data

30
© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 1 Data Mining: Data Lecture Notes for Chapter 2 Introduction to Data Mining by Tan, Steinbach, Kumar Revised by QY

Upload: tommy96

Post on 11-May-2015

424 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 1

Data Mining: Data

Lecture Notes for Chapter 2

Introduction to Data Miningby

Tan, Steinbach, Kumar

Revised by QY

Page 2: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 2

What is Data?

Collection of data objects and their attributes

An attribute is a property or characteristic of an object

– Examples: eye color of a person, temperature, etc.

– Attribute is also known as variable, field, characteristic, or feature

A collection of attributes describe an object

– Object is also known as record, point, case, sample, entity, or instance

Tid Refund Marital Status

Taxable Income Cheat

1 Yes Single 125K No

2 No Married 100K No

3 No Single 70K No

4 Yes Married 120K No

5 No Divorced 95K Yes

6 No Married 60K No

7 Yes Divorced 220K No

8 No Single 85K Yes

9 No Married 75K No

10 No Single 90K Yes 10

Attributes

Objects

Page 3: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 3

Attribute Values

Attribute values are numbers or symbols assigned to an attribute– E.g. ‘Student Name’=‘John’– Attributes are also called ‘variables’, or ‘features’– Attribute values are also called ‘values’, or ‘feature-

values’ Designing Attributes for a data set requires

domain knowledge– Always have an objective in mind (e.g., what is the

class attribute?)– Design a ‘movie’ data set for a movie dataset?

What is domain knowledge?

Page 4: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 4

Measurement of Length

Different designs have different attributes properties.

1

2

3

5

5

7

8

15

10 4

A

B

C

D

E

Page 5: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 5

Types of Attributes

There are different types of attributes– Nominal (Categorical)

Examples: ID numbers, eye color, zip codes

– Ordinal (Categorical) Examples: rankings (e.g., movie ranking scores on a scale

from 1-10), grades (A,B,C..), height in {tall, medium, short}

– Binary (0, 1) is a special case

– Continuous Example: temperature in Celsius

Page 6: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 6

Record Data

Data consist of a collection of records, each of which consists of a fixed set of attributes

Tid Refund Marital Status

Taxable Income Cheat

1 Yes Single 125K No

2 No Married 100K No

3 No Single 70K No

4 Yes Married 120K No

5 No Divorced 95K Yes

6 No Married 60K No

7 Yes Divorced 220K No

8 No Single 85K Yes

9 No Married 75K No

10 No Single 90K Yes 10

Q: what is a sparse data set?

Page 7: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 7

Data Matrix

If data objects have the same fixed set of numeric attributes, then the data objects can be thought of as points in a multi-dimensional space, where each dimension represents an attribute

Such data set can be represented by an m by n matrix, where there are m rows, one for each object, and n columns, one for each attribute

1.12.216.226.2512.65

1.22.715.225.2710.23

Thickness LoadDistanceProjection of y load

Projection of x Load

1.12.216.226.2512.65

1.22.715.225.2710.23

Thickness LoadDistanceProjection of y load

Projection of x Load

Q: what is a sparse data set?

Page 8: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 8

Document Data

Each document becomes a `term' vector, – each term is a component (attribute) of the vector,

Term can be n-grams, phrases, etc.

– the value of each component is the number of times the corresponding term occurs in the document.

Document 1

season

timeout

lost

win

game

score

ball

play

coach

team

Document 2

Document 3

3 0 5 0 2 6 0 2 0 2

0

0

7 0 2 1 0 0 3 0 0

1 0 0 1 2 2 0 3 0

Q: what is a sparse data set?

Page 9: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 9

Transaction Data

A special type of record data, where – each record (transaction) has a set of items.

– For example, consider a grocery store. The set of products purchased by a customer during one shopping trip constitute a transaction, while the individual products that were purchased are the items.

– Set based TID Items

1 Bread, Coke, Milk

2 Beer, Bread

3 Beer, Coke, Diaper, Milk

4 Beer, Bread, Diaper, Milk

5 Coke, Diaper, Milk

Q: class attribute?

Page 10: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 10

Graph Data

Examples: Directed graph and URL Links

5

2

1

2

5

<a href="papers/papers.html#bbbb">Data Mining </a><li><a href="papers/papers.html#aaaa">Graph Partitioning </a><li><a href="papers/papers.html#aaaa">Parallel Solution of Sparse Linear System of Equations </a><li><a href="papers/papers.html#ffff">N-Body Computation and Dense Linear System Solvers

Q: what is a sparse data set?

Page 11: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 11

Ordered Data

Sequences of transactions

An element of the sequence

Items/Events

Page 12: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 12

Ordered Data

Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCCCGCAGGGCCCGCCCCGCGCCGTCGAGAAGGGCCCGCCTGGCGGGCGGGGGGAGGCGGGGCCGCCCGAGCCCAACCGAGTCCGACCAGGTGCCCCCTCTGCTCGGCCTAGACCTGAGCTCATTAGGCGGCAGCGGACAGGCCAAGTAGAACACGCGAAGCGCTGGGCTGCCTGCTGCGACCAGGG

Page 13: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 13

Data Quality

What kinds of data quality problems? How can we detect problems with the data? What can we do about these problems?

Examples of data quality problems: – Noise and outliers

– missing values

– duplicated data

Page 14: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 14

Outliers

Outliers are data objects with characteristics that are considerably different than most of the other data objects in the data set– Are they noise points, or meaningful outliers?

Page 15: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 15

Missing Values

Reasons for missing values– Information is not collected

(e.g., people decline to give their age and weight)

– Attributes may not be applicable to all cases (e.g., annual income is not applicable to children)

Handling missing values– Eliminate Data Objects

– Estimate Missing Values

– Ignore the Missing Value During Analysis

– Replace with all possible values (weighted by their probabilities)

– Missing as meaningful…

Page 16: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 16

Data Preprocessing

Aggregation and Noise Removal Sampling Dimensionality Reduction Feature subset selection Feature creation and transformation Discretization

Q: How much % of the data mining process is data preprocessing?

Page 17: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 17

Aggregation

Combining two or more attributes (or objects) into a single attribute (or object)

Purpose– Data reduction

Reduce the number of attributes or objects

– Change of scale Cities aggregated into regions, states, countries, etc

– De-noise: more “stable” data Aggregated data tends to have less variability

Page 18: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 18

Aggregation

Standard Deviation of Average Monthly Precipitation

Standard Deviation of Average Yearly Precipitation

Variation of Precipitation in Australia

Page 19: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 19

Sampling

Sampling is the main technique employed for data selection.

– It is often used for both the preliminary investigation of the data and the final data analysis.

Reasons:– too expensive or time consuming to obtain or to process

the data.

Page 20: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 20

Curse of Dimensionality

When dimensionality increases, data becomes increasingly sparse in the space that it occupies

Definitions of density and distance between points, which is critical for clustering and outlier detection, become less meaningful

Thus, harder and harder to classify the data!

• Randomly generate 500 points

• Compute difference between max and min distance between any pair of points

Page 21: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 21

Dimensionality Reduction

Purpose:– Avoid curse of dimensionality

– Reduce amount of time and memory required by data mining algorithms

– Allow data to be more easily visualized

– May help to eliminate irrelevant features or reduce noise

Techniques (supervised and unsupervised methods)– Principle Component Analysis

– Singular Value Decomposition

– Others: supervised and non-linear techniques

Page 22: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 22

Dimensionality Reduction: PCA

Goal is to find a projection that captures the largest amount of variation in data– Supervised or unsupervised?

x2

x1

e

Page 23: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 23

Dimensionality Reduction: PCA

Find the eigenvectors of the covariance matrix The eigenvectors define the new space

– How many eigenvectors here?

x2

x1

e

Page 24: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 24

Dimensionality Reduction: ISOMAP

Construct a neighbourhood graph For each pair of points in the graph, compute the shortest

path distances – geodesic distances

By: Tenenbaum, de Silva, Langford (2000)

Page 25: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 25

Dimensions = 10Dimensions = 40Dimensions = 80Dimensions = 120Dimensions = 160Dimensions = 206

Dimensionality Reduction: PCA

Page 26: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 26

Question

What is the difference between sampling and dimensionality reduction?– Thining vs. shortening of data

Page 27: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 27

Discretization

Three types of attributes:– Nominal — values from an unordered set

Example: attribute “outlook” from weather data

– Values: “sunny”,”overcast”, and “rainy”– Ordinal — values from an ordered set

Example: attribute “temperature” in weather data

– Values: “hot” > “mild” > “cool”– Continuous — real numbers

Discretization: – divide the range of a continuous attribute into intervals– Some classification algorithms only accept categorical attributes.– Reduce data size by discretization– Supervised (entropy) vs. Unsupervised (binning)

Page 28: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 28

Simple Discretization Methods: Binning

Equal-width (distance) partitioning:– It divides the range into N intervals of equal size: uniform grid– if A and B are the lowest and highest values of the attribute, the

width of intervals will be: W = (B –A)/N.The most straightforwardBut outliers may dominate presentation: Skewed data is not handled well.

Equal-depth (frequency) partitioning:– It divides the range into N intervals, each containing

approximately same number of samples– Good data scaling– Managing categorical attributes can be tricky.

Page 29: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 29

Transforming Ordinal to Boolean

Simple transformation allows to code ordinal attribute with n values using n-1 boolean attributes

Example: attribute “temperature”

Why? Not introducing distance concept between different colors: “Red” vs. “Blue” vs. “Green”.

Temperature

Cold

Medium

Hot

Temperature > cold Temperature > medium

False False

True False

True True

Original data Transformed data

Page 30: Data

© Tan,Steinbach, Kumar Introduction to Data Mining 4/18/2004 30

Visually Evaluating Correlation

Scatter plots showing the similarity from –1 to 1.