Priority Report

Cytomegalovirus Infection Leads to PleomorphicRhabdomyosarcomas in Trp53þ/� Mice

Richard L. Price1, Katherine Bingmer1, Lualhati Harkins6, O. Hans Iwenofu3, Chang-Hyuk Kwon1,2,Charles Cook4, Christopher Pelloski5, and E. Antonio Chiocca1,7

AbstractCytomegalovirus (CMV) has been detected in several human cancers, but it has not proven to be oncogenic.

However, recent studies have suggested mechanisms through which cytomegalovirus may modulate the tumorenvironment, encouraging its study as a positive modifier of tumorigenesis. In this study, we investigated theeffects of cytomegalovirus infection in Trp53 heterozygous mice. Animals were infected with murine cytomeg-alovirus (MCMV) after birth at 2 days (P2) or 4 weeks of age and then monitored for tumor formation. Miceinjected at 2 days of age developed tumors at a high frequency (43%) by 9 months of age. In contrast, only 3% ofmock-infected or mice infected at 4 weeks developed tumors. The majority of tumors from P2 MCMV–infectedmicewere pleomorphic rhabdomyosarcomas (RMS) harboringMCMVDNA, RNA, and protein. An examination ofclinical cases revealed that human RMS (embryonal, alveolar, and pleomorphic) harbored human cytomega-lovirus IE1 andpp65 protein aswell as viral RNA. Taken together, ourfindings offer support for the hypothesis thatcytomegalovirus contributes to the development of pleomorphic RMS in the context of Trp53 mutation, asituation that occurs with high frequency in human RMS. Cancer Res; 72(22); 5669–74. �2012 AACR.

IntroductionRhabdomyosarcoma (RMS) is a lethal tumor believed to

originate from immature striated muscle cells that primarilyaffects children (1). Approximately half of patients with RMSperish and survival has changed little in the last few decades(2). RMS is divided into 3 subtypes: embryonal, alveolar, andpleomorphic. Both embryonal and alveolar are more commonin children, whereas the more lethal pleomorphic subtypeoccurs primarily in adults with a median survival of 2.25years (3).Human cytomegalovirus (HCMV) is a DNA b-herpes virus.

Like all herpesviridae, acute infection is followed by a lifelonglatent infection that is re-activatable. HCMV is present in 70%to 90% of adults and in 40% of one-year-olds (4). It infectsseveral human cells including RMS (5) and myoblasts (6) invitro, shown to be a cell of origin for RMS (7). Accumulating

evidence suggests a link between persistent HCMV infectionand cancer. Several reports have shown HCMV presence insolid tumors including glioma, medulloblastoma, breast, pros-tate, and colorectal cancer (8–10). This warrants research intohow this virus is linked to cancer.

Although some have reported a high frequency of TP53mutations in RMS (11, 12), this is not universally accepted(13). Heterozygous Trp53þ/� mice develop a mixed spectrumof tumors occurring at a late age (>9 months; ref. 14). Com-bining Trp53 heterozygosity with K-Ras oncogene activation inmice leads to pleomorphic RMS, suggesting a cooperative rolebetween the 2 mutations (15). HCMV has been shown tointeract with many cancer pathways, some of which areimplicated in RMS. HCMV can interact with p53 (9); IE2 canbind directly to p53, inactivating p53-dependent apoptosis;UL44 inhibits p53 transcriptional activity (16); and IE1 reducesp53 expression in glioma cells.

There is no evidence for aHCMVrole in RMS. UsingTrp53þ/�

mice, we report that MCMV infection leads to the developmentof murine pleomorphic RMS. We show HCMV gene expressionin human RMS, implicating this virus in the pathogenesis ofthese neoplasms.

Materials and MethodsSee Supplementary Methods.

Mouse handling and virus infectionThe Institutional Animal Care and Use Committee at The

Ohio State University (Columbus, OH) approvedmouse experi-ments and care. Trp53þ/� mice (see Supplementary Methods)were intraperitoneally (i.p.) injected on postnatal day 2 (P2)with 103 plaque-forming units or at 4 weeks of age with 106

Authors' Affiliations: 1Department of Neurological Surgery, DardingerNeuro-oncology Center, 2Solid Tumor Program at the James Comprehen-sive Cancer Center, Departments of 3Pathology, 4Surgery, and 5RadiationOncology, The Ohio State University Medical Center, Columbus, Ohio;6Department of Medicine-Hematology Oncology, University Alabama atBirmingham, Birmingham, Alabama; and 7Department of NeurologicalSurgery, Brigham and Women's Hospital and Dana-Farber Cancer Insti-tute, Boston, Massachusetts

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Author: E. Antonio Chiocca, Department of NeurologicalSurgery, Brigham and Women's Hospital and Dana-Farber Cancer Insti-tute, Boston, MA 02116. Phone: 617-732-6939; Fax: 617-734-8342;E-mail: EAChiocca@Partners.org

doi: 10.1158/0008-5472.CAN-12-2425

�2012 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 5669

on May 8, 2020. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 21, 2012; DOI: 10.1158/0008-5472.CAN-12-2425

plaque-forming units with an MCMV strain that possesses anablated m157 allele to enhance infectivity in B6 mice (17) in100 mL of PBS or PBS only (Mock). MCMV infection in mice isconsidered a reasonable surrogate for modeling HCMV infec-tion in humans. An additional cohort received 103 plaque-forming units of HSV-1 at P2 in 100 mL of PBS. To preventunintentional viral spread, mock-infected mice were housedseparately from virus-infected mice and always handled beforeMCMV mice, and their cages were changed on different daysthan MCMV-infected mice. Mice were genotyped on P19 (18)and genotypes were reconfirmed. Mice were sacrificed aftertumors became 1.6 cm in diameter or moribund. Tumorsappeared throughout the body, although they favored theabdominal cavity or limb girdles (Supplementary Table S1A).

MCMV PCR and reverse transcriptase-PCRAfter anesthesia with i.p. injection of ketamine (100 mg/kg)

and xylazine (20 mg/kg), 0.5 mL of blood was obtained via thefacial vein.Micewere perfused via the intracardiac routewith ice-cold PBS followed by organ harvest. Genomic DNAwas obtainedusing a DNeasy Kit and RNA via RNeasy Kit (Qiagen) with on-column DNase treatment. MCMV-GB gene was amplified byPCR using the following primers (50–30): MCMV-GB forward:TGGGTGAGAACAACGAGAT and MCMV-GB reverse: CGCA-GTCTCCCTTCGAGTA. b-Actin was used as control (mouseb-actin forward: AGCCTCGTCCCGTAGACAAAT;mouse b-actinreverse: GAAGACACCAGTAGACTCCACGACAT). For reversetranscriptase (RT)-PCR experiments, 1 mg of total RNA wastranscribed using a SuperScript First-Strand cDNA Synthesis

Kit (Invitrogen). Primers (50–30) for MCMV-IE1 were forward:TAGCCAATGATATCTTCGAGCG and reverse: TTAGCTGATC-TGAGGAGCACCAGAT.

Mouse histologyInitially visible tumors reached a large size within 1 week.

After anesthesia, mice were examined for visible pathology.Tumor tissue or other tissues of interest were snap frozen at�80�C or placed in 4% paraformaldehyde, processed for par-affin embedding, and cut into 4-mm sections. A board-certifiedpathologist (O.H. Iwenofu) specializing in sarcomas wasblinded to infection status and evaluated hematoxylin andeosin stained sections. In addition, immunohistochemistrywas conducted. Antibodies were against MyoD1 (Santa CruzBiotechnology, Inc.), Desmin (Sigma), smooth muscle actin(Millipore), and Croma101 (from Stipan Jonjic). MOM kit(Vector) was used for antibodies raised in mouse. Microscopicimages were captured with an Olympus BX51 microscope(Olympus America Inc.) equipped with DP72 camera.

HCMV immunohistochemistryHuman RMS and normal muscle biopsy samples were

obtained using an approved Institutional Review Board pro-tocol. Immunohistochemistry for HCMV in tumors has beenpreviously described with minor modifications (8). HCMV-IE1(Millipore), HCMV-pp65 (Leica Microsystems), or smoothmuscle actin (Millipore) primary antibodies were incubatedon sections overnight at 4�C. Secondary antibody was appliedfor 30 minutes followed by biotin link for 30 minutes

Figure 1. Kaplan–Meier survival curve for Trp53þ/� mice after infection with MCMV versus control. A, mice were followed for 9 months. Twelve of 28 miceinfected with MCMV at P2 developed tumors compared with 1 of 27 mock-infected mice, 0 of 16 infected with MCMV at 4 weeks of age, or 1 of 12 miceinfected with HSV-1. The difference in survival was significant (P < 0.05 for P2 MCMV-infected vs. mock, HSV-1, or 4-week infection, log-rank test). B, bargraph displaying tumor incidence for Trp53þ/� mice (��, P ¼ 0.003, Fisher exact test). C, RT-PCR for MCMV-IE1 and MCMV-GB from mouse organs 5 daysafter MCMV infection of P2 mice. The gels are representative of 3 different experiments. H, heart; L, liver; P, peritoneum; Q, quadriceps muscle; T,trapezius muscle; þ, MCMV-infected fibroblasts; �, mock-infected fibroblasts. D, immunohistochemistry for MCMV-IE1 (arrow) in muscle from P2MCMV–infected mice or mock-infected (5 days postinfection). Arrows indicate positive immunohistochemistry. Scale bar, 50 mm.

Price et al.

Cancer Res; 72(22) November 15, 2012 Cancer Research5670

on May 8, 2020. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 21, 2012; DOI: 10.1158/0008-5472.CAN-12-2425

(Biogenex). Positive staining was visualized with a 3,30-diami-nobenzidine (DAB) substrate.

Results and DiscussionMCMV-infected Trp53þ/� mice developed tumors at ahigh rate by 9 monthsMicewere infectedwithMCMV (103 plaque-forming units) 2

days after birth (P2) or at 4 weeks of age (106 plaque-formingunits). Separate Trp53þ/� control cohorts were inoculatedwith PBS vehicle (mock infection) or with a nonlethal doseof another herpes virus, herpes simplex virus 1 (HSV-1), at thesame time points, to test for nonspecific viral effects on tumorformation. Virus infection caused no distinguishing behavioralor clinical effects in mice. Because Trp53þ/� mice start devel-oping tumors at a late age (>9 months), we followed mice for 9months to detect MCMV-specific effects on tumor develop-ment. P2 MCMV infection was associated with a statisticallysignificant decrease in survival (the point of veterinary need foreuthanasia) compared with mock-infected mice (P < 0.05, log-rank test; Fig. 1A). About 42.8% (12 of 28) of P2MCMV–infectedTrp53þ/� mice developed large, visible tumors over 9 months(Fig. 1B). Instead, only 1 of 27mock-infected and 1 of 12 HSV-1-infected mice developed a visible tumor during this timeperiod. In addition, MCMV infection at 4 weeks of age didnot result in visible tumors. Therefore, MCMV (but not HSV-1or mock) infection of Trp53þ/� mice at P2, but not at 4 weeks,led to a significantly higher incidence of visible tumors over thefirst 9 months of animal life.

MCMV infected muscle and connective tissueNext, we examined mice for MCMV distribution. Tissues

from mice, infected with MCMV at P2 and analyzed 5 dayspostinfection, were positive for MCMV immediate, early(MCMV-IE1), and late (MCMV-GB) transcripts (Fig. 1C). Inaddition, quadriceps exhibited expressionofMCMV-IE1protein(Fig. 1D). MCMV RNA expression in muscle was not detected 2weeks after infection (data not shown). In addition, tissues from

mice infected at 4weeks of agewere positive forMCMV-specificglycoprotein B DNA (MCMV-GB; Supplementary Fig. S1A) andfor MCMV-IE1 and GB transcripts (Supplementary Fig. S1B).Mock-infected mice were negative for MCMV-GB (data notshown). These findings confirm that MCMV infects the tissuesfrom which pleomorphic RMS originate.

Figure 2. Histologic and molecularanalyses of tumors from MCMVinfected Trp53þ/�mice. Hematoxylinandeosin staining ofMCMV-infectedectopic tumor showingpleomorphism (arrowhead; A) andimmature muscle (arrow; A),rhabdomyoblasts (arrowhead;B) andmulti-nucleated giant cells (arrow; B),and invasive tumor margins (C). D,immunohistochemistry for myogenicmarkers, MyoD1 and Desmin.

Figure 3. MCMV analysis of mouse tumors. A, PCR for MCMV DNA intumors from MCMV-infected (n ¼ 4) and mock-infected (n ¼ 1) mice. B,RT-PCR forMCMV-IE1 in tumors fromMCMV-infected (n¼ 4) andmock-infected (n ¼ 1) mice. C, RT-PCR product fidelity was validated bysequencing the amplified MCMV-IE1 transcript. D, MCMV-IE1immunohistochemistry in MCMV- and mock-infected tumor. Scale bars,50 mm.

A Role of Cytomegalovirus in Rhabdomyosarcoma

www.aacrjournals.org Cancer Res; 72(22) November 15, 2012 5671

on May 8, 2020. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 21, 2012; DOI: 10.1158/0008-5472.CAN-12-2425

MCMV-infected Trp53þ/� mice developed pleomorphicRMS at an early age

Tumors that developed in MCMV-infected Trp53þ/� micerevealed diagnostic features of pleomorphic RMS includingpleomorphic features (Fig. 2A), rhabdomyoblasts (Fig. 2B), andinfiltration into surroundingmuscle (Fig. 2C). The immunophe-notypic expression of MyoD1 and Desmin confirmed RMS (Fig.2D). Analysis of a subset of MCMV-infected tumors (n ¼ 4)revealed MCMV DNA (Fig. 3A), which was absent in the singletumor that had developed in one of themock-infected Trp53þ/�

mice. MCMV-IE1 transcripts were also present in the 4 testedtumors (Fig. 3B). Fidelity of PCR reactions was confirmed byDNA sequencing of PCR products (Fig. 3C). Furthermore,MCMV-infected tumors expressed IE1 protein, whereas thiswas not seen in the mock-infected tumor (Fig. 3D). Isotypecontrol andnoprimary antibody confirmed immunohistochem-ical specificity (Supplementary Fig. S2A). Taken together, thesedata show transcriptionally active MCMV within tested RMS.

Published data for uninfected Trp53þ/� mice show variabletumor types occurring after the age of 9 months. In one study,28% (28 of 100) ofTrp53þ/�mice develop tumors by 17months.These tumors were primarily lymphomas, osteosarcomas, andfibrosarcomas; only one was an RMS (14). Pathologic analysesof MCMV-infected tumors in this study revealed that 84.6%were RMS (10 of 12), whereas 15.4% (2 of 12) were lymphomas.Nine of 10 RMS tumors were pleomorphic (SupplementaryTable S1A). Therefore, our data suggest thatMCMVacceleratestumor formation in mice with heterozygous Trp53 mutation,leading preferentially to pleomorphic RMS.

HCMV antigen presence in human RMS, but not innormal muscle

Because the majority of tumors from MCMV-infected micewere pleomorphic RMS, we tested whether this finding wasclinically relevant by examining human tumors for the pres-ence of HCMV (Supplementary Table S1B). Pleomorphic RMS

Figure 4. HCMV detection in human RMS. A, immunohistochemistry for HCMV-IE1 and HCMV-pp65 IHC in pleomorphic, embryonal, and alveolar RMSand normal muscle. B, bar graph detailing antigen presence in pleomorphic and pediatric RMS. C, in situ hybridization for HCMV in pleomorphic RMS.The same tumor was stained with a probe against poly T RNA, present in all cells, as a positive control. A negative control probe is included. This section wascounterstained with eosin to show cell architecture. Scale bar, 50 mm.

Price et al.

Cancer Res; 72(22) November 15, 2012 Cancer Research5672

on May 8, 2020. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 21, 2012; DOI: 10.1158/0008-5472.CAN-12-2425

cases were first examined for HCMV-IE1 via immunohisto-chemistry. All human pleomorphic RMS cases (8 of 8) stainedstrongly and diffusely for HCMV-IE1 (Fig. 4A), with expectedisotype and negative control immunohistochemistry (Supple-mentary Fig. S2B). As a control, HCMV-IE1 immunoreactivitywas not observed in 5 of 5 normal human adult muscle (Fig.4A). Staining was expanded to include embryonal and alveolar(collectively referred to as pediatric) RMS tumors (Fig. 4A).Nine of 10 (90%) of these tumors stained positive forHCMV-IE1(Fig. 4B). Because HCMV-IE1 transcription can frequently bedetected even after the virus becomes latent, we also stainedfor the presence of HCMV-pp65, a late protein expressedduring active viral replication. All adult pleomorphic RMScases andmost (6 of 10) pediatric RMS tumors stained stronglyfor pp65 (Fig. 4B), and pp65-positive cells were abundantthroughout the positive tumors (Fig. 4A). Altogether, 100%(8 of 8) of adult and 90% (9 of 10) of pediatric RMS casesexpressed HCMV antigen (Fig. 4B). Only one pediatric case didnot stain positive for HCMV-IE1 or HCMV-pp65 (Supplemen-tary Fig. S2C and not shown). Rhabdomyoblasts stainedstrongly for HCMV antigen (Supplementary Fig. S2D, arrow),suggesting that the RMS-associated primitive cell type wasindeed infected with the virus. In several cases, cells in musclebeyond the tumormargin were also positive for HCMV antigen(Supplementary Fig. S2E). One limitation of the presentedimmunopositive findings in human RMS cases results fromour inability to secure serum from these same historicalsubjects to determine their cytomegalovirus serology. Toconfirm the selective presence of HCMV DNA in human RMS,quantitative PCR analysis showed that tumors expressed anaverage of 81.1 copies/ng of HCMV-UL83 and of 22.2 copies/ngof HCMV-UL146 compared with 0 and 0.49 copies/ng innormal muscle, respectively (P < 0.05, Student t test; Supple-mentary Fig. S3A). The amplified products' nucleotidesequence was greater than 95% identical to that of a clinicalstrain (Supplementary Fig. S3B).To further validate the presence of HCMV in RMS, we next

tested for the presence of HCMV RNA by using in situ hybrid-ization in a subset of tumors. A commercially available RNAprobe targeted to an unspecified early gene of HCMV revealedHCMV RNA in RMS (Fig. 4C). In situ hybridization with anegative control probe or no probe was negative (Fig. 4C anddata not shown). Altogether 100% (5 of 5) of RMS cases tested,but none of the normal muscle biopsies, contained HCMVRNA. The one pediatric case that did not express HCMV-IE1or HCMV-pp65 protein was positive for HCMV via in situhybridization (data not shown). Taken together, 100% (18 of18) of tested RMS cases contained HCMV genetic material.

Our data suggest a link between RMS and cytomegalovirus.During the 9months of our study, wild-type mice infected withMCMV did not develop tumors (data not shown). However,when MCMV infection was introduced into a neonatal mousewith a Trp53þ/� tumor suppressor deficiency, mice developtumors at a higher rate and earlier onset than mock-infectedmice. Interestingly, tumor formation primarily occurred inTrp53þ/� mice infected at P2. In addition, mice preferentiallydevelop pleomorphic RMS as opposed to a wide array oftumors. Molecular analyses reveal the presence of MCMV inthese mouse tumors. In addition, examination of human RMSsamples revealed that 100% of tumors contain HCMV geneticmaterial. This implicates cytomegalovirus in the pathogenesisof the disease. Cytomegalovirus has never been shown to be atransforming virus. Our data shows for the first time thatcytomegalovirus infection combined with Trp53 heterozygos-ity promotes pleomorphic RMS. Furthermore, the idea thatcytomegalovirus can promote tumorigenesis in an organismwith genetic aberrations may help to explain the difficulty ofepidemiologically linking cytomegalovirus infection with rel-atively rare cancers.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: R.L. Price, C.-H. Kwon, C. Cook, E.A. ChioccaDevelopment of methodology: R.L. Price, L. Harkins, C.-H. KwonAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): R.L. Price, K. Bingmer, O.H. Iwenofu, C. PelloskiAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): R.L. Price, O.H. Iwenofu, C.-H. Kwon, C. Cook, C.Pelloski, E.A. ChioccaWriting, review, and/or revision of themanuscript:R.L. Price, O.H. Iwenofu,C.-H. Kwon, C. Cook, C. Pelloski, E.A. ChioccaAdministrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): R.L. Price, L. Harkins, E.A. ChioccaStudy supervision: C.-H. Kwon, E.A. Chiocca

AcknowledgmentsThe authors thank Ulrich Koszinowski (Max von Pettenkofer-Institute,

Munich, Germany) for kindly providing MCMV and Stipan Jonjic (Universityof Rijeka, Rijeka, Croatia) for providing Croma101 antibody. Denis Guttridge(Ohio State University, Columbus, OH) provided constructive guidance to theproject.

Grant SupportR.L. Price was funded by a seed grant from the AmericanMedical Association

Foundation. This study was funded by a Viral Oncology Program Grant, theDardinger Neuro-oncology Fund, the Jeffrey Thomas Hayden Foundation (E.A.Chiocca), OSU MBCG Program grant (E.A. Chiocca and C.-H. Kwon), and OSUCCC Start-up Fund (C.-H. Kwon).

Received June 20, 2012; revised September 4, 2012; accepted September 17,2012; published OnlineFirst September 21, 2012.

References1. Paulino AC, Okcu MF. Rhabdomyosarcoma. Curr Probl Cancer 2008;

32:7–34.2. Weitz J, Antonescu CR, Brennan MF. Localized extremity soft tissue

sarcoma: improved knowledge with unchanged survival over time.J Clin Oncol 2003;21:2719–25.

3. Simon JH, Paulino AC, Ritchie JM, Mayr NA, Buatti JM. Presentation,prognostic factors and patterns of failure in adult rhabdomyosarcoma.Sarcoma 2003;7:1–7.

4. Onorato IM, Morens DM, Martone WJ, Stansfield SK. Epidemiologyof cytomegaloviral infections: recommendations for preventionand control. Rev Infect Dis 1985;7:479–97.

5. Cinatl J, Cinatl J, RadsakK, RabenauH,WeberB,NovakM, et al. Replica-tion of human cytomegalovirus in a rhabdomyosarcoma cell line dependson the state of differentiation of the cells. Arch Virol 1994;138:391–401.

6. Wang W, Yu P, Zhang P, Shi Y, Bu H, Zhang L. The infection ofhuman primary cells and cell lines by human cytomegalovirus:

A Role of Cytomegalovirus in Rhabdomyosarcoma

www.aacrjournals.org Cancer Res; 72(22) November 15, 2012 5673

on May 8, 2020. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 21, 2012; DOI: 10.1158/0008-5472.CAN-12-2425

new tropism and new reservoirs for HCMV. Virus Res 2008;131:160–9.

7. Saab R, Spunt SL, Skapek SX. Myogenesis and rhabdomyosarcomathe Jekyll and Hyde of skeletal muscle. Curr Top Dev Biol 2011;94:197–234.

8. Cobbs CS, Harkins L, Samanta M, Gillespie GY, Bharara S, King PH,et al. Human cytomegalovirus infection and expression in humanmalignant glioma. Cancer Res 2002;62:3347–50.

9. Soroceanu L, Cobbs CS. Is HCMV a tumor promoter? Virus Res 2011;157:193–203.

10. Baryawno N, Rahbar A, Wolmer-Solberg N, Taher C, Odeberg J,Darabi A, et al. Detection of human cytomegalovirus in medullo-blastomas reveals a potential therapeutic target. J Clin Invest 2011;121:4043–55.

11. Felix CA, Kappel CC, Mitsudomi T, Nau MM, Tsokos M, Crouch GD,et al. Frequency and diversity of p53 mutations in childhood rhabdo-myosarcoma. Cancer Res 1992;52:2243–7.

12. Mulligan LM, Matlashewski GJ, Scrable HJ, Cavenee WK. Mechan-isms of p53 loss in human sarcomas. Proc Natl Acad Sci U S A1990;87:5863–7.

13. Ognjanovic S, Martel G, Manivel C, Olivier M, Langer E, Hai-naut P. Low prevalence of TP53 mutations and MDM2 ampli-fications in pediatric rhabdomyosarcoma. Sarcoma 2012;2012:492086.

14. Jacks T, Remington L,Williams BO, Schmitt EM, Halachmi S, BronsonRT, et al. Tumor spectrum analysis in p53-mutant mice. Curr Biol1994;4:1–7.

15. KirschDG,DinulescuDM,Miller JB,GrimmJ, SantiagoPM,YoungNP,et al. A spatially and temporally restricted mouse model of soft tissuesarcoma. Nat Med 2007;13:992–7.

16. Kwon Y, Kim M-N, Young Choi E, Heon Kim J, Hwang E-S, Cha C-Y.Inhibition of p53 transcriptional activity by human cytomegalovirusUL44. Microbiol Immunol 2012;56:324–31.

17. Bubi�c I, Wagner M, Krmpoti�c A, Saulig T, Kim S, YokoyamaWM, et al.Gain of virulence caused by loss of a gene in murine cytomegalovirus.J Virol 2004;78:7536–44.

18. Zhu Y, Guignard F, Zhao D, Liu L, Burns DK, Mason RP, et al.Early inactivation of p53 tumor suppressor gene cooperating withNF1 loss induces malignant astrocytoma. Cancer Cell 2005;8:119–30.

Price et al.

Cancer Res; 72(22) November 15, 2012 Cancer Research5674

on May 8, 2020. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 21, 2012; DOI: 10.1158/0008-5472.CAN-12-2425

2012;72:5669-5674. Published OnlineFirst September 21, 2012.Cancer Res   Richard L. Price, Katherine Bingmer, Lualhati Harkins, et al.  

Mice−+/Trp53Rhabdomyosarcomas in Cytomegalovirus Infection Leads to Pleomorphic

  Updated version

  10.1158/0008-5472.CAN-12-2425doi:

Access the most recent version of this article at:

  Material

Supplementary

  http://cancerres.aacrjournals.org/content/suppl/2012/09/21/0008-5472.CAN-12-2425.DC2

http://cancerres.aacrjournals.org/content/suppl/2012/09/21/0008-5472.CAN-12-2425.DC1Access the most recent supplemental material at:

   

   

  Cited articles

  http://cancerres.aacrjournals.org/content/72/22/5669.full#ref-list-1

This article cites 18 articles, 5 of which you can access for free at:

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.org

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/72/22/5669To request permission to re-use all or part of this article, use this link

on May 8, 2020. © 2012 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst September 21, 2012; DOI: 10.1158/0008-5472.CAN-12-2425