Infection, Genetics and Evolution 12 (2012) 142–148

Contents lists available at SciVerse ScienceDirect

Infection, Genetics and Evolution

journal homepage: www.elsevier .com/locate /meegid

Deletion of the APOBEC3B gene strongly impacts susceptibility to falciparum malaria

Pankaj Jha a, Swapnil Sinha b, Kanika Kanchan b, Tabish Qidwai b, Ankita Narang a, Prashant Kumar Singh a,Sudhanshu S. Pati c, Sanjib Mohanty c, Saroj K. Mishra c, Surya K. Sharma d, Shally Awasthi e,Vimala Venkatesh e, Sanjeev Jain f, Analabha Basu g, Shuhua Xu h,Indian Genome Variation Consortium a, Mitali Mukerji a,⇑, Saman Habib b,⇑a Genomics and Molecular Medicine, Institute of Genomics and Integrative Biology, CSIR, Delhi, Indiab Division of Molecular and Structural Biology, Central Drug Research Institute, CSIR, Lucknow, Indiac Ispat General Hospital, Rourkela, Indiad National Institute of Malaria Research Field Station, Rourkela, Indiae Chhatrapati Sahuji Maharaj Medical University (CSMMU), Lucknow, Indiaf National Institute of Mental Health and Neuro Sciences, Bangalore, Indiag National Institute of BioMedical Genomics, Kalyani, Kolkata, Indiah Chinese Academy of Sciences and Max Planck Society (CAS-MPG), Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences,Chinese Academy of Sciences, Shanghai 200031, China

a r t i c l e i n f o

Article history:Received 1 August 2011Received in revised form 19 September 2011Accepted 3 November 2011Available online 12 November 2011

Keywords:APOBEC3BPlasmodium falciparumMalaria endemicityInnate responseStructural variation

1567-1348/$ - see front matter � 2011 Elsevier B.V. Adoi:10.1016/j.meegid.2011.11.001

⇑ Corresponding authors. Addresses: Division of Mogy, Central Drug Research Institute, CSIR, M.G. Road,2612411x4282; fax: +91 522 2623405 (S. Habibmedicine, Institute of Genomics and Integrative Bio110 007, India. Tel.: +91 11 27667806; fax: +91 11 27

E-mail addresses: mitali@igib.res.in (M. Muker(S. Habib).

a b s t r a c t

APOBEC3B, a gene involved in innate response, exhibits insertion–deletion polymorphism across worldpopulations. We observed the insertion allele to be nearly fixed in malaria endemic regions of sub-Sah-aran Africa as well as populations with high malaria incidence in the past. This prompted us to investigatethe possible association of the polymorphism with falciparum malaria. We studied the distribution ofAPOBEC3B, in 25 diverse Indian populations comprising of 500 samples and 176 severe or non-severePlasmodium falciparum patients and 174 ethnically-matched uninfected individuals from a P. falciparumendemic and a non-endemic region of India. The deletion frequencies ranged from 0% to 43% in the Indianpopulations. The frequency of the insertion allele strikingly correlated with the endemicity map of P. fal-ciparum malaria in India. A strong association of the deletion allele with susceptibility to falciparummalaria in the endemic region (non-severe vs. control, Odds ratio = 4.96, P value = 9.5E�06; severe vs.control, OR = 4.36, P value = 5.76E�05) was observed. Although the frequency of deletion allele was higherin the non-endemic region, there was a significant association of the homozygous deletion genotype withmalaria (OR = 3.17, 95% CI = 1.10–10.32, P value = 0.0177). Our study also presents a case for malaria as apositive selection force for the APOBEC3B insertion and suggests a major role for this gene in innateimmunity against malaria.

� 2011 Elsevier B.V. All rights reserved.

1. Introduction

The role of human genetic factors in susceptibility to Plasmo-dium falciparum malaria infection has been the subject of manyinvestigations (Kwiatkowski, 2005; Sirugo et al., 2008). However,most of these studies have implicated genes that affect parasitegrowth and survival in the blood stages and there is a dearth ofinformation on host responses to the infection in the early pre-erythrocytic liver stage or during parasite immune clearance in

ll rights reserved.

olecular and Structural Biol-Lucknow, India. Tel.: +91 522), Genomics and Molecularlogy, CSIR, Mall Road, Delhi667471 (M. Mukerji).

ji), saman.habib@gmail.com

the spleen. The human APOBEC family of (deoxy)cytidine deamin-ases play an important role in innate immunity. There has been anexpansion of the APOBEC3 locus in humans with eight APOBEC3forms (A–H) arranged in tandem and members of the human APO-BEC3 family have been shown to inhibit replication of viruses aswell as retrotransposition of endogenous elements (Bhattacharyaet al., 2008; Bonvin and Greeve, 2008; Harris and Liddament,2004; Stenglein and Harris, 2006). A common 29.5 kb human dele-tion polymorphism that removes the APOBEC3B gene has beenidentified and its distribution in the Human Genome DiversityPanel (HGDP) of world populations has been studied (Kidd et al.,2007). APOBEC3B has been shown to inhibit HBV replication inthe hepatocytes and has been implicated as a potent innate antivi-ral factor (Zhang et al., 2008). In a recent report on expressionprofiling of mouse hepatocyte genes upon infection with therodent parasite Plasmodium berghei a significant enhancement of

P. Jha et al. / Infection, Genetics and Evolution 12 (2012) 142–148 143

expression of a member of the APOBEC (apolipoprotein B editingcomplex 1) gene family was also observed in early stages of infec-tion (Albuquerque et al., 2009). In addition, quantitative profilingof APOBEC3B has revealed significant expression in the spleen,the major site for immune clearance of erythrocytic parasites(Refsland et al., 2010).

Observations on the architecture, deletion frequency distribu-tion and haplotype structure at the APOBEC3B locus in worldpopulations have indicated significance of the polymorphism andrevealed a weak signal of selection for the deletion (Kidd et al.,2007). The fixation of the APOBEC3B insertion allele in populationsof the malaria-endemic regions of sub-Saharan Africa (Kidd et al.,2007) and the induction of APOBEC1 expression upon infection ofliver cells in mice (Albuquerque et al., 2009) prompted us to inves-tigate the possible association of the polymorphism with falcipa-rum malaria. We thus investigated the distribution of theAPOBEC3B deletion across diverse ethnic Indian populations repre-sented in the Indian Genome Variation Consortium (IGVC) panel.The panel has previously been used to study SNP frequencies inimmune response and adhesion/receptor molecules associatedwith susceptibility to diseases including malaria and HIV and hasprovided insights into the distribution of specific SNPs associatedwith disease susceptibility with respect to malaria endemicity(Indian Genome Variation Consortium, 2008; Sinha et al.,2008a,b). Case-control analysis with P. falciparum malaria patientsamples drawn from a malaria endemic and a non-endemic regionof India was also carried out. In addition, the distribution of theAPOBEC3B deletion in HGDP populations was analyzed in termsof the history of malaria incidence. Our analysis presents a casefor malaria as a positive selection force for the APOBEC3B insertionand suggests a major role for APOBEC3B in innate immunity againstmalaria, possibly during the pre-erythrocytic liver stage of theinfection and/or immune clearance in the spleen.

2. Methods

2.1. Populations and study subjects

The APOBEC3B insertion/deletion polymorphism study was car-ried out on 500 samples from 25 reference populations from theexisting panel of Indian Genome Variation Consortium (IGVC).These populations encompass diverse ethnic and linguistic groupsresiding in different geographical regions and represent the geneticspectrum of India. The reference populations were a subset of 55populations that had been used in Phase I analysis of the IGVC toestablish genetic relatedness among the diverse populations ofIndia (Indian Genome Variation Consortium, 2008). The popula-tions are coded on the basis of linguistic affiliation (Indo-European,IE; Dravidian, DR; Tibeto-Burman, TB; Austro-Asiatic, AA) followedby geographical zone (North, N; South, S, East, E; West, W, Central,C; North–East NE) and ethnicity (caste LP; tribe IP; religious group,SP). Population descriptions are available in IGVC, 2008 (IndianGenome Variation Consortium, 2008). A population (OG-W-IP1)of known African descent was included as an out-group.

The APOBEC3B insertion/deletion polymorphism was analyzedin a case-control format with patients and controls drawn from fal-ciparum malaria endemic and a non-endemic region of India. Theendemic region (Antagarh, Chhattisgarh and Sundargarh, Orissa)samples primarily comprised of individuals from isolated popula-tions of Austro-Asiatic origin while the non-endemic region(Lucknow and surrounding areas of Uttar Pradesh) samples werefrom populations of Indo-European lineage. Informed consentwas obtained from each volunteer/guardian prior to collection.Sampling details were as described previously (Sinha et al.,2008a). Briefly, 2–5 ml of venous blood was drawn from patients

of above 5 years of age diagnosed with P. falciparum malaria. Sincethe study aimed to include P. falciparum cases, initial screening byrapid diagnostic test (RDT) kits (Optimal/Paracheck) was done topick up P. falciparum cases, followed by thin and thick blood smearexamination for malarial parasites. In rare cases of discrepancy be-tween the results of the two tests (positive for P. falciparum in RDTbut failure to detect parasite in smear), P. falciparum infection wasconfirmed by a diagnostic polymerase chain reaction (PCR) specificfor its 18S rRNA (Patsoula et al., 2003). Morphological forms ofPlasmodium vivax are relatively easier to distinguish on smearexamination than P. falciparum rings, and this was relied upon todetect P. vivax co-infections. Smear examination in our study didnot suggest the possibility of mixed infection in the reported cases.The WHO guidelines (WHO, 2000) were followed to categorize se-vere and non-severe malaria as described in Sinha et al. (2008).Non-severe malaria patients were P. falciparum-positive, had feverand lacked symptoms that characterized severe malaria. Severecerebral malaria was characterized by impaired consciousness(coma) with fever. Any one of the following symptoms togetherwith a positive RDT readout and blood smear, and fever indicatedsevere (non-cerebral) malaria: severe anemia, acidotic breathing,pulmonary edema, increased serum creatinine and increased bili-rubin levels. Both cerebral malaria and severe non-cerebral malariapatients were considered under the common category of ‘severe’malaria. A total of 176 P. falciparum malaria patients (91 fromendemic and 85 from non-endemic region) were analyzed. Non-endemic region patients included in this study were enrolled in areferral hospital and had severe disease manifestations. Controlsamples were collected from ethnically-matched and unrelatedindividuals from the endemic (92 samples) and non-endemic (82samples) regions. The study was approved by ethical committeesof all participating institutes.

2.2. Genotyping

Genotyping of the insertion/deletion polymorphism was carriedout using PCR primers described by Kidd et al. (2007). The deletionspans a 29.5 kb of segment between the fifth exon of APOBEC3Aand eighth exon of APOBEC3B in chromosome 22. One pair of dele-tion and two pairs of insertion (insertion 1 and 2) primers wereused to distinguish between the insertion and deletion alleles.The primer sequences are: Deletion_F (forward primer): TAG-GTGCCACCCCGAT; Deletion_R (reverse primer): TTGAGCATAATCTTACTCTTGTAC; Insertion1_F: TTGGTGCTGCCCC CTC; Inser-tion1_R: TAGAGACTGAGGCCCAT; Insertion2_F: TGTCCCTTTTCAGAGTTTGAGTA; Insertion2_R: TGGAGCCAATTAATCACTTCAT. Deletionprimers amplify a 700-bp PCR product which is specific to the dele-tion sequence. Insertion 1 and Insertion 2 primers are specific forthe insertion and amplify 490 bp and 705 bp fragments, respec-tively. Insertion and deletion PCR reactions were performed sepa-rately then pooled together and visualized on a 2% agarose gel.HbAS determination was carried out by blood electrophoresis(Kohn, 1969) and confirmed by single base primer extension usingSNaPshot™ (Applied Biosystems).

For evaluating population stratification, genotyping of 85 SNPsfrom 39 candidate genes in controls and P. falciparum patientswas carried out using the Illumina genotyping platform (Illumina,SanDiego, USA). SNP genotypes were determined with the GoldenGate Assay following manufacturer’s protocol. Out of these 12 SNPsfrom three genes were excluded for further analysis as they weremonomorphic.

In order to detect selection at the APOBEC3B locus, we geno-typed 43 SNPs from a 1 Mb region encompassing the APOBEC3Blocus. The SNPs had an average spacing of �25 kb. Genotypingwas performed using MALDI-TOF based chemistry on the Seque-nom platform (SEQUENOM Inc., USA).

144 P. Jha et al. / Infection, Genetics and Evolution 12 (2012) 142–148

2.3. Genetic analysis

Chi-square test was performed to estimate whether populationswere in Hardy–Weinberg equilibrium (HWE). FST value was calcu-lated according to the method of Nei and Chesser (1983). Oddsratio (OR) for risk assessment was estimated using EpiInfo™ ver-sion 3.4 software. We calculated an empirical FST distribution of4991 neutral SNPs spaced at 100 kb intervals from genotypesobtained in individuals from the same 25 Indian populations onthe Affymetrix 50 K array. EIGENSTRAT (Price et al., 2006) was usedfor detection and correction of population stratification amongcases and controls.

To detect possible selection at the locus we performed extendedhaplotype homozygosity (EHH) analysis. Haplotypes of 44 markers(43 SNPs + 1 indel) from a 1 MB region encompassing the APOBEClocus were inferred for each individual from its genotypes withfastPHASE version 1.3. The integrated haplotype scores (IHS) andXP-EHH scores (Sabeti et al., 2007) were calculated with codedownloaded from the Pritchard labweb page (http://hgdp.uchica-go.edu). Genotype data from the HGDP-CEPH Human GenomeDiversity Panel (Cann et al., 2002; Li et al., 2008) were alsoincluded in EHH analyses.

3. Results

3.1. APOBEC3 deletion frequency differs vastly in Indian populations

The APOBEC3B insertion/deletion polymorphism demonstrateda wide spectrum of frequencies across Indian populations (Fig. 1)with the insertion allele being fixed in AA-E-IP3. Indo-Europeanlarge populations from the western, eastern and northern partsof the country had the insertion allele as the major allele. In con-trast, Tibeto-Burman populations residing in the North andNorth–East and Indo-European isolated populations of North-Eastand Eastern regions had the deletion allele as the major allele. Dra-vidian populations demonstrated considerable heterogeneity inthe distribution of the deletion. OG-W-IP which is an out-grouppopulation of African ancestry also had near fixation of the inser-tion allele. The polymorphism was in HWE in all populations.The global FST value for this locus was observed to be 0.052. Testingagainst a neutral set of markers this FST value was in the upper 15%quartile indicative of differentiation with respect to this locus(Supplementary Table 1). However, the extent of differentiationwas much lower than the HGDP panel (FST, 0.28).

Fig. 1. Representation of APOBEC3B deletion frequency in the

The populations IE-E-LP4, AA-E-IP3, DR-C-IP2 and DR-S-LP2that have low frequency of the deletion allele inhabit a region ofthe country where the incidence of falciparum malaria is high(Fig. 2). A comparison of the distribution of the frequency of theinsertion allele with the prevalence map of P. falciparum malariain India (Hay et al., 2009) indicated a clear overlap suggestive ofa correlation between the APOBEC3B polymorphism and malaria.The association between susceptibility to falciparum malaria andthe APOBEC3B deletion was thus investigated.

3.2. The APOBEC3B insertion allele is strongly associated withprotection from malaria

To study whether there was a relationship between the APO-BEC3B insertion/deletion polymorphism and susceptibility tomalaria, we genotyped cases and control samples from a P. falcipa-rum endemic and a nonendemic region of India. Malaria patients,clinically characterized as severe or non-severe, were comparedwith ethnically matched control samples for presence of the poly-morphism. Patients diagnosed with cerebral malaria (CM) andthose with symptoms of non-cerebral severe malaria (NCM) wereboth included under the ‘severe’ category. A significant differencein the frequency of the deletion allele was observed between casesand controls (0.11 and 0.365, respectively) in the malaria endemicregion (Table 1). Strong association of the deletion allele withsusceptibility to falciparum malaria was also seen in the endemicregion (non-severe vs. control, OR = 4.96, P value = 9.5E�06; severevs. control, OR = 4.36, P value = 5.76E�05). The higher frequency ofthe deletion allele was due to significant over-representation of thehemizygous genotype (ID, where I and D are the insertion anddeletion alleles, respectively) in both severe as well as non severecases compared to controls (P = 1.4 � 10�5 and P = 0.00, respec-tively). Patients from the non-endemic region that were includedin this study had severe malaria. There was no significant differ-ence in deletion allele frequency between these severe malariapatients and controls in the non-endemic region. Separate analysisof cerebral and non-cerebral severe malaria patients also revealedstrong association of the deletion allele with both categories in theendemic region (CM vs. control, OR = 3.47, P value = 9.01E�04; NCMvs. control, OR = 4.96, P value = 9.5E�06; CM vs. NCM, OR = 0.7, Pvalue = 0.23). No disease association was observed with the dele-tion allele when cerebral and non-cerebral severe patients of thenon-endemic region were analyzed separately.

Comparison of genotype distribution between patient andcontrol categories revealed significant over-representation of the

Indian Genome Variation Consortium (IGVC) populations.

Fig. 2. (A) Spatial distribution of APOBEC3B deletion in Indian population. (B) P. falciparum malaria endemicity across India [map adapted from P. falciparum malariaendemicity map of the Malaria Atlas Project (MAP; www.map.ox.ac.uk); Hay et al., 2009].

Table 1Genotype distribution and deletion frequency in patient and control groups.

Malariacohort

Subjects II ID DD Total Minor allele (D)frequency

Endemicregion

Controls 73 19 0 92 0.11Non-severe

21 42 5 68 0.38⁄

Severe 7 16 0 23 (CM:10,NCM:13)

0.35⁄

Non-endemicregion

Controls 51 25 6 82 0.23Severe 57 11 17 85 (CM:41,

NCM:44)0.26

Odds ratio (OR) for allele frequency: ⁄Endemic, non-severe vs. control, OR = 4.96 (95%CI = 2.25–11.53), P = 9.5E�06. ⁄Endemic, severe vs. control, OR = 4.36 (95% CI = 1.97–10.18), P = 5.76E�05. Non-Endemic, severe vs. control, OR = 1.24 (95% CI = 0.62–2.48), P = 0.51.

Table 2Association of APOBEC3 deletion with malaria susceptibility.

Malariacohort

Comparisons(Fisher’s test)

Genotypes Odds ratio(95% CI)

P value

Endemic Non-severe vs.control

ID & II 7.68(3.50–17.0)

1 � 10�7

Severe vs. control ID & II 8.78(2.86–28.46)

5.6� 10�5

Severe vs. non-severe ID & II 1.14(0.37–3.81)

0.8

Non-endemic

Severe vs. control ID & II 0.39(0.16–0.93)

0.0211

Severe vs. control DD & II 2.54(0.86–8.42)

0.064

Severe vs. control DD & ID 6.44(1.76–24.99)

0.0012

Severe vs. control DD &(II + ID)

3.17(1.10–10.32)

0.0177

P. Jha et al. / Infection, Genetics and Evolution 12 (2012) 142–148 145

homozygous deletion genotype in cases when compared to con-trols in the non-endemic region [severe vs. control, DD and II,OR = 2.54, P = 0.064; DD and ID, OR = 6.44, P = 0.0012; DD and(II + ID), OR = 3.17, P = 0.0177] (Table 2). In the endemic region,however, none of the controls was homozygous for the deletion.A strong association was observed between presence of the hemi-zygote (ID) and susceptibility to malaria in the endemic regionwith similar odds ratio values obtained for patients with severeor non-severe disease manifestation (ID and II, non-severe vs.control, OR = 7.68, P = 1E�07; severe vs. control, OR = 8.78,P = 5.6E�05; severe vs. non-severe, OR = 1.14, P = 0.8) (Table 2).We also evaluated the possible role of the sickle cell trait (HbAS)in contributing to protection in the endemic region population.However, very low frequency of the sickle cell allele (0.5%) was ob-served ruling out its prominent role in malaria manifestation inthis population.

Though the samples were collected from the same region andwere language and ethnicity matched, we did a principal-compo-nent analysis on a panel of 85 SNPs from 40 candidate genes toinvestigate potential inflation of the OR due to population stratifi-cation. These SNPs were selected on the basis of their reportedassociation with susceptibility/resistance to severe falciparummalaria in world populations (Sirugo et al., 2008). The non-ende-

mic region case and control samples did not show any populationstructure. However, the samples that were collected from theendemic region did show a significant difference (9.9E�05) betweenthe cases and controls along the second eigenvector (Supplemen-tary Fig. 1). This again was not unexpected, as it is well known thatthe Austro-Asiatic populations living in this endemic region oftenhave small effective population sizes, thus are more susceptibleto allele frequency variations due to random genetic drift. It is alsoto be noted that the panel of SNPs, on which the principal compo-nent analysis was performed, was a set of candidate SNPs formalaria. Hence the existence of difference between the cases andcontrols may not be due to population structure but a systematicvariation pertaining to the disease. Thus correcting for stratifica-tion in this dataset would only make our inferences conservative.Visual inspection showed 11 samples which were clearly separatedthrough the second eigenvector. We removed these 11 samplesand re-ran the same association tests. The removal of these con-trols resulted in the removal of any possible systematic differencebetween the cases and controls due to population stratification (wechecked the significance for the first 10 eigenvectors). Reanalysis ofassociation after removal of the samples that contributed tostratification did not show any difference.

146 P. Jha et al. / Infection, Genetics and Evolution 12 (2012) 142–148

3.3. APOBEC3B insertion/deletion polymorphism in world populationsand malaria

In light of the strong association of the deletion allele withsusceptibility to malaria, a possible role for malaria in selectionat the locus was hypothesized. An overlay of the global malariatransmission risk map (WHO and UNICEF, 2005) and the APO-BEC3B deletion frequency map of HGDP populations, (Kiddet al., 2007) revealed a striking correlation between diseaseoccurrence and higher frequency of the protective insertion allele(Supplementary Fig. 2). African populations from the malariousregions of central and sub-Saharan Africa, where malaria inci-dence is estimated to have been high from about 4000 to5000 years ago, were largely fixed for the insertion allele withlow levels of the deletion seen in populations of North Africa. Infact, the APOBEC3B deletion allele frequencies observed for worldpopulations seem to follow the timeline for malaria followingits spread across Egypt (�4000–3500 years ago) to India(�3000 years ago) on the one hand and to the Mediterranean(2500–2000 years ago) and Northern Europe (1000–500 yearsago) on the other (Sallares et al., 2004). Although malaria waslargely controlled in the Mediterranean region by the late1940s, (Gallup and Sachs, 2001; Missiroli, 1948) Italy has had ahistory of falciparum malaria from ancient times (Hackett,1937; Romi et al., 2001) possibly explaining the very lowfrequency/absence of the deletion in the three Italian populationsof HGDP, particularly Sardinian and Tuscan. However, the highfrequency of the deletion in the Melanesian (Bougainville) popu-lation and near fixation of the deletion in the non-highlanderpopulation from Papua New Guinea cannot be explained directlyby the ‘selection by malaria’ hypothesis. One possible explanationcan be that these Pacific Islander populations were historicallysubjected to extreme random genetic drift. Alternatively, epistaticeffects of another locus could override the effect of the APOBEC3Binsertion allele in these populations (Williams et al., 2005). Boththese regions have a long history of malaria endemicity with veryhigh incidence of P. falciparum and P. vivax malaria (Kaslow et al.,2008; Muller et al., 2003). Malaria (P. vivax) was probablyintroduced to The New World (South America) only at the endof the 15th century AD and P. falciparum probably reached CentralAmerica through the African slaves brought by the Spanish colo-nizers (Patricia Schlagenhauf-Lawlor, 2001). Malaria spread toNorth America in the 18th century. This relatively recent expo-sure of the Americas to the malaria parasite is reflected in thehigher frequency of the APOBEC3B deletion in HGDP populationsfrom Brazil, Colombia and Mexico. Since presence of APOBEC3Bmay also result in hypermutations a deletion of this gene mighthave beneficial effects in the absence of infection as proposedby Kidd et al. (2007). Therefore, the overall global distributionof the APOBEC3B insertion/deletion polymorphism may reflecta balance between the advantages of the insertion allele, forinstance in viral infections or malaria, or the deletion which couldlower the risk of hyper-mutation.

In order to determine whether the APOBEC3B locus was underselection we carried out XP-EHH and iHS analysis in these popula-tions. Strong signals of positive selection based on the current datawere not observed. The extent of Linkage disequilibrium (LD) inthis gene region was weak across majority of the populations ofIGV and HGDP-CEPH panels indicating the presence of recombina-tion hotspots which could lead to a breakdown of LD on the corehaplotype and a low EHH (Supplementary Fig. 3). The power ofEHH-based methods could be compromised in case of LD decaysquickly and haplotype homozygosity could not extend to longrange in case natural selection occurred in genes with recombina-tion hotspots (Supplementary Fig. 4).

4. Discussion

The APOBEC3B deletion, which results in the loss of at least onecopy of the unique coding portion of APOBEC3B, ranges infrequency from 0% to 43% in Indian populations with low deletionfrequency observed in populations inhabiting malaria endemicregions of India. The deletion allele was strongly associated withsusceptibility to falciparum malaria in an endemic region and thehomozygous deletion genotype was over-represented in caseswhen compared to controls in a non-endemic region. Strong asso-ciation of the deletion allele with manifestation of falciparummalaria indicates a possible role for APOBEC3B in innate immunityagainst malaria. The distribution of the deletion in HGDP popula-tions reported by Kidd et al. (2007) suggests selection of theprotective insertion allele in regions with high malaria incidence.

Kidd et al. (2007) reported clinal increase in deletion frequencyin HGDP populations as one moves eastward from Africa, followingthe route of human migration. However, pairwise FST estimates intheir study differentiated Amerindian, Oceanic and some EastAsian populations from other populations based on the frequencyof the deletion in comparison to other ins/del polymorphismsand SNPs. This indicated that the pattern of distribution of the APO-BEC3B deletion is not the result of demographic history alone (Kiddet al., 2007). Our results on Indian populations and the associationstudy suggest a role for malaria as a selection force for the protec-tive insertion allele. However, these results would need to be cor-roborated in a larger clinical study in different geographicalsettings before the functional role of APOBEC3B in malaria can beestablished. As we did not observe high linkage disequilibrium inthe vicinity of APOBEC3 locus, the involvement of a closely linkedlocus that may confer differences in malaria susceptibility seemsunlikely.

APOBEC3B is among the innate immune response genes that areinduced during the acute stage of HIV infection but returns to base-line levels in the asymptomatic stage (Li et al., 2009). The proteinalso inhibits infectivity of wild-type HIV-1 (Doehle et al., 2005)and recently an association of the APOBEC3B ins/del polymorphismwith risk of HIV acquisition has been reported (An et al., 2009). Theinteraction between HIV and malaria that may fuel the spread ofboth infections, particularly in Sub Saharan Africa and parts of Asia,is a public health concern. It has been speculated that HIV immunesuppression increases the risk of malaria infection and malariainfection provokes a transient increase in the viral load in HIVinfected individuals (Abudu et al., 2006; bu-Raddad et al., 2006;Kublin et al., 2005). Both malaria and HIV pathogenesis is influ-enced by a range of factors including host genetics, parasite strain,parasite exposure and treatment. Cell based immune responses toHIV and malaria provides an explanation for the observed interac-tion between the virus and the protozoan (Renia and Potter, 2006).If basal or induced levels of APOBEC3B in the human host differbetween the insertion homozygote and the hemizygote carryinga deletion allele, host innate immunity to both HIV and malariamay be influenced and both the infections may play a role in selec-tion of the protective insertion allele in affected populations.

APOBEC3 proteins in humans are a family of cytidine deaminas-es that mediate C–U or dC–dU conversion in mRNA or DNA, respec-tively (Cullen, 2006). These proteins cause hypermutations inhepatitis B virus DNA and APOBEC3B, 3F and 3G, which areexpressed in the liver and up-regulated by IFN-a in hepatocyteshave been shown to contribute to the non-cytolytic clearance ofHBV (Bonvin et al., 2006). APOBEC3B is expressed predominantlyin the nucleus but is seen in the cytoplasm in association with viralparticles in HBV-infected cells (Bonvin et al., 2006). There has beenan expansion of the APOBEC3 gene family in humans such thateight APOBEC3 genes (A–H) are tandemly arranged on human

P. Jha et al. / Infection, Genetics and Evolution 12 (2012) 142–148 147

chr22q13.1 (Bhattacharya et al., 2008; Harris and Liddament,2004). Quantitative estimates of APOBEC3B levels in human tissueshave revealed significantly higher expression in the lungs andspleen (Refsland et al., 2010).

A recent study on expression profiling of the rodent parasiteP. berghei-infected and non-infected hepatoma cells had shownsignificant induction of the related APOBEC1 gene in the first 6–12 h after infection (Albuquerque et al., 2009). The mouse genomeencodes only one APOBEC3 gene on chr15 as compared to theexpanded APOBEC3 locus on chr22 in humans. It is tempting tohypothesize that the role of APOBEC3 genes as innate immune re-sponse genes in the liver may influence the growth of the malariaparasite in the pre-erythrocytic stages and impact upon subse-quent parasite release and invasion of erythrocytes. Further, thehigher expression of APOBEC3B in the human spleen is suggestiveof a possible role of this protein in immune clearance of the para-sites. Although the mechanism for the protective role of APOBEC3Bremains to be elucidated, a direct action on parasite replication orgrowth may require its import into the parasite through the uptakemechanisms used by Plasmodium in infected liver cells (Bano et al.,2007).

The results reported here are for P. falciparum alone and theeffect of the APOBEC3B deletion on P. vivax cases, and P. falciparumand P. vivax co-infections remains to be investigated. While ourstudy indicates a strong association of the APOBEC3B deletion withsusceptibility to falciparum malaria, the functional effects of thepolymorphism on basal and induced levels of APOBEC3B, Plasmo-dium replication and growth in the liver and erythrocytic stagesas well as HIV-1 and HBV replication remain to be ascertained.

Acknowledgments

We are grateful to all donors and their families. We thank Dr.Prajesh Tyagi and Dr. G.N. Jha for help with sample collection.The project was supported by funding from the Council of Scientificand Industrial Research (CMM-0016 to MM and SH, and SIP0006 toMM) and from the Department of Biotechnology to SH and VV (BT/PR6065/MED/14/738/2005). Senior Research Fellowship to PJ fromCSIR is duly acknowledged. This is CDRI communication number7857.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.meegid.2011.11.001.

References

Abudu, A., Takaori-Kondo, A., Izumi, T., Shirakawa, K., Kobayashi, M., Sasada, A.,Fukunaga, K., Uchiyama, T., 2006. Murine retrovirus escapes from murineAPOBEC3 via two distinct novel mechanisms. Curr. Biol. 16, 1565–1570.

Albuquerque, S.S., Carret, C., Grosso, A.R., Tarun, A.S., Peng, X., Kappe, S.H.,Prudencio, M., Mota, M.M., 2009. Host cell transcriptional profiling duringmalaria liver stage infection reveals a coordinated and sequential set ofbiological events. BMC Genomics 10, 270.

An, P., Johnson, R., Phair, J., Kirk, G.D., Yu, X.F., Donfield, S., Buchbinder, S., Goedert,J.J., Winkler, C.A., 2009. APOBEC3B deletion and risk of HIV-1 acquisition. J.Infect. Dis. 200, 1054–1058.

Bano, N., Romano, J.D., Jayabalasingham, B., Coppens, I., 2007. Cellular interactionsof Plasmodium liver stage with its host mammalian cell. Int. J. Parasitol. 37,1329–1341.

Bhattacharya, C., Aggarwal, S., Kumar, M., Ali, A., Matin, A., 2008. Mouseapolipoprotein B editing complex 3 (APOBEC3) is expressed in germ cells andinteracts with dead-end (DND1). PLoS ONE 3, e2315.

Bonvin, M., Achermann, F., Greeve, I., Stroka, D., Keogh, A., Inderbitzin, D., Candinas,D., Sommer, P., Wain-Hobson, S., Vartanian, J.P., Greeve, J., 2006. Interferon-inducible expression of APOBEC3 editing enzymes in human hepatocytes andinhibition of hepatitis B virus replication. Hepatology 43, 1364–1374.

Bonvin, M., Greeve, J., 2008. Hepatitis B: modern concepts in pathogenesis–APOBEC3 cytidine deaminases as effectors in innate immunity against thehepatitis B virus. Curr. Opin. Infect Dis. 21, 298–303.

bu-Raddad, L.J., Patnaik, P., Kublin, J.G., 2006. Dual infection with HIV and malariafuels the spread of both diseases in sub-Saharan Africa. Science 314, 1603–1606.

Cann, H.M., de, T.C., Cazes, L., Legrand, M.F., Morel, V., Piouffre, L., Bodmer, J.,Bodmer, W.F., Bonne-Tamir, B., Cambon-Thomsen, A., Chen, Z., Chu, J., Carcassi,C., Contu, L., Du, R., Excoffier, L., Ferrara, G.B., Friedlaender, J.S., Groot, H.,Gurwitz, D., Jenkins, T., Herrera, R.J., Huang, X., Kidd, J., Kidd, K.K., Langaney, A.,Lin, A.A., Mehdi, S.Q., Parham, P., Piazza, A., Pistillo, M.P., Qian, Y., Shu, Q., Xu, J.,Zhu, S., Weber, J.L., Greely, H.T., Feldman, M.W., Thomas, G., Dausset, J., Cavalli-Sforza, L.L., 2002. A human genome diversity cell line panel. Science 296,261–262.

Cullen, B.R., 2006. Role and mechanism of action of the APOBEC3 family ofantiretroviral resistance factors. J. Virol. 80, 1067–1076.

Doehle, B.P., Schafer, A., Wiegand, H.L., Bogerd, H.P., Cullen, B.R., 2005. Differentialsensitivity of murine leukemia virus to APOBEC3-mediated inhibition isgoverned by virion exclusion. J. Virol. 79, 8201–8207.

Gallup, J.L., Sachs, J.D., 2001. The economic burden of malaria. Am. J. Trop. Med. Hyg.64, 85–96.

Hackett, 1937. Malaria in Europe, an ecological study. Oxford University Press.Harris, R.S., Liddament, M.T., 2004. Retroviral restriction by APOBEC proteins. Nat.

Rev. Immunol. 4, 868–877.Hay, S.I., Guerra, C.A., Gething, P.W., Patil, A.P., Tatem, A.J., Noor, A.M., Kabaria, C.W.,

Manh, B.H., Elyazar, I.R., Brooker, S., Smith, D.L., Moyeed, R.A., Snow, R.W., 2009.A world malaria map: Plasmodium falciparum endemicity in 2007. PLoS Med. 6,e1000048.

Indian Genome Variation Consortium, 2008. Genetic landscape of the people ofIndia: a canvas for disease gene exploration. J Genet. 87, 3–20.

Kaslow, R.A., McNicholl, J., Hil, A.V., 2008. Genetic Susceptibility to InfeciousDiseases., p. 376.

Kidd, J.M., Newman, T.L., Tuzun, E., Kaul, R., Eichler, E.E., 2007. Populationstratification of a common APOBEC gene deletion polymorphism. PLoS Genet.203, e63.

Kohn, J., 1969. Separation of haemoglobins on cellulose acetate. J. Clin. Pathol. 22,109–111.

Kublin, J.G., Patnaik, P., Jere, C.S., Miller, W.C., Hoffman, I.F., Chimbiya, N., Pendame,R., Taylor, T.E., Molyneux, M.E., 2005. Effect of Plasmodium falciparum malaria onconcentration of HIV-1-RNA in the blood of adults in rural Malawi: aprospective cohort study. Lancet 365, 233–240.

Kwiatkowski, D.P., 2005. How malaria has affected the human genome and whathuman genetics can teach us about malaria. Am. J. Hum. Genet. 77, 171–192.

Li, J.Z., Absher, D.M., Tang, H., Southwick, A.M., Casto, A.M., Ramachandran, S., Cann,H.M., Barsh, G.S., Feldman, M., Cavalli-Sforza, L.L., Myers, R.M., 2008. Worldwidehuman relationships inferred from genome-wide patterns of variation. Science319, 1100–1104.

Li, Q., Smith, A.J., Schacker, T.W., Carlis, J.V., Duan, L., Reilly, C.S., Haase, A.T., 2009.Microarray analysis of lymphatic tissue reveals stage-specific, gene expressionsignatures in HIV-1 infection. J. Immunol. 183, 1975–1982.

Missiroli, A., 1948. Anopheles control in the Mediterranean area. pp, 1566–1575.Muller, I., Bockarie, M., Alpers, M., Smith, T., 2003. The epidemiology of malaria in

Papua New Guinea. Trends Parasitol. 19, 253–259.Nei, M., Chesser, R.K., 1983. Estimation of fixation indices and gene diversities. Ann.

Hum. Genet. 47, 253–259.Patricia Schlagenhauf-Lawlor, 2001. Travelers’ Malaria: People and Plasmodia:

Some Historic Perspectives.Patsoula, E., Spanakos, G., Sofianatou, D., Parara, M., Vakalis, N.C., 2003. A single-

step, PCR-based method for the detection and differentiation of Plasmodiumvivax and P. falciparum. Ann. Trop. Med. Parasitol. 97, 15–21.

Price, A.L., Patterson, N.J., Plenge, R.M., Weinblatt, M.E., Shadick, N.A., Reich, D.,2006. Principal components analysis corrects for stratification in genome-wideassociation studies. Nat. Genet. 38, 904–909.

Refsland, E.W., Stenglein, M.D., Shindo, K., Albin, J.S., Brown, W.L., Harris, R.S., 2010.Quantitative profiling of the full APOBEC3 mRNA repertoire in lymphocytes andtissues: implications for HIV-1 restriction. Nucleic Acids Res. 38, 4274–4284.

Renia, L., Potter, S.M., 2006. Co-infection of malaria with HIV: an immunologicalperspective. Parasite Immunol. 28, 589–595.

Romi, R., Sabatinelli, G., Majori, G., 2001. Could malaria reappear in Italy? Emerg.Infect. Dis. 7, 915–919.

Sabeti, P.C., Varilly, P., Fry, B., Lohmueller, J., Hostetter, E., Cotsapas, C., Xie, X., Byrne,E.H., McCarroll, S.A., Gaudet, R., Schaffner, S.F., Lander, E.S., Frazer, K.A.,Ballinger, D.G., Cox, D.R., Hinds, D.A., Stuve, L.L., Gibbs, R.A., Belmont, J.W.,Boudreau, A., Hardenbol, P., Leal, S.M., Pasternak, S., Wheeler, D.A., Willis, T.D.,Yu, F., Yang, H., Zeng, C., Gao, Y., Hu, H., Hu, W., Li, C., Lin, W., Liu, S., Pan, H.,Tang, X., Wang, J., Wang, W., Yu, J., Zhang, B., Zhang, Q., Zhao, H., Zhao, H., Zhou,J., Gabriel, S.B., Barry, R., Blumenstiel, B., Camargo, A., Defelice, M., Faggart, M.,Goyette, M., Gupta, S., Moore, J., Nguyen, H., Onofrio, R.C., Parkin, M., Roy, J.,Stahl, E., Winchester, E., Ziaugra, L., Altshuler, D., Shen, Y., Yao, Z., Huang, W.,Chu, X., He, Y., Jin, L., Liu, Y., Shen, Y., Sun, W., Wang, H., Wang, Y., Wang, Y.,Xiong, X., Xu, L., Waye, M.M., Tsui, S.K., Xue, H., Wong, J.T., Galver, L.M., Fan, J.B.,Gunderson, K., Murray, S.S., Oliphant, A.R., Chee, M.S., Montpetit, A., Chagnon, F.,Ferretti, V., Leboeuf, M., Olivier, J.F., Phillips, M.S., Roumy, S., Sallee, C., Verner,A., Hudson, T.J., Kwok, P.Y., Cai, D., Koboldt, D.C., Miller, R.D., Pawlikowska, L.,Taillon-Miller, P., Xiao, M., Tsui, L.C., Mak, W., Song, Y.Q., Tam, P.K., Nakamura,Y., Kawaguchi, T., Kitamoto, T., Morizono, T., Nagashima, A., Ohnishi, Y., Sekine,A., Tanaka, T., Tsunoda, T., Deloukas, P., Bird, C.P., Delgado, M., Dermitzakis, E.T.,Gwilliam, R., Hunt, S., Morrison, J., Powell, D., Stranger, B.E., Whittaker, P.,Bentley, D.R., Daly, M.J., de Bakker, P.I., Barrett, J., Chretien, Y.R., Maller, J.,

148 P. Jha et al. / Infection, Genetics and Evolution 12 (2012) 142–148

McCarroll, Patterson, N., Pe’er, I., Price, A., Purcell, S., Richter, D.J., Sabeti, P.,Saxena, R., Schaffner, S.F., Sham, P.C., Varilly, P., Altshuler, D., Stein, L.D.,Krishnan, L., Smith, A.V., Tello-Ruiz, M.K., Thorisson, G.A., Chakravarti, A., Chen,P.E., Cutler, D.J., Kashuk, C.S., Lin, S., Abecasis, G.R., Guan, W., Li, Y., Munro, H.M.,Qin, Z.S., Thomas, D.J., McVean, G., Auton, A., Bottolo, L., Cardin, N.,Eyheramendy, S., Freeman, C., Marchini, J., Myers, S., Spencer, C., Stephens, M.,Donnelly, P., Cardon, L.R., Clarke, G., Evans, D.M., Morris, A.P., Weir, B.S.,Tsunoda, T., Johnson, T.A., Mullikin, J.C., Sherry, S.T., Feolo, M., Skol, A., Zhang, H.,Zeng, C., Zhao, H., Matsuda, I., Fukushima, Y., Macer, D.R., Suda, E., Rotimi, C.N.,Adebamowo, C.A., Ajayi, I., Aniagwu, T., Marshall, P.A., Nkwodimmah, C., Royal,C.D., Leppert, M.F., Dixon, M., Peiffer, A., Qiu, R., Kent, A., Kato, K., Niikawa, N.,Adewole, I.F., Knoppers, B.M., Foster, M.W., Clayton, E.W., Watkin, J., Gibbs, R.A.,Belmont, J.W., Muzny, D., Nazareth, L., Sodergren, E., Weinstock, G.M., Wheeler,D.A., Yakub, I., Gabriel, S.B., Onofrio, R.C., Richter, D.J., Ziaugra, L., Birren, B.W.,Daly, M.J., Altshuler, D., Wilson, R.K., Fulton, L.L., Rogers, J., Burton, J., Carter,N.P., Clee, C.M., Griffiths, M., Jones, M.C., McLay, K., Plumb, R.W., Ross, M.T.,Sims, S.K., Willey, D.L., Chen, Z., Han, H., Kang, L., Godbout, M., Wallenburg, J.C.,L’Archeveque, P., Bellemare, G., Saeki, K., Wang, H., An, D., Fu, H., Li, Q., Wang, Z.,Wang, R., Holden, A.L., Brooks, L.D., McEwen, J.E., Guyer, M.S., Wang, V.O.,Peterson, J.L., . Genome-wide detection and characterization of positiveselection in human populations. Nature 449, 913–918.

Sallares, R., Bouwman, A., Anderung, C., 2004. The spread of malaria to SouthernEurope in antiquity: new approaches to old problems. Med. Hist. 48, 311–328.

Sinha, S., Mishra, S.K., Sharma, S., Patibandla, P.K., Mallick, P.K., Sharma, S.K.,Mohanty, S., Pati, S.S., Mishra, S.K., Ramteke, B.K., Bhatt, R., Joshi, H., Dash, A.P.,Ahuja, R.C., Awasthi, S., Venkatesh, V., Habib, S., 2008a. Polymorphisms of TNF-

enhancer and gene for FcgammaRIIa correlate with the severity of falciparummalaria in the ethnically diverse Indian population. Malar J. 7, 13.

Sinha, S., Qidwai, T., Kanchan, K., Anand, P., Jha, G.N., Pati, S.S., Mohanty, S., Mishra,S.K., Tyagi, P.K., Sharma, S.K., Venkatesh, V., Habib, S., 2008b. Variations in hostgenes encoding adhesion molecules and susceptibility to falciparum malaria inIndia. Malar J. 7, 250.

Sirugo, G., Hennig, B.J., Adeyemo, A.A., Matimba, A., Newport, M.J., Ibrahim, M.E.,Ryckman, K.K., Tacconelli, A., Mariani-Costantini, R., Novelli, G., Soodyall, H.,Rotimi, C.N., Ramesar, R.S., Tishkoff, S.A., Williams, S.M., 2008. Genetic studies ofAfrican populations: an overview on disease susceptibility and response tovaccines and therapeutics. Hum. Genet. 123, 557–598.

Stenglein, M.D., Harris, R.S., 2006. APOBEC3B and APOBEC3F inhibit L1 retrotrans-position by a DNA deamination-independent mechanism. J. Biol. Chem. 281,16837–16841.

WHO, 2000. Severe falciparum malaria. World Health Organization, CommunicableDiseases Cluster. Trans. R. Soc. Trop. Med. Hyg. 94 (Suppl. 1), S1–90.

WHO and UNICEF, 2005. World Malaria Report 2005. WHO.Williams, T.N., Mwangi, T.W., Wambua, S., Peto, T.E., Weatherall, D.J., Gupta, S.,

Recker, M., Penman, B.S., Uyoga, S., Macharia, A., Mwacharo, J.K., Snow, R.W.,Marsh, K., 2005. Negative epistasis between the malaria-protective effects ofalpha+-thalassemia and the sickle cell trait. Nat. Genet. 37, 1253–1257.

Zhang, W., Zhang, X., Tian, C., Wang, T., Sarkis, P.T., Fang, Y., Zheng, S., Yu, X.F., Xu, R.,2008. Cytidine deaminase APOBEC3B interacts with heterogeneous nuclearribonucleoprotein K and suppresses hepatitis B virus expression. Cell. Microbiol.10, 112–121.