degruyter biol biol-2021-0012 128..141

Research Article

Gang Xiao*#, Mei Zhang#, Xing Peng, Guangyuan Jiang

Protocatechuic acid attenuates cerebralaneurysm formation and progression byinhibiting TNF-alpha/Nrf-2/NF-kB-mediatedinflammatory mechanisms in experimental ratshttps://doi.org/10.1515/biol-2021-0012received July 15, 2020; accepted September 16, 2020

Abstract: Our current research aims to examine whetherprotocatechuic acid (PCA) can be used as a therapeuticagent for the development of cerebral aneurysm (CA) andto elucidate the mechanisms behind this. We assessed theeffects of PCA at 50 and 100mg/kg on the activation ofsignaling pathways for tissue necrosis factor (TNF)-α/nuclear factor (NF)-κB/nuclear factor erythroid 2 (Nrf-2) onprogression and development in an elastase-induced CAmodel, accompanied by a high-salt diet to induce hyper-tension. The expression of inflammatory cytokines, chemo-kines, tumor necrosis factor-α, interleukins (IL)-8, IL-17,IL-6, IL-1β, and matrix metalloproteinase (MMP)-2 andMMP-9 was analyzed by ELISA, western blot, and reversetranscriptase quantative polymerase chain reaction. Theexpression levels of antioxidant enzymes and translocationof Nrf-2 were also determined. The group treated with PCAdemonstrated a significant (P < 0.05) decrease in the aneur-ysmal size in rats compared to the CA-induced group.We found that PCA treatment suppressed the invasion ofmacrophage and activation of TNF-α/NF-κB/Nrf-2 signalingpathways. There was a significant decrease (P < 0.05) in pro-

inflammatory cytokine and chemokine levels in adose-depen-dent manner. We found that PCA treatment exerts protectiveeffects by suppressing the development and progression ofCA through the inhibition of inflammatory responses inmacrophages via TNF-α/NF-κB/Nrf-2 signaling pathways,thus demonstrating that PCA can act as a treatment for CA.

Keywords: cerebral aneurysm, protocatechuic acid,macrophages, inflammatory response mechanisms, chemo-kines, TNF-α signaling, Nrf-2

1 Introduction

Cerebral aneurysm (CA) is the most common cerebrovas-cular disease with pathological dilations of cerebral arteriesoccurring in more than 5% of the population [1]. CA canappear as unruptured [2] with a symptom of chronic head-ache [3] and as ruptured forms, giving rise to hypertensioncausing a condition called subarachnoid hemorrhage (SAH)[4,5]. This leads to morbidity and mortality worldwide.The etiology of CA is unclear, but several factors, suchas chronic inflammation, hemodynamic changes withendothelial dysfunction [6], oxidative stress, and apop-tosis, may contribute to the development of CA [7,8]. Itis hypothesized that release of inflammatory cytokinesand free radicals disrupts the endothelial intima ofblood vessel, causing extracellular matrix remodelingdysfunction [6–9].

Several studies highlighted the important role ofchronic inflammation in the formation and progressionof CA [10–14]. In addition, reactive oxygen species (ROS)can damage vascular endothelium contributing to theformation and rupture of CA [15,16]. It is known thatROS plays a significant role in inflammation and vascularsmoothmuscle dysfunction involving transcriptional factor,nuclear factor erythroid 2 (Nrf-2), because of its endogenousantioxidant effect. Under inflammatory conditions, Nrf-2

* Corresponding author: Gang Xiao, Department of Neurosurgery,Chongqing Traditional Chinese Medicine Hospital, No. 6 Panxi 7Branch Road, Jiangbei District, Chongqing 400021, People’sRepublic of China, tel: +86-023-6798-3716, fax: +86-023-6798-3716, e-mail: [email protected], [email protected] Zhang: Department of Dermatology, Daping Hospital,Army Medical University, Chongqing 400042, ChinaXing Peng, Guangyuan Jiang: Department of Neurosurgery,Chongqing Traditional Chinese Medicine Hospital, No. 6 Panxi 7Branch Road, Jiangbei District, Chongqing 400021,People’s Republic of China

# These authors contributed equally to this work.

Open Life Sciences 2021; 16: 128–141

Open Access. © 2021 Gang Xiao et al., published by De Gruyter. This work is licensed under the Creative Commons Attribution 4.0International License.

https://doi.org/10.1515/biol-2021-0012

mailto:[email protected]

mailto:[email protected]

translocates from the cytoplasm into the nucleus. Thisresults in the expression of endogenous anti-inflammatoryand antioxidant substances [17]. However, the pathogenesisof Nrf-2 in the formation and progression of CA is unclear.

Inflammatory responses are also influenced by therecruitment of nuclear factor (NF)-kB-mediatedmacrophages.This induces the expression of inflammation-related genessuch as monocyte chemoattractant protein-1 (MCP-1), inter-leukin (IL)-1β, inducible nitric oxide synthase (iNOS), andmatrix metalloproteinases (MMPs) [18]. NF-kB-mediated sig-naling through iNOS and IL-1β expression induces apoptosisof vascular smooth muscle causing endothelium damagewith the disruption of elastic lamina [19]. It also mediatesthe expression ofMMP-2 andMMP-9 causing degradation ofcollagen leading to vascular wall remodeling [20].

Studies have shown that increased levels of expressionof tissue necrosis factor (TNF)-α are implicated in the pro-gression of CA. This can be induced by the injection ofelastase into the coronary arteries and the aorta of animal,which results in the fragmentation of lamina [21–24]. Chronicinflammation mediated by TNF-α causes disruption of vesselwalls and deposition of plaques. The secretion of TNF-α by T-cells also stimulates other immune cells to secrete TNF-α [25].

These plaques formed at the intersection of cerebralarteries and their curvatures [26] weaken the endothe-lium causing migration of leukocytes [27], which causesfurther injury to the vascular smooth muscle through theexpression of MMPs. This disrupts the tight endothelialjunctions between the vascular walls of cerebrum [25]. Inaddition, several other conditions such as hemodynamicstress and increase in blood pressure exacerbate theexpression of TNF-α leading to the progression of CA.

However, there currently exist no noninvasive thera-pies, and hence the need to develop new therapies toaddress the formation and progression of CA. In a routinedrug screen for various diseases, the therapeutic use ofphytochemicals is growing in popularity, because theyhave either no or low side effects. Protocatechuic acid(PCA) is a phenolic acid, commonly present in green tea,is one of the mainmetabolites of catechins found in humansafter ingestion of green tea infusions. Its antioxidant andanti-inflammatory effects have been widely recognized[28–31]. It was proven to show antihypertensive and anti-oxidant effects against high-salt induced hypertension [32].PCA has also been shown to be efficient in treating asthmaairway remodeling [33]. Through anti-inflammatory, antiox-idant, and antiapoptotic mechanisms, PCA was used inprotecting againstmethotrexate (MTX) induced hepatorenaltoxicity [34]. It has also proved its effectiveness in reducingpaw edema, cotton pellet-induced granuloma, and index ofarthritis in rat models [35]. PCA exhibits an antiapoptoticeffect through activation of the c-Jun N-terminal kinase

(JNK) pathway causing Nrf-2 to translocate from the cyto-plasm into the nucleus, which results in the suppression ofROS generation [36,37]. In addition, PCA has anti-inflam-matory effect in lipopolysaccharide (LPS) induced BV2microglia, acting on the activation of NF-κB and MAPKsignaling pathways [38].

In patients previously pretreated with PCA, inflam-mation was noticeably restrained. Moreover, pretreart-ment had an inhibitory effect on the production of NOand TNF-α secretion in the macrophages, which wasinduced by LPS-induced acute inflammation and oxida-tive stress by inhibiting iNOS/NO and cyclooxygenase-2(COX-2) expression/PGE2 expression involving the NF-κBand MAPK signaling pathways [39]. PCA also demon-strated a novel anti-cancer activity that involves thedownregulation of the RAS/Akt/NF-kB pathway. Thisworks by targeting RhoB activation and reducing MMP-mediated cell involvement in cancer cells [39]. Chen et al.demonstrated that oral administration of 50mg/kg ofPCA in mice reached a plasma peak of 73.6 μM [40].Another study by Leila Safaeian et al. showed that PCAat 50, 100, and 200mg/kg has antioxidant and antihyper-tensive effects against dexamethasone-induced hyperten-sion [41]. In addition, the study by Bhattacharjee et al. [42]reported that the treatment with PCA at 50 and 100mg/kg,p.o. significantly (P < 0.05–0.01) promotes glucose metabo-lism in the skeletal muscle, controlling glycemic and lipidlevels. This also causes a decrease in the secretion of pro-inflammatory cytokines and improved myocardial phy-siology to near normalcy in type II diabetic rats.

With the aforementioned effects, we investigated theprotective effects of PCA in CA-induced rats with stereo-taxic administration of elastase in cerebrospinal fluid tohistologically imitate human CA, with inhibition of TNF-alpha/Nrf-2/NF-kB-mediated inflammatory mechanismsfor the suppression of CA formation and SAH at dosesof 50 and 100mg/kg, respectively.

2 Materials and methods

2.1 Rat IA model

Wistar rats of either sex weighing between 150 and 170 gwere treated. Elastase (CAS Number 39445-21-1) and PCA(CAS Number: 99-50-3) were procured from Sigma Aldrich,China. Rats were initially divided into four groups: vehiclecontrol, CA induced, PCA treated (50mg/kg, orally), andPCA treated (100mg/kg, orally), with 16 rats in each group.PCA was administered orally to rats 1 week before the

PCA prevents CA by anti-inflammatory pathway 129

induction of CA and continued until the end of the experi-ment. All test groups were treated with ketamine (80mg/kg) for inducing anesthesia. Before subjecting the rats to leftinternal carotid artery ligation, a single stereotaxic elastaseinjection was administered into the cerebrospinal fluidin the right basal cistern as previously illustrated [43]. For16 weeks, body weights and body mass index (BMI) of ratswere recorded in all four groups.

To cause hypertension, a high-salt diet (4% NaCl instandard animal chow and allowed to drink water) wasimplemented continuously for all the groups for 4 weeks[44]. The tail-cuff procedure was used in rats to assess thesystolic blood pressure both before and during treatment,and again for the next 4 weeks. After 90 days, a blue dyecontaining bromophenol was administered into the lungs,the Willis circle, and major branches. The vascular wallthickness was determined, and the degree of aneurysmwas calculated. Hematoxylin and eosin (H&E) stainingwas used to perform degenerative transformation evalua-tions of vessel endothelium.

Ethical approval: The research related to animal use hasbeen complied with all the relevant national regulationsand institutional policies for the care and use of animals.

2.2 ELISA measurements

The standard ELISA kits (Catalogue number, CA8563518G3;Chongqing Mbio Technology Co., Ltd, Chongqing, China)were used for assessing cytokine levels (IL-1β, IL-2, IL-17,IL-8, IL-6, and TNF-α). Tissue samples were obtained fromall groups around the COW tissues to determine the con-centrations of specific cytokines, including IL-1β, IL-2, IL-17,IL-8, IL-6, and TNF-α, as per the instructions of the supplier(Wuhan Fine Biotech Co., Ltd, China). Similarly, the valuesfor the parameters MMP-2 and MMP-9 were also obtainedusing the commercial kits (Chongqing Mbio TechnologyCo., Ltd, Chongqing, China).

2.3 RNA isolation and quantitative real-timepolymerase chain reaction (qRT-PCR)analysis

The samples were collected around the COW region fromcontrol and experimental rat groups. Total mRNA wasextracted using TRIzol® reagent (Sigma Aldrich, China)according to the manufacturer’s instructions and storedat −80°C. The cDNA was synthesized using ABScript IIsynthesis kit (Sigma Aldrich, China) to conduct the qRT-

PCR (Applied Bio-systems Real-Time PCR, Thermo-FisherScientific, China) analysis using SYBR® Green (SigmaAldrich, China). Thirty to forty cycles were used for per-forming qRT-PCR. The first phase involved denaturationof cDNA at 90°C for 30 s preceded by annealing for 30 s at50°C; finally, the method was extended for 40 s at 70°C. TheΔCt method was used to measure the expression of tran-scripts normalizing to the internal control of glyceraldehyde3-phosphate dehydrogenase (GAPDH). The primers (EurofinsMWG Operon, Bangalore, Karnataka, India) used for quanti-fying specific genes in this study are listed in Table 1.

2.4 Western blotting assay

Protein lysates from the entire COW were obtained, incu-bated with ice-cold lysis buffer containing 1 mm phenyl-methanesulfonyl fluoride (PMSF) and centrifuged at 4°Cfor 15 min. The protein concentration was determinedusing Pierce™ BCA Protein Assay kit (CAT No. 23225;Thermo Fisher Scientific, China). Proteins were then sepa-rated using a 10% sodium dodecyl sulfate (SDS) - polyacryl-amide-based discontinuous gel and western transferredonto 0.3 μm polyvinylidene fluoride or polyvinylidenedifluoride (PVDF) membranes. After blocking with 4% (w/v)bovine serum albumin in a mixture of tris-buffered salineand Tween 20 at room temperature, the membranes wereincubated overnight at a temperature of 4°C with primaryantibodies. After washing, membranes were incubated withhorseradish peroxidase-conjugated secondary antibodies atroom temperature for 1 h. To visualize proteins, ECL westernblotting substrate (BioVision, Inc, Milpitas, CA, USA) was

Table 1: Oligonucleotides used in this study

Gene Primer Sequence

TNF-α 5′ forward 3′ CATCCGTTCTCTACCCAGCC3′ reverse 5′ AATTCTGAGCCCGGAGTTGG

NF‑κB 5′ forward 3′ ACGATCTGTTTCCCCTCATC3′ reverse 5′ TGC TTCTCTCCCCAGGAATA

MMP‑2 5′ forward 3′ CTGATAACCTGGATGCAGTCGT3′ reverse 5′ CCAGCCAGTCCGATT TGA

MMP-9 5′ forward 3′ TTCAAGGACGGTCGGTATT3′ reverse 5′ CTCGAGCCTAGACCCAACTTA

GAPDH 5′ forward 3′ AAGAAGGTGGTGAAGCAGGC3′ reverse 5′ TCCACCACCCTGTTGCTGTA

Nrf-2 5′ forward 3′ CACATCCAGTCAGAAACCAGTGG3′ reverse 5′ GGAATGTCTGCGCCAAAAGCTG

INF-γ 5′ forward 3′ GGCAAAAGGACGGTAACACG3′ reverse 5′ TCTGTGGGTTGTTCACCTCG

SM22 5′ forward 3′ ATCCTATGGCATGAGCCGTG3′ reverse 5′ CAGGCTGTTCACCAACTTGC

130 Gang Xiao et al.

used. The following primary antibodies were used to performthis assay: NF‑κB (#N8523; 1:1,000, Sigma Aldrich, China),β-actin (#SAB3500350; 1:5,000, Sigma Aldrich, China), LaminB (#SAB5700147; 1:10,000, SigmaAldrich),MMP-9 (#SAB5700152;1:2,000, Sigma Aldrich, China), and GAPDH (#AB2302;1:5,000, Sigma Aldrich, China). To examine the expressionof nuclear transcription factor Nrf-2, nuclear and cytoplasmicproteins were isolated separately. Gel electrophoresis wasused to differentiate the lysates of cells and then transferredto the PVDF. The membranes were probed with anti-Nrf-2 (#ABE1845; 1:500, Sigma Aldrich, China), anti-NADPH(#ab109225; 1:2,000, ElabScience, Hubei, China), and anti-αSMA antibodies (#ab5694; 1:5,000, ElabScience, Hubei,China). The membranes were visualized with improvedchemiluminescence, followed by X-ray film for imaging.The results were analyzed using ImageJ.

2.5 H&E and immunohistochemical staining

The extracted tissues were sliced into 5 μM sections andplaced on polylysine-coated slides until treatment withH&E. The tissues were then stained with hematoxylinsolutions for 7 h at temperatures between 50 and 70°Cand then washed with tap water till the water was color-less. Next, 10% acetic acid and 85% ethanol were used for2 and 10 h for differentiation of the tissue, and tissueswere then washed with tap water. We saturated the tissuein the lithium carbonate solution for 10 h and thenwashed itwith tap water. Eventually, staining was done for 48 h withthe eosin solution. The tissue slices were dehydrated twicefor 30minwith 95% ethanol and then immersed in xylene at50–70°C for 1 h, accompanied by paraffin for 10 h. Thestained tissues were then imaged using microscopy.

Paraffin-embedded sections in Histoclear solutionwere heated overnight to 50°C and deparaffinized for5–10 min. The sections were rehydrated using 100%alcohol twice for 10 min, followed by 95%, 90%, 70%of alcohol for 10 min respectively. Subsequently the sec-tions were re-hydrated with water for 5 min. The activityof endogenous peroxidase was inactivated by immersionin 3% H2O2 peroxide for 25 min. Antigen unmasking wasaccomplished by incorporating slides for 1 h at 95°C inthe target recovery solution. Tissue portions wereblocked with 10% normal goat serum in phosphate-buf-fered saline after rapid cooling to room temperature.Antibodies for Nrf2 (#C20, Santa Cruz Biotechnology)were used for immunohistochemistry staining at dilution(1:2,000). 3,3-Diaminobenzidine (DAB) was used to developand display colors. With hematoxylin, the tissue slices weregently counterstained, dehydrated, and covered. Using alight microscope, the slides were imaged.

To evaluate the production of macrophages in CAwalls, the brain tissue in the area typically performedwith CA was extracted and split into 5 μm sections.These areas were initially hydrated and then stainedwith primary antibody CD68 (CAS No. 3F103; 1:200 dilu-tion, Santa Cruz Biotech, Shanghai, China), and conse-quently several secondary antibodies (CAS No. sc-2354;goat anti-mouse IgG, peroxidase-linked antibody, 1:5,000dilution) were counterstained with hematoxylin. To ensurethat a consistent number of macrophage cells were producedin the CA walls, the number of labeled positive cells wascounted in a 100 μm square area surrounding the CA walls.

2.6 Statistical analysis

Mean ± SE was used to statistically measure the effectsfrom multiple observations. Student’s t-test is used todeduce the significance of two mean values between twodifferent groups. One-way ANOVA method was used formultiple comparisons. GraphPad Prism software was usedto determine the significance with P < 0.05.

3 Results

3.1 PCA suppresses CA formation andprogression in rats

In this study, we attempted to understand the inhibitoryeffect of PCA against CA progression, after the adminis-tration of elastase. The development of aneurysm wasidentified along the Willis circle or its major branches,which is consistent with previous studies [25–27]. Mostaneurysms were larger in size, with multiple aneurysmsaround three to four times larger than their parent arteries.Before triggering CA, the experimental group of rats wastreated with PCA. We found that the control group had ananeurysm size of 26.5 ± 0.76 μm, constantly increasing insize to 45.5 ± 1.67 μm (P < 0.001) in the group induced byintracranial aneurysm over a period of 16 weeks, whereasthe group of rats pretreated with PCA had an aneurysm sizesignificantly decreased to 31.33 ± 1.10 μm (P < 0.05) and32.33 ± 2.06 μm (P < 0.01) at doses of 50 and 100mg/kg,respectively, of PCA relative to the CA group (Table 2) ina dose-dependent manner. While taking into considerationthe systolic blood pressure (SBP) levels, the CA groupshowed significant (P < 0.001) variation in their levels after8 weeks of CA induction. Similarly, the group pretreated


with PCA displayed a significant decrease in SBP levels after8 weeks in a dose-dependent manner when compared tothe CA group (Figure 1), besides the degree of elevatedaneurysm scores (Table 3). Treatment with PCA suppressedvessel wall thickness in rats (P < 0.05) relative to the CAgroup (Table 4) in a dose-dependent manner. After CAinduction, the body weight and BMI were substantiallydecreased after 4weekswhen compared to the control group.However, the groups receiving PCA-50 and 100mg/kg treat-ments demonstrated a gain in body weight and BMI tonormal control groups after 4 weeks. Furthermore, theyretained the body weight and BMI of rats in groups receivingPCA treatments in a dose-dependent manner until 16 weeksof the study duration (Tables 5 and 6).

The effect of PCA was examined in rats with H&Estaining to assess the formation and progression of CA.A cerebral artery from the CA-induced group revealed

that an endothelial cell lining with a thin layer of smoothmuscle cells as described in Figure 2a and b shows mod-erately thick vascular walls with inflammatory infiltrationof the cells, thus displaying distortion of the vessel wallwith evidence of myointimal hyperplasia. The thicknessof the tunica media in the PCA-treated groups was sig-nificantly decreased compared to the CA group (Figure 2cand d, Table 4) at 50 and 100mg/kg in a dose-dependentmanner.

This study was able to analyze the effect of PCAon macrophage infiltration. Recruitment for macrophageinfiltration was significantly (P < 0.05) elevated 4 weeksafter aneurysm induction (Table 7, Figure 2f). Macro-phage staining of the normal control group using anti-CD68 antibody in the cerebral artery showed lack ofinflammatory cells and macrophage infiltration (Figure 2e).Chronic macrophage-related inflammation plays a majorrole in CA progression and can be seen in Figure 2f. This isfurther demonstrated with staining with anti-CD68 anti-bodies. The positive cells show that a majority of leuko-cytes in the intracranial aneurysms were macrophages.Figure 2f shows numerous leukocytes in intracranialaneurysms, and the distribution of macrophages wasidentical to that of leukocytes. Significantly, a fewer numberof cells were observed at the inflammatory site as comparedto CA after PCA treatments in a dose-dependent manner

Table 2: Progression of CA size in control, induced, and PCA-50 and 100mg/kg administered experimental group of rats monitored for 16weeks

Control CA PCA-50 PCA-100

0 week 28.33 ± 0.88 28.5 ± 0.76 27.5 ± 0.76 28.5 ± 0.764 weeks 26 ± 0.97 28.5 ± 0.76 29.5 ± 0.76 27.5 ± 0.768 weeks 26.5 ± 0.76 36.5 ± 0.76*** 33 ± 0.97* 29.5 ± 0.76***12 weeks 26.5 ± 0.76 38.5 ± 0.76*** 31.33 ± 1.99** 30.67 ± 1.71**16 weeks 26.5 ± 0.76 45.5 ± 1.67*** 31.33 ± 1.10* 32.33 ± 2.06**

Values are expressed as mean ± SE (n = 16). Statistical significance is expressed as ***P < 0.001 CA compared to vehicle (control) and PCA-treated groups; *P < 0.05, PCA-50 compared to CA rats; and **P < 0.01 PCA-100 compared to CA rats.

Figure 1: Effect of PCA on systolic blood pressure in control, CA-induced,and experimental group of 16-week-monitored rats administered PCA-50and 100mg/kg. Values are expressed as mean ± SE (n = 16). Statisticalsignificance is expressed as **P < 0.01; ***P < 0.01 compared to thecontrol group, #P < 0.05 PCA-50 compared to CA rats, and ΨP < 0.01PCA-100 compared to CA rats.

Table 3: Effect of Nrf-2 activation on IA formation and progressionwith aneurysmal scores in control and PCA treatment groups

CA PCA-50 PCA-100

Aneurysmal score 3 ± 0.39 1.8 ± 0.21* 1.5 ± 0.2**#

Values are expressed as mean ± SE (n = 16). Statistical significanceis expressed as *P < 0.05, PCA-50 compared to CA rats; **P < 0.01,PCA-100 compared to CA rats. #P < 0.05, PCA-100 compared withPCA-50 treatment. Aneurysmal scores in the CA group were muchhigher than that in the PCA group, corresponding to aneurysmalscore of 1–5.


(P < 0.05) at 50 and 100mg/kg, respectively (Table 7, Figure2g and h).

3.2 Effect of PCA on inflammatory cytokines,MMP-2, and MMP-9 analyzed by ELISA,qRT-PCR, and western blot analysis

The cytokine levels (Figure 3) in the group of rats inducedwith CA were elevated in comparison to the controlgroup. The cytokines include IL-1β (P < 0.05), IL-2 (P <0.05), IL-17 (P < 0.05), IL-8 (P < 0.01), IL-6 (P < 0.01), andTNF-α (P < 0.05). With the decline in the inflammatorycytokines in groups pretreated with PCA, the CA growthsignaling was substantially (P < 0.05) reduced.

It’s been proved that the NF‑κB signaling was quitecrucial in macrophage infiltration, and as a result, thelevels of downstream MMP-2 and MMP-9 in the wallsof aneurysm were measured. It was found that thelevels of MMP-2 and MMP-9 proteins show an increasein the CA group and were reduced with PCA treatment(Figure 4).

Growing evidence suggests that in chronic inflam-mation, there are molecular pathways causing TNF-αstimulation which further leads to nuclear translocationof NF-κB. This is also demonstrated in our studies wherewe found that NF-κB protein levels shown by western blotanalysis (Figure 5) in aneurysmal walls of the CA weredecreased in the rats treated with PCA-50 and 100mg/kg. The data suggest that the TNF-α stimulated NF-κBpathway inmacrophages was altered by PCA causing sup-pression of CA formation. Because of this, potentially,

Table 4: Wall thickness ratio


Wallthickness

38.5 ± 1.26 73.33 ± 1.71*** 48.50 ± 4.0* 51.33 ± 2.81**


Table 5: Effect of PCA-50 and 100mg/kg administered to the experimental group of rats monitored for 16 weeks on body weight


0 week 162.33 ± 2.45 165.5 ± 1.76 157.5 ± 2.36 158.5 ± 1.864 weeks 167.6 ± 1.97 138.5 ± 1.46** 159.5 ± 1.37* 157.5 ± 1.91*8 weeks 163.5 ± 1.76 136.5 ± 2.46*** 153.43 ± 1.97* 159.5 ± 2.76**12 weeks 166.5 ± 1.36 135.5 ± 1.86*** 161.33 ± 2.99** 168.67 ± 1.71***16 weeks 167.5 ± 2.76 137.7 ± 2.67*** 167.3 ± 1.10** 169.33 ± 2.06***


Table 6: Effect of PCA-50 and 100mg/kg administered experimental group of rats monitored for 16 weeks on BMI


0 week 0.54 ± 0.005 0.55 ± 0.006 0.54 ± 0.003 0.54 ± 0.0054 weeks 0.55 ± 0.007 0.50 ± 0.004** 0.54 ± 0.007** 0.54 ± 0.009**8 weeks 0.54 ± 0.007 0.51 ± 2.46*** 0.53 ± 0.009** 0.54 ± 0.006***12 weeks 0.54 ± 0.003 0.50 ± 1.86** 0.54 ± 0.008** 0.55 ± 0.001***16 weeks 0.55 ± 0.006 0.51 ± 0.006*** 0.55 ± 0.002*** 0.55 ± 0.006***



the NF‑κB pathway is involved in PCA to inhibit theprogression of CA within macrophages (Figure 5).

To provide evidence of the protective role of PCA toCA, mRNA levels of transgelin (SM22) and inflammatorycytokines were analyzed with qPRC (Figures 3 and 6).The group of rats induced by the CA had elevated levelsof cytokines TNF-α, IL-6, IFN-γ, and SM22. In contrast,a significant decrease in cytokine levels was observed inthe PCA-treated groups (P < 0.01). Here, we validate thePCA’s protective action by inhibiting cytokines, thusproving it to be effective in controlling CA and thereforecan be considered as a novel treatment (Figure 6).

Nrf-2 pathway is involved in the mechanisms ofantioxidant defense system. For the investigation ofantioxidant enzymes such as NQO-1, qRT-PCR and wes-tern blot analysis were used. Figures 7 and 8 indicatethat PCA increased the gene expression of antioxidantenzymes (Figure 8d–f), triggering Nrf-2 to substantiallydownregulate cytokine levels (P < 0.05) in both qRT-PCR and western blot analysis. Furthermore, our find-ings revealed that the activation of Nrf-2 with PCA incytoplasm and nucleus as shown in Figure 7 shows aremarkable decrease in cytoplasmic Nrf-2 expression(Figure 8a and b) and an increase in nuclear Nrf-2expressions (Figure 8a and c) after treatment withPCA, respectively (P < 0.05).

3.3 PCA causes downregulation and nucleartranslocation of Nrf-2 with decreasedcellular ROS levels

Nrf-2 expression was significantly decreased in the con-trol group stained with DAB when compared to PCA treat-ment. There was a difference in expression between thecytoplasmic and nucleus cellular compartments in CA(Figure 9a). In the CA group, the amount of Nrf-2 found

Figure 2: H&E staining of normal cerebral artery, CA induced byelastase, and CA treated with PCA-50 and 100mg/kg (a–h).Squares in f–h images are enlarged to show staining with anti-CD68-positive cells revealing that a majority of leukocytes in intra-cranial aneurysms were macrophages. 2G shows numerous leuko-cytes noticed in intracranial aneurysms indicating the distributionof macrophages was identical to that of leukocytes. Scale bar for aand e: 500 µm. Scale bar for b–d: 100 µm. Scale bar for f–h: 20 µm.

Table 7:Macrophage infiltration (number of cells) in control, induced, and PCA-50 and 100mg/kg administered experimental group of ratsmonitored for 16 weeks


0 week 2.45 ± 0.12 2.26 ± 0.07 2.24 ± 0.06 2.35 ± 0.114 weeks 3.85 ± 0.09 4.09 ± 0.13 4.05 ± 0.13 4.05 ± 0.078 weeks 3.39 ± 0.08 7.02 ± 0.25*** 5.57 ± 0.50* 5.37 ± 0.52**12 weeks 4.78 ± 0.12 8.84 ± 0.19*** 6.29 ± 0.68* 5.69 ± 0.81**16 weeks 5.85 ± 0.12 8.92 ± 0.2*** 6.93 ± 0.69* 6.41 ± 0.45**



in the nucleus was greater than that of the group treatedwith PCA. Figure 9b shows that the CA group showed anincrease in ROS levels visualized by an elevated fluores-cence intensity (three-fold)when compared to the controlgroup. This was substantially (P < 0.05) reduced by the

treatment with PCA. These findings confirm that activa-tion of Nrf-2 causes suppression of intracellular oxidativestress.

4 Discussion

This is the first study to investigate the effect of PCA onCA in rats. CA is a chronic inflammatory condition causedby excessive hemodynamic disturbance in arterial walls.It may cause serious SAH, a severe type of stroke.PCA possesses wide pharmacological activities such asanti-inflammatory, antioxidant, antiapoptotic, and anti-cancer [28–31]. Our findings demonstrated that PCAsuppresses the formation and progression of CA viathe inhibition of macrophage infiltration in rats whenupon elastase administration. This mechanism has yetto be elucidated; however, several factors, namelyhemodynamic stress, inflammation, degeneration ofextracellular matrix, ROS generation, etc., contributeto the formation of CA [45]. In the CA group, elastictissues with swollen aneurysmal dilation were absent.Furthermore, there was an increase in aneurysm size(Table 2) demonstrating the connection between theincrease in size with the number of weeks after elastaseadministration. Our results showed that PCA treatment

Figure 3: Effect of PCA on inflammatory cytokines in control, CA-induced, and experimental group of rats administered PCA-50 and100mg/kg. Values are expressed as mean ± SE (n = 16). Statistical significance is expressed as ***P < 0.01 compared to the control group,*P < 0.05 PCA-50 compared to CA rats, and **P < 0.01 PCA-100 compared to CA rats.

Figure 4: Effect of PCA on relative expression of MMP-2 and MMP-9in control, CA-induced, and experimental group of rats administeredPCA-50 and 100mg/kg. Values are expressed as mean ± SE (n = 16).Statistical significance is expressed as ***P < 0.001 compared tothe control group, *P < 0.05 PCA-50 compared to CA rats, and **P <0.01 PCA-100 compared to CA rats.


Figure 5: Effect of PCA on relative mRNA expression of NF-κB in control, CA-induced, and experimental group of rats administered PCA-50and 100mg/kg. Values are expressed as mean ± SE (n = 16). Statistical significance is expressed as ***P < 0.01 compared to the controlgroup, **P < 0.01 PCA-50 compared to CA rats, and ***P < 0.001 PCA-100 compared to CA rats.

Figure 6: Effect of PCA on inflammatory cytokines IFN-γ and SM22 in control, CA-induced, and experimental group of rats administered PCA-50 and 100mg/kg. Values are expressed as mean ± SE (n = 16). Statistical significance is expressed as ***P < 0.01 compared to the controlgroup, *P < 0.05 PCA-50 compared to CA rats, and **P < 0.01 PCA-100 compared to CA rats.

Figure 7: Effect of PCA on mRNA expressions of cytoplasm and nuclear fractions Nrf-2, antioxidant enzyme NQO-1 in control, CA-induced,and experimental group of rats administered PCA-50 and 100 mg/kg. Values are expressed as mean ± SE (n = 16). Statistical significanceis expressed as ***P < 0.01 compared to control group, *P < 0.05 PCA-50 compared to CA rats, and **P < 0.01 PCA-100 compared toCA rats.


was able to reduce the effects of elastase significantly(P < 0.05) decreasing the aneurysm size, thereby showingthe role of inflammatory cytokines, IL-1β, IL-2, IL-17, IL-8,IL-6 and TNF-α in the development of lesions inCA-induced rats (Figure 3) over 16 weeks.

Further validation of aneurysm induction using elas-tase was obtained by measuring systolic blood pressurein all animal groups. Our findings noted high blood pres-sure because of the induction of aneurysms over a period

of 16 weeks. PCA treatment reduced the high blood pres-sure restoring readings comparable to control rats. Theformation of CA was regulated by MMPs, namely MMP-2and MMP-9, which caused the deterioration of the endo-thelium of cerebral arteries via degradation of elastic laminaresulting in inflammation and hypertension. The over-expression of MMP-2 and MMP-9 in CA-induced rats rein-forced the effect of CA induction with elastase treatmentrelative to PCA groups. These overexpressions of MMPs

Figure 8: Effect of PCA on (a) and (d) western blot and (b, c, e, and f) densitometry analysis of cytoplasm and nuclear fractions Nrf-2 andantioxidant enzyme NQO-1 in control, CA-induced, and experimental group of rats administered PCA-50 and 100mg/kg. Values areexpressed as mean ± SE (n = 16). Statistical significance is expressed as #P < 0.01 compared to the control group, *P < 0.05 PCA-50and 100mg/kg compared to CA rats.

Figure 9: (a) Translocation of Nrf-2 from positive cells and number of positive cells analyzed (n = 4) showing H&E staining in CA-induced andPCA (100mg/kg)-treated groups. (b) Intracellular ROS in the control, CA-induced, and experimental group of rats administered PCA-50 and100mg/kg. Values are expressed as mean ± SE (n = 16). Statistical significance is expressed as ***P < 0.01 compared to the control group,*P < 0.05 PCA-50 compared to CA rats, and **P < 0.01 PCA-100 compared to CA rats.


that are involved in the progression of CA concur withresults of other studies [46–48]. We investigated the rolethat the pro-inflammatory cytokine, TNF-α, plays in thedevelopment of intracranial aneurysm. The mRNA expres-sion of pro-inflammatory cytokines, TNF-α, IL-17 IL-6, andIL-8 with activated infiltration of macrophages in responseto IFN- γ, [49] showed a significant increase in CA-inducedrats (Figure 6). The increase in IL-6 levels correlatedwith cerebral damage via the rupture of aneurysm andthus the development of CA [50]. Increased IL-1β levelsin CA-induced rats demonstrated the deterioration of extra-cellular matrix, resulting in damage of the vascular endo-thelium [51]. The IL-1β levels were suppressed with PCAtreatments and inhibited the development of an aneurysm,thus reducing the progression of vascular remodeling[52]. The recruitment of macrophage infiltration wasdemonstrated by an increase in IL-17 and IL-8 levelsleading to the production of cytokines. These markersof inflammation result in the formation and development

of aneurysm [53–55]. The increase in pro-inflammatorycytokines downregulated SM22, which in turn promotedthe destruction and formation of the cytoskeleton andaccelerated the formation and rupture of an aneurysm[56]. The treatment of PCA at 50 and 100mg/kg showeda significant reduction in the levels of pro-inflammatorycytokines in a dose-dependent manner. This demon-strates that potentially TNF-α signaling mechanism isinvolved in the development and progression of CA.

In addition, PCA was shown to inhibit NF-κB expres-sion, subsequently exerting anti-inflammatory action onaneurysms. Our results show an increase in systolic pres-sure denoting induction of hemodynamic stress in animalmodels within the intracranial arteries, thereby triggeringinflammation with progression of CA, similar to the patho-genesis of CA in humans [57].

Although several studies reported the role of NF-κBas a key transcription factor in the regulation of the expres-sion of MMPs, production and release of pro-inflammatory

Figure 10: Schematic representation of the study.


cytokines, and macrophage infiltration in advancing theprogression of CA [58–60], the effect of PCA on the CAprogression has not been reported. The treatment withPCA at the two different doses shows suppression inaneurysmal wall degeneration, prevention in macrophageinfiltration, and inflammatory cytokines. This potentiallyinvolves the role of NF-κB and MCP‑1 signaling pathwaysand could be a therapeutic target in the treatment of CA.In addition, this study noticed significant reductions inthe expressions of MMP-2 and MMP-9 in PCA-treatedgroups. While CA pathogenesis involving MMPs is debated,our findings concur with a previous study, showing anincreased expression of MMP-2 andMMP-9 in human serumand aneurysmal walls [61].

Inflammation and oxidative stress are possibly involvedin causing endothelial dysfunction. The transcription factor,Nrf-2, is involved in the modulation of cellular oxidativeprocesses via antioxidant and detoxifying genes. Under oxi-dative stress, Nrf-2 translocates from the cytoplasm to thenucleus. Thus, we hypothesized that the potential role ofNrf-2 activation is to inhibit the oxidative stress and offerprotective effects against CA formation and progression.Our results showed reduced aneurysmal scores and pro-gression of CA without rupturing after treatment withPCA at 50 and 100mg/kg, respectively, thus indicatingthe role of Nrf-2 pathway activation in the suppressionof CA progression. This is consistent with another studythat reported elevated Nrf-2 levels in the inhibition ofacute aortic dissection formation. Our immunohistochem-ical findings showed the downregulation and Nrf-2 nucleartranslocation in aneurysm walls (Figure 9).

We show that PCA decreases the inflammatory responsesin the formation of CA by inhibiting the NF‑κB pathway andmacrophage infiltration. NF‑κB pathway inhibition can be apotential target for the prevention and treatment of CA. Wealso confirmed that Nrf-2 signaling inhibits CA formationand development, via acting on Nrf-2 translocation intothe nucleus. TNF-α signaling initiates the procedure in theCA-induced group of rats by development and maturationof the CA. We found that with the treatment of PCA, itis possible to control aneurysms as well as inhibit theaneurysm rupture in the brain (Figure 10).

5 Conclusion

This study suggests that formation and progression ofCA induced by inflammation and oxidative stress canbe inhibited with the treatment of PCA in a dose-depen-dent manner. This involves the regulatory roles of TNF-α,

NF-κB, and Nrf-2 activation pathways. The underlyingmechanism involves a decreased expression of pro-inflam-matory cytokines, upregulation of antioxidant enzyme acti-vities, and reduced intracellular ROS formation. We proposethat PCA can be an alternative and novel therapeutic for thetreatment of CA by inhibiting TNF-α, NF-κB, and Nrf-2 acti-vation pathways.

Funding: The authors state no funding involved.

Conflict of interest: The authors state no conflict ofinterest.

Data availability statement: The datasets generated duringand/or analyzed during the current study are available fromthe corresponding author on reasonable request.

References

[1] Monique HV, Ale A, Raya B, Gabriël JR. Prevalence of unrup-tured intracranial aneurysms, with emphasis on sex, age,comorbidity, country, and time period: a systematic reviewand meta-analysis. Lancet Neurol. 2011;10(7):626–36.

[2] Etminan N, Rinkel G. Unruptured intracranial aneurysms:development, rupture and preventive management. Nat RevNeurol. 2016;12:699–713.

[3] Eric PBD. Headache, cerebral aneurysms, and the use of trip-tans and ergot derivatives. Headache. 2015;55(5):739–47.

[4] Schievink WI. Intracranial aneurysms. N Engl J Med.1997;336(1):28–40.

[5] Anderson CS, Feigin V, Bennett D, Lin RB, Hankey G,Jamrozik K. Active and passive smoking and the risk of sub-arachnoid hemorrhage. Stroke. 2004;35:633–7.

[6] Francesco S, Sapir S, Loreto G, Sophie C, Félix T, Cyril PM, et al.Hemodynamic stress, inflammation, and intracranialaneurysm development and rupture: a systematic review.World Neurosurg. 2018;115:234–44.

[7] Hashimoto T, Meng H, Young WL. Intracranial aneurysms: linksamong inflammation, hemodynamics and vascular remo-deling. Neurol Res. 2006;28(4):372–80.

[8] Chalouhi N, Hoh BL, Hasan D. Review of cerebral aneurysmformation, growth and rupture. Stroke. 2013;44(12):3613–22.

[9] Liu P, Song Y, Zhou Y, Liu Y, Qiu T, An Q, et al. Cyclicmechanical stretch induced smooth muscle cell changes incerebral aneurysm progress by reducing collagen type IV andcollagen type VI levels. Cell Physiol Biochem.2018;45(3):1051–60.

[10] Pera J, Korostynski M, Krzyszkowski T, Czopek J, Slowik A,Dziedzic T, et al. Gene expression profiles in human rupturedand unruptured intracranial aneurysms: what is the role ofinflammation? Stroke. 2010;41:224–31.

[11] Hosaka K, Hoh BL. Inflammation and cerebral aneurysms.Transl Stroke Res. 2014;5(2):190–8.


[12] Tuttolomondo A, Riccardo DS, Domenico DR, Pedone C,Placa SL, Pinto A, et al. Effects of clinical and laboratory vari-ables and of pretreatment with cardiovascular drugs in acuteischaemic stroke: a retrospective chart review from the GIFAstudy. Int J Cardiol. 2011;151(3):318–22.

[13] Raimondo DD, Tuttolomondo A, Buttà C, Miceli S, Licata G,Pinto A. Effects of ace-inhibitors and angiotensin receptorblockers on inflammation. Curr Pharm Des.2012;18(28):4385–413.

[14] Licata G, Tuttolomondo A, Corrao S, Raimondo DD,Fernandez P, Caruso C, et al. Immunoinflammatory activationduring the acute phase of lacunar and non-lacunar ischemicstroke: association with time of onset and diabetic state. Int JImmunopathol Pharmacol. 2006;19(3):639–46.

[15] Starke RM, Chalouhi N, Ding D, Daniel MSR, Mckisic MS,Gary KO, et al. Vascular smooth muscle cells in cerebralaneurysm pathogenesis. Transl Stroke Res.2014;5(3):338–46.

[16] Starke RM, Chalouhi N, Ali MS, Pascal MJ, Stavropoula IT,Fernando GL, et al. The role of oxidative stress in cerebralaneurysm formation and rupture. Curr Neurovasc Res.2013;10(3):247–55.

[17] Keleku-Lukwete N, Suzuki M, Yamamoto M. An overview of theadvantages of KEAP1-NRF2 system activation during inflam-matory disease treatment. Antioxid Redox Signal.2018;29(17):1746–55.

[18] Aoki T, Kataoka H, Shimamura M, Nakagami H, Wakayama K,Moriwaki T, et al. nF-kappaB is a key mediator of cerebralaneurysm formation. Circulation. 2007;116(24):2830–40.

[19] Moriwaki T, Takagi Y, Sadamasa N, Aoki T, Nozaki K,Hashimoto N. Impaired progression of cerebral aneurysms ininterleukin-1β deficient mice. Stroke. 2006;37(3):900–5.

[20] Aoki T, Kataoka H, Morimoto M, Nozaki K, Hashimoto N.Macrophage-derived matrix metalloproteinase-2 and -9promote the progression of cerebral aneurysms in rats.Stroke. 2007;38(1):162–9.

[21] Wanderer S, Waltenspuel C, Gruter BE, Remonda L, Fandino J,Marbacher S, et al. Arterial pouch microsurgical bifurcationaneurysm model in the rabbit. J Vis Exp. 2020;159:32478731.doi: 10.3791/61157

[22] de Oliveira IA. Main models of experimental saccular aneurysm inanimals. Neurosurgery. 2012;9(7):10264–8. doi: 10.5772/50310.

[23] Rowinska Z, Gorressen S, Merx MW, Koeppel TA, Liehn EA,Zernecke A. Establishment of a new murine elastase-inducedaneurysm model combined with transplantation. PLoS One.2014;9:7.

[24] Jayaraman T, Paget A, Shin YS, Li X, Mayer J, Chaudhry HW,et al. TNF-alpha-mediated inflammation in cerebral aneurysms:a potential link to growth and rupture. Vasc Health Risk Manag.2008;4(4):805–17.

[25] Liu Z, Ajimu K, Yalikun N, Zheng Y, Xu F. Potential therapeuticstrategies for intracranial aneurysms targeting aneurysmpathogenesis. Front Neurosci. 2019;13:1238. doi: 10.3389/fnins.2019.01238.

[26] Olmos G, Lladó J. Tumor necrosis factor alpha: a link betweenneuroinflammation and excitotoxicity. Mediators Inflamm.2014;2014:861231. doi: 10.1155/2014/861231.

[27] Ma Y, Chen F, Yang S, Chen B, Shi J. Protocatechuic acidameliorates high glucose-induced extracellular matrix

accumulation in diabetic nephropathy. Biomed Pharmacother.2018;98:18–22.

[28] Jang SA, Song HS, Kwon JE, Baek HJ, Koo HJ, Sohn EH, et al.Protocatechuic acid attenuates trabecular bone loss in ovar-iectomized mice. Oxid Med Cell Longev. 2018;2018:7280342.doi: 10.1155/2018/7280342.

[29] Molehin OR, Adeyanju AA, Adefegha SA, Akomolafe SF.Protocatechuic acid mitigates adriamycin-induced reproduc-tive toxicities and hepatocellular damage in rats. Comp ClinPathol. 2018;27:1681–9.

[30] Jang SE, Choi JR, Han MJ, Kim DH. The preventive and curativeeffect of cyanidin-3β-D-glycoside and its metabolite proto-catechuic acid against TNBS-induced colitis in mice. Nat ProdSci. 2016;22(4):282–6.

[31] Safaeiana L, Emamia R, Hajhashemia V, Haghighatian Z.Antihypertensive and antioxidant effects of protocatechuicacid in deoxycorticosterone acetate-salt hypertensive rats.Biomed Pharmacother. 2018;100:147–55.

[32] Lende AB, Kshirsagar AD, Deshpande AD, Muley MM, Patil RR,Bafna PA, et al. Anti-inflammatory and analgesic activity ofprotocatechuic acid in rats and mice. Inflammopharmacology.2011;19(5):255–63.

[33] Liu YD, Sun X, Zhang Y, Wu HJ, Wang H, Yang R, et al.Protocatechuic acid inhibits TGF-β1-induced proliferation andmigration of human airway smooth muscle cells. J PharmacolSci. 2019;139(1):9–14. doi: 10.1016/j.jphs.2018.10.011.

[34] Owumi SE, Ajijola IJ, Agbeti. OM. Hepatoremal protectiveeffects of Protocatechuic acid In rats administered with anti-cancer drug methotrexate. Hum Exp Toxicol.2019;38(11):1254–65.

[35] Varì R, Scazzocchio B, Santangelo C, Filesi C, Galvano F,D’Archivio M, et al. Protocatechuic acid prevents oxLDL-induced apoptosis by activating JNK/Nrf2 survival signals inmacrophages. Oxid Med Cell Longev. 2015;2015:351827.

[36] Varì R, D’Archivio M, Filesi C, Carotenuto S, Scazzocchio B,Santangelo C, et al. Protocatechuic acid induces antioxidant/detoxifying enzyme expression through JNK-mediated Nrf2activation in murine macrophages. J Nutr Biochem.2011;22(5):409–17.

[37] Wang HY, Wang H, Wang JH, Wang Q, Ma QF, Chen YY.Protocatechuic acid inhibits inflammatory responses in LPS-stimulated BV2 Microglia via NF-kappaB and MAPKs signalingpathways. Neurochem Res. 2015;40:1655–60.

[38] Jangho L, Su JH, Hye JL, Min JK, Jin HK, Yun TK, et al. Protectiveeffect of Tremella fuciformis berk extract on LPS-induced acuteinflammation via inhibition of the NF-κB and MAPK pathways.Food Funct. 2016;7(7):3263–72.

[39] Hui-Hsuan L, Jing-Hsien C, Fen-Pi C, Chau-Jong W.Protocatechuic acid inhibits cancer cell metastasis involvingthe down-regulation of Ras/Akt/NF-kB pathway and MMP-2production by targeting RhoB activation. Br J Pharmacol.2011;162(1):237–54.

[40] Chen W, Wang D, Wang LS, Bei D, Wang J, See WA, et al.Pharmacokinetics of protocatechuic acid in mouse and itsquantification in human plasma using LC‐tandem mass spec-trometry. J Chromatogr B. 2012;908:39–44. doi: 10.1016/j.jchromb.2012.09.032.

[41] Safaeian L, Hajhashemi V, Javanmard SH, Naderi HS. The effectof protocatechuic acid on blood pressure and oxidative stress


in glucocorticoid-induced hypertension in rat. Iran J PharmRes. 2016;15(Special issue):83–91.

[42] Bhattacharjee N, Dua TK, Khanra R, Joardar S, Nandy A, Saha A,et al. Protocatechuic acid, a phenolic from Sansevieria rox-burghiana leaves, suppresses diabetic cardiomyopathy viastimulating glucose metabolism, ameliorating oxidativestress, and inhibiting inflammation. Front Pharmacol.2017;8:251. doi: 10.3389/fphar.2017.00251.

[43] Nuki Y, Tsou TL, Kurihara C, Kanematsu M, Kanematsu Y,Hashimoto T. Elastase-induced intracranial aneurysms inhypertensive mice. Hypertension. 2009;54(6):1337–44.

[44] Allen Linda A, Schmidt James R, Thompson Christopher T,Carlson Brian E, Beard Daniel A, Lombard Julian H. High saltdiet impairs cerebral blood flow regulation via salt-inducedangiotensin-II suppression. Microcirculation.2019;26(3):e12518.

[45] Weir B. Unruptured aneurysms. J Neurosurg.2002;97(5):1011–3.

[46] Seo JH, Guo S, Lok J, Navaratna D, Whalen MJ, Kim KW, et al.Neurovascular matrix metalloproteinases and the blood-brainbarrier. Curr Pharm Des. 2012;18(25):3645–8.

[47] Zhang X, Ares WJ, Taussky P, Ducruet AF, Grandhi R. Role ofmatric metalloproteinases in the pathogenesis of intracranialaneurysms. Neurosurg Focus. 2019;47:E4. doi: 10.3171/2019.4.

[48] Pannu H, Kim DH, Guo D, King TM, Van Ginhoven G, Chin T,et al. The role of MMP-2 and MMP-9 polymorphisms insporadic intracranial aneurysms. J Neurosurg.2006;105(3):418–23.

[49] Mantovani A, Sica A, Locati M. Macrophage polarization comesof age. Immunity. 2005;23(4):344–6.

[50] Morgan L, Cooper J, Montgomery H, Kitchen N, Humphries SE.The interleukin-6 gene -174G [{GT}]C and -572G[{GT}]C pro-moter polymorphisms are related to cerebral aneurysms.J Neurol Neurosurg Psychiatry. 2006;77(8):915–7.

[51] Aoki T, Kataoka H, Ishibashi R, Nozaki K, Morishita R,Hashimoto N. Reduced collagen biosynthesis is the hallmark

of cerebral aneurysm: contribution of interleukin-1beta andnuclear factor-kappaB. Arterioscler Thromb Vasc Biol.2009;29(7):1080–6.

[52] Moriwaki T, Takagi Y, Sadamasa N, Aoki T, Nozaki K,Hashimoto N. Impaired progression of cerebral aneurysms ininterleukin-1beta-deficient mice. Stroke. 2006;37(3):900–5.

[53] Toth G, Cerejo R. Intracranial aneurysms: review of currentscience and management. Vasc Med. 2018;23(3):276–88.

[54] Cummings TJ, Johnson RR, Diaz FG, Michael DB. The relation-ship of blunt head trauma, subarachnoid hemorrhage, andrupture of pre-existing intracranial saccular aneurysms.Neurol Res. 2000;22(2):165–70.

[55] Chalouhi N, Points L, Pierce GL, Ballas Z, Jabbour P, Hasan D.Localized increase of chemokines in the lumen of humancerebral aneurysms. Stroke. 2013;44(9):2594–7.

[56] Shen J, Yang M, Ju D, Jiang H, Zheng JP, Xu Z, et al. Disruptionof SM22 promotes inflammation after artery injury vianuclear factor kappaB activation. Circ Res.2010;106(8):1351–62.

[57] Jou LD, lee DH, Morsi H, Mawad ME. Wall shear stress onruptured and unruptured intracranial aneurysms at theinternal carotid artery. Am J Neuroradiol. 2008;29(9):1761–7.

[58] Chalouhi N, Ali MS, Jabbour PM, Tjoumakaris SI, Gonzalez IF,Rosenwasser RH, et al. Biology of intracranial aneurysms:role of inflammation. J Cereb Blood Flow Metab.2012;32(9):1659–76.

[59] Starke RM, Raper DM, Ding D, Chalouhi N, Owens GK, Hasan DM.Tumor necrosis factor-α modulates cerebral aneurysm formationand rupture. Transl Stroke Res. 2014;5(2):269–77.

[60] Starke RM, Chalouhi N, Ali MS, Jabbour PM, Tjoumakaris SI,Gonzalez LF, et al. The role of oxidative stress in cerebralaneurysm formation and rupture. Curr Neurovasc Res.2013;10(3):247–55.

[61] Jin D, Sheng J, Yang X, Gao B. Matrix metalloproteinases andtissue inhibitors of metalloproteinases expression in humancerebral ruptured and unruptured aneurysm. Surg Neurol.2007;68(Suppl 2):S11–6.


degruyter biol biol-2021-0012 128..141

Documents