Crystal structure of Pseudomonas aeruginosabacteriophytochrome: Photoconversion andsignal transductionXiaojing Yang*†, Jane Kuk*, and Keith Moffat*†‡

*Department of Biochemistry and Molecular Biology and ‡Institute for Biophysical Dynamics, University of Chicago, Chicago, IL 60637

Communicated by Winslow R. Briggs, Carnegie Institution of Washington, Stanford, CA, July 11, 2008 (received for review February 26, 2008)

Phytochromes are red-light photoreceptors that regulate lightresponses in plants, fungi, and bacteria via reversible photocon-version between red (Pr) and far-red (Pfr) light-absorbing states.Here we report the crystal structure at 2.9 Å resolution of abacteriophytochrome from Pseudomonas aeruginosa with an in-tact, fully photoactive photosensory core domain in its dark-adapted Pfr state. This structure reveals how unusual interdomaininteractions, including a knot and an ‘‘arm’’ structure near thechromophore site, bring together the PAS (Per-ARNT-Sim), GAF(cGMP phosphodiesterase/adenyl cyclase/FhlA), and PHY (phyto-chrome) domains to achieve Pr/Pfr photoconversion. The PAS, GAF,and PHY domains have topologic elements in common and mayhave a single evolutionary origin. We identify key interactions thatstabilize the chromophore in the Pfr state and provide structuraland mutational evidence to support the essential role of the PHYdomain in efficient Pr/Pfr photoconversion. We also identify a pairof conserved residues that may undergo concerted conformationalchanges during photoconversion. Modeling of the full-length bac-teriophytochrome structure, including its output histidine kinasedomain, suggests how local structural changes originating in thephotosensory domain modulate interactions between long, cross-domain signaling helices at the dimer interface and are transmittedto the spatially distant effector domain, thereby regulating itshistidine kinase activity.

phytochrome � photoreceptor

L ight is a major environmental stimulus for both prokaryotesand eukaryotes. The phytochrome superfamily contains a

diverse set of red light photoreceptors, members of whichregulate a wide range of physiologic processes, such as seedgermination, f loral induction, and phototaxis in plants, fungi,and bacteria. Plant phytochromes and bacteriophytochromes(Bph) use a linear tetrapyrrole (bilin) as a chromophore andphotoconvert between red-absorbing (Pr) and far-red-absorbing(Pfr) states (1, 2). Like many naturally occurring signalingmolecules, Bphs possess a modular domain architecture in which3 N-terminal domains, denoted PAS (Per-ARNT-Sim), GAF(cGMP phosphodiesterase/adenyl cyclase/FhlA), and PHY (phy-tochrome), form the photosensory core domain (PCD). They arecovalently linked to the C-terminal histidine kinase (HK) outputor effector domain that transduces a light signal into a chemicalsignal via autophosphorylation of a histidine residue in the HKdomain. The PAS and GAF domains together form the chro-mophore binding domain (CBD), responsible for chromophoreincorporation. Recent crystallographic studies of the CBDs fromDeinococcus radiodurans DrBphP and Rhodopseudomonaspalustris RpBphP3 reveal the structures of the PAS and GAFdomains and their biliverdin-IX� (BV) chromophore in the Prstate (3–5). However, as previously shown in many other phy-tochromes (6–9), these shorter CBD constructs lack the PHYdomain and hence do not undergo full photoconversion betweenthe Pr and Pfr states. The photoconversion mechanism, involv-ing rapid 15Z anti to 15E anti isomerization of the C15 � C16double bond between rings C and D of the bilin chromophore,

has been extensively explored by static and time-resolved spec-troscopic studies on various phytochromes and Bphs (10–15).However, the molecular basis of reversible Pr/Pfr photoconver-sion and signal transduction mechanisms in phytochromes re-mains unclear, largely owing to the absence of structural infor-mation on fully photoactive constructs containing the PHY andHK domains, and on constructs in the Pfr state.

Results and DiscussionCrystal Structure of PaBphP-PCD. We have determined the crystalstructure of a fully photoactive photosensory core domain fromPseudomonas aeruginosa bacteriophytochrome (PaBphP-PCD)in its dark-adapted Pfr state (Fig. 1A). This construct consists ofthe PAS, GAF, and PHY domains and includes residues 1–497together with 2 linker residues and 6 additional histidine tagresidues at the C terminus. The dark-adapted Pfr state isconfirmed by the UV-visible absorption spectra in solution (toptrace of Fig. 2D) and in crystals, which is consistent with spectraof Agp1 and Agp2 reconstituted with a synthetic bilin chro-mophore sterically locked in the 15Ea configuration (14, 16). ThePaBphP-PCD crystals exhibited similar spectral behavior atroom temperature: photoconversion between the Pr and Pfrstates and dark reversion to the Pfr state (data not shown).

We solved 2 crystal structures in 2 different space groups. Thecrystal structure of a single mutant Q188L was determined bymultiple wavelength anomalous dispersion in space group P65and was then used as a search model to solve the crystal structureof the wild type in space group C2221 by molecular replacement(Materials and Methods). Diffraction from wild-type crystalswas anisotropic, extending to 2.7 Å resolution along the c axisand �3.3 Å along the a and b axes [supporting information (SI)Table S1]. The PaBphP-PCD wild-type structure contains 8molecules, each containing 1 BV chromophore and 16 watermolecules in the asymmetric unit. The final model was refinedat 2.9 Å resolution with an R-factor of 0.221 and free R-factor of0.268. In this report, we focus on the PaBphP-PCD wild-typestructure; the PaBphP-PCD Q188L mutant structure will bediscussed in detail separately (X.Y., J.K., and K.M., unpublisheddata).

The 8 PaBphP-PCD molecules in the asymmetric unit com-prise 4 parallel, head-to-head dimers (Fig. 1 A and Fig. S1). Thetertiary structures of the PAS and GAF domains and theirdisposition in the dimers are similar to those in the RpBphP-

Author contributions: X.Y. designed research; X.Y. and J.K. performed research; X.Y. andJ.K. contributed new reagents/analytic tools; X.Y. analyzed data; and X.Y. and K.M. wrotethe paper.

The authors declare no conflict of interest.

Data deposition: Coordinates and structure factor amplitudes have been deposited in theProtein Data Bank, www.pdb.org (PDB ID code 3C2W).

†To whom correspondence may be addressed. E-mail: xiaojingyang@uchicago.edu ormoffat@cars.uchicago.edu.

This article contains supporting information online at www.pnas.org/cgi/content/full/0806718105/DCSupplemental.

© 2008 by The National Academy of Sciences of the USA

www.pnas.org�cgi�doi�10.1073�pnas.0806718105 PNAS � September 23, 2008 � vol. 105 � no. 38 � 14715–14720

PLA

NT

BIO

LOG

Y

CBD and DrBphP-CBD structures (3–5). The core of the novelPHY domain forms a typical �/� fold in which a central5-stranded, antiparallel � sheet has a single helix packed on oneside and a helical bundle on the other (Fig. 1 A). It bears asignificant resemblance to the core of the GAF domain, whichconfirms a prediction made in the PFAM database for the Cph2family (17). Both the GAF and PHY domains contain a largesegment (approximately 44 residues) inserted in their core foldcontaining 1 helix (D) in an extended loop but at differenttopologic locations (Fig. 1E). The PAS, GAF, and PHY domainsmake extensive interdomain contacts via these large inserts (Fig.1 B and C). The PAS domain penetrates the GAF domain toform a knot in which its N-terminal extension passes through thelarge insert in the GAF domain (3–5). The large insert in thePHY domain forms an extended arm that shields the chro-mophore hosted by the GAF domain and constitutes 90% of theburied surface area between the GAF and PHY domains.

The cores of the PAS, GAF, and PHY domains share acommon topology: each has an antiparallel � sheet whose 5strands occur in the spatial order 2–1–5–4–3 with variousconnectors of different lengths, but all include helix C betweenstrands 2 and 3 (Fig. 1 C and D). Accessory structural elementsdecorate these common cores and, although scattered in theprimary structure, are spatially localized in 2 regions. The firstis located near the chromophore binding pocket, where theN-terminal extension of the PAS domain and the arm of thePHY domain interact with the large insert of the GAF domain,and conserved residues from all 3 domains interact directly withthe chromophore (discussed below). The second region com-prises helical bundles at the dimer interface, in which a singlelong helix directly connects the GAF and PHY domains. Thesimilar topologies in the PAS, GAF, and PHY domains areassociated with only a low level of identity in primary structure(PAS-GAF and PAS-PHY: �25%; GAF-PHY: �10%; PAS-

Fig. 1. Crystal structure of wild-type PaBphP-PCD. (A) Ribbon diagram of the dimeric PaBphP-PCD structure. The PAS, GAF, and PHY domains of one monomerare highlighted in yellow, green, and blue, respectively. Helices in the GAF and PHY domains are identified by letters (A–E). (B) The PAS, GAF, and PHY domainsare integrated via extensive interdomain interactions and converge on the chromophore binding site (cyan). (C) Accessory structure elements (gray) decoratethe common cores of the PAS, GAF, and PHY domains and are spatially clustered near the chromophore (cyan) and as helical bundles at the dimer interface. (D)The core of the PAS, GAF, and PHY domains contains an antiparallel � sheet with strands in the spatial order of 2–1–5–4–3 and a variable connector betweenstrands 2 and 3 that contains helix C. (E) Both core and accessory elements are highlighted in a topologic diagram of the PaBphP-PCD structure.

14716 � www.pnas.org�cgi�doi�10.1073�pnas.0806718105 Yang et al.

GAF-PHY: �5%) (18, 19). We propose that the PAS, GAF, andPHY domains originated in a precursor to the PAS sensorymodule and became specialized in phytochromes via accessorystructural elements that confer Pr/Pfr photoconversion andfacilitate dimerization.

The BV chromophore is covalently attached to S� of Cys-12in the PAS domain via the vinyl group of ring A. The electrondensity in the simulated-annealing omit map establishes the5-syn/10-syn/15-anti configuration for the BV chromophore (Fig.2A and Fig. S2). Limited by anisotropic diffraction and moderateresolution (Table S1), the electron density alone could notunambiguously distinguish between the 15Ea and 15Za config-urations of ring D. However, hydrogen bonding interactionsbetween ring D and the surrounding residues clearly favor the15Ea over the 15Za configuration (Fig. 2B). This interpretationof the 5Zs/10Zs/15Ea configuration is consistent with the as-signment of the 15Ea and 15Za configurations to the Pfr and Prstates, respectively, but does not support the 5Za configurationof ring A proposed for the Pfr state (14).

The GAF–PHY Interface and the Pfr State. On the basis of ourRpBphP3-CBD structure, we predicted that a surface patch inthe GAF domain consisting of conserved residues Asp-216 from

the characteristic phytochrome PASDIP sequence, Tyr-272,and the 15Ea pocket of RpBphP3 forms part of the interface withthe PHY domain (5). This prediction is now confirmed by thePaBphP-PCD structure. At the interface of the GAF and PHYdomains, there are extensive interactions among conservedresidues Asp-194 and Tyr-250 of the GAF domain [correspond-ing to Asp-216 and Tyr-272 of RpBphP3 (Fig. S5)], Ser-459 andArg-453 from the arm of the PHY domain, and the chro-mophore. Specifically, Asp-194, Tyr-250, and Ser-459 interactdirectly with the pyrrole nitrogen of ring D of the chromophorein the 15Ea configuration (Fig. 2B). The carboxyl group ofAsp-194 is sandwiched between ring D and the side chains ofSer-459 and Arg-453. The PHY arm is largely diverse in se-quence and rich in glycine and proline but contains a stretch ofconserved residues spanning residues 453–463. Within thisstretch, Ser-459 is located in helix D, and Arg-453 protrudesfrom a sharp turn immediately N-terminal to helix D. To explorethe roles of these residues in stabilizing the Pfr state, wesubjected them to site-specific mutagenesis. Single alanine sub-stitutions at any of Asp-194, Ser-459, and Arg-453 disrupted thePfr dark state of wild type and caused each to adopt the Pr darkstate (Fig. 2D). Remarkably, the D194A mutant undergoes nophotoconversion from the Pr state, is completely incapable of

Fig. 2. Residues and interactions in the chromophore binding pocket. (A) The BV chromophore of PaBphP-PCD in the Pfr state adopts the 15Ea configuration(cyan) as compared with the 15Za configuration (gray) in the Pr state of the RpBphP3-CBD structure. The superposition is based on the structural alignment ofthe PAS and GAF domains of the PaBphP-PCD and RpBphP3-CBD (PDB ID 2OOL) structures. (B) At the interface between the GAF and PHY domains in PaBphP-PCD,conserved residues Tyr-250, Asp-194, Ser-459, and Arg-453 and the chromophore form extensive hydrogen bond interactions (red dotted lines) to stabilize ringD in the 15Ea configuration. (C) The side chains of Tyr-250 and Gln-188 directly interact with the carbonyl group of ring D. (D) UV-visible absorption spectra ofthe dark-adapted (solid) and light-illuminated (dash) states in PaBphP-PCD wild type (WT) and mutants. Half-times of dark reversion are indicated in parentheses.

Yang et al. PNAS � September 23, 2008 � vol. 105 � no. 38 � 14717

PLA

NT

BIO

LOG

Y

forming the Pfr state, and is intensely fluorescent (Fig. S3) (20).The S459A and R453A mutants display limited light-inducedphotoconversion from the Pr to the Pfr state. Consistently, ashorter construct containing only the PAS and GAF domains ofPaBphP adopts Pr instead of Pfr as the dark-adapted state (datanot shown). These results establish that interactions amongAsp-194, Arg-453, Ser-459, and the chromophore at the interfaceof the GAF and PHY domains are critical for engaging the PHYdomain and forming the Pfr state.

Residues Tyr-250, Gln-188, and Ser-459 are within hydrogenbonding distance of the carbonyl substituent of ring D (Fig.2C). Both the Y250F and Q188L mutants retain the Pfr groundstate and are able to undergo light-induced photoconversion tothe Pr state, but their rates of spontaneous reversion to the Pfrstate are significantly slower than wild type (Fig. 2D). Theamino group of Gln-188 apparently contributes to stabilizingthe 15Ea configuration. It is noteworthy that those Bphs whosedark-adapted state is Pfr typically contain Gln (in PaBphP,RpBphP5, and AtBphP2) (5, 21–24) or Asn (in BrBphP andRpBphP1) (25) at the position corresponding to Gln-188 (seeFig. 2c of ref. 5).

Signal Transduction Mechanism. Understanding the signal trans-duction mechanism in bacteriophytochromes raises several ques-tions. What conformational changes occur upon prompt isomer-ization of the chromophore? How do these, initially local,structural changes propagate through the photosensory domainsto the spatially remote effector domain, where they regulate itsHK activity? The pair of aromatic residues Tyr-190 and Tyr-163surrounding ring D in the PaBphP-PCD structure adopts sidechain conformations that differ substantially from their coun-terparts in other structures (3–5). The side chain of the Tyr-190is deeply buried underneath ring D in the PaBphP-PCD struc-ture (Fig. 3A), but the side chain of the equivalent Phe-212 inRpBphP3-CBD lies on the surface of the GAF domain andshields ring D from solvent (5). In the RpBphP3-CBD structurethe side chain of Tyr-185 occupies the same cavity, and itsequivalent Tyr-163 in the PaBphP-PCD structure adopts a newside chain conformation, where its hydroxyl group interactsdirectly with the propionate group of ring C (Fig. 3A). Sequence

alignment shows that all phytochromes contain aromatic resi-dues at both positions: either Tyr or Phe at the position ofTyr-190 but only Tyr at the position of Tyr-163. Similar dis-placements of aromatic side chains around ring D have also beenobserved in the crystal structures of �-phycoerythrocyanin withits phycoviolobilin chromophore in the Z- and E- configurations(26). In Cph1, the equivalent Y176H mutant is unable toundergo photoconversion and is intensely fluorescent, with anemission maximum of approximately 650–670 nm (8). Satura-tion mutagenesis on Tyr-176 of Cph1 indicated that its hydroxylgroup is important for efficient Pr to Pfr photoconversion (27).We propose that Tyr-163 and Tyr-190 undergo concerted sidechain rotamer changes upon light-induced isomerization, tofacilitate a snug fit of ring D in its cavity and thereby stabilize the15Za or 15Ea configurations.

How could structural changes originating in isomerization ofthe BV chromophore be coupled to the HK domain? In thePaBphP-PCD structure, the C-terminal GAF-hE helix is col-linear with the N-terminal helix A in the PHY domain (PHY-hA); together they form a continuous helix of 12 turns spanningresidues 286–331 that directly connects the GAF and PHYdomains. Such long helices with �40 residues are widely foundin signaling proteins, where they connect modular domains (28).Structural perturbation, either specifically via these long ‘‘sig-naling helices’’ or more generally (29), has been proposed as ageneral mechanism by which helices can transmit a signal fromone domain to another (28). In the PaBphP-PCD structure, thelong signaling helix forms a substantial portion of the paralleldimer interface. Furthermore, the PHY-hA helix displays analternating pattern of glutamic acid and arginine residues, andoppositely charged Glu and Arg residues interact across thedimer interface (Fig. S4).

Comparison of the crystal structures of Bphs reveals tertiaryand quaternary plasticity of the helical bundles at the dimerinterface found in all structures. When the 8 monomers in theasymmetric unit of the wild-type PaBphP-PCD structure aresuperposed, significant differences in location of the GAF-hAhelix are observed between the 2 monomers in each dimer(Fig. 3B). That is, the chemically identical monomers exhibit 2distinct tertiary structures in the GAF-hA helix and form a

Fig. 3. Conformational changes in the chromophore binding pocket and structural variation of the helical bundle at the dimer interface. (A) In the chromophorebinding pocket of PaBphP-PCD, Tyr-190 and Tyr-163 (green) near ring D adopt side chain conformations distinct from the corresponding residues Phe-212 andTyr-185 (light gray) of RpBphP3-CBD in the Pr state. As ring D flips, the 2 side chains rearrange. (B) Superposition of the 8 monomers (4 shown in green, 4 in darkgray) in the asymmetric unit shows 2 distinct locations for the GAF-hA helix, resulting in 4 tertiary heterodimers. (C) Quaternary structural variation at the dimerinterface, as shown by angles between the GAF-hE helices of one monomer when dimeric structures are aligned according to the PAS and GAF domains of theother monomer. Structures compared are DrBphP-CBD (1ZTU, pink; 2O9C, gray), RpBphP3-CBD (2OOL, yellow), PaBphP-PCD-WT (3C2W, cyan), and PaBphP-PCD-Q188L (G.X. Yang, J.K., and K.M., unpublished results; blue).

14718 � www.pnas.org�cgi�doi�10.1073�pnas.0806718105 Yang et al.

structural heterodimer. A heterodimeric structure may resultfrom ‘‘induced fit’’ at the dimer interface to allow tighter dimericassociation and eliminate steric clashes. When we model the 2structural homodimers formed by each tertiary structure, theydisplay either significantly less buried surface area or severesteric clashes at the dimer interface (Fig. S1D). In addition, whendimeric Bphs structures are aligned according to the PAS andGAF domains of one monomer, there is wide variation in therelative orientation of the other monomer as shown by anglesbetween the GAF-hE helices (Fig. 3C). We propose that tertiaryand quaternary plasticity of extended helical bundles at thedimer interface plays an important role in transmitting signalsover long distances.

Using the PaBphP-PCD structure as the dimeric scaffold, wemodeled a full-length PaBphP structure on the basis ofsequence and structural alignment between the C terminus ofPaBphP-PCD and the N terminus of a homologous sensor HKstructure (30, 31). Secondary structure predictions stronglyindicate a long continuous helix in the linker region betweenthe PHY and HK domains. In our model, the PHY-hE helix isdirectly fused to and collinear with the N-terminal helix of theHK domain in which the phospho-acceptor histidine residue islocated (Fig. 4), thereby further extending the central helicalbundle at the dimer interface into the HK domain. The sidechain of the phospho-acceptor His in one monomer is orien-tated toward the ATP binding site of the kinase domain fromthe other monomer, consistent with the geometry of in transphosphorylation proposed for phytochromes (32, 33). In ad-dition, the radius of gyration (Rg �46 Å) and maximumparticle diameter (Dmax �152 Å) calculated from this model[CRYSOL (34)] is consistent with those dimensions derivedfrom the experimental SAXS data on full-length R. palustrisbacteriophytochrome RpBphP2 in the Pr state (Rg �52 Å andDmax �155 Å) that suggested a structure with strongly aniso-tropic axial dimensions (35).

We propose that signals generated by light-induced 15Za/15Ea

isomerization from the photosensory domain are transmitted tothe extended central helical bundle at the dimer interface, wherethey effect tertiary and quaternary structural changes thatposition the phospho-acceptor His in the catalytic site of the HKdomain and thus regulate phosphorylation in trans of bacterio-phytochromes.

Materials and MethodsCloning, Mutagenesis, and Purification. The full-length PaBphP gene (PaBphP-FL, residues 1–728) vector was constructed from the PCR-amplified geneproduct of P. aeruginosa strain PA01 genomic DNA (American Type CultureCollection) using primers (5�- CAGCCATATGACGAGCATCAC CCCGGTTAC and5� CATCCTCGAGTCAGGACGAGGAGCCGGTCTC [Integrated DNA Technolo-gies]), which was then ligated into expression vector pET28a (Novagen) viarestriction sites NdeI/XhoI. The photosensory core domain coding region(residues 1–497) of PaBphP (PaBphP-PCD) was PCR-amplified from the pET28avector containing the PaBphP-FL gene and inserted into the expression vectorpET24a (Novagen) using the restriction sites NdeI/XhoI. PaBphP-PCD wascoexpressed with heme oxygenase (pET11a carrying the R. palustris hmuOgene, kindly provided by Dr. Carl Bauer of Indiana University) in BL21(DE3).Se-Met proteins were prepared using the methionine synthesis inhibitionprotocol (36). The purification procedure for both wild-type and mutantsproteins was as described (5). Site-directed mutagenesis was carried out usingthe QuikChange Site-Directed Mutagenesis Kit (Stratagene).

UV-Visible Spectroscopy. UV-visible spectra of purified wild-type and mutantPaBphP-PCD proteins in solution were recorded at room temperature from900 to 230 nm with a Shimadzu UV-1650 PC spectrophotometer. Spectra wererecorded either in the dark-adapted state or after illumination with fiber opticlight at 750 nm (far red) or 690 nm (red) provided by interference filters witha 10-nm bandwidth (Andover). Visible spectra of the PaBphP-PCD crystalswere recorded at room temperature with a microspectrophotometer Xspectra(4DX-ray Systems).

Crystallization and Data Collection. Crystals of both the PaBphP-PCD singlemutant Q188L and wild type were obtained at 20°C in the dark using the hangingdrop vapor diffusion method but under very different crystallization conditions.Thewild-typecrystalswerecrystallizedwith10mg/mlprotein,0.45Mammoniumsulfate in 0.1 M Tris�HCl buffer, pH 7.7; and the Q188L crystals with 10 mg/mlprotein, 0.5% PEG4000 (wt/vol), and 0.01 M sodium acetate, pH 4.6. Microspec-troscopic experiments showed that both crystal forms are photoactive: theyundergo reversible Pr/Pfr photoconversion at room temperature and revert tothe Pfr state in the dark (data not shown). To minimize light exposure, crystalli-zationtrayswerewrappedwithAl foilandkept inthedarkduringcrystalgrowth.All observations and handling of crystals were carried out under double-filteredlight using a combination of 1 green and 1 blue broad band-pass filter to permitonly transmissionbetween450and500nm,awavelengthrange inwhichPaBphPhas minimal absorption (Fig. 2D). In solution studies we have shown that such anillumination protocol with doubled-filtered light can effectively limit light exci-tations in the PaBphP samples. Dark-adapted crystals were then cryoprotectedusing 40% glycerol in the mother liquor. Our preliminary microspectroscopicexperiments showed no detectable photoactivity at 100 K. All diffraction dataused in this study were collected at 100 K at the SBC 19-ID, SBC 19-BM, andBioCARS 14BM-C beam stations of the Advanced Photon Source, Argonne Na-tional Laboratory. All images were indexed, integrated, and scaled usingHKL2000 or HKL3000 (37).

Structure Determination. The PaBphP-PCD Q188L mutant crystals are in spacegroup P65, with 2 molecules in the asymmetric unit that are related by anear-perfect noncrystallographic 2-fold symmetry axis perpendicular to theprincipal 6-fold crystallographic axis. The crystal structure of the Q188L mu-tant was determined by the multiwavelength anomalous diffraction methodwith Solve (38) and Sharp (39) at 2.9 Å resolution and was refined withCNS/Refmac5/PHENIX (40–42) using native data at 2.75 Å resolution. Thewild-type PaBphP-PCD crystals are in space group C2221, with 8 molecules inthe asymmetric unit packed as 4 dimers. The PaBphP-PCD crystals with a typicalsize of 300 � 100 � 100 �m diffract to a maximum resolution at 2.7 Å alongthe long axis c but only to �3.3 Å along a/b axes. A partially refined Q188Lstructure was used as a search model to determine the wild-type structure bythe molecular replacement method using Phaser (43), followed by structuralrefinement at 2.9 Å resolution using PHENIX. Eight molecules in the asym-metric unit were restrained by noncrystallographic symmetry in early refine-ment cycles; and were independently refined and rebuilt at later refinementstages. Data collection, phasing, and refinement statistics are summarized in

Fig. 4. A domain architecture model of the full-length dimeric PaBphP basedon the PaBphP-PCD dimer structure and the sensor HK structure (PDB acces-sion ID 2C2A) (PAS, GAF, and PHY in green; HK in blue; BV in cyan).

Yang et al. PNAS � September 23, 2008 � vol. 105 � no. 38 � 14719

PLA

NT

BIO

LOG

Y

Table S1. Coot (44) was used for model building and structural alignment.Structures were illustrated using PyMOL (http://pymol.org).

ACKNOWLEDGMENTS. We thank Ying Pigli and Yuen-Ling Chan for helpand advice in cloning and mutagenesis; Yu-Sheng Chen and Vukica

Srajer of BioCARS for assistance in microspectroscopic experiments oncrystals; and the staff of the Structural Biology Center and BioCARS at theAdvanced Photon Source, Argonne National Laboratory, for beam lineaccess. Supported by National Institutes of Health Grant GM036452(to K.M.).

1. Rockwell NC, Su YS, Lagarias JC (2006) Phytochrome structure and signaling mecha-nisms. Annu Rev Plant Biol 57:837–858.

2. Rockwell NC, Lagarias JC (2006) The structure of phytochrome: A picture is worth athousand spectra. Plant Cell 18:4–14.

3. Wagner JR, Zhang J, Brunzelle JS, Vierstra RD, Forest KT (2007) High resolutionstructure of Deinococcus bacteriophytochrome yields new insights into phytochromearchitecture and evolution. J Biol Chem 282:12298–12309.

4. Wagner JR, Brunzelle JS, Forest KT, Vierstra RD (2005) A light-sensing knot revealed bythe structure of the chromophore-binding domain of phytochrome. Nature 438:325–331.

5. Yang X, Stojkovic EA, Kuk J, Moffat K (2007) Crystal structure of the chromophorebinding domain of an unusual bacteriophytochrome, RpBphP3, reveals residues thatmodulate photoconversion. Proc Natl Acad Sci USA 104:12571–12576.

6. Park CM, Bhoo SH, Song PS (2000) Inter-domain crosstalk in the phytochrome mole-cules. Semin Cell Dev Biol 11:449–456.

7. Wu SH, Lagarias JC (2000) Defining the bilin lyase domain: Lessons from the extendedphytochrome superfamily. Biochemistry 39:13487–13495.

8. Fischer AJ, Lagarias JC (2004) Harnessing phytochrome’s glowing potential. Proc NatlAcad Sci USA 101:17334–17339.

9. Oka Y, et al. (2004) Functional analysis of a 450-amino acid N-terminal fragment ofphytochrome B in Arabidopsis. Plant Cell 16:2104–2116.

10. van Thor JJ, Ronayne KL, Towrie M (2007) Formation of the early photoproduct lumi-Rof cyanobacterial phytochrome cph1 observed by ultrafast mid-infrared spectroscopy.J Am Chem Soc 129:126–132.

11. Schumann C, Gross R, Michael N, Lamparter T, Diller R (2007) Sub-picosecond mid-infrared spectroscopy of phytochrome Agp1 from Agrobacterium tumefaciens. Chem-physchem 8:1657–1663.

12. Mroginski MA, Murgida DH, Hildebrandt P (2007) The chromophore structural changesduring the photocycle of phytochrome: A combined resonance Raman and quantumchemical approach. Acc Chem Res 40:258–266.

13. van Thor JJ, Mackeen M, Kuprov I, Dwek RA, Wormald MR (2006) Chromophorestructure in the photocycle of the cyanobacterial phytochrome Cph1. Biophys J91:1811–1822.

14. Inomata K, et al. (2006) Assembly of synthetic locked chromophores with agrobacte-rium phytochromes Agp1 and Agp2. J Biol Chem 281:28162–28173.

15. Borucki B, et al. (2005) Light-induced proton release of phytochrome is coupled to thetransient deprotonation of the tetrapyrrole chromophore. J Biol Chem 280:34358–34364.

16. Inomata K, et al. (2005) Sterically locked synthetic bilin derivatives and phytochromeAgp1 from Agrobacterium tumefaciens form photoinsensitive Pr- and Pfr-like adducts.J Biol Chem 280:24491–24497.

17. Montgomery BL, Lagarias JC (2002) Phytochrome ancestry: Sensors of bilins and light.Trends Plants Sci 7:357–366.

18. Ponting CP, Aravind L (1997) PAS: A multifunctional domain family comes to light. CurrBiol 7:R674–R677.

19. Aravind L, Ponting CP (1997) The GAF domain: An evolutionary link between diversephototransducing proteins. Trends Biochem Sci 22:458–459.

20. Wagner JR, et al. (2008) Mutational analysis of Deinococcus radiodurans bacteriophy-tochrome reveals key amino acids necessary for the photochromicity and protonexchange cycle of phytochromes. J Biol Chem 283:12212–12226.

21. Giraud E, et al. (2005) A new type of bacteriophytochrome acts in tandem with aclassical bacteriophytochrome to control the antennae synthesis in Rhodopseudomo-nas palustris. J Biol Chem 280:32389–32397.

22. Tasler R, Moises T, Frankenberg-Dinkel N (2005) Biochemical and spectroscopic char-acterization of the bacterial phytochrome of Pseudomonas aeruginosa. FEBS J272:1927–1936.

23. Karniol B, Vierstra RD (2003) The pair of bacteriophytochromes from Agrobacteriumtumefaciens are histidine kinases with opposing photobiological properties. Proc NatlAcad Sci USA 100:2807–2812.

24. Lamparter T, Michael N, Mittmann F, Esteban B (2002) Phytochrome from Agrobacte-rium tumefaciens has unusual spectral properties and reveals an N-terminal chro-mophore attachment site. Proc Natl Acad Sci USA 99:11628–11633.

25. Giraud E, et al. (2002) Bacteriophytochrome controls photosystem synthesis in anoxy-genic bacteria. Nature 417:202–205.

26. Schmidt M, Patel A, Zhao Y, Reuter W (2007) Structural basis for the photochemistry ofalpha-phycoerythrocyanin. Biochemistry 46:416–423.

27. Fischer AJ, et al. (2005) Multiple roles of a conserved GAF domain tyrosine residue incyanobacterial and plant phytochromes. Biochemistry 44:15203–15215.

28. Anantharaman V, Balaji S, Aravind L (2006) The signaling helix: A common functionaltheme in diverse signaling proteins. Biol Direct 1:25.

29. Strickland D, Moffat K, Sosnick T (2008) Light-activated DNA binding in a designedallosteric protein. Proc Natl Acad Sci USA 105:10709–10714.

30. Marina A, Waldburger CD, Hendrickson WA (2005) Structure of the entire cytoplasmicportion of a sensor histidine-kinase protein. EMBO J 24:4247–4259.

31. Marina A, Mott C, Auyzenberg A, Hendrickson WA, Waldburger CD (2001) Structuraland mutational analysis of the PhoQ histidine kinase catalytic domain. Insight into thereaction mechanism. J Biol Chem 276:41182–41190.

32. Yang Y, Inouye M (1991) Intermolecular complementation between two defectivemutant signal transducing receptors of Escherichia coli. Proc Natl Acad Sci USA88:11057–11061.

33. Swanson RV, Bourret RB, Simon MI (1993) Intermolecular complementation of thekinase activity of CheA. Mol Microbiol 8:435–441.

34. Svergun DI, Barberato C, Koch MHJ (1995) CRYSOL—A program to evaluate X-raysolution scattering of biological macromolecules from atomic coordinates. J Mol Biol112:535–542.

35. Evans K, Grossmann JG, Fordham-Skelton AP, Papiz MZ (2006) Small-angle x-rayscattering reveals the solution structure of a bacteriophytochrome in the catalyticallyactive Pr state. J Mol Biol 364:655–666.

36. Doublie S (1997) Preparation of selenomethionyl proteins for phase determination.Methods Enzymol 276:523–530.

37. Otwinowski Z, Minor W (1997) Processing of x-ray diffraction data collected in oscil-lation mode. Methods Enzymol 276(part A):307–326.

38. Terwilliger JD (2000) A likelihood-based extended admixture model of oligogenicinheritance in ‘model-based’ and ‘model-free’ analysis. Eur J Hum Genet 8:399 –406.

39. La Fortelle Ed, Bricogne G (1997) Maximum-likelihood heavy-atom parameter refine-ment for the multiple isomorphous replacement and multiwavelength anomalousdiffraction methods. Methods Enzymol 276:472–494.

40. Brunger AT, Adams PD, Clore M, Delano WL (1998) Crystallography & NMR system: Anew software suite for macromolecular structure determination. Acta CrystallogrD(54):905–921.

41. Vagin AA, et al. (2004) REFMAC5 dictionary: Organization of prior chemical knowledgeand guidelines for its use. Acta Crystallogr D(60):2184–2195.

42. Adams PD, et al. (2002) PHENIX: Building new software for automated crystallographicstructure determination. Acta Crystallogr D Biol Crystallogr 58(part 11):1948–1954.

43. Read RJ (2001) Pushing the boundaries of molecular replacement with maximumlikelihood. Acta Crystallogr D(57):1373–1382.

44. Emsley P CK (2004) Coot: Model-building tools for molecular graphics. Acta CrystallogrD(60):2126–2132.

14720 � www.pnas.org�cgi�doi�10.1073�pnas.0806718105 Yang et al.