darwin & natural selection · evolution evolution: the process of change over time; one species...
TRANSCRIPT
![Page 1: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/1.jpg)
Darwin & Natural Selection
Adapted from Mr. Gray & Bristol University
![Page 2: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/2.jpg)
Hypothesis: is an educated guess, based on observations . It's a prediction of cause and effect.
Theory:
Summarizes a hypothesis/hypotheses
Supported with repeated testing
Valid as long as there is no evidence to dispute it
Explains how and why something happens
Example: Theory of Plate Tectonics
Law:
Generalizes a LOT of observations
Tells you what IS going to happen
Example: Law of Gravitation
Basic Scientific Terms Review
![Page 3: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/3.jpg)
Directions Manager: read ?’s
1. Can a theory become a law?
Explain.
2. What’s wrong with this statement
– I have a theory that students
get more write ups after the
holidays.
![Page 4: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/4.jpg)
Evolution
Evolution: The process of change over
time; one species gives rise to another &
“tree” grows!
All living things share a common ancestor.
We can draw a “family” tree of life to show
how every species is related.
![Page 5: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/5.jpg)
Learning Manager – read ?
Besides cell phones, what other
non-biological items have
evolved?
![Page 6: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/6.jpg)
Charles Darwin
Father of Evolution
Proposed the theory of evolution, change over time
Made observations on a 5-year trip around the world on the ship the HMS Beagle
Wrote a book “Origin of the Species” that documented his observations
Survival of the Fittest idea came from this book
![Page 7: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/7.jpg)
![Page 8: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/8.jpg)
Darwin’s Finches
![Page 9: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/9.jpg)
Check out their feet!!!
![Page 10: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/10.jpg)
![Page 11: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/11.jpg)
On Task Manager – read ?
Charles Darwin noticed all the
different looks of the same species.
How might different looks affect
whether a species goes extinct?
![Page 12: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/12.jpg)
Natural Selection
Natural Selection: Organisms that are best
adapted to an environment survive and
reproduce more than others
![Page 13: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/13.jpg)
How Natural Selection Occurs – 4 Ways
Overproduction
Variation
Competition
Selection
![Page 14: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/14.jpg)
Overproduction
Each species produces more offspring that can
survive
![Page 15: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/15.jpg)
Each individual has a unique combination of inherited traits (DNA)
Adaptation: an inherited trait that increases an organism’s chances of survival
Environments can changewhich can change the success of an adaptation Same Parents
Variation
![Page 16: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/16.jpg)
Adaptation Categories
Camouflage (Blend in and hide)
Mimicry (Act and look like)
Physiological (Poison)
Behavioral (Group behavior)
Remember the organism doesn’t CHOOSE the
adaptation! They are born with it or the
environment is more supporting of it!
![Page 17: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/17.jpg)
![Page 18: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/18.jpg)
Coral Snake
(Poisonous)Milk Snake
(Not
poisonous)
![Page 19: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/19.jpg)
![Page 20: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/20.jpg)
![Page 21: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/21.jpg)
![Page 22: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/22.jpg)
![Page 23: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/23.jpg)
![Page 24: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/24.jpg)
![Page 25: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/25.jpg)
Stick Mantid
![Page 26: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/26.jpg)
Flower Mantid
![Page 27: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/27.jpg)
What adaptations do
you see?
![Page 28: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/28.jpg)
What adaptations do
you see?
![Page 29: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/29.jpg)
Variation
The more variation within a species, the more likely they are to survive
The more variation of types of species in a habitat, the more likely at least some will survive
![Page 30: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/30.jpg)
![Page 31: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/31.jpg)
Which community has a better chance of
surviving a natural disaster?
Community A Community B
![Page 32: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/32.jpg)
Competition
Individuals COMPETE for food, water, space, etc.
Survival of the Fittest – the fittest is most able to
survive and reproduce
Not all individuals survive to adulthood
![Page 33: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/33.jpg)
Best adaptations will survive and be able to pass on
their traits to their kids
Genotype: your genes/DNA
Ex: Cat’s ear shape
Phenotype: your physical appearance that is
influenced by your genes and the environment
The color of the flamingo is based on what they eat
(environment)
Selection
![Page 34: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/34.jpg)
Materials Manager – read ? ‘s
What are the 4 “methods” of natural
selection?
Which “method” in your opinion
affects humans most?
![Page 35: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/35.jpg)
How It Works
Individuals with traits that are not well suited to their environment either die or leave few offspring.
Evolution occurs when good traits build up in a population over many generations and bad traits are eliminated by the death of the individuals.
![Page 36: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/36.jpg)
50 Million Years Ago
![Page 37: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/37.jpg)
![Page 38: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/38.jpg)
![Page 39: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/39.jpg)
Today
![Page 40: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/40.jpg)
![Page 41: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/41.jpg)
Directions Manager – read ?
Summarize how giraffes evolved.
![Page 42: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/42.jpg)
Peppered Moth
Which moth will the bird catch?
A
B
![Page 43: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/43.jpg)
Evidence for Evolution:
Fossil Record
Homologous Body Structures
Vestigial Organs
Embryology
Biochemical Evidence
![Page 44: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/44.jpg)
Fossils provide a record of the history of life on
Earth
Fossil Record
![Page 45: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/45.jpg)
Progression of Organisms
dinosaurs humansbacteriaorigins
http://en.wikipedia.org/wiki/Geologic_time_scale
en.wikipedia.org/wiki/Image:Eopraptor_sketch5.png© World Health Org.
© NASA
complex cells
The fossil record shows a sequence from simple bacteria to
more complex organisms through time and provides the most
compelling evidence for evolution.
![Page 46: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/46.jpg)
Transitional Fossils – Ex.
Archaeopteryx
Missing link between
reptiles and birds
![Page 47: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/47.jpg)
Geologic Separation
![Page 48: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/48.jpg)
Homologous Body Structures
Body parts that are
similar in different
species
Related organisms have
similar body structures
![Page 49: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/49.jpg)
![Page 50: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/50.jpg)
Humans and Gorillas Bone Structure
![Page 51: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/51.jpg)
“Leftover” organs (traces of
evolution) that serve no
purpose currently (did in the
past)
Examples appendix,
tonsils, tailbone, wisdom
teeth
Vestigial Organs
![Page 52: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/52.jpg)
Embryos of all vertebrates are very similar early
on – yes you had gills!
Embryology
![Page 53: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/53.jpg)
The Pharyngeal Pouches will shape parts of the
pharynx and upper bronchial segments
![Page 54: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/54.jpg)
DNA with more similar
sequences suggest species
are more closely related
Humans and chimpanzees
share > 98% of identical
DNA sequences
Biochemistry
HUMAN CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
CHIMPANZEE CCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCATGACTGTTGAACGA
GORILLA CCAAGGTCACAACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTGAACGA
Genetic code of chimps and gorillas is almost identical to humans
![Page 55: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/55.jpg)
Directions Manager – read ?
What are the 5 types of evidence
used for evolution?
What is your opinion about evolution?
![Page 56: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/56.jpg)
Thinking outside
biology/species – how might
the quote above affect you in
everyday/real life?
![Page 57: Darwin & Natural Selection · Evolution Evolution: The process of change over time; one species gives rise to another & “tree” grows! All living things share a common ancestor](https://reader035.vdocuments.site/reader035/viewer/2022071104/5fde032d6064a46b640536c9/html5/thumbnails/57.jpg)
Supporting Resources
https://www.youtube.com/watch?v=0SCjhI86grU
Must Watch—Fantastic Review
https://www.youtube.com/watch?v=FW-uW71-DHU
Simpson Evolution