 2009). It was realized that the size of the target molecule (long mRNA versus 20-
nucleotide long DNA) affected the hybridization efficiency at the microsensor. From the
Whitman’s model of diffusion it was evident that the microsensor used in the previous
studies was not optimal for detection of clinically relevant mRNA, and a larger NME was
needed (Sheehan & Whitman, 2004; Nair & Alam, 2006; Soleymani et al., submitted). A
modified NME needed to be created that would retain the nanostuctured features, but
would larger than the previously used sensors (Figure 3.1).
Figure 3.1. According to Whitman’s diffusion model it would take 24 days for an
average mRNA molecule to get to the 100 nm sensor, while only 12 minutes if the
sensor’s size is increased to 10 microns (Illustration done by B. Lam).
![Page 38: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/38.jpg)
31
Various structures were made from palladium, gold, and the combination of both.
Morphology and size was varied by changing the plating time, potential and the
concentration of the metal salt. Large palladium NMEs were found to be not as stable,
and would collapse from the chip after plating during the washing step. The optimal
structure was found to be made from gold, plated for 250 seconds at 25 mV. The
dimensions and the morphology of the new structures were analyzed using scanning
electron microscopy (Figure 3.2). The dimensions of the new gold NMEs were determine
to be approximately 100 microns both in length and width. A magnified view allowed
visualizion of the nanostructured features that were crucial for high sensitivity. One
important characteristic of the structures generated was that they were 3-D, compared
with the older palladium structures that did not significantly protrude into solution, which
helped with the efficiency of target hybridization (Bin et al., 2010).
Figure 3.2. Scanning electron microscopy image of the new design of gold NMEs.
Both the side and magnified views are presented. From the side view it is visible how
the structure is 3-D with the tips of the electrode protruding in all directions from
the core of the electrode.
According to the Whitman’s model of diffusion and the Figure 3.1, the new NME
satisfied all the requirements to be an optimal sensor for effectively hybridizing long
messenger RNA targets in less than half an hour.
50 µm 5 µm
![Page 39: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/39.jpg)
32
3.2 Modification of the probe
In a previous study with gold nanowires, which used the same electrochemical
assay to analyze biologically relevant samples (prostate cancer specific mRNA fusions),
the advantage of using PNA probe over a DNA one was demonstrated (Fang et al., 2009).
The background signal from the DNA probe was eliminated by switching to PNA probe,
a neutral molecule, dramatically enhancing the sensitivity with the signal change
increasing 40-fold with the same concentration of the target.
The PNA probe to capture the bcr-abl (e14a2 fusion type) target molecule was
designed to be a 20-mer with glycine and cysteine residues. Glycine served as a linker
and cysteine was incorporated because it possessed a thiol-containing side chain, which
was necessary to attach to the NME surface and form a monolayer. However, the PNA
probes for the CML fusions did not behave in the same manner as the previously used
PNA probes. Solubility of the new PNA molecules was an issue and modifications
needed to be made. The sequence of the probe could not be changed, since it was
complementary to the fusion region which is unique. Similarly, there was not much
freedom with changing the length of the probe, because by making it shorter it would
contribute to nonspecific hybridization, while increasing the length would lead to
secondary structures and would be unlikely to improve the solubility. Therefore, as it was
necessary to keep the original nucleotide sequence other parts of the probe needed to be
re-designed.
Considering that the solubility could be improved by introducing charged groups,
the PNA probe was modified by introducing two aspartic acid residues on each terminus.
This was accomplished on a peptide synthesizer used to make the PNA probes. The
![Page 40: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/40.jpg)
33
reason for choosing an aspartic acid was that this amino acid was small and had a
negative charge at neutral pH. The negative charge would not greatly affect the assay, for
unlike the case with the DNA probe previously used, as it would have significantly less
charge than the DNA probe. This modification introduced a small background signal
from the probe alone, however the solubility was dramatically improved making this re-
designed probe behave similarly to a DNA probe. The properties of the three different
probes DNA, original PNA and modified PNA probes are briefly described in Table 4.
Table 4. Summary of properties of the different probes.
Probe Solubility Signal after
deposition
Signal after
hybridization
DNA-P14 Always soluble
High background
signal
No change
PNA-P14 Soluble after synthesis and
purification, precipitate after 1-2
weeks in fridge (can be dissolved
upon heating), precipitate after
deposition
No or very low
signal
No signal
PNA-P14A Soluble after synthesis and
purification, no visible precipitate
after storage in fridge up to 1
month, soluble after deposition
Signal present
(smaller than with
a DNA probe)
Increase (varies
depending on
target
concentration)
Further, to illustrate the difference in using the three different probes to capture
mRNA corresponding to the e14a2 fusion type, hybridization with 1 ng/ul of RNA
containing the target transcripts was carried out. The assay conditions were the same for
the three probes in order to make accurate comparisons.
![Page 41: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/41.jpg)
34
It was evident from Figure 3.3 that the background signal from DNA probe was
too high to be able to detect target concentration of 1 ng/µl, which was expected as
previously detection limit with a DNA probe was in a nanomolar range. On the other
hand, PNA molecule lacking any negative charges did not produce any signal increase
due to its inability to form a desirable monolayer for hybridization. The modified PNA
probe, PP14A, unlike the DNA probe had a significantly lower background signal and
showed an obvious signal increase after hybridization with 1 ng/µl. This target
concentration was not the limit of detection of this probe, however this amount of target
was chosen to clearly illustrate the advantage of using the modified PNA probe over the
DNA probe and that modifications can make a completely nonfunctional probe into a
well-behaving probe with desirable characteristics for hybridization.
Figure 3.3. A panel illustrating the difference between a DNA, original and modified
PNA probes. DPV signal showed signal increase with the modified PNA probe and
no change in signal with DNA and the original PNA probes after hybridization
(solid line) with 1 ng/µl RNA.
![Page 42: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/42.jpg)
35
Since it was challenging to find direct evidence why the modified probe worked
better, it was proposed that introducing aspartic acid residues could make the PNA probe
work by : i) preventing two or more hydrophobic PNA molecules from associating with
each other, potentially hiding the thiol group and preventing its reaction with electrode
surface, ii) improving solubility, thus preventing precipitation at the electrode to allow for
effective deposition, iii) disrupting secondary structures within the PNA molecule and
exposing the thiol group for the attachment to the electrode surface. The first two claims
can be supported by the observation that unmodified PNA was unstable in solution and
easily formed precipitate owing to the fact of being hydrophobic. To check the third
claim, whether it was the accessibility of thiol group that prevented the formation of the
monolayer, Ellman’s assay was performed.
Since the original PNA probe was neutral it was challenging to figure out whether
any of it was deposited on the surface of the electrode at all. One method to assess the
accessibility of the thiol group on the probe was pursued using Ellman’s reagent,
traditionally used to quantify the free thiol groups of peptides and proteins (Sedlak &
Lindsay, 1968; Ellman, 1968). In this case, this reaction was used qualitatively to
compare the activity of the thiols on the probes. The three probes were incubated with the
Ellman’s reagent and the absorbance at 412 nm was read, since one of the reaction
products absorbs at this wavelength. Interestingly, the signal from the DNA and the
modified PNA probe were of equal intensities, but a lower signal was observed in case of
the original PNA molecule, indicating that the thiol group was somehow hindered (Figure
3.4). Two peaks are 412 nm and 260 were observed corresponding to 2-nitro-5-
thiobenzoate, a product of the Ellman’s reaction, and nucleotides respectively. The peaks
![Page 43: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/43.jpg)
36
at 260 nm were of the same intensity indicating equal amounts of each probe, thus the
difference in intensities of the peaks at 412 nm was due to either a few PNA molecules
associating with each other or secondary structure hindering the access of the thiol group.
Figure 3.4. Ellman’s reaction with the DNA (DP14), PNA (PP14) and modified PNA
(PP14A) probes. Peak at 412 nm was be used to compare the reaction of thiol groups
with the Ellman’s reagent between the DNA, original and modified PNA probes.
Combining the characteristics of the unmodified PNA probe with the results from
the reaction with the Ellman’s reagent, it could be concluded that the combination of all
of these factors that made the original PNA probe nonfunctional. Fortunately, by making
a relatively small change to the original probe to make it more soluble and disrupt any
secondary structure and intermolecular interactions, it was possible to overcome the
problems faced with the original PNA probe PP14.
3.3 Validation of the assay with a short synthetic DNA target
When a new target sequence is chosen for detection, the first step in the
development of the assay is validation of the new probe. In addition, we created a new
microsensor structure for this application, and it was necessary to determine whether it
![Page 44: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/44.jpg)
37
was optimal for the assay. Hybridization experiment with a short synthetic target
complementary to the e14a2 type fusion modified PNA probe was performed. Although,
synthetic target sequences are not directly relevant to clinical diagnostics, factors such as
stability of the NME, quality of the probe monolayer and the probe’s specificity and
could be assessed using this approach.
Figure 3.5. Electrocatalytic detection of a 20-nucleotide long DNA target. Cyclic
voltammogram (A) and differential pulse voltammogram (B) of PP14A probe before
(dotted line) and after hybridization (solid line) with 100 fM target.
To monitor hybridization at the surface of the NME, cyclic voltammetry and
differential pulse voltammetry were carried out. Two scans were performed, one before
hybridization and one after hybridization with the target sequence (Figure 3.5). From the
CV and DPV scans it was clear that the signal (ruthenium (III) hexamine reduction peak
at – 175 mV) increased after addition of the target to the chip, which indicated
hybridization between the probe and the target. As previously described, reduction of the
positive reporter ion ruthenium (III) hexamine occurs at -175 mV, and both cyclic and
differential pulse voltammogram clearly showed that. The concentration of the DNA
B A
![Page 45: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/45.jpg)
38
target used in this experiment was 100 fM, which was well above the expected detection
limit to ensure that the system performs well.
Another important parameter to assess was the specificity of the assay, which was
evaluated by including a probe with an unrelated sequence and incubating it with the
DNA target of interest. From Figure 3.6, it was evident that the assay was specific as no
target bound to the negative control probe, while with the complementary probe
hybridization with 100 fM and 100 pM produced a large signal change.
Figure 3.6. Confirmation of specificity of the electrocatalytic assay. 100 fM and 100
pM DNA target sequence were hybridized with PP14A probe (e14a2 fusion type),
negative control was a probe with an unrelated sequence hybridized with 100 pM
target. For this experiment, the signal changed was quantified by dI= (Iafter hybridization-I
before hybridization/I before hybridization)*100%
This proof-of-principle experiment with synthetic DNA target showed that the
new probe and NME were functional. The next step in the development of the assay was
to work with the biologically relevant samples, such as mRNA from a CML cancer cell
line K562 that carried the e14a2 fusion.
![Page 46: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/46.jpg)
39
3.4 Absolute quantification of the bcr-abl gene fusion in K562 cells
The K562 cell line was selected as a model system for the assay development
because it carries the Ph chromosomes, and as a result expresses fusion mRNA.
However, the number of the fusion transcripts per cell was unknown, thus a
quantification experiment was carried out to determine how much target was present per
cell.
Reverse transcription (RT) followed by a polymerase chain reaction (PCR) is a
sensitive method for analyzing both absolute and relative amount of mRNA transcripts in
a cell (Heid et al., 1996; Schmittgen, 2001; Pfaffl & Hageleit, 2001). Real-time RT-PCR
utilizing SYBR Green dye for readout can be used to determine the absolute number of
the transcript of interest. SYBR Green dye detects the products of polymerase chain
reaction by intercalating into double-stranded DNA formed during the amplification step.
The result is an increase in fluorescence intensity, which is proportional to the amount of
the PCR product. The two-step process starts with a reverse transcription reaction in
which total isolated RNA or mRNA is converted to cDNA either using gene specific
primers, random hexamers or oligo dT primers. The second step is amplification of the
gene (cDNA) of interest. This is the step in which SYBR Green gets intercalated into a
newly synthesized double strand. Fluorescent signal increases with each cycle and is
recorded in the amplification plot, which is fluorescence versus cycle number. The fewer
the copy number, the longer it takes to detect a signal. The threshold cycle (Ct) is chosen
by identifying the point where all the reactions produced a signal. The fluorescence signal
is constant at the threshold value, however Ct values vary for different PCR reactions
depending on the starting amount of the template. Moreover, the Ct value is considered a
![Page 47: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/47.jpg)
40
relative measure of concentration of the amplification products. To obtain an accurate
absolute value using this technique, a very precise calibration curve is required.
Generation of an external calibration curve using recombinant DNA (recDNA) is
considered the most reliable standard for absolute quantification of a target. Such
recDNA consists of a PCR product inserted into a plasmid to mimic the copy DNA
(cDNA) of interest, and the region amplified in the unknown and the recDNA is identical
making the Ct values of both reactions comparable. The accuracy of an absolute real-time
RT-PCR assay depends on the condition of ‘identical’ amplification efficiencies for both
the native target in a pool of different cDNA molecules and the known standards in
amplification step (Pfaffl & Hageleit, 2001).
To do the absolute quantification, a set of primers were designed to amplify a 275
base pair region unique to e14a2 fusion. The reverse transcription step was performed to
make cDNA, following by an amplification step to produce one PCR product that could
be subsequently cloned into a plasmid (recDNA) to be used as a standard. A 275 bp
product was amplified and run on a 2% agarose gel to confirm the size (Figure 3.7). The
band highlighted in the red box is the product, the low molecular weight bands are due to
the primers.
Figure 3.7. Amplification of a 275 bp fusion region. Lane 1- DNA ladder, lane 2-
cDNA plus the primers and reaction mix, lane 3- no template cDNA.
1 2 3
100 bp
200 bp
300 bp
![Page 48: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/48.jpg)
41
The amplification product was purified from the gel and cloned into a pCR4-
TOPO plasmid (Figure 3.8A). The commercially available plasmid vector was linearized
with topoisomerase covalently bound to the vector revealing the 3´ thymidine overhangs
ideal for cloning. Topoisomerase I from Vaccinia virus I was covalently bound to
plasmid DNA by a covalent bond between the 3′ phosphate of the cleaved DNA strand
and a tyrosyl residue (Tyr-274) of the enzyme. Since Taq polymerase left a single
deoxyadenosine at the 3´ ends of PCR product, it could be inserted into the vector that
had the T overhangs. The phospho-tyrosyl bond between the DNA and enzyme was
attacked by the 5′ hydroxyl of the PCR product allowing for efficient ligation (Figure
3.8B).
Figure 3.8. Cloning with PCR-4 TOPO. A) pCR4-TOPO plasmid map, indicating
where the PCR product was inserted. B) PCR product is inserted into the plasmid
via reaction with the phosphate group covalently attached to topoisomerase enzyme.
The next step involved transformation of the plasmid into competent E. coli cells
for its subsequent amplification. Once the plasmid was amplified and isolated from the
bacteria, it was cut with EcoRI endonuclease to ensure the presence of the insert and
A B
![Page 49: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/49.jpg)
42
verify its size (Figure 3.9). The plasmid was further linearized with NaeI for the RT-PCR
reaction.
Figure 3.9. RT-PCR of the bcr-abl fusion transcript. Lane 1- DNA ladder, lane 2-
uncut plasmid, lane 3- EcoRI digestion, lane 4- NaeI linearization.
The recDNA can also be used for synthesis of in-vitro RNA that mimics fusion
mRNA, but could be produced at much higher concentrations and used for the
hybridization experiments. This saves time on growing CML cancer cells such as K562
and isolating total mRNA at initial stages of optimization of the assay. To make the
synthetic mRNA, it was necessary to find out the orientation of the insert in the plasmid.
The vector had two promoters, one for T3 and the other for T7 polymerases, and with
sequencing of the vector, one could determine which one to use to obtain the transcript
that would be same as the native mRNA and complementary to the probe (Figure 3.10).
From the sequencing result, it was found that T7 polymerase needed to be used and in-
vitro RNA was synthesized. The RNA was run on 1 % agarose gel to analyze the quality,
since RNA could be degraded due to contamination with RNases. Although the sample
was pure and no degradation was observed, instead of one band, two bands of equal
intensities were observed. Difference in sizes of the two RNA products would not affect
200 bp
300 bp
400 bp
1 2 3 4
![Page 50: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/50.jpg)
43
downstream experiments, because both products contained the fusion region. Based on
the plasmid sequence, NaeI was expected to cut the plasmid only in one location, making
one linear fragment. The insert did not contain the NaeI cut site either. One explanation
was that the T7 polymerase produced two different length transcripts at equal efficiency
due to a region in the sequence that half of the time made the polymerase stop.
Figure 3.10. In-vitro RNA synthesis. A) Depending on the orientation of the PCR
product, either T3 or T7 polymerase needed to be used. B) In-vitro synthesized
RNA, lane 1- RNA in reaction buffer, lane 2- RNA denatured with formamide.
Finally, the absolute quantification of e14a2 fusion transcript was performed. The
calibration curve is illustrated in Figure 3.11, which gives the Ct values corresponding to
the known concentration of recDNA standards that were made over a 4-log range. The
unknown sample, which was total mRNA extracted from K562 cell line underwent RT
step first and then the amplification steps, same as recDNA standards, which allowed to
use the standard curve to determine the number of target molecules in the unknown
sample.
T3 T7
1 2 A B
T7 RNA product
T3 RNA product
![Page 51: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/51.jpg)
44
Figure 3.11. Standard curve for the RT-PCR reaction. By comparing the Ct values
from the unknown samples with calibration curve, one could determine the original
number of the molecules present in that sample.
To determine the copy number of the fusion transcript in total mRNA, Ct values
of the unknown was compared to the calibration curve values (Figure 3.11). Assuming
that there was 1 pg of mRNA per K562 cells, there were 100,000 copies per 5 ng of
mRNA or 20 copies per cell. This was consistent with an accepted literature value for
non-abundant or transcripts of non-housekeeping genes containing on average 20 copies
per cell (Alberts et al., 1994).
3.5 Optimization of the assay with mRNA target
To test the new NME for sensitivity with a biologically relevant sample, total
mRNA was extracted from K562 cells, which carried one of the two gene fusions
(e14a2). The procedure is summarized in Figure 3.12.
y = -2.5032x + 32.27
R2 = 0.9705
10
12
14
16
18
20
22
24
4 5 6 7 8
Log (copy number)
Ct
![Page 52: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/52.jpg)
45
Figure 3.12. Isolation of total mRNA from K562 cells and hybridization analysis
using the chip-based electrochemical assay.
The sample was quantified using absorbance at 260 nm and titrated onto the
chips. A negative control was run in parallel, which was a probe with an unrelated
sequence with the highest titrant concentration showed signal decrease. The negative ∆I
was due to loss of probe from the surface of the NME. Detectable signal was observed
with the titrant concentration as low as 1 pg/µL of total mRNA (Figure 3.13A).
Figure 3.13. Determination of sensitivity with total isolated mRNA from K562 cells.
A) Titration with mRNA using the chip-based electrochemical assay, the detection
limit was 1 pg/µL, corresponding to 30 cells. B) Commercially available PCR-based
assay with a detection limit of about 25 cells (Jobbagy et al., 2007).
Grow CML cell
line K562 Isolate mRNA Deposit on chip Analyze
A B
![Page 53: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/53.jpg)
46
The detection limit with mRNA target has been improved from the previous
studies with detection of prostate specific fusion transcripts 1000-fold by optimizing the
assay, most importantly designing a new NME. Assuming that there was 1-2 pg of total
mRNA per cell and the hybridization sample volume was 30 µL, this translated into
mRNA from 30 cells. Taking into account the result from the quantitative PCR
experiment, 30 cells would have on average 600 fusion transcripts, similar to detection
limit of 100 molecules with short DNA targets previously reported with this system
(Soleymani et al., 2009). This result is comparable with a commercially available PCR-
based assay designed to specifically detect CML that has reported a similar sensitivity
(Figure 3.13B) (Jobbagy et al., 2007). This new detection limit with long mRNA target
molecules showed the versatility of the system, as it could be customized to detect
various clinically relevant targets, as previously a low detection limit was observed with
detecting head and neck cancer specific short microRNA molecules (Yang et al., 2009).
3.6 Detection of fusion transcripts from whole cell lysates
The detection of mRNA transcripts has not yet been accomplished from an
unpurified cellular lysate. For example, to date all PCR assays include RNA purification
step prior to target amplification due to complexity of the sample. In a cell lysate, the
amount of fusion mRNA transcripts, which is typically 20 copies per cell is insignificant
compared to all other RNA and DNA molecules, proteins, and other macromolecules. In
addition, cellular and organellar membrane fragments add to all the material that could
potentially inhibit detection of the few fusion transcripts. Furthermore, cell lysis release
RNases that rapidly degrade the RNA molecules.
![Page 54: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/54.jpg)
47
Figure 3.14. Lysis of the cells was accomplished by applying an electric field. A)
Schematic illustration of the lysis procedure. B) Cells under the light microscope
before and after lysis.
Nonetheless, to test whether it was possible to detect fusion mRNA from an
unpurified sample, K562 cells were lysed using an electric field. This allowed for a rapid
lysis (less than 5 minutes) and did not require addition of any agents, such as detergents,
that could affect subsequent events in the assay (Figure 3.14). From the light microscope
images, it was apparent that virtually all cells were ruptured, since the image taken after
lysis showed a clear solution.
The lysed sample was added to the chips to find out if hybridization could be
detected. The DPV signals were measured before and after hybridization with lysate
containing 10 cells and 1000 cells and the results are illustrated in Figure 3.15. It was
evident that the increasing number of cells produced a much higher signal after
hybridization to the probe, indicating that not all of the target transcripts were degraded
e-
Lysis
A
B
100 µm 100 µm
![Page 55: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/55.jpg)
48
and the probe was able to catch them regardless of all the other molecules and cellular
material in the hybridization solution.
Figure 3.15. Hybridization with unpurified cell lysates. DPV signal before (dotted
line) and after hybridization (solid line) with the lysate of 10 (A) and 1000 (B) cells.
Both concentrations produced signal increase indicating hybridization at the NME.
A titration experiment with 10, 50, 100, 500 and 1000 K562 cells is illustrated in
Figure 3.16. The negative control here was a half complementary probe (probe for the
e13a2 gene fusion) and showed no signal increase indicating specificity of the assay. The
signal has reached a plateau once the cell number was increased to 5000 and 10,000 cells
(the results not shown), making the dynamic range only 3 orders of magnitude. This is
due to probe being saturated with the target and addition of more molecules did not
produce an even larger signal increase. One solution to overcome this would be to make
an array of NME with slightly bigger sizes that would be suitable for detection of more
concentrated samples if needed. However, a yes-or-no answer concerning whether the
fusion was present or not could be given over a wider range.
A B
![Page 56: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/56.jpg)
49
Figure 3.16. Determination of sensitivity of the system with unpurified whole cell
lysates. The detection limit was 10 K562 cells, the negative control, which was a half
complementary probe did not produce a signal increase.
It was evident that the purification step was not necessary for detection of the
fusion in unpurified lysate, and the rest of the cellular contents did not affect the detection
of the fusion transcript. Interestingly, the detection limit was very close to that of purified
mRNA suggesting that assay worked just as well for unpurified sample. The degradation
was not an issue, most likely because the assay time was decreased from 1 hour as with
purified mRNA to 30 minutes, which could prevent extensive degradation and affect the
assay.
3.7 Whole blood spiked with cell lysate
Analysis of complex samples has always been challenging due to their
heterogeneity. In particular, analyzing nucleic acids in blood is problematic due to their
rapid degradation. We sought to challenge our system with K562 spiked blood and then
analyze whether accurate analysis could be performed. Blood is a complex mixture of
cells, biomolecules, including proteins that bind and degrade nucleic acids (Table 5).
![Page 57: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/57.jpg)
50
Table 5. Cell content of blood and typical hybridization sample.
Blood cell type Blood cells / µL Hybridization sample (40
uL) on average/ cells
Erythrocytes 4.2 to 5.9 x106 202,000
Leukocytes 4,500 to10,000 2,900
Platelets 150,000 to 400,000 110,000
Prior to lysis, whole blood was diluted 100 times with 1XPBS buffer otherwise
the sample clogged the channels of the microfluidic lysis chamber and made it extremely
challenging to obtain enough material for the hybridization experiment. A typical
hybridization sample volume was 40 µL and contained over 200,000 erythrocytes,
100,000 platelets and almost 3,000 white blood cells, all of which contain nucleic acids.
Upon lysis of whole blood, nucleic acids are released from the leukocytes, and their rapid
degradation occurs. As a result the hybridization solution would have a large number of
nucleic acids that would be expected to create a high background signal. Consequently, it
was important to determine the background signal produced from addition of whole
blood alone, and then check if it was possible to detect any signal above that after
addition of K562 cells lysate to the sample.
Titration with 1000, 500 and 10 K562 cells in whole blood was done to determine
whether it was possible to distinguish the signal from the different amount of fusion in
the sample.
A fully complementary probe P14A was incubated with a blood sample alone to
determine the background signal. A negative control, which was a half complemetrary
![Page 58: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/58.jpg)
51
probe P13A was incubated with the highest titrant concentration of 1000 cells in blood to
ensure specificity. As expected, a high background signal was produced from the blood
sample only, which was subtracted from the signal obtained with samples containing both
the blood and different amount of K562 cells (Figure 3.17).
Figure 3.17. Whole blood spiked with K562 cell lysates. 1000, 500 and 10 lysed
K562 cells were added to lysed blood and hybridized on the chip. Negative control
was half complementary probe with 1000 K562 cells spiked blood. Signal from
blood was measured and was subtracted from signals from 1000, 500 and 10 cells.
Hybridization time in this assay was shortened, because of the potential for the
rapid degradation of nucleic acids. A signal was observed with addition of blood only
(background signal), which suggested that nucleic acid hybridization, most likely the
nucleic acids degradation products. Interestingly, the signal produced by 1000 cells was
very similar with signal from 10 cells, which was not the case in both experiments with
purified mRNA and K562 lysates. This could be due to sample degradation and non-
specific binding of nucleic acids, as a result blocking hybridization of the fusion mRNA
with the probe on the surface of the NMEs.
![Page 59: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/59.jpg)
52
When working with blood samples, target RNA degradation and non-specific
binding are major issues. In this case the time it took to complete the assay was crucial in
the getting a signal. One way to reduce the background signal is to have an automated
system, which is would minimize the preparation time between each step of the assay. It
is worth mentioning in this work, that currently an automated point-of-care device is
being designed and built in the Kelley group, which would potentially improve the
performance of the assay. Nevertheless, the titrant signal was higher than the background
hybridization of the fusion transcript was detected even in a blood sample.
3.8 Analysis of CML patient samples
After accomplishing high sensitivity with isolated mRNA and unpurified cell
lysates, analysis of patient samples was sought. The ability of the assay to analyze white
blood cells from human peripheral blood for the gene fusion would be a step forward
towards bringing the chip-based assay to the clinic.
Two patient samples were analyzed. These samples were mononuclear cells
isolated either from peripheral blood and/or bone marrow samples at presentation, post
induction, post consolidation and relapse from the patients diagnosed with CML. In brief,
since CML is characterized by an increased production of one cell type (Figure 3.18), the
majority of the population of the cells is mostly the granuloid cells if no treatment is
being done.
![Page 60: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/60.jpg)
53
Figure 3.18. Development of CML begins with a mutation in the hematopoietic stem
cell in the bone marrow. The disease is characterized by increased production of
granuloid cells at the expense of the other cell types (Adapted from Ren, 2005).
We analyzed patient cells containing the e14a2 gene fusion which is the same
fusion type as the K562 cells. The assay with these cells was done in an exactly similar
manner as the K562 assay.
The fusion type was confirmed by RT-PCR. One set of primers was designed that
can amplify a fusion of both fusion types, however their sizes would differ due to an
extra exon in the e14a2 type. The result is illustrated in Figure 3.19, the lane 3 has a
product that is the same in size as the product in lane 2 from amplification of the fusion
of K562 cells (e14a2 type).
![Page 61: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/61.jpg)
54
Figure 3.19. Confirmation of the fusion type in a patient sample. Lane 1- DNA
ladder, lane 2- amplified fusion region from K562 total mRNA, and lane 3-
amplification product from the patient sample.
To evaluate the sensitivity of the assay using the patient sample a titration
experiment was carried out. The result is illustrated in Figure 3.20, which is the plot of
DPV signals after hybridization of the probe with 100, 1000 and 10 000 cells. An
increase in signal was observed with increase in the concentration of the sample.
Figure 3.20. Determination of sensitivity with patient sample 1, DPV signals after
probe (black) hybridization with 100 (blue), 1000 (green) and 10,000 (red) cells.
1 2 3 4
300 bp
![Page 62: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/62.jpg)
55
A titration experiment with a second patient sample was done to compare with the
results from the patient sample 1 (Figure 3.21). The negative control was the half probe
complementary to e14a2, which is fully complementary to e13a2 type fusion. Absence of
signal with the negative control again confirms the specificity of hybridization. It also
suggests that the wild type bcr or abl genes will unlikely give a signal (both being only
half complementary to the probe) and in future probes for bcr and abl can be used as
internal controls. The detection limit here was 100 cells. However, the percentage of cells
containing the gene fusion was not known, thus it is possible that only some cells
expressed the bcr-abl, explaining a larger number of cells needed to get a signal.
Figure 3.21. Determination of a sensitivity and detection limit with two different
patient samples. Total white blood cells were lysed and added onto the chip. A
negative control was a half-complementary probe with the highest number of cells.
Sample 1 Sample 2
Number of cells
![Page 63: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/63.jpg)
56
Finally, one of the patient samples was spiked into whole blood. In a manner
similar to the K562 spiked blood experiment to find out if the bcr-abl transcripts can be
detected. This would be the closest to the clinically relevant test, where a patient’s blood
would be analyzed for the mRNA biomarker. In this experiment, two negative controls
were used, one was the e14a2 probe with blood alone, and the second control was the
half complementary probe e13a2 with the highest number of cells (10,000) spiked into
blood. From previous real-time hybridization studies it was found that maximum change
in signal is observed after 10 minutes of hybridization. Based on that fact, and
considering the degradation rate of nucleic acids in blood, 10, 100, 1000 and 10 000 cells
in whole blood were hybridized for less than 20 minutes. The result is illustrated in
Figure 3.22. From the titration data, it can be concluded that the signal reached a plateau
at 100 cells, with 10 and 10,000 cells producing a similar change in signal, a similar
observation as with whole blood spiked with K562 cells. Negative control 2 showed a
much smaller signal change, than the samples incubated with the fully complementary
probe, indicating specificity of the assay. The background signal from blood was
significantly lower than the signal obtained from the samples containing blood plus K562
cells. This difference could be due to shorter hybridization time in this particular
experiment. This potentially reduced the amount of degradation of nucleic acids in the
sample that would accumulate at the surface of the NME and prevent the hybridization of
the target bcr-abl transcript hybridization with the probe. At the same time if a lot of
nonspecific accumulation occurred at the surface it would block the access of the
ruthenium hexamine ions and would decrease the electrochemical signal.
![Page 64: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/64.jpg)
57
Figure 3.22. Whole blood spiked with patient sample 3. Whole blood and cells were
lysed separately and then combined before adding to the chip. After hybridization
at 37ºC for 15 minutes, the signal was measured. Negative control 1 was blood only;
negative control 2 was half complementary probe with 10,000 cells.
As expected, working with complex samples such as blood is much more
challenging that with cell lysates or purified nucleic acids. However, the ability of the
system to detect fusion even in blood samples has been demonstrated. The next step
would be to include the internal controls for the wild type bcr and abl genes and house
keeping genes and determine the reproducibility of this assay. One other critical
experiment is to check background signal from blood alone from different healthy
individuals lacking the bcr-abl transcript. Furthermore, the assay could be optimized for
bringing down the background signal from blood, for example by trying RNase inhibitors
to find out if the nucleic acid degradation can be slowed down for the time of the assay
and increase the dynamic range.
![Page 65: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/65.jpg)
58
4.0 Conclusion
In summary, this study has demonstrated an important step forward in the analysis
of nucleic acid biomarkers using a nanosensor-based electrochemical assay. It was
possible to detect mRNA from cell lysates as well as blood containing samples with the
sensitivity and selectivity comparable to that of the homogeneous samples. With chronic
myelogenous leukemia, monitoring different response levels to treatment have been
described (Table 6) (Radich, 2009). Initial response to treatment includes complete
hematologic response, which is the normal number of different blood cell types.
Cytogenic response, which measures the amount of Ph chromosome can also vary
between minor, partial and complete and would indicate the response to treatment and
likely course of the disease development. With the tyrosine kinase inhibitor treatment, the
number fusion transcripts can be dramatically decreased or even disappear completely,
which is evidently the most desirable outcome as at that point the patient is virtually
healthy if the treatment continues for life. To continue to be disease-free and avoid
disease relapse at this stage due to resistance to the treatment, each patient undergoes a
periodic PCR-based test to quantify the fusion transcript or confirm its absence.
The assay described in this work has demonstrated great potential for doing what
is currently accomplished with PCR in terms of detection of bcr-abl fusions, as the
sensitivity of the two methods are similar and the electrochemical assay can be used as
both quantitatively and qualitatively depending on the nature of the sample analyzed.
![Page 66: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/66.jpg)
59
Table 6. Monitoring response to treatment of CML (adapted fromRadich, 2009).
Level of Response Definition
Complete hematologic response Normal complete blood count and
differential
Minor cytogenic response 35%-90% Ph+ metaphases
Partial cytogenic response 1%-34% Ph+ metaphases
Complete cytogenic response 0% Ph+ metaphases
Major molecular response ≥ 3-log reduction of bcr-abl mRNA
Complete molecular remission Negative by qRT-PCR
The platform has been previously characterized as robust, cost-effective, fast,
simple to use, sensitive and selective (Soleymani et al., 2009). The results presented here
show the versatility of the system in terms of analyzing a wide range of samples, such as
short nucleic acid target molecules, purified mRNA or complex blood samples. The next
step would require including necessary internal controls, such as the probes for wild type
bcr and abl genes, and testing a large number of patient samples both healthy and
diagnosed with CML.
![Page 67: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/67.jpg)
60
References
Advani, A. S., & Pendergast, A. M. (2002). Bcr-Abl variants: biological and clinical
aspects. Leukemia Research, (26), 713-720.
Alberts, B, Bray, D., Lewis, J., Raff, M., Roberts, K., & Watson, J. D. (1994). Molecular
Biology of the Cell, 3rd edition, New York: Garland Science.
Bailey, V., Puleo, C. M., Ho, Y. P., Yeh, H. C., & Wang, T. H. (2009). Quantum dots in
molecular detection of disease. Conf Proc IEEE Eng Med Biol Soc., 4089-92.
Bernarda, P., & Wittwer, C. (2002). Real-Time PCR Technology for Cancer Diagnostics.
Clinical Chemistry (48), 1178-85.
Bin, X., & Kelley, S. O. (2010). Nanostructuring of sensors determines the efficiency of
biomolecular capture. Anal Chem. 82 (14), 5928-31.
Burmeister, T., Maurer, J., Aivado, M., Elmaagacli, A. H., Grunebach, F., Held, K.R. et
al. (2002). Quality assurance in RT-PCR-based BCR/ABL diagnostics—results of
an interlaboratory test and a standardization approach. Leukemia (14), 1850–56.
Capdeville, R., Buchdunger, E., Zimmermann, J., & Matter, A. (2002). Glivec (STI571,
Imatinib), a rationally developed, targeted anticancer drug. Nature reviews, Drug
Discovery (1), 493-502.
Chen, X., Xie, H., Seow, Z. Y., & Gao, Z. (2010). An ultrasensitive DNA biosensor
based on enzyme-catalyzed deposition of cupric hexacyanoferrate nanoparticles.
Biosens Bioelectron., 25(6), 1420-6.
Deininger, M., Goldman, J. M., & Junia, V. M. (2000).The molecular biology of chronic
myeloid leukemia. Blood, 96 (10), p. 3343-56.
Dewald, G.W., Wyatt, W.A., Juneau, A.L., Carlson, R. O., Zinsmeister, A.R., Jalal., S.
M., et al. (1998). Highly sensitive fluorescence in situ hybridization method to
detect double BCR/ABL fusion and monitor response to therapy in chronic
myeloid leukemia. Blood, (91), 3357-65.
Ellman, G. L. (1959). Arch. Biochem. Biophys., (82), 70-77.
Etzioni, R., Urban, N., Ramsey, S., McIntosh, M., Schwartz, S., Reid, B., et al. (2003).
The case for early detection. Nature Reviews Cancer, (3), 1-10.
![Page 68: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/68.jpg)
61
Evans, D. H., O'Connell, K. M., Petersen, R. A., & Kelly, M. J. (1983). Cyclic
Voltammetry. Journal of chemical education, (60), 290-93.
Fang, Z., Soleymani, L., Pampalakis, J., Yoshimoto, M., Squire, J. A., Sargent, E. H., &
Kelley, S. O. (2009). Direct Profiling of Cancer Biomarkers in Tumour Tissue
Using a Multiplexed Nanostructured Microelectrode Integrated Circuit. ACS
Nano, (3), 3207-13.
Fang, Z., & Kelley, S. O. (2009). Direct Electrocatalytic mRNA Detection Using PNA-
Nanowire Sensors. Anal. Chem., (81), 612-17.
Feng, Q., Yu, M., & Kiviat, N. B. (2006). Molecular Biomarkers for cancer detection in
blood and bodily fluids. Critical Reviews in Clinical Laboratory Sciences, 43(5–
6), 497–560.
Gasparac, R.L., Taft, B. J., Lapierre-Devlin, M. A., Lazareck, A. D., Xu, J. M., & Kelley,
S. O. (2004). Ultrasensitive Electrocatalytic DNA Detection with 3D
Nanoelectrodes. J. Am. Chem. Soc., (126), 1270-71.
Giljohann, D., & Mirkin, C. (2009). Drivers of biodiagnostic development. Nature 462
(26), 461-64.
Gleissner, B., Rieder, H., Thiel, E., Fonatsch, C., Janssen, L. A., Heinze, B., et al. (2001).
Prospective BCR-ABL analysis by polymerase chain reaction (RT-PCR) in adult
acute B-lineage lymphoblastic leukemia: reliability of RT-nested-PCR and
comparison to cytogenetic data. Leukemia, (15), 1834-40.
Hage, D. (1999). Immunoassays. Anal. Chem., 71 (12), 294–304.
Heid, C. A., Stevens, J., Livak, K. J., & Williams, P. M. (1996). Real time quantitative
PCR. Genome Res., 6, 986-94.
Jobbagy, Z., van Atta, R., Murphy, K. M., Eshleman, J. R., & Gocke, S. D. (2007).
Evaluation of the Cepheid GeneXpert BCR-ABL Assay. Journal of Molecular
Diagnostics, 9 (2), 220-27.
Kantarjian, H. M., Cortes, J., La Rosée, P., & Hochhaus, A. (2010). Optimizing Therapy
for Patients with Chronic Myelogenous Leukemia in Chronic Phase. Cancer
Review, 116 (6), 1419-30.
Lapierre, M. A, O'Keefe, M., Taft, B. J., & Kelley. S. O. (2003). Electrocatalytic
Detection of Pathogenic DNA Sequences. Anal. Chem., (75), 6327-33.
![Page 69: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/69.jpg)
62
Lozzio, C. B., & Lozzio, B. B. (1975). Human chronic myelogenous leukemia cell-line
with positive Philadelphia chromosome. Blood (45), 321-34.
Müller, M. C., Hördt, T., Paschka, P., Merx, K., La Rosee P., Hehlmann, R. et al. (2004)
Standardization of preanalytical factors for minimal residual disease analysis in
chronic myelogenous leukemia. Acta Haematol, (112), 30–33.
Nair, P.R., & Alam, M. A. (2006). Performance limits of nanobiosensors. Appl. Phys.
Lett., (88), 233120- 23.
Nam, J., Stoeva, S. I., & Mirkin, C. A. (2004). Bio-Bar-Code-Based DNA Detection with
PCR-like Sensitivity. J. Am. Chem. Soc., 126 (19), 5932–33.
Nashed, A.L., Rao, W., & Gulley, M. L. (2003). Clinical Applications of BCR-ABL
Molecular Testing in Acute Leukemia. JMD, 5 (2), 63-72.
Negm, R., Verma, M., & Srivastava, S. (2002). The promise of biomarkers in cancer
screening and detection. Trends in Molecular Medicine, 8 (6), 288-93.
Nowell, P. C., & Hungerford, D. A. (1960). A minute chromosome in human chronic
granulocytic leukemia. Science. (132), 1497.
Osteryoung, J. (1983). Pulse Voltammetry. Journal of chemical education. 60 (4), 296-
98.
Pelz, A. F., Kröning, H., Franke, A., Wieacker, P., & Stumm, M. (2002). High reliability
and sensitivity of the BCR/ABL1 D-FISH test for the detection of BCR/ABL
rearrangements. Ann. Hematol, (81), 147-53.
Pfaffl, M. W., & and Hageleit, M. (2001). Validities of mRNA quantification using
recombinant RNA and recombinant DNA external calibration curves in real-time
RT-PCR. Biotechnology Letters, (23), 275-82.
Piazza, R., Magistroni, V., Andreoni, F., Franceschino, A., Tornaghi, L., Varellaet, M.,
al. (2005). Imatinib dose increase up to 1200 mg daily can induce new durable
complete cytogenetic remissions in relapsed Ph+ chronic myeloid leukemia
patients. Leukemia, (19), 1985–87.
Radich, J. P. (2009). How I monitor residual disease in chronic myeloid leukemia. Blood,
114 (16), 3376-81.
Ren, R. (2005). Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous
leukaemia. Nat Rev Cancer, (5), 172-83.
![Page 70: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/70.jpg)
63
Rowley, J. D. (1973). Letter: a new consistent chromosomal abnormality in chronic
myelogenous leukaemia identified by quinacrine fluorescence and Giemsa
staining. Nature, (243), 290-93.
Schmittgen, T. D. (2001) Real-time quantitative PCR. Methods, (25), 383-85.
Sedlak, J., & Lindsay, R. H. (1968). Estimation of total, protein bound and nonprotein
sulthydryl groups in tissue with Ellman's reagent. Anal. Biochem., (25), 192-205.
Sengupta, S., & Sasisekharan, R. (2007). Exploiting nanotechnology to target cancer.
British Journal of Cancer, (96), 1315 – 19.
Sheehan, P. E., & Whitman, L. J. (2004). Detection Limits for Nanoscale Biosensors.
Nano Letters, (5), 803-7.
Soleymani, L., Fang, Z., Sargent, E. H., & Kelley, S. O. (2009). Programming the
Detection Limits of Biosensors through Controlled Nanostructuring. Nature
Nanotechnology, (4), p. 844-48.
Soleymani, L., Fang, Z., Sun, X., Yang, H., Taft, B. J., Sargent, E. H., & Kelley, S. O.
(2009). Nanostructuring of Patterned Microelectrodes to Enhance the Sensitivity
of Electrochemical Nucleic Acids Detection. Angewandte Chemie, (48), 8457-60.
Star, A., Tu, E., Niemann, J., Gabriel, J. P., Joiner, S. C., & Valcke, C. (2006). Label-
Free Detection of DNA Hybridization Using Carbon Nanotube Network Field-
Effect Transistors. Proc. Natl. Acad. Sci., (103), 921–26.
Taft, B., O’Keefe, M., Fourkas, J. T., & Kelley, S. O. (2003). Engineering DNA-
Electrode Connectivities: Manipulation of Linker Length and Structure. Anal.
Chim. Acta., (496), 81-91.
Thaxton, C. S., Georganopoulou, D. G., & Mirkin, C. A. (2006). Gold nanoparticle
probes for the detection of nucleic acid targets. Clinica Chimica Acta, 363 (1-2),
120-26.
Urbanova, M., Plzak, J., Strnad, H., & Betka, J. (2010). Circulating nucleic acids as a
new diagnostic tool. Cellular and Molecular Biology Letters, (15), 242-59.
Wang, H, Bhunia, A. K., & Lu, C. A microfluidic flow-through device for high
throughput electrical lysis of bacterial cells based on continuous dc voltage.
Biosensors and Bioelectronics, 22 (50), 582-588.
![Page 71: Detection of the BCR-ABL leukemia gene fusion …...ii Detection of the BCR-ABL leukemia gene fusion using chip-based electrochemical assay Elizaveta Vasilyeva Master of Science Graduate](https://reader030.vdocuments.site/reader030/viewer/2022040817/5e6148459c64b00e6456ec39/html5/thumbnails/71.jpg)
64
Weisser, A., La Rosee, P., Burmeister, T., Raff, T., Kneba, M., Hehlmann, R. et al.
(2001). Sensitivity, quality and comparability of BCR-ABL quantification by RT-
PCR: results of an interlaboratory analysis. Blood, 98 (Suppl 1), 320a.
Xu, F., Dong, C., Xie, C., & Ren, J. (2010). Ultrahighly sensitive homogeneous detection
of DNA and microRNA by using single-silver-nanoparticle counting. Chemistry,
16 (3), 1010-6.
Yang, H., Hui, A., Pampalakis, G., Soleymani, L., Liu, F., Sargent, E. H., et al. (2009).
Direct, Electronic MicroRNA Detection Reveals Differential Expression Profiles
in 30 Minutes. Angewandte Chemie, 48 (45), 8461-64.
Zheng, G., Patolsky, F., Cui, Y., Wang, W. U., & Lieber, C. M. (2005). Multiplexed
electrical detection of cancer markers with nanowire sensor arrays. Nature
Biotechnology 23 (10), 1294-1301.