cytosolic phospholipase a2α and peroxisome proliferator-activated receptor γ signaling pathway...

Cytosolic Phospholipase A2a and PeroxisomeProliferator-Activated Receptor c Signaling

Pathway Counteracts Transforming Growth Factorb–Mediated Inhibition of Primary and Transformed

Hepatocyte GrowthChang Han,1,2 William C. Bowen,2 Guiying Li,2,3 Anthony J. Demetris,2

George K. Michalopoulos,2 and Tong Wu1,2

Hepatocellular carcinoma often develops in the setting of abnormal hepatocyte growthassociated with chronic hepatitis and liver cirrhosis. Transforming growth factor b (TGF-b) is a multifunctional cytokine pivotal in the regulation of hepatic cell growth, differen-tiation, migration, extracellular matrix production, stem cell homeostasis, and hepatocar-cinogenesis. However, the mechanisms by which TGF-b influences hepatic cell functionsremain incompletely defined. We report herein that TGF-b regulates the growth of pri-mary and transformed hepatocytes through concurrent activation of Smad and phospho-rylation of cytosolic phospholipase A2a (cPLA2a), a rate-limiting key enzyme that releasesarachidonic acid for the production of bioactive eicosanoids. The interplays between TGF-b and cPLA2a signaling pathways were examined in rat primary hepatocytes, human hepa-tocellular carcinoma cells, and hepatocytes isolated from newly developed cPLA2a trans-genic mice. Conclusion: Our data show that cPLA2a activates peroxisome proliferator-activated receptor c (PPAR-c) and thus counteracts Smad2/3-mediated inhibition of cellgrowth. Therefore, regulation of TGF-b signaling by cPLA2a and PPAR-c may representan important mechanism for control of hepatic cell growth and hepatocarcinogenesis.(HEPATOLOGY 2010;52:644-655)

Transforming growth factor b (TGF-b) is a mul-tifunctional cytokine that plays an importantrole in the regulation of cell proliferation, dif-

ferentiation, migration, apoptosis, extracellular matrixproduction, angiogenesis, and neoplasia.1-4 The actionsinitiated by TGF-b are complex and often varydepending on individual cell or tissue types and theactivation status of other intracellular signaling path-ways. In the liver, TGF-b is well known to regulatestellate cell activation/liver fibrosis, hepatocyte prolifer-ation/apoptosis, and hepatocarcinogenesis.There are three mammalian TGF-b isoforms, TGF-b1,

TGF-b2, and TGF-b3, all of which signal through a het-eromeric complex of type I and type II TGF-b recep-tors.1,5 Binding of ligand to the type II receptor results inthe recruitment and activation of one of two type I recep-tors. The activated type I receptor phosphorylates Smad2and Smad3. The phosphorylated Smad2 and Smad3 thenassociate with Smad4 and translocate to the nucleus. Themitoinhibition by TGF-b is predominantly mediated

Abbreviations: AA, arachidonic acid; cDNA, complementary DNA; COX-2,cyclooxygenase-2; cPLA2a, cytosolic phospholipase A2a; ERK, extracellularsignal-regulated kinase; MAPK, mitogen-activated protein kinase; PG,prostaglandin; PGE2, prostaglandin E2; PPAR-c, peroxisome proliferator-activated receptor c; PPRE, peroxisome proliferator response element; SD,standard deviation; siRNA, small interfering RNA; TGF-b, transforminggrowth factor b; WT, wild-type.From the 1Department of Pathology and Laboratory Medicine, Tulane

University School of Medicine, New Orleans, LA; 2Department of Pathology,University of Pittsburgh School of Medicine, Pittsburgh, PA; and the 3KeyLaboratory for Molecular Enzymology and Engineering of Ministry of Education,Jilin University, Changchun, China.Received November 23, 2009; accepted March 30, 2010.Supported by National Institutes of Health Grants DK077776, CA106280,

CA102325, and CA134568 (to T. W.) and CA137729 (to C. H.).Address reprint requests to: Chang Han, M.D., Ph.D., or Tong Wu, M.D.,

Ph.D., Department of Pathology and Laboratory Medicine, Tulane UniversitySchool of Medicine, 1430 Tulane Avenue, SL-79, New Orleans, LA 70112.E-mail: [email protected] or [email protected] 2010 by the American Association for the Study of Liver Diseases.Published online in Wiley InterScience (www.interscience.wiley.com).DOI 10.1002/hep.23703Potential conflict of interest: Dr. Demetris is a consultant for Wyeth,

Novartis, and Bristol-Myers Squibb.Additional Supporting Information may be found in the online version of

this article.

644

through activation of the Smad pathway. In addition, theactivated TGF-bRII and TGF-bRI receptor complex canalso signal independently of Smads, via extracellular sig-nal-regulated kinase (ERK), c-Jun NH2-terminal kinase,p38 mitogen-activated protein kinase (MAPK), phosphati-dylinositol-3 kinase, and Rho GTPases.1,2,6 Recent studieshave revealed an intriguing link between TGF-b and inter-leukin-6/signal transducer and activator of transcription 3signaling pathways in hepatocarcinogenesis.7,8 However, itremains unclear whether TGF-b may also modulate hepa-tocarcinogenesis through interaction with other growth-regulating signaling pathways. In this study, we presentedevidence that TGF-b regulates the growth of primary andtransformed hepatocytes through concurrent activation ofSmad-mediated gene transcription and phosphorylation ofcytosolic phospholipase A2a (cPLA2a).Prostaglandin (PG) signaling is implicated in the growth

control of various human cells and cancers.9-14 PG biosyn-thesis is tightly controlled by a series of enzymes includingthe group IVa cytosolic phospholipase A2 (cPLA2a) thatselectively cleaves arachidonic acid (AA) from membranephospholipids, and cyclooxygenase-2 (COX-2) that con-verts AA substrate to PGs.9-14 This signaling cascade isactive in various human cancers including hepatocellularcarcinoma and promotes tumor growth by enhancingtumor cell proliferation, survival, invasion, or angiogene-sis.14-16 Whereas PGs regulate cell functions through activa-tion of specific G protein–coupled receptors on plasmamembrane, studies from our laboratory have shown thatthe cPLA2a-derived arachidonic acid can also regulatecellular functions through activation of nuclear receptorsincluding peroxisome proliferator-activated receptor c(PPAR-c).17,18

This study describes the interaction between TGF-band prostaglandin signaling pathways in primary andtransformed hepatocytes. Our data show that TGF-bphosphorylates and activates cPLA2a and the cPLA2a-derived AA subsequently activates PPAR-c, leading to in-hibition of Smad2/3. This phenomenon is further veri-fied in hepatocytes isolated from newly developed trans-genic mice with targeted overexpression of cPLA2a in theliver. Our findings suggest that the level and activationstatus of cPLA2a/PPAR-c in hepatic cells may represent akey factor that determines the cellular response to TGF-band modulates hepatocarcinogenesis.

Materials and Methods

Materials. Minimum essential medium with Earle’ssalts, fetal bovine serum, glutamine, antibiotics, Lipo-fectamine PLUS reagent, and Lipofectamine 2000 rea-

gent were purchased from Invitrogen (Carlsbad, CA).Human TGF-b1 was purchased from R&D Systems,Inc. (Minneapolis, MN). AA and prostaglandin E2(PGE2) were purchased from Calbiochem (San Diego,CA). The PPAR-c agonists, ciglitazone and piglitazone,were purchased from Cayman Chemical (Ann Arbor,MI). The cPLA2a specific inhibitor pyrrolidine deriva-tive, the COX2 inhibitor NS398, the p38 MAPK in-hibitor SB203580 and the p42/44 MARK inhibitorPD98059 were purchased from Calbiochem (SanDiego, CA). The antibodies against human cPLA2a,PPAR-c, TGF-bRI (transforming growth factor breceptor I), TGF-bRII (transforming growth factor breceptor II), PAI-1 (the type 1 plasminogen activatorinhibitor) were purchased from Santa Cruz Biotech-nology (Santa Cruz, CA). Antibodies against phospho-cPLA2a (Ser505), phospho-p38 MARP (Thr180/Tyr182), phospho-p42/44 MARP (Thr202/Tyr204),phospho-Smad2 (Ser465/467), phospho-Smad3 (Ser423/425), p38 MARP, p42/44 MARP, Smad2, Smad3, andSmad4 were purchased from Cell Signaling (Beverly,MA). Antibody against b-actin was purchased fromSigma (St. Louis, MO). Antibody against glyceralde-hyde 3-phosphate dehydrogenase was purchased fromAmbion (Austin, TX). Amersham ECL Plus westernblotting detection reagents were purchased from GEHealthcare (Piscataway, NJ). The cell proliferationassay reagent WST-1 was purchased from Roche Mo-lecular Biochemicals (Indianapolis, IN). The PPAR-cexpression plasmid and PPRE-Luc reporter vectorwere purchased from Addgene (Cambridge, MA). Thesmall interfering RNAs (siRNAs) for cPLA2a, PPAR-c, Smad2, or Smad3 were purchased from Dharmacon(Chicago, IL).Isolation of Primary Hepatocytes. Primary hepato-

cytes were isolated from the cPLA2a transgenic mice,matched wild-type (WT) mice, and Fisher 344 rats(Harlan, Indianapolis, IN) using the modified two-stepcollagenase perfusion technique as described.19,20

Freshly isolated hepatocytes of >90% viability, asassessed by trypan blue exclusion, were placed on rat-tail collagen I–coated culture plates at a density of ei-ther 3 to 4 � 106 cells/100-mm plastic dish for west-ern blotting or 1 � 105 cells/each well of six-wellplates for the measurement of DNA synthesis in Wil-liams’ E medium supplemented with 5% calf serum.The cells were incubated at 37�C (5% CO2) andchecked for adherence of monolayers after 2-4 hours.Once adhered, the cells were changed to serum-freeWilliams’ E medium for 2 hours, then subjected tothe treatment as indicated in the text.

HEPATOLOGY, Vol. 52, No. 2, 2010 HAN ET AL. 645

Hepatocyte DNA Synthesis. The primary hepato-cyte cultures were treated with either different concen-trations of TGF-b1 or PGE2 as indicated. To deter-mine in vitro DNA synthesis, 1 lCi [3H]thymidine(PerkinElmer, Boston, MA) was added to each well ofsix-well plates. After overnight incubation, the hepato-cytes were harvested and [3H]-thymidine incorporationwas measured using a scintillation counter.Cell Growth Assay. Cell growth was determined

using the cell proliferation reagent WST-1, a tetrazo-lium salt that is cleaved by mitochondrial dehydroge-nases in viable cells. Briefly, 100 lL of cell suspension(containing 0.5 to 2 � 104 cells) were plated in eachwell of 96-well plates. After overnight culture to allowreattachment, the cells then were treated with specificreagents such as different concentrations of TGF-b1 inserum-free medium for indicated time points. At theend of each treatment, the cell proliferation reagentWST-1 (10 lL) was added to each well, and the cellswere incubated at 37�C for 0.5-5 hours. A450 nm wasmeasured using an automatic enzyme-linked immuno-sorbent assay plate reader.Cell Culture and Transient Transfection. Three

different human hepatocellular carcinoma cell lines(Hep3B, HepG2, and Huh7) were cultured accordingto our described methods.18,21 For transient transfec-tion assays, the cells with 80% confluence were trans-fected with the cPLA2a expression plasmid (with MT-2 as control plasmid) or the PPAR-c expressionplasmid (with pcDNA as control plasmid) using Lipo-fectamine PLUS reagent. The cells with optimal over-expression of either cPLA2a or PPAR-c were con-firmed by immunoblotting and subsequently used forfurther experiments.Luciferase Reporter Assay. The cells with 80% con-

fluence were transiently transfected with either p3TP orPPRE reporter vector using Lipofectamine PLUS rea-gent. After transfection, the cells were treated with spe-cific reagent such as PPAR-c agonists ciglitazone andpiglitazone in serum-free medium for 24 hours. Thecell lysates were then obtained with 1� reporter lysisbuffer (Promega). The luciferase activity was assayed ina Berthold AutoLumat LB 953 luminometer (Nashua,NH) using the luciferase assay system from Promega.The relative luciferase activity was calculated after nor-malization of cellular proteins. All values are expressedas fold induction relative to basal activity.Phosphorylation of cPLA2a. Analysis for cPLA2a

phosphorylation was performed as described.22 Equalamounts of cell lysate were preincubated with 5 lg/mL mouse anti-human cPLA2a monoclonal antibodyfor 1 hour followed by addition of 20 lL of protein

A/G-agarose (Santa Cruz Biotechnology) for overnightat 4 �C. The cell lysate preincubated with mouse im-munoglobulin G was used as the negative control. Af-ter three washes with the same hypotonic buffer, thepellet was used for immunoblotting using rabbit anti–phospho-cPLA2a (Ser505) antibody.DNA–Protein Binding. DNA–protein binding was

performed by the biotinylated oligonucleotides precipi-tation assay as described,23 with minor modifications.Briefly, 1 lg 50-biotinylated, double-stranded oligo-nucleotides that corresponded to the Smad3 bindingsite from the PAI-1 promoter region (forward, 50-CAACCTCAGCCAGACAAGGTTGTTGACACAAGAGAGCCCTCAGGGGCACAGAGAGAGTCTGGACACGTGGGGAGTCAGCCGTGTATCATCGGAGGCGGCCGGGC-30; reverse, 50- GCCCGGCCGCCTCCGATGATACACGGCTGACTCCCCACGTGTCCAGACTCTCTCTGTGCCCCTGAGGGCTCTCTTGTGTCAACAACCTTGTCTGGCTGAGGTTG-30; synthesized by Sigma-Genosys in Woodland,Texas) were mixed with equal amount of the cellextract and 10 lg poly(dl-dC)/poly(dl-dC) over-night at 4�C. After precipitation with ImmunoPurestreptavidin-agarose beads (Pierce, Rockford, IL) at4�C for another 1 hour, the DNA-bound proteinswere subjected to immunoblotting to detectSmad3.RNA Interference. The cells with 50% confluence

were transfected with either cPLA2a siRNA or PPAR-csiRNA or Smad2/3 siRNA, or a 21-nucleotide irrele-vant RNA duplex as a control siRNA using Lipofect-amine 2000. After transfection, the cells were culturedin serum-free medium for 48 hours. Depletion ofcPLA2a or PPAR-c or Smad2/3 was confirmed by im-munoblotting for further experiments.AA Release and PGE2 Production. To measure AA

release, the cells with 80% confluence in six-well plateswere labeled with 0.5 lCi/mL [3H]-AA (218 Ci/mmol) in serum-supplemented medium for 18 hours.After washing three times with serum-free medium,the cells were exposed to TGF-b1 in the absence orpresence of the cPLA2a-specific inhibitor pyrrolidinederivative, the p38 MAPK inhibitor SB203580, or thep42/44 MAPK inhibitor PD98059. At the end of eachtreatment, the media were collected and centrifuged toremove the suspending cells. In addition, 0.5 mLmedia was used for scintillation counting to measure3H activity.To measure PGE2 production, the serum-starved

cells with 80% confluence in six-well plates wereexposed to TGF-b1 in the absence or presence of theinhibitors of cPLA2a, COX-2, p38 MAPK, or p42/44

646 HAN ET AL. HEPATOLOGY, August 2010

MAPK in serum-free medium. At the end of eachtreatment, the spent medium was collected. A 100-lLcentrifuged sample was analyzed for PGE2 productionusing the PGE2 enzyme immunoassay system (Amer-sham Biosciences) according to the manufacturer’sprotocol.Generation of cPLA2a Transgenic Mice. Transgenic

mice with targeted expression of cPLA2a in the hepa-tocytes were developed by using the well-established al-bumin promoter-enhancer driven vector. To construct

the albumin promoter-cPLA2a transgene, a 2.8-kbhuman cPLA2a complementary DNA (cDNA) con-taining the entire coding region of human cPLA2a wasinserted into the first exon of the human growth hor-mone gene controlled by the mouse albumin ehancer/promoter.24,25 After the confirmation of its overexpres-sion in vitro, this transgene was microinjected intomouse zygotes (B6SJL/F1 eggs) at the transgenic corefacility of the University of Pennsylvania according toour contract. The produced transgenic lines were

Fig. 1. TGF-b1 activates AA signaling cascade through cPLA2a phosphorylation in transformed human hepatocytes. (A) Effect of TGF-b1 oncPLA2a phosphorylation. Left: TGF-b1 increases phosphorylation of cPLA2a. Hep3B, Huh7, and HepG2 cells were treated with 5 ng/mL TGF-b1for the indicated periods. Cell lysates were then collected to determine the cPLA2a phosphorylation by immunoprecipitation and western blotanalysis. Right: The p38 MAPK inhibitor SB203580 and the p42/44 MAPK inhibitor PD98059 inhibited TGF-b1–induced cPLA2a phosphorylation.Hep3B, Huh7, and HepG2 cells were treated with either 10 lM SB203580 or 10 lM PD98059 in serum-free medium for 2 hours prior to thestimulation with 5 ng/mL TGF-b1 for 15 minutes. Cell lysates were then collected to determine the cPLA2a phosphorylation by immunoprecipita-tion and western blot analysis. (B) AA release and PGE2 production. Left: The cPLA2a inhibitor pyrrolidine derivative, the p38 MAPK inhibitorSB203580, and the p42/44 MAPK inhibitor PD98059 inhibited TGF-b1–induced AA release. Hep3B, Huh7, and HepG2 cells prelabeled with0.5 lCi/mL [3H]-AA were treated with 5 ng/mL TGF-b1 for 60 minutes in the absence or presence of 2 lM pyrrolidine derivative, 10 lMSB203580, or 10 lM PD98059. Media were then collected for the measurement of AA release as indicated in the Materials and Methods.Data are presented as the mean 6 standard deviation of four experiments (*P < 0.01 versus control; **P < 0.05 versus TGF-b1 treatment).Right: The cPLA2a inhibitor pyrrolidine derivative, the COX-2 inhibitor NS 398, the p38 MAPK inhibitor SB203580, and the p42/44 MAPK inhibi-tor PD98059 inhibited TGF-b1–induced PGE2 production. Hep3B, Huh7, and HepG2 cells were treated with 5 ng/mL TGF-b1 for 8 hours in theabsence or presence of 2 lM pyrrolidine derivative, 25 lM NS398, 10 lM SB203580, or 10 lM PD98059 in serum-free medium. Media werethen collected for the measurement of PGE2 production as indicated in the Materials and Methods. Data are presented as the mean 6 standarddeviation of four experiments (*P < 0.01 versus control; **P < 0.05 versus TGF-b1 treatment). (C) TGF-b1 activates p38 MAPK, p42/44MAPK, Smad2, and Smad3. Hep3B, Huh7, and HepG2 cells were treated with 5 ng/mL TGF-b1 for the indicated periods. Cell lysates were thencollected to determine phosphorylated and total p38 MAPK, phosphorylated and total p42/44 MAPK, or phosphorylated and total Smad2/3 bywestern blot analysis.


brought back to the University of Pittsburgh animalfacility for propagation. The transgenic lines weremaintained by back-crossing to the C57Bl/6 wild-typemice, and the transgenic mice were identified withgenotyping from the genomic DNA of tails. ThecPLA2a transgenic mice develop normally with no sig-nificant liver inflammation or histological abnormalityunder normal housing conditions, although thecPLA2a transgenic mice show slightly higher bodyweight and liver weight compared with WT mice(body weight 25.82 6 1.23 in cPLA2a-Tg versus22.63 6 0.68 in WT; liver weight 1.30 6 0.10 incPLA2a-Tg versus 1.13 6 0.06 in WT). The animalswere kept at 22�C under a 12-hour light/dark cycleand received food and water ad libitum. The handlingof mice and experimental procedures were conducted

in accordance with experimental animal guidelines.The cPLA2a transgenic mice used in this study werederived from one transgenic line that was back-crossedto C57Bl/6 WTmice for 10 consecutive generations.Statistical Analysis. All values were expressed as the

mean and standard deviation (SD). The statistical sig-nificance of differences between groups was analyzedwith the homoscedastic Student t test, and P < 0.05was considered statistically significant. Single and dou-ble asterisks represent P < 0.05 and P < 0.01,respectively.

Results

We examined the effect of TGF-b1 on cPLA2aphosphorylation and protein expression in three

Fig. 2. cPLA2a signaling prevents TGF-b1–induced inhibition of cell growth. (A) Overexpression of cPLA2a prevents TGF-b1–induced inhibitionof Hep3B cell growth. Hep3B cells were transfected with either MT2 control vector or cPLA2a in MT2. After transfection, the cells were treatedwith different concentrations of TGF-b1 in serum-free medium for 48 hours. Cell growth was determined with WST-1 reagent. Data are presentedas the mean 6 SD of six independent experiments (*P <0.01 versus MT2 control vector cells without TGF-b1 treatment; **P <0.05 versusMT2 control vector cells treated with the same concentration of TGF-b1). Western blots in the right panel show successful overexpression ofcPLA2a in Hep3B cells transfected with the cPLA2a expression vector; the protein levels of PPAR-c, TGF-bRI, TGFbRII, Smad2, Smad3, andSmad4 were not altered. (B) PGE2 effect in Hep3B cells. Hep3B cells were treated with 5 ng/mL TGF-b1 in the absence or presence of 10 lMPGE

2in serum-free medium for 48 hours. Cell growth was determined with the WST-1 reagent. Data are presented as the mean 6 SD of six in-

dependent experiments. PGE2 increased the growth of Hep3B cells (*P < 0.05). TGF-b1 significantly inhibited the growth of Hep3B cells (**P< 0.01); this effect was partially blocked by cotreatment with 10 lM PGE

2(***P < 0.05). (C) PGE2 effect in rat primary hepatocytes. Rat pri-

mary hepatocytes were treated with 5 ng/mL TGF-b1 in the absence or presence of 10 lM PGE2in serum-free medium for 48 hours. Cell growth

was determined with [3H]-thymidine incorporation assay (left panel). Data are presented as the mean 6 SD of three independent experiments(*P <0.01 versus control; **P <0.05 versus TGF-b1 treatment). Western blots in the right panel show the protein levels of cPLA2a, PPAR-c,TGFbRI, TGFbRII, Smad2, and Smad3 in rat primary hepatocytes. (D) cPLA2a overexpression prevents TGF-b1–induced caspase-3 activation. Aftertransfection with the cPLA2a expression plasmid or the MT-2 control vector, Hep3B cells were cultured in serum-free medium for 24 hours andthen treated with either vehicle or 5 ng/mL TGFb1 for 12 hours. The cell lysates were then obtained for western blotting analysis to determinecaspase-3 activation (b-actin was used as the loading control).


human hepatocellular carcinoma cell lines (Hep3B,Huh7, and HepG2). Treatment of these cells withTGF-b1 (5 ng/mL) induced a rapid phosphorylationof cPLA2a, occurring within 15 minutes (Fig. 1A). Incontrast, TGF-b1 treatment had no effect on theexpression of cPLA2a and COX-2 proteins (Support-ing Fig. 1). Consistent with its effect on cPLA2a phos-phorylation, TGF-b1 treatment significantly increasedAA release and PGE2 production in these cells (Fig.1B). These results show that TGF-b1 activates cPLA2aphosphorylation and increases AA release and PGE2synthesis in these cells.Because cPLA2a is phosphorylated by protein kinases

including p38 MAPK and ERK1/2 (p44/42 MAPK),we also examined the effect of TGF-b1 on p38 MAPKand ERK1/2 activation in these cells. TGF-b1 treatmentinduced the phosphorylation of p38 MAPK and ERK1/2 as well as Smad2/3 (Fig. 1C). These findings, alongwith the significant increase of Smad2/3 reporter activityby TGF-b1 (Fig 4C), indicate intact TGF-b–initiatedsignaling in these cells. The involvement of p38 MAPKand ERK1/2 in TGF-b1–induced cPLA2a phosphoryla-tion is demonstrated by the fact that TGF-b1–induced

cPLA2a phosphorylation in these cells was inhibited bythe p38 MAPK inhibitor SB203580 and by the MEK1/2 inhibitor PD98059 (Fig. 1A). Consistent with this,TGF-b1–induced AA release and PGE2 productionwere also inhibited by SB203580, PD98059, and thecPLA2a inhibitor pyrrolidine (Fig. 1B). These findingsdemonstrate the role of p38 MAPK and ERK1/2-medi-ated cPLA2a activation in TGF-b1–induced AA releaseand PGE2 synthesis. In addition, the TGF-b1–inducedPGE2 production was also inhibited by the selectiveCOX-2 inhibitor NS-398 (Fig. 1B), although thelevel of COX-2 expression was not altered (SupportingFig. 1). Taken together, these findings suggest thatTGF-b1 induces AA release for PGE2 productionvia p38 MAPK and ERK1/2-mediated cPLA2aphosphorylation.Further experiments were performed to determine

whether cPLA2a overexpression or PGE2 treatmentcould prevent TGF-b1–induced inhibition of cellgrowth. As shown in Fig. 2, overexpression of cPLA2ain Hep3B cells prevents TGF-b1–induced inhibitionof growth; PGE2 treatment of Hep3B cells as well asrat primary hepatocytes also prevented TGF-b1–

Fig. 3. Effect of cPLA2a on p3TP and PPREreporter activities. (A) cPLA2a overexpression.Hep3B, HepG2, and Huh7 cells were transi-ently transfected with the cPLA2a expressionplasmid or MT2 control plasmid with cotrans-fection of either the p3TP-Luc reporter vectoras shown in the upper left panel or thePPRE-Luc reporter vector as shown in theupper right panel. Cell lysates were obtainedto determine luciferase activity. Data are pre-sented as the mean 6 SD of three inde-pendent experiments (*P <0.01 versuscorresponding control). (B) cPLA2a siRNA.Hep3B, HepG2, and Huh7 cells were transi-ently transfected with either cPLA2a siRNA orcontrol siRNA with cotransfection of p3TP-Lucreporter vector. Cell lysates were thenobtained to determine luciferase activity. Dataare presented as the mean 6 SD of three in-dependent experiments (*P <0.01 versuscorresponding control siRNA). RNA suppres-sion of cPLA2a expression significantlyincreased the expression PAI-1, a Smad2/3target gene.


Fig. 4. The effect of PPAR-c overexpression and ligands on p3TP and PPRE reporter activities. (A) PPAR-c overexpression. Hep3B, HepG2, andHuh7 cells were transiently transfected with the PPAR-c expression plasmid or pcDNA control plasmid with cotransfection of either PPRE-Luc re-porter vector as shown in the left upper panel or the p3TP-Luc reporter vector as shown in the right upper panel. Cell lysates were obtained todetermine luciferase activity. Data are presented as the mean 6 SD of three independent experiments (*P <0.01 versus corresponding vectorcontrol). (B) PPAR-c ligands. Left: Hep3B cells were transiently transfected with PPRE-Luc reporter vector and then were treated with either 5 lMciglitazone or 10 lM piglitazone in serum-free medium for 24 hours. Cell lysates were obtained to determine luciferase activity. Data are pre-sented as the mean 6 SD of three independent experiments (*P <0.01 versus control). Right: Hep3B cells were transiently transfected withp3TP-Luc reporter vector. After transfection, the cells were treated with 5 ng/mL TGF-b1 in the absence or presence of either ciglitazone or pigli-tazone in serum-free medium for 24 hours. Cell lysates were then obtained to determine luciferase activity. Data are presented as the mean 6SD of three independent experiments (*P <0.01 versus no TGF-b1 treatment; **P <0.05 versus TGF-b1 treatment alone). (C) Effect of ciglita-zone on TGF-b1–induced p3TP reporter activity in cells with or without Smad3 overexpression. Hep3B cells were transiently transfected with eitherpcDNA control vector or Smad3 in pcDNA overexpression vector with cotransfection of the p3TP-Luc reporter vector. After transfection, the cellswere treated with 5 ng/mL TGF-b1 in the absence or presence of 5 lM ciglitazone in serum-free medium for 24 hours; cell lysates were thenobtained to determine luciferase activity. Data are presented as the mean 6 SD of three independent experiments. Overexpression of Smad3significantly increased the p3TP reporter activity compared with pcDNA control vector (*P < 0.01). TGF-b1 significantly increased the p3TP re-porter activity in pcDNA- or Smad3-transfected cells compared with each own control (**P < 0.01). Ciglitazone significantly blocked TGF-b1–induced increase of p3TP reporter activity in cells transfected with either pcDNA or Smad3 in pcDNA (***P <0.01).

Fig. 5. The effect of PPAR-c depletion on p3TP reporter activity and cell growth. (A) PPAR-c siRNA. Hep3B, HepG2, and Huh7 cells were transi-ently transfected with either PPAR-c siRNA or control siRNA with cotransfection of p3TP-Luc reporter vector. Cell lysates were obtained to determineluciferase activity. Data are presented as the mean 6 SD of three independent experiments (*P < 0.01 versus control siRNA). RNAi suppressionof PPAR-c expression significantly increased expression of the Smad2/3 target gene, PAI-1. (B) Depletion of cPLA2a and PPAR-c inhibits cell growthand involvement of Smad2/3. Hep3B cells were transfected with cPLA2a siRNA or PPAR-c siRNA, with or without Smad2/3 siRNA. After transfec-tion, the cells were cultured in serum-free medium for 48 hours. Cell growth was determined with WST-1 reagent. Data are presented as the mean6 SD of six independent experiments (*P < 0.01 versus control siRNA; **P <0.05 versus cPLA2a siRNA or PPAR-c siRNA). Western blots in thelower panel show successful depletion of cPLA2a, PPAR-c or Smad2/3 in cells transfected with the corresponding siRNA.


induced inhibition of cell growth. The observationthat cPLA2a overexpression prevents TGF-b1–inducedcaspase-3 cleavage in Hep3B cells suggests the role ofcPLA2a for prevention of TGF-b–induced apoptosis.These data indicate that cPLA2a signaling pathway isable to counteract the growth inhibitory effect ofTGF-b.We next investigated whether cPLA2a-mediated AA

release might influence Smad transcriptional activity.Hep3B cells were transiently transfected with thecPLA2a expression plasmid or the control plasmidMT-2 with cotransfection of the p3TP-Lux reporterconstruct (containing Smad2/3-responsive element)and the cell lysates were obtained to determine the lu-ciferase reporter activity. As shown in Fig. 3A, overex-pression of cPLA2a significantly inhibited Smad2/3transcriptional activity. Accordingly, depletion ofcPLA2a by siRNA significantly enhanced Smad2/3transcriptional activity (Fig. 3B). These findings revealan important role of cPLA2a for modulation ofSmad2/3 transcription activity.PPAR-c is a ligand-activated nuclear transcription

factor regulating the expression of target genes bybinding to specific peroxisome proliferator responseelements (PPREs) or by interacting with other intracel-lular signaling molecules.26 The activity of PPAR-c isregulated by several ligands, including thiazolidine-diones, 15-deoxy-D,12,14 prostaglandin J2, and AA,among others. Consistent with our previous studyshowing that cPLA2a is able to activate PPAR-c inother cells,17 cPLA2a overexpression was found toincrease PPRE reporter (containing PPAR responseelement) activity in all three hepatocellular carcinomacell lines used in this study (Hep3B, Huh7, andHepG2) (Fig. 3A). Because PPAR-c is known to bindand inhibit Smad3 in vitro27 and cPLA2a is able toactivate PPAR-c, we postulated that cPLA2a might in-hibit Smad3 through activation of PPAR-c.To document the direct effect of PPAR-c on Smad

activation, Hep3B, HepG2, and Huh7 cells werecotransfected with the PPAR-c expression plasmid andthe p3TP-Lux reporter construct containing theSmad2/3 response element. As shown in Fig. 4A, over-expression of PPAR-c partially inhibited Smad tran-scriptional activity in those cells. Accordingly, activationof PPAR-c by its ligands (ciglitazone and piglitazone)significantly inhibited TGF-b1–induced Smad activa-tion in Hep3 cells; this effect was observed with orwithout Smad3 overexpression (Fig. 4B,C). In contrast,siRNA inhibition of PPAR-c augmented TGF-b1–mediated Smad transcription (Fig. 5A). In the transfec-tion experiments with a reporter construct containing

PPRE, we observed an approximately two-fold increaseof PPRE reporter activity in Hep3B cells after PPAR-cligand treatment (Fig. 4B), suggesting that the endoge-nous PPAR-c protein in these cells is functional.To further evaluate the role of cPLA2a and PPAR-c

in Smad activation and hepatic cell growth, additionalexperiments were performed to determine whetherdepletion of endogenous cPLA2a and PPAR-c mightinhibit cell growth via Smad2/3. As shown in Fig. 5B,depletion of either cPLA2a or PPAR-c significantlyreduced cell growth, and this effect was blocked bySmad2/3 siRNA. These findings suggest the involve-ment of Smad2/3 in cPLA2a/PPAR-c depletion-induced inhibition of cell growth. Furthermore, thecPLA2a product (AA) and the PPAR-c ligands (ciglita-zone and piglitazone) inhibited TGF-b1–induced

Fig. 6. AA and PPAR-c ligands block TGF-b1–induced Smad3 bind-ing to its DNA response element. A comparison of cPLA2a and PPAR-cexpression in different cell lines is shown. (A) Hep3B cells weretreated with AA, ciglitazone, or piglitazone in the absence or presenceof TGF-b1 for 30 minutes. The binding of Smad3 to its DNA responseelement was analyzed by DNA–protein binding assay. (B) Hep3B,Huh7, and HepG2 cells were treated with different concentrations ofTGF-b1 for different periods as indicated. Cell growth was determinedwith WST-1 reagent. Data are presented as the mean 6 SD of six in-dependent experiments. TGF-b1 inhibited the growth of Hep3B, butnot Huh7 and HepG2 cells. The Western blots in the lower panelshowed the protein levels of cPLA2a, PPAR-c, TGFbRI, TGFbRII, andSmad2/3 in these cells.


binding of Smad3 to its DNA response element (Fig.6A). Therefore, Smad3 is a downstream target ofcPLA2a/PPAR-c in hepatic cells.We have found that cPLA2a activates PPAR-c in all

three hepatic cell lines used in this study. However,these cell lines respond differently to TGF-b treat-ment; whereas TGF-b1 significantly inhibited thegrowth of Hep3B cells, it had minimal growth inhibi-tory effect in Huh7 or HepG2 cells under the sameexperimental condition (Fig. 6B). The exact mecha-nism for such a differential effect among different celllines is complex; however, it is possible that this mayrelate partly to the low level of PPAR-c expression inHep3B cells (hence a sensitivity to TGF-b–induced in-

hibition of growth) and the high level of PPAR-c inHuh7 and HepG2 cells (hence a resistance to TGF-b–induced inhibition of growth).To further address the role of cPLA2a in TGF-b–

induced hepatocyte growth regulation, we generatedtransgenic mice with targeted expression of the cPLA2ain the liver (Fig. 7) and the produced animals wereused to determine TGF-b–induced inhibition of hepa-tocyte growth. Primary hepatocytes were isolated fromthe cPLA2a transgenic or WT mice and the culturedcells were treated with different concentrations ofTGF-b1 in serum-free medium to determine [3H]-thy-midine incorporation. As shown in Fig. 7D, althoughTGF-b1 significantly inhibited the growth of

Fig. 7. Overexpression of cPLA2a in hepatocytes prevents TGF-b1–induced mitoinhibition. (A) Schematic representation of the human cPLA2atransgene. Transgenic mice with targeted expression of cPLA2a in hepatocytes were developed using the well-established albumin promoter-enhancer driven vector. The 8-kb ALB-cPLA2a transgene consists of the 2.8-kb human cPLA2a cDNA (white box) inserted into the first exon ofthe human growth hormone gene (black boxes) controlled by the mouse albumin enhancer/promoter (cross-hatched ovals), and possessing ahuman growth hormone polyadenylation site (cross-hatched box). (B) PCR analysis of tail genomic DNA for cPLA2a transgene. cPLA2a cDNAserved as the positive control; the genomic DNA from WT mice served as a negative control. An 860-bp cPLA2a transgene product was detectedby polymerase chain reaction using specific primer pairs (forward primer, cPLA2aF, 50-TGGCCAACATCAACTTCAGA-30; reverse primer, GHE1R,50TTACCTGCAGCCATTGCCGCTAGTGAG-30) derived from the pALB-cPLA2a transgene. (C) Western blotting analysis of cPLA2a protein levels in livertissues from cPLA2a transgenic mice. Equal amounts of the liver tissue proteins from WT and cPLA2a transgenic (TG) mice littermates underwentsodium dodecyl sulfate–polyacrylamide gel electrophoresis and western blot analysis using anti-human cPLA2a antibody (with glyceraldehyde 3-phosphate dehydrogenase as a loading control). (D) TGF-b1–mediated mitoinhibition of primary hepatocytes from cPLA2a transgenic and WTmice. Primary hepatocytes isolated from WT or cPLA2a transgenic mice were treated with different concentrations of TGF-b1 in serum-free me-dium for 48 hours. Cell proliferation was determined by [3H]-thymidine incorporation assay. Data are presented as the mean 6 SD of three inde-pendent experiments (*P < 0.01 versus WT cells without TGF-b1 treatment; **P <0.05 versus the same TGF-b1 treatment of WT cells).


hepatocytes from WT mice, this effect was attenuatedin cPLA2a overexpressed hepatocytes. Thus, overex-pression of cPLA2a in hepatocytes renders the cells re-sistant to TGF-b1–induced inhibition of growth.

Discussion

In the liver, TGF-b is well-known to inhibit hepato-cyte proliferation and induce hepatocyte apoptosis.28-34

Quiescent liver usually contains only modest amountsof TGF-b but injury to the liver results in the produc-tion of TGF-b, most prominently by nonparenchymalcells, including hepatic stellate cells and Kupffer cells.TGF-b1 regulates hepatocyte growth by inducing cellcycle arrest or apoptosis, both in vitro and in vivo.28-34

In primary hepatocyte cultures, TGF-b inhibits DNAsynthesis from normal and regenerating livers byblocking the transition from the G1 to the S phase ofthe cell cycle. After a two-thirds partial hepatectomy,TGF-b1 messenger RNA expression increases, andTGF-b is the ostensible inhibitory peptide for hepato-cyte replication and liver regeneration.35 Intravenousadministration of mature TGF-b to rats has beenshown to reduce [3H]thymidine incorporation in hepa-tocytes after partial hepatectomy, although inhibitionof hepatocyte DNA synthesis was transient, becausecomplete regeneration of the liver still occurred by 8days.30 On the other hand, intravenous administrationof adenoviral vector expressing active TGF-b1 potentlyinhibits liver regeneration in rats after standard two-thirds partial hepatectomy, ultimately leading to ani-

mal death.36 Thus, high levels of expression of activeTGF-b1 is able to effectively inhibit hepatocyte growthin vivo.In consideration of the key role of TGF-b in the

regulation of hepatocyte growth and liver fibrosis, it isnot surprising that TGF-b is causatively involved inhepatocarcinogenesis. Given its antiproliferative andproapoptotic role in the liver, TGF-b1 could beexpected to act as a tumor suppressor. Indeed,mice heterozygous for the deletion of TGF-b1 orTGFbRII were found to be more susceptible to DEN-induced hepatocarcinogenesis when compared withtheir WT littermates37,38 (mice homozygous for thedeletion of TGF-b1 or TGFbRII are lethal). Enhancedhepatocarcinogenesis is also observed in transgenicmice overexpressing a dominant negative TGFbRII39

or in mice heterozygous for deletion of the Smadadaptor protein, embryonic liver fodrin.40 Consistentwith these observations, forced expression of Smad3 inthe liver has been shown to inhibit DEN-induced hep-atocarcinogenesis.41 However, there is also evidencesuggesting that TGF-b may promote hepatic carcino-genesis42-44 and that late stage human liver cancers of-ten show overexpression of TGF-b.45,46 The opposingeffects of TGF-b on liver cancer growth may beexplained by the fact that TGF-b functions as a tumorsuppressor early in tumorigenesis when epithelial cellresponsiveness to TGF-b is still relatively normal. It ispossible that during multistage tumorigenesis, themitoinhibitory effect of TGF-b becomes lost, eitherthrough mutation of the TGF-b signaling molecules

Fig. 8. Schematic illustration ofthe interaction between cPLA2aand TGF-b signaling pathways inhepatic cells.


or by subversion of the normal signaling pathway dueto activation of other molecules.1,2,47-49 Because muta-tion of TGF-b signaling molecules occurs only in aminority of human hepatocellular cancers and theprostaglandin signaling pathway is active in tumorcells,15,50 we postulate that disruption of TGF-b–mediated inhibition of cell growth by PG cascade maybe an important mechanism for the regulation of cellgrowth and carcinogenesis.The current study shows that TGF-b regulates the

growth of primary and transformed hepatocytesthrough concurrent activation of Smad-mediated genetranscription and phosphorylation of cPLA2a (Fig. 8).Our findings suggest that the level and activation sta-tus of cPLA2a/PPAR-c signaling in hepatic cells likelyrepresents a key factor that determines the cellularresponse to TGF-b. It is possible that activation ofcPLA2a/PPAR-c signaling may in part explain the lossof responsiveness of neoplastic cells to the antiprolifer-ative actions of TGF-b (due to suppression of Smad2/3 activity). Further studies are warranted to determinethe exact role of this interaction in different stages ofhepatocarcinogenesis.

References1. Massague J, Blain SW, Lo RS. TGFbeta signaling in growth control,

cancer, and heritable disorders. Cell 2000;103:295-309.

2. Derynck R, Akhurst RJ, Balmain A. TGF-beta signaling in tumor sup-pression and cancer progression. Nat Genet 2001;29:117-129.

3. Mishra L, Derynck R, Mishra B. Transforming growth factor-beta sig-naling in stem cells and cancer. Science 2005;310:68-71.

4. Yang L, Moses HL. Transforming growth factor beta: tumor suppressoror promoter? Are host immune cells the answer? Cancer Res 2008;68:9107-9111.

5. Shi Y, Massague J. Mechanisms of TGF-beta signaling from cell mem-brane to the nucleus. Cell 2003;113:685-700.

6. Derynck R, Zhang YE. Smad-dependent and Smad-independent path-ways in TGF-beta family signalling. Nature 2003;425:577-584.

7. Tang Y, Kitisin K, Jogunoori W, Li C, Deng CX, Mueller SC, et al.Progenitor/stem cells give rise to liver cancer due to aberrant TGF-betaand IL-6 signaling. Proc Natl Acad Sci USA 2008;105:2445-2450.

8. Lin L, Amin R, Gallicano GI, Glasgow E, Jogunoori W, Jessup JM, et al.The STAT3 inhibitor NSC 74859 is effective in hepatocellular cancerswith disrupted TGF-beta signaling. Oncogene 2009;28:961-972.

9. Burke JE, Dennis EA. Phospholipase A2 structure/function, mecha-nism, and signaling. J Lipid Res 2009;50(Suppl):S237-S242.

10. Schaloske RH, Dennis EA. The phospholipase A2 superfamily and itsgroup numbering system. Biochim Biophys Acta 2006;1761:1246-1259.

11. Ghosh M, Tucker DE, Burchett SA, Leslie CC. Properties of theGroup IV phospholipase A2 family. Prog Lipid Res 2006;45:487-510.

12. Murakami M, Kudo I. Phospholipase A2. J Biochem (Tokyo) 2002;131:285-292.

13. Fitzpatrick FA, Soberman R. Regulated formation of eicosanoids.J Clin Invest 2001;107:1347-1351.

14. Gupta RA, Dubois RN. Colorectal cancer prevention and treatment byinhibition of cyclooxygenase-2. Nat Rev Cancer 2001;1:11-21.

15. Wu T. Cyclooxygenase-2 in hepatocellular carcinoma. Cancer Treat Rev2006;32:28-44.

16. Wu T. Cyclooxygenase-2 and prostaglandin signaling in cholangiocarci-noma. Biochim Biophys Acta 2005;1755:135-150.

17. Pawliczak R, Han C, Huang XL, Demetris AJ, Shelhamer JH, Wu T.85-kDa cytosolic phospholipase A2 mediates peroxisome proliferator-activated receptor gamma activation in human lung epithelial cells.J Biol Chem 2002;277:33153-33163.

18. Xu L, Han C, Lim K, Wu T. Cross-talk between peroxisome prolifera-tor-activated receptor delta and cytosolic phospholipase A(2)alpha/cy-clooxygenase-2/prostaglandin E(2) signaling pathways in humanhepatocellular carcinoma cells. Cancer Res 2006;66:11859-11868.

19. Seglen PO. Preparation of isolated rat liver cells. Methods Cell Biol1976;13:29-83.

20. Runge D, Runge DM, Jager D, Lubecki KA, Beer Stolz D, Karathana-sis S, et al. Serum-free, long-term cultures of human hepatocytes: main-tenance of cell morphology, transcription factors, and liver-specificfunctions. Biochem Biophys Res Commun 2000;269:46-53.

21. Han C, Leng J, Demetris AJ, Wu T. Cyclooxygenase-2 promotes humancholangiocarcinoma growth: evidence for cyclooxygenase-2-independentmechanism in celecoxib-mediated induction of p21waf1/cip1 andp27kip1 and cell cycle arrest. Cancer Res 2004;64:1369-1376.

22. Wu T, Han C, Lunz JG, 3rd, Michalopoulos G, Shelhamer JH,Demetris AJ. Involvement of 85-kd cytosolic phospholipase A(2) andcyclooxygenase-2 in the proliferation of human cholangiocarcinomacells. HEPATOLOGY 2002;36:363-373.

23. Hata A, Seoane J, Lagna G, Montalvo E, Hemmati-Brivanlou A, Mas-sague J. OAZ uses distinct DNA- and protein-binding zinc fingers in sep-arate BMP-Smad and Olf signaling pathways. Cell 2000;100:229-240.

24. Bell A, Chen Q, DeFrances MC, Michalopoulos GK, Zarnegar R. Thefive amino acid-deleted isoform of hepatocyte growth factor promotescarcinogenesis in transgenic mice. Oncogene 1999;18:887-895.

25. Wang X, DeFrances MC, Dai Y, Pediaditakis P, Johnson C, Bell A,et al. A mechanism of cell survival. Sequestration of Fas by the HGFreceptor Met. Mol Cell 2002;9:411-421.

26. Rosen ED, Spiegelman BM. Ppargamma: a nuclear regulator of metabolism,differentiation, and cell growth. J Biol Chem 2001;276:37731-37734.

27. Fu M, Zhang J, Zhu X, Myles DE, Willson TM, Liu X, et al. Peroxi-some proliferator-activated receptor gamma inhibits transforminggrowth factor beta-induced connective tissue growth factor expressionin human aortic smooth muscle cells by interfering with Smad3. J BiolChem 2001;276:45888-45894.

28. Carr BI, Hayashi I, Branum EL, Moses HL. Inhibition of DNA syn-thesis in rat hepatocytes by platelet-derived type beta transforminggrowth factor. Cancer Res 1986;46:2330-2334.

29. Nakamura T, Tomita Y, Hirai R, Yamaoka K, Kaji K, Ichihara A. In-hibitory effect of transforming growth factor-beta on DNA synthesis ofadult rat hepatocytes in primary culture. Biochem Biophys Res Com-mun 1985;133:1042-1050.

30. Russell WE, Coffey RJ Jr., Ouellette AJ, Moses HL. Type beta trans-forming growth factor reversibly inhibits the early proliferative responseto partial hepatectomy in the rat. Proc Natl Acad Sci USA 1988;85:5126-5130.

31. Braun L, Mead JE, Panzica M, Mikumo R, Bell GI, Fausto N. Trans-forming growth factor beta mRNA increases during liver regeneration:a possible paracrine mechanism of growth regulation. Proc Natl AcadSci USA 1988;85:1539-1543.

32. Jakowlew SB, Mead JE, Danielpour D, Wu J, Roberts AB, Fausto N.Transforming growth factor-beta (TGF-beta) isoforms in rat liver regen-eration: messenger RNA expression and activation of latent TGF-beta.Cell Regul 1991;2:535-548.

33. Bottinger EP, Factor VM, Tsang ML, Weatherbee JA, Kopp JB, Qian SW,et al. The recombinant proregion of transforming growth factor beta1 (la-tency-associated peptide) inhibits active transforming growth factor beta1 intransgenic mice. Proc Natl Acad Sci USA 1996;93:5877-5882.

34. Romero-Gallo J, Sozmen EG, Chytil A, Russell WE, Whitehead R,Parks WT, et al. Inactivation of TGF-beta signaling in hepatocytesresults in an increased proliferative response after partial hepatectomy.Oncogene 2005;24:3028-3041.


35. Michalopoulos GK. Liver regeneration. J Cell Physiol 2007;213:286-300.

36. Schrum LW, Bird MA, Salcher O, Burchardt ER, Grisham JW, BrennerDA, et al. Autocrine expression of activated transforming growth fac-tor-beta(1) induces apoptosis in normal rat liver. Am J Physiol Gastro-intest Liver Physiol 2001;280:G139-G148.

37. Tang B, Bottinger EP, Jakowlew SB, Bagnall KM, Mariano J, AnverMR, et al. Transforming growth factor-beta1 is a new form of tumorsuppressor with true haploid insufficiency. Nat Med 1998;4:802-807.

38. Im YH, Kim HT, Kim IY, Factor VM, Hahm KB, Anzano M, et al.Heterozygous mice for the transforming growth factor-beta type II re-ceptor gene have increased susceptibility to hepatocellular carcinogene-sis. Cancer Res 2001;61:6665-6668.

39. Kanzler S, Meyer E, Lohse AW, Schirmacher P, Henninger J, Galle PR,Blessing M. Hepatocellular expression of a dominant-negative mutantTGF-beta type II receptor accelerates chemically induced hepatocarci-nogenesis. Oncogene 2001;20:5015-5024.

40. Kitisin K, Ganesan N, Tang Y, Jogunoori W, Volpe EA, Kim SS, et al.Disruption of transforming growth factor-beta signaling through beta-spectrin ELF leads to hepatocellular cancer through cyclin D1 activa-tion. Oncogene 2007;26:7103-7110.

41. Yang YA, Zhang GM, Feigenbaum L, Zhang YE. Smad3 reduces sus-ceptibility to hepatocarcinoma by sensitizing hepatocytes to apoptosisthrough downregulation of Bcl-2. Cancer Cell 2006;9:445-457.

42. Factor VM, Kao CY, Santoni-Rugiu E, Woitach JT, Jensen MR, Thor-geirsson SS. Constitutive expression of mature transforming growth fac-

tor beta1 in the liver accelerates hepatocarcinogenesis in transgenicmice. Cancer Res 1997;57:2089-2095.

43. Sanderson N, Factor V, Nagy P, Kopp J, Kondaiah P, Wakefield L,et al. Hepatic expression of mature transforming growth factor beta 1in transgenic mice results in multiple tissue lesions. Proc Natl Acad SciUSA 1995;92:2572-2576.

44. Schnur J, Nagy P, Sebestyen A, Schaff Z, Thorgeirsson SS. Chemicalhepatocarcinogenesis in transgenic mice overexpressing mature TGFbeta-1 in liver. Eur J Cancer 1999;35:1842-1845.

45. Bedossa P, Peltier E, Terris B, Franco D, Poynard T. Transforming growthfactor-beta 1 (TGF-beta 1) and TGF-beta 1 receptors in normal, cir-rhotic, and neoplastic human livers. HEPATOLOGY 1995;21:760-766.

46. Ito N, Kawata S, Tamura S, Takaishi K, Shirai Y, Kiso S, et al. Elevatedlevels of transforming growth factor beta messenger RNA and its polypep-tide in human hepatocellular carcinoma. Cancer Res 1991;51:4080-4083.

47. Siegel PM, Massague J. Cytostatic and apoptotic actions of TGF-betain homeostasis and cancer. Nat Rev Cancer 2003;3:807-821.

48. Akhurst RJ, Derynck R. TGF-beta signaling in cancer—a double-edgedsword. Trends Cell Biol 2001;11:S44-S51.

49. Wakefield LM, Roberts AB. TGF-beta signaling: positive and negativeeffects on tumorigenesis. Curr Opin Genet Dev 2002;12:22-29.

50. Leng J, Han C, Demetris AJ, Michalopoulos GK, Wu T. Cyclooxygen-ase-2 promotes hepatocellular carcinoma cell growth through Akt acti-vation: evidence for Akt inhibition in celecoxib-induced apoptosis.HEPATOLOGY 2003;38:756-768.


cytosolic phospholipase a2α and peroxisome proliferator-activated receptor γ signaling pathway...

Documents