criticalrolefornadglycohydrolaseinregulationof ... · superscript ii reverse transcriptase by...

Critical Role for NAD Glycohydrolase in Regulation ofErythropoiesis by Hematopoietic Stem Cells throughControl of Intracellular NAD Content*

Received for publication, February 24, 2014, and in revised form, April 22, 2014 Published, JBC Papers in Press, April 23, 2014, DOI 10.1074/jbc.M114.560359

Tae-Sik Nam‡§, Kwang-Hyun Park‡§, Asif Iqbal Shawl‡§, Byung-Ju Kim‡§, Myung-Kwan Han¶, Youngho Kim�,Joel Moss**, and Uh-Hyun Kim‡§‡‡1

From the ‡Department of Biochemistry, §National Creative Research Laboratory for Ca2� Signaling Network, and ‡‡Institute ofCardiovascular Research, Chonbuk National University Medical School, Jeonju 561-182, Korea, ¶Department of Microbiology,Chonbuk National University Medical School, Jeonju 561-182, Korea, �Department of Biochemistry, School of Medicine, WonkwangUniversity, Iksan 570-749, Korea, and **Cardiovascular and Pulmonary Branch, NHLBI, National Institutes of Health,Bethesda, Maryland 20892

Background: The structure and function of NAD glycohydrolases (NADases) with pure hydrolytic activity are unclear.Results: We show that a novel NADase, exclusively expressed in rabbit reticulocytes, affects erythropoiesis.Conclusion: The intracellular NAD level regulated by the NADase is critical for erythropoiesis.Significance: We show that NADase activity regulates erythropoiesis of hematopoietic stem cells.

NAD glycohydrolases (NADases) catalyze the hydrolysis ofNAD to ADP-ribose and nicotinamide. Although many mem-bers of the NADase family, including ADP-ribosyltransferases,have been cloned and characterized, the structure and functionof NADases with pure hydrolytic activity remain to be eluci-dated. Here, we report the structural and functional character-ization of a novel NADase from rabbit reticulocytes. The novelNADase is a glycosylated, glycosylphosphatidylinositol-an-chored cell surface protein exclusively expressed in reticulo-cytes. shRNA-mediated knockdown of the NADase in bonemarrow cells resulted in a reduction of erythroid colony forma-tion and an increase in NAD level. Furthermore, treatment ofbone marrow cells with NAD, nicotinamide, or nicotinamideriboside, which induce an increase in NAD content, resulted in asignificant decrease in erythroid progenitors. These results indi-cate that the novel NADase may play a critical role in regulatingerythropoiesis of hematopoietic stem cells by modulating intra-cellular NAD.

Nicotinamide adenine dinucleotide (NAD) and NAD phos-phate (NADP) are important coenzymes in metabolic reactionsand substrates for a variety of signaling enzymes, includingNAD glycohydrolases (NADases),2 poly(ADP-ribose) poly-

merases, ADP-ribosyltransferases (ARTs), ADP-ribosyl cycla-ses, and Sirtuins. These enzymes catalyze specific reactionsusing NAD(P) as substrates. NADases catalyze the hydrolysis ofNAD to ADP-ribose (ADPR) and nicotinamide; ARTs mono-ADP-ribosylate proteins; poly(ADP-ribose) polymerases poly-(ADP-ribosyl)ate proteins; ADP-ribosyl cyclases synthesizeCa2�-signaling second messengers, cyclic ADP-ribose, and nic-otinic acid adenine dinucleotide phosphate and catalyze theirhydrolysis; and Sirtuins synthesize O-acetyl-ADPR and deacety-late protein.

An NADase with relatively pure NAD hydrolytic activityfrom Neurospora crassa has long been known (1). Anotherenzyme from the Gram-positive pathogen Streptococcus pyo-genes was reported to be an NADase with no apparent ART,ADP-ribosyl cyclase, or cyclic ADPR hydrolase activities (2).We identified and characterized a rabbit erythrocyte enzymewith pure NADase activity (3) that was anchored to the plasmamembrane via a glycosylphosphatidylinositol (GPI) linkage andcould be solubilized by incubation with Bacillus cereus phos-phatidylinositol-specific phospholipase C (PI-PLC) (4, 5).

Of the NAD-degrading enzymes, which have the potential tocontrol of NAD(P) levels, CD38, a mammalian ADP-ribosylcyclase that exhibits significant NADase activity in addition toits intrinsic ADP-ribosyl cyclase activity, has been the mostextensively studied (6). CD38 knock-out mice showed signifi-cantly higher tissue NAD levels than wild type, suggesting thatCD38 may play a role in the control of NAD(P) levels (7). Aprevious study investigated a correlation between CD38 expres-sion and erythroid differentiation in CD34� progenitor cells. TheCD34�/CD38� population included 25–30% clonogenic progen-itors with a mature erythroid phenotype, whereas the CD34�/CD38� population was mostly primitive progenitors (8), suggest-ing that CD38 might affect erythroid differentiation.

* This work was supported, in whole or in part, by the National Institutes ofHealth Intramural Research Program, NHLBI (to J. M.). This work was alsosupported by National Research Foundation Grant 2012R1A3A2026453funded by the Korean government (to U.-H. K.) and the Chonbuk NationalUniversity for the International Collaborative Research (2009) (to U.-H. K.).

The nucleotide sequence(s) reported in this paper has been submitted to the Gen-BankTM/EBI Data Bank with accession number(s) JN798515.

1 To whom correspondence should be addressed: Dept. of Biochemistry,Chonbuk National University Medical School, Keumam-dong, Jeonju, 561-182, Republic of Korea. Tel.: 82-63-270-3083; Fax: 82-63-274-9833; E-mail:[email protected].

2 The abbreviations used are: NADase, NAD glycohydrolase; GPI, glycosyl-phosphatidylinositol; ART, ADP-ribosyltransferase; ADPR, ADP-ribose; PI-PLC, phosphatidylinositol-specific phospholipase C; BFU-E, burst-formingunit-erythroid; CFU-E, colony-forming unit-erythroid; �-NAD�, 1,N6-ethe-

noadenine dinucleotide; RACE, rapid amplification of cDNA ends; PNGaseF, peptide-N-glycosidase F; SSC, saline-sodium citrate; NR, nicotinamideriboside.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 23, pp. 16362–16373, June 6, 2014Published in the U.S.A.

16362 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 23 • JUNE 6, 2014

by guest on May 2, 2020

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

In the erythroid lineage, the earliest committed progenitors,the slowly proliferating burst-forming unit-erythroid (BFU-E)cells, divide and further differentiate through the maturationstage into rapidly dividing colony-forming unit-erythroid(CFU-E). CFU-E progenitors divide and differentiate into redblood cells (9). BFU-E cells respond to many hormones andcytokines, including erythropoietin, stem cell factor, insulin-like growth factor 1, glucocorticoids, IL-3, and IL-6, whereasthe terminal proliferation and differentiation of CFU-E progen-itors are stimulated by erythropoietin, which is induced underhypoxic conditions (10). However, additional regulatory factorsfor proliferation and differentiation of these progenitor cells arebeing investigated.

In the present study, we report for the first time a novelenzyme from eukaryotes with pure NADase activity (desig-nated as “NADase” here). We characterized this enzyme on amolecular level, especially in comparison with rabbit skeletalmuscle ART, which exhibits the most similar primary structurebut has different enzymatic activity. The rabbit enzyme showeda restricted pattern of tissue expression limited to erythroid.We also found that the novel NADase plays a critical role inregulating erythropoiesis of hematopoietic stem cells by mod-ulating intracellular NAD content.

EXPERIMENTAL PROCEDURES

Materials—Erythrocytes were obtained from New ZealandWhite rabbits (3 months old). PI-PLC from Bacillus cereus waspurified as described (4). Nicotinamide 1,N6-ethenoadeninedinucleotide (�-NAD�), Cibacron Blue 3GA, and SephacrylS-200HR were purchased from Sigma-Aldrich. Octyl-Sephar-ose CL-4B was from GE Healthcare. Total RNA preparationkits (easy-Blue and easy-spin Total RNA Extraction kit) werefrom iNtRON Biotechnology (Seongnam, Korea). Super-ScriptTM II reverse transcriptase was from Invitrogen. Cap-FishingTM Full-length cDNA Premix kit was from Seegene(Seoul, Korea). [�-32P]dCTP (3,000 Ci/mmol) and �-[ade-nine-2,8-3H]NAD (28.6 Ci/mmol) were from PerkinElmer

Life Sciences. The Prime-a-Gene Labeling System was fromPromega (Madison, WI).

Purification of NADase—NADase was purified from rabbiterythrocytes as described (3). One liter of packed rabbit eryth-rocytes was washed three times with ice-cold PBS and incu-

FIGURE 1. Expression and purification of NADase in rabbit erythrocytes.A, purification of NADase from rabbit erythrocytes. Visualization of NADasewith an in-gel assay (lane 1), Coomassie Blue staining (lane 2), and silver stain-ing (lane 3) is shown. The gel was washed with 0.1% Triton X-100 and incu-bated with 150 �M �-NAD� as described under “Experimental Procedures.”Fluorescence of NADase in lane 1 was visualized under UV light (254 nm).Purification was repeated five times. B, Northern blot analysis of NADaseusing rabbit tissues. Each lane contains 20 �g of total RNA from rabbit tissues.Positions of RNA standards (kilobases (kb)) are indicated (n � 3). C, RT-PCRanalysis of NADase in rabbit tissues. Total RNA was isolated from various rab-bit tissues. Lane 1, reticulocytes; lane 2, skeletal muscle; lane 3, heart; lane 4,brain; lane 5, kidney; lane 6, spleen; lane 7, liver; lane 8, lung; lane 9, testis; lane10, intestine. AA, amino acids. D, Western blot analysis of NADase in rabbitblood cells. Western blot analysis was performed using an anti-NADase anti-body. E, NADase is a glycosylated protein. Western blot analysis was per-formed using an anti-NADase antibody. Samples were treated with (�) orwithout (�) PNGase F as described under “Experimental Procedures.”

TABLE 1Summary of purification of NAD glycohydrolase from rabbit erythrocytesNAD glycohydrolase activity of each fraction was determined by measuring the formation of the fluorescent product �-ADPR from the substrate �-NAD�.

Purification step Protein Total activity Specific activity -Fold Yield

mg �mol�min�1 �mol�min�1�mg�1 %PI-PLC extracts 1,230.0 1,130.0 0.9 1 100Cibacron Blue 3GA 22.0 812.0 48.5 53 72Octyl-Sepharose CL-4B 1.1 76.4 69.5 76 6.8Sephacryl S-200HR 0.8 59.6 74.5 81 5.3

TABLE 2Oligonucleotides used in the analysis of NADaseOligonucleotides are listed from 5� to 3�. H stands for A, T, and C; R stands for A andG; Y stands for C and T; N stands for A, T, G, and C; and D stands for G, A, and T.

Name Sequence (5�–3�) Amino acids

For partial PCR productrbNA-5� ATHCARGAYGCNCARCTNGAYAT 20–26rbAR-3� TCRAANGGNGGDATNAGNACYTC 227–220rbAR-r GATGACCTGGAAGGTCTC 232–227

For 5�-, 3�-RACE PCRNA-m1-f TGGAGGCAAGACAGAAGTGGCA 66–73NA-m1-r TGCCACTTCTGTCTTGCCTCCA 73–66NA-m2-f CCCCACAAGGCTGCCCCCCT 80–86NA-m2-r AGGGGGGCAGCCTTGTGGGG 86–80

Role for NAD Glycohydrolase in Erythropoiesis

JUNE 6, 2014 • VOLUME 289 • NUMBER 23 JOURNAL OF BIOLOGICAL CHEMISTRY 16363


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

bated for 1 h with shaking with bacterial PI-PLC (1 �g/ml) inPBS. After incubation, the supernatant was collected by cen-trifugation (1,000 � g) at 4 °C and applied to a Cibacron Blue3GA column (5 � 30 cm), which had been equilibrated withbuffer A (10 mM potassium phosphate, pH 6.8, 50 mM NaCl,0.1 mM PMSF). The column was washed and eluted with alinear gradient of buffer B (2 M NaCl in buffer A). Fractionscontaining NADase activity were applied to an octyl-Sephar-ose CL4B column (3 � 30 cm) equilibrated with buffer Bfollowed by washing with buffer B and elution with a lineargradient of buffer C (30% ethylene glycol in buffer A). Theeluted fractions were concentrated to 1 ml (CentriprepYM-10). The resulting solution was loaded on a SephacrylS-200HR gel filtration column (1.5 � 120 cm), which wasequilibrated and eluted with buffer A. High activity fractions

were subjected to SDS-PAGE. A summary of the purificationis given in Table 1.

In-gel Activity Measurement of NADase—Purified NADasewas separated by non-reducing SDS-PAGE (12% gel), and theactivity of NADase in the gel was measured with 150 �M

�-NAD� as described previously (11). The apparent molecularmass of a protein corresponding to a fluorescent band was esti-mated by marking the band with a needle and, after staining thegel with Coomassie Brilliant Blue, comparing its position withthose of marker proteins.

Mass Spectrometry—Quadrupole TOF analysis of trypsin-di-gested peptide fragments of purified proteins was performed byPROTEINWORKS Inc. (Daejeon, Korea).

5�- and 3�-Rapid Amplification of cDNA Ends (RACE)—Thefirst cDNA strand was synthesized from 2 �g of total RNA using

FIGURE 2. Nucleotide and deduced amino acid sequences of NADase. Nucleotide and amino acid sequences are numbered relative to the initiatingmethionine codon and the initiating methionine, respectively. Sequences found in tryptic peptides are underlined. Two in-frame stop codons upstream fromthe initiator codon are double underlined, and potential N-glycosylation sites are marked below the amino acids (✶).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

SuperScript II reverse transcriptase by following the manualfrom the CapFishing cDNA isolation kit. PCR was performedusing i-StarTaq DNA polymerase (iNtRON Biotechnology)with 5�- or 3�-RACE primers and gene-specific RACE primers.Full-length cDNA was generated by two-step PCR followingthe manufacturer’s protocol.

RT-PCR—Total RNA was isolated from rabbit reticulocytesand reverse transcribed into cDNA with oligo(dT)12–18 andamplified using primers to generate a partial PCR product(Table 2). Forty cycles of amplification were carried out as fol-lows: 1 min at 94 °C, 1 min at 62 °C, and 1 min at 72 °C followedby 10-min elongation at 72 °C. The amplified products wereseparated on 1.5% agarose gels, blotted, and hybridized with32P-labeled specific probes; bound radioactivity was quantifiedby autoradiography.

Glycosylation Assay—Purified rabbit erythrocyte NADasewas denatured and treated with peptide-N-glycosidase F(PNGase F) (New England Biolabs) according to the manufa-cturer’s instructions before Western blot analysis.

Cell Culture—HEK293 cells were cultured in Dulbecco’smodified Eagle’s medium (DMEM) supplemented with 10%fetal bovine serum (FBS), 100 units/ml penicillin, and 100�g/ml streptomycin.

Preparation of the Antibody—Antibodies against purifiedNADase were raised in mice.

Treatment of NADase-transfected Cells with PI-PLC—For PI-PLC treatment, HEK293 cells transfected with NADase wereincubated either in the absence or presence of 1 �g/ml PI-PLC

at 37 °C for 1 h in 7 ml of HEPES buffer (156 mM NaCl, 3 mM

KCl, 2 mM MgSO4, 1.25 mM KH2PO4, 10 mM D-glucose, 2 mM

CaCl2, 10 mM HEPES, pH 7.4). The incubation medium wasthen collected and concentrated 10-fold using an Amicon Ultracentrifugal filter (3-kDa cutoff).

Confocal Microscopy—Green fluorescent protein (GFP)-NADase-transfected HEK293 cells were visualized using a con-focal microscope (Carl Zeiss LSM 510 Meta). The respectiveexcitation and emission wavelengths were 488 and 505–530 nmfor GFP.

Western Blot Analysis—Lysed cells and purified sampleswere reduced and separated by SDS-PAGE (12% gel). Theresolved proteins were transferred to a nitrocellulose mem-brane (Bio-Rad). The blots were blocked with 5% skim milkpowder dissolved in TTBS (20 mM Tris-HCl, pH 7.6, 137 mM

NaCl with 0.1% Tween 20). The blot was incubated with theprimary antibody (mouse anti-rabbit NADase antiserum,1:2,000 dilution; rabbit anti-FLAG polyclonal antibody (Sigma),1:2,000 dilution) for 2 h at room temperature. The blot waswashed five times with TTBS and then incubated with the sec-ondary antibody (anti-mouse IgG conjugated to horseradishperoxidase, 1:5,000 dilution; anti-rabbit conjugated to horse-radish peroxidase (Santa Cruz Biotechnology), 1:2,000 dilution)for 2 h at room temperature. The blots were developed using anenhanced chemiluminescence kit (Amersham Biosciences) andexposed to an LAS 1000 Image Reader Lite (Fujifilm, Tokyo,Japan). Protein concentrations were determined using a Bio-

FIGURE 3. Genomic structure of rabbit NADase. A, nucleotide sequence of the rabbit NADase gene (GenBankTM accession number NW_003159229). Thenucleotide sequence is shown as capital letters in exon and bp numbers in introns. B, genomic structures of rabbit ART1, ART1-like, and NADase. The exons aredepicted as boxes with filled and open boxes representing translated regions and untranslated regions, respectively. Gray boxes represent GPI anchor sites. Thenumbers indicate chromosome 1 genomic nucleotide sequence position. The arrows indicate the direction from 5�-flanking region to 3�-flanking region.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Rad protein assay kit with bovine serum albumin (BSA) as thestandard.

Plasmids and Transfection—Wild-type NADase cDNA wascloned from rabbit reticulocyte cDNA, and ART active sitemutant NADases Q218E, Q218A, and Q218D (NADase Q218E,NADase Q218A, and NADase Q218D) were synthesized byreplacing glutamine with glutamate, alanine and aspartate,respectively. Rabbit ART (ART) was cloned from rabbit skeletalmuscle cDNA. NADase, NADase Q218E, NADase Q218A,NADase Q218D, and ART were amplified by PCR using EcoRI-NAex forward (5�-CGGAATTCCATGTGGGTTCCTGCCG-TGGCG-3�) and SalI-NAex reverse (5�-ACGCGTCGACGA-AGAGGCCTGGGCTTCCTGGGA-3�) primers. The italicizednucleotides are restriction enzyme sequences. The PCR prod-ucts were gel-purified and digested with restriction enzymes,and the resulting 891-bp fragment (NADase and NADaseQ218E, NADase Q218A, and NADase Q218D) and 981-bpfragment (ART) were ligated into a pFLAG-CMV2 expressionvector. NADase was ligated into a pEGFP-C1 expression vectorfor GFP-NAD fusion protein expression. HEK293 cells weretransfected with the plasmids using Lipofectamine 2000 trans-fection reagent (Invitrogen) according to the manufacturer’sinstructions. Cells were used 24 h post-transfection. ForNADase and ART assays, transfected cells were resuspended in1 ml of ice-cold lysis buffer (50 mM potassium phosphate, pH7.2, 150 mM NaCl, 1 mM PMSF, 1% Nonidet P-40) and solubi-lized at 4 °C overnight.

Site-directed Mutagenesis—Site-directed mutagenesis wasperformed according to methods reported previously (12–14).Site-directed mutagenesis of NADase was performed using aMuta-DirectTM site-directed mutagenesis kit (iNtRON Bio-technology). The following oligonucleotides were used for themutagenesis of NADase: 5�-GTCTTCCCTGGGGAGGCAG-AGGTGCTGATC-3� (Q218E), and 5�-GTCTTCCCTGGGG-ATGCAGAGGTGCTGATC-3� (Q218D), 5�-GTCTTCCCT-GGGGCGGCAGAGGTGCTGATC-3� (Q218A) where theunderlined nucleotide(s) was altered. Mutant clones wereselected by sequencing. A pFLAG-CMV2 vector carrying eitherthe wild-type or mutant NADase cDNA was expressed inHEK293 cells.

Northern Blot Analysis—Total RNA was isolated from rabbittissues. For Northern blot analysis, 20 �g of total RNA wassubjected to electrophoresis in a denaturing 1.2% agarose gelcontaining formaldehyde and ethidium bromide and thentransferred to Hybond-N membranes (GE Healthcare). Mem-branes were prehybridized at 42 °C for 1–2 h in hybridizationbuffer (50% formamide, 5� saline/sodium phosphate/EDTA,5� Denhardt’s solution, 0.1% SDS, 100 �g/ml denaturedsalmon sperm DNA) and then hybridized overnight to theprobe labeled with [�-32P]dCTP in a hybridization buffer. Themembranes were washed twice at room temperature for 10 minin 2� SSC, 0.1% SDS; twice at room temperature for 15 min in1� SSC, 0.1% SDS; and twice at 65 °C for 15 min in 0.1� SSC,0.1% SDS. After air drying, membranes were evaluated by imageanalysis using a BAS 2000 system (Fujifilm).

NADase and ART Assays—NADase activity was determinedby measuring etheno-ADPR formation fluorometrically using�-NAD� as a substrate (15, 16). Samples (20 �g) were incubated

in the presence of 200 �M �-NAD� with or without an appro-priate protein in an assay buffer (50 mM potassium phosphate,pH 7.2, 150 mM NaCl, 0.1% Nonidet P-40; final volume of 50 �l).The reaction mixture was incubated at 37 °C for 20 min. Thereaction was stopped by adding 50 �l of trichloroacetic acid(10%). The samples were centrifuged at 15,000 � g for 10 min,and the supernatant (80 �l) was diluted with 720 �l of 100 mM

sodium phosphate buffer, pH 7.2. Fluorescence of etheno-ADPR in solution was determined at excitation/emission wave-lengths of 297/410 nm (Hitachi F-2500 fluorescence spectro-photometer). Assays were repeated five times.

ART activity was assayed in 300 �l of 50 mM potassium phos-phate, pH 7.5 with 20 mM agmatine and 0.1 mM �-[adenine-2,8-3H]NAD (0.2 �Ci). The reaction was initiated with enzyme (20�g); after incubation at 30 °C for 1 h, samples (100 �l) wereapplied to a 2-ml column of Dowex AG 1-X2. [3H]ADP-ribo-sylagmatine was eluted with 5 ml of H2O (17, 18). 1 ml of elutionsample was mixed with 2 ml of liquid scintillation counter mix-ture for liquid scintillation counting. Assays were repeatedthree times.

FIGURE 4. NADase exists as a GPI-anchored species on the plasma mem-brane of HEK293 cells. A, confocal fluorescence images of HEK293 cellsexpressing GFP-NADase. NADase expression was detected by GFP fluores-cence. DIC, differential interference contrast. B, FLAG-NADase-expressingHEK293 cells were treated with (�) or without (�) PI-PLC, and solubilizedNADase was determined in the supernatant by Western blot analysis. C,FLAG-vector- or FLAG-NADase-expressing HEK293 cells were treated with (�)or without (�) PI-PLC, and NADase activity was measured in the supernatant.*, p � 0.001, non-PI-PLC-treated NADase versus 1 �g/ml PI-PLC-treatedNADase. The means � S.E. (error bars) of three independent experiments areshown.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Preparation of shRNA-expressing Lentivirus—Experimentsinvolving shRNA-expressing lentivirus were performedaccording to the method of Han et al. (19) with some modifica-tions. Oligonucleotides (NA42 shRNA, 5�-GGGCCTTCTGG-AAGCAATTCACTCGAGTGAATTGCTTCCAGAAGGCC-CTTTTT-3�; NA145 shRNA, 5�-AATCTCAACCTCACAGA-GTTCCTCGAGGAACTCTGTGAGGTTGAGATTTTTTT-3�; NA751 shRNA, 5�-AAGCACAGTTCATACAACTGCC-TCGAGGCAGTTGTATGAACTGTGCTTTTTTT-3� forrabbit NADase and 5�-GGACAGGTATCGGGGTTACTCCT-CGAGGAGTAACCCCGATACCTGTCCTTTTT-3� for ascrambled sequence) containing the sense, loop, and antisensesequences and a polythymidine tract were annealed and ligatedinto pLK0.1 downstream of the U6 promoter. To produceshRNA-expressing lentiviral particles, HEK293-FT cells weretransfected with 9 �g of Virapower packaging mixture (Invit-rogen) and 3 �g of pLK0.1-NADase shRNAs or pLK0.1-scram-bled shRNA with Lipofectamine 2000 (Invitrogen).

Purification and Lentiviral Transduction of Bone Marrow—Purification of bone marrow cells was performed according tothe method of Lutton et al. (20). Adult New Zealand Whiterabbits were used as bone marrow donors. Rabbits were sacri-ficed by anesthesia. Bone marrow cells were harvested fromfemora and tibiae. Bone marrow was flushed with Iscove’s mod-ified Dulbecco’s medium. Bone marrow cells were washed threetimes with ice-cold PBS, and red blood cells (RBCs) wereremoved by RBC lysis buffer. After removing adherent cells, thecells were prestimulated in Iscove’s modified Dulbecco’smedium containing 10% FBS and the following growth factors:mouse stem cell factor, human thrombopoietin, and humanFlt3 ligand (R&D System) at 10 ng/ml each for 24 h. The pre-stimulated bone marrow cells were infected with scrambled or

NADase shRNA-expressing lentivirus in the presence of Poly-brene (8 �g/ml) and selected with puromycin at 5.0 �g/ml for 3days.

Quantification of Erythropoiesis—The cells transduced withshRNAs expressing lentivirus were plated in triplicate at a den-sity of 2 � 105 cells/plate in MethoCult M3334 (StemCell Tech-nologies) to quantify the formation of CFU-E and matureBFU-E following the manufacturer’s instructions. Colonieswere scored after 7–10 days.

Measurement of Intracellular NAD Concentration ([NAD]i)and ADPR Concentration ([ADPR]i)—Cells were sonicatedwith 0.2 ml of 0.6 M perchloric acid. Precipitates were removedby centrifugation at 20,000 � g for 10 min at 4 °C, and perchlo-ric acid was neutralized with 60 �l of 2 M KHCO3 (21). Aftercentrifugation at 16,000 � g for 10 min at 4 °C, the precipitateswere removed. The [NAD]i was measured using a cyclicenzyme assay as described previously (22). Briefly, the superna-tants (100 �l/tube) were further incubated with 100 �l of acycling reagent solution (2% ethanol, 100 �g/ml alcohol dehy-drogenase, 20 �M resazurin, 10 �g/ml diaphorase, 10 �M ribo-flavin 5�-phosphate, 10 mM nicotinamide, 0.1 mg/ml BSA, 100mM sodium phosphate, pH 8.0) at room temperature for 2 h. Anincrease in the resorufin fluorescence was measured at 544-nmexcitation and 590-nm emission using a fluorescence platereader (Spectra-Max GEMINI, Molecular Devices). Variousknown concentrations of NAD were also included in the cyclingreaction to generate a standard curve. The [ADPR]i was mea-sured using LC-MS/MS as described (23). Briefly, to determinethe [ADPR]i, the supernatants were loaded onto a WatersACQUITY UPLC system coupled to a Waters Xevo TQ-S massspectrometer and separated by a BEH Amide column (WatersACQUITY UPLC BEH Amide, 130 Å, 1.7 �m, 2.1 � 50 mm).

TABLE 3Amino acid sequence identity between NADase and ART family membersThe extent of identity (colored boxes) and similarity (white boxes) was calculated with BLASTp and ClustalW. m, mouse; r, rat; h, human; rb, rabbit. The followingreferences were used: Refs. 5, 25, 28, and 32–34.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

All chromatographic separations were performed using eachmobile phase combination at a flow rate of 0.5 ml/min. Thecolumn was equilibrated with 100% buffer B (90% acetonitrile,10% 50 mM ammonium formate) and eluted in a 5-min gradientto 60% buffer A (10 mM ammonium formate in water). Thecolumn was then rinsed with 100% buffer A and re-equilibratedwith buffer B before the next injection. The following parame-ters were optimized for ADPR MS analysis: cone gas, 150liters/h; nebulizer, 7 bars; and desolvation temperature, 350 °C.The confirmation ion transitions for quantification were m/z558.173 346.01 for ADPR.

Statistical Analysis—Data represent the means � S.E. of atleast three separate experiments. Statistical analysis was per-

formed using Student’s t test. A value of p � 0.05 was consid-ered significant.

RESULTS AND DISCUSSION

Purification and Characterization of NADase—The purifica-tion procedure was essentially the same as described in ourprevious report, beginning with the PI-PLC-cleaved enzymeobtained from intact rabbit erythrocytes (4). The NADasewas purified 81-fold with respect to the PI-PLC-treatedsupernatant (Table 1). The purified enzyme gave a singleprotein band with an apparent molecular mass of 40 kDa byelectrophoresis in 12% SDS-polyacrylamide gels (Fig. 1A).Tryptic digestion and amino acid sequencing of the tryptic

FIGURE 5. Alignment of ART deduced amino acid sequence (Clustal program) of NADase. Identical, strongly conserved, and weakly conserved amino acidsare indicated by asterisks, colons, and dots, respectively, based on the methods of Higgins and Sharp (35) as utilized by the Clustal program. Dashes indicategaps to maximize alignment. Nucleophilic arginine or histidine (R-H) and acidic amino acid regions, believed to be involved in the formation of the active site,are boxed (25). RbART1, rabbit skeletal muscle ART; mART1, mouse ART1; mART2a, mouse ART2a; mART2b, mouse ART2b; mRt6-1, mouse Rt6-1; mRt6-2, mouseRt6-2; rART1, rat ART1; rART2a, rat ART2a; rART2b, rat ART2b; rRt6-1, rat Rt6-1; rRt6-2, rat Rt6-2.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

peptides were performed using the activity fractions of Sep-hacryl S-200HR.

Cloning of NADase—The amino acid sequence of one of thetryptic peptides (amino acids 20 – 40) was used to synthesizetwo sets of degenerate oligonucleotides, which were used asprimers in PCR amplification, following rabbit reticulocytefirst-strand cDNA synthesis. Significant amounts of PCR prod-ucts were obtained with primers (rbNA-5�, rbAR-3�, and rbAR-r). On the basis of the partial cDNA sequence, oligonucleotideprimers for 5�- and 3�-RACE PCR were designed. The cDNAobtained by RACE-PCR was 1,491 bp in length, encoding a 293amino acid-long polypeptide with a calculated molecular massof 32,769 Da (Fig. 2). The deduced amino acid sequence of thisprotein includes the sequences of all four tryptic peptides fromthe NADase protein. The NADase gene is located downstreamof ART1 and ART1-like gene in chromosome 1 (Fig. 3). Toconfirm the tissue distribution of NADase, which was red bloodcell-specific in the Western blot, we performed Northern blotand RT-PCR analyses with total RNA isolated from various rab-bit tissues. The Northern blot analysis showed a 3.6 kb mRNAfor the NADase (Fig. 1B), and the NADase-specific bandappeared only in reticulocytes in both Northern blot and RT-PCR analyses (Fig. 1, B and C). To further examine whetherother blood cells also express NADase, we performed Westernblot analysis with various types of rabbit blood cells. NADasewas expressed in red blood cells but not expressed in lympho-cytes, platelets, and neutrophils (Fig. 1D).

Structural Characterization—To examine whether theNADase is glycosylated, we performed Western blot analysis ofpurified NADase treated with or without PNGase F. PNGaseF-treated NADase showed a molecular weight of 33 kDa com-pared with 40 kDa for untreated NADase (Fig. 1E), indicatingthat the NADase is an N-glycosylated protein. Consistent withthe findings that the NADase is modified by PNGase F-sensitiveN-glycosylation (Fig. 1E) and that GPI-linked proteins are oftenheavily glycosylated (24, 25), three potential sites for N-linkedglycosylation were found in the deduced amino acid sequence:Asn51, Asn211, and Asn233 (Fig. 2). The hydrophilicity plotshowed hydrophobic N and C termini with a hydrophilic center(data not shown). The hydrophobic N-terminal region wasreported to serve as a leader sequence, and the hydrophobicsequence near the C terminus was reported to serve as a recog-nition signal for GPI modification in the endoplasmic reticu-lum (26, 27). To determine localization of NADase on theplasma membrane, we performed immunocytochemical analy-sis in conjunction with confocal microscopy. GFP-NADase wasexclusively localized on the plasma membrane in HEK293cells (Fig. 4A). To confirm that NADase exists as a GPI-anchored form on the plasma membrane, HEK293 cellstransfected with FLAG-NADase were incubated with bacte-rial PI-PLC. Western blot analysis and an NADase activityassay showed release of NADase into the medium by PI-PLCtreatment (Fig. 4, B and C), indicating that the NADase is aGPI-anchored protein.

Catalytic Glutamine of NADase Is a Crucial Residue forNADase Activity—A homology search of the deduced aminoacid sequence of NADase was performed at the National Cen-ter for Biotechnology Information by using BLAST (databases,

April 2013) (Table 3). The highest homology score wasobtained for rabbit ART1 protein, which is expressed in skeletaland cardiac muscle (28). In comparison with ART1, the aminoacid sequence in the vicinity of the catalytic glutamate residuewas notably different in NADase (Fig. 5). Typical ART enzymes,including ART1, have an EEE motif, whereas NADase has218QAE220, and ART enzymes possessing NADase activity con-

FIGURE 6. NADase and ART activities of wild-type and mutant NADasesand ART1. HEK293 cells transfected with plasmids (vector, NADase, NADaseQ218E, NADase Q218A, NADase Q218D, and ART1) were lysed and assayedfor NADase and ART activities. Activity was determined as described under“Experimental Procedure.” A, Western blot analysis of proteins from cellsoverexpressing NADase and mutant NADases. Western blot analysis was per-formed using anti-FLAG antibody for comparison of NADase expression lev-els among HEK293 cells transfected with NADase and mutant NADase genes.B, NADase activity of HEK293 cells transfected with indicated plasmids. *, p �0.001, vector versus NADase; **, p � 0.001, NADase versus mutant NADases orART. C, ART activity of HEK293 cells transfected with indicated plasmids. #, p �0.001, vector or NADase versus ART1 or NADase Q218E; ##, p � 0.001, ART1versus NADase Q218A or NADase Q218D. The means � S.E. (error bars) ofthree independent experiments are shown.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

tain a QEE motif. This finding suggests that the NADase mayfunction as a NADase but not as an ART as it is enzymaticallymore similar to rat RT6 rather than to mouse Rt6 (13, 24, 25,29). To test this hypothesis, we used site-directed mutagenesiswith subsequent synthesis of recombinant NADase and ART1proteins in HEK293 cells (Fig. 6A). A recombinant protein fromthe full-length NADase cDNA showed NADase activity withvery low ART activity, whereas recombinant ART1 exhibitedART activity only (Fig. 6, B and C). Replacement of glutaminewith glutamate at position 218 (Q218E) of the recombinantNADase resulted in a loss of NADase activity and an increase ofART activity, similar to the recombinant ART (Fig. 6, B and C).We also examined enzyme activity after replacing glutamine atposition 218 with other amino acids. Replacement of glutaminewith aspartate at position 218 (Q218D) resulted in a loss ofNADase activity, similar to Q218E, but the ART activity was notsignificantly increased. Replacement of glutamine with alanine(Q218A) resulted in loss of both NADase and ART activities

(Fig. 6, B and C). Taken together, these findings indicate thatglutamine 218 is a crucial determinant of NADase and ARTactivities.

NADase Is Involved in Erythropoiesis in Bone Marrow Cells—Because NADase is exclusively expressed in erythrocytes, wespeculated that NADase may play a role in erythroid differen-tiation of bone marrow cells. We quantified colony formation(CFU-E and BFU-E). For lentivirus transduction, we first pre-stimulated bone marrow cells with stem cell factor, thrombo-poietin, and Flt3 ligand and then infected them with scrambledor NADase shRNA-expressing lentivirus. NADase was signifi-cantly reduced in bone marrow cells treated with NADaseshRNAs compared with those treated with scrambled shRNA(Fig. 7A). CFU-E formation was significantly reduced inNADase knockdown cells compared with those with scrambledshRNA lentivirus (Fig. 7, B and C), suggesting that NADase isinvolved in erythropoiesis of bone marrow cells. Mature BFU-Eformation was not observed in bone marrow cells treated with

FIGURE 7. Role of rabbit NADase in erythroid differentiation of bone marrow cells. Rabbit (Rb) bone marrow cells were infected with scrambled or NADaseshRNA-expressing lentivirus and selected with puromycin. A, Western blot analysis of NADase in lentivirus-infected bone marrow cells (scrambled or NADaseshRNAs). B, in vitro methylcellulose colony formation of CFU-E and BFU-E. Methylcellulose cultures for erythroid colonies of bone marrow cells were infectedwith scrambled or NADase shRNA-expressing lentivirus for 10 days. Colonies were examined under a Zeiss microscope (Axiovert 40 CFL, Carl Zeiss). C, CFU-Eand mature BFU-E were scored in scrambled or NADase shRNA-expressing lentivirus-infected bone marrow cells for 10 days. Mean values of three independentexperiments �S.D. (error bars) are shown. ND, not detected. *, p � 0.005, scrambled shRNA CFU-E versus NADase shRNA CFU-E. D, intracellular NAD concen-tration in scrambled shRNA- or NADase shRNA-expressing lentivirus-infected bone marrow cells. $, p � 0.005, scrambled shRNA versus NADase shRNAs. E,intracellular ADPR concentration in scrambled shRNA- or NADase shRNA-expressing lentivirus-infected bone marrow cells. #, p � 0.01, scrambled shRNA versusNADase shRNAs.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

NADase shRNAs probably due to the effect of puromycin in theprocess of selection (Fig. 7C).

To investigate further the mechanism by which NADaseaffects erythropoiesis and a possible role of the metabolites gen-erated by the NADase, we examined concentrations of sub-strate, NAD, and a product, ADP-ribose, in control cells or cellsin which the NADase had been suppressed. Bone marrow cellswith NADase reduced by shRNA treatment showed a signifi-cant increase in NAD content and a decrease in ADPR contentcompared with control cells (Fig. 7, D and E). We reasoned thatan increased NAD level might affect erythropoiesis of bonemarrow cells. Therefore, we examined whether erythropoiesisis affected in the bone marrow cells with increased NAD levelby supplementation with an NAD precursor, nicotinamideriboside (NR) (30, 31). NR-treated cells showed a significantdecrease in CFU-E formation and BFU-E formation (Fig. 8A).The NR-treated cells showed an increase in intracellular NADbut not in ADPR level compared with control cells (Fig. 8, B and

C). These results indicate that the NAD level affects erythropoi-esis of bone marrow cells. To further corroborate these find-ings, we examined the effects of extracellular NAD, ADPR, andnicotinamide on erythropoiesis of bone marrow cells. Treat-ment of bone marrow cells with NAD or nicotinamide, whichresulted in an increase in intracellular NAD level, significantlydecreased CFU-E and BFU-E formation, whereas ADPR-treated cells showed no difference from control vehicle-treatedcells (Fig. 9). These results confirm that the NAD level regulateserythropoiesis of bone marrow cells. A previous report onhematopoietic progenitor cell content of mouse bone marrowcells showed that CFU-E formation and mature BFU-E forma-tion of CD34�/CD38� cells were significantly decreased com-pared with those of CD34�/CD38� cells (8), suggesting thatanother NADase family, CD38, also plays a role in erythropoi-esis. Given that CD38 is also an NAD-degrading enzyme, theexpression of the enzyme in bone marrow cells may regulateerythropoiesis in hematopoietic stem cells by modulating theNAD level, similar to the rabbit NADase. Therefore, to confirmwhether a decrease in erythropoiesis in the bone marrow cellsfrom CD38-deficient mice was due to an increase in NAD level,

FIGURE 8. Effect of NR on erythroid differentiation of bone marrow cells.A, rabbit bone marrow cells were treated with 0.5 mM NR. CFU-E formationand mature BFU-E formation were scored at day 10 of culture with NR. Meanvalues of three independent experiments �S.D. (error bars) are shown. *, p �0.01, vehicle (Veh) versus NR. B, rabbit bone marrow cells were treated with 0.5mM NR for 24 h, and intracellular NAD concentration was measured. $, p �0.05, vehicle versus NR. C, intracellular ADPR concentration in NR-treatedbone marrow cells.

FIGURE 9. Effect of NAD, ADP-ribose, and nicotinamide on erythroid dif-ferentiation of bone marrow cells. A, rabbit bone marrow cells were treatedwith 200 �M NAD, ADP-ribose, or nicotinamide, and CFU-E formation andmature BFU-E formation were scored at day 10 of culture with NAD, ADP-ribose, or nicotinamide. Mean values of three independent experiments�S.D. (error bars) are shown. *, p � 0.05, vehicle (Veh) versus NAD or nicotin-amide. B, intracellular NAD concentration in rabbit bone marrow cells treatedwith NAD, ADP-ribose, or nicotinamide. **, p � 0.0005, vehicle versus NAD ornicotinamide.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

we examined erythropoiesis and NAD levels of bone marrowcells prepared from CD38 wild-type (WT) and knock-out (KO)mice. As expected, bone marrow cells from CD38 KO miceshowed a significant increase in NAD level and a decrease inerythropoiesis compared with those of CD38 WT mice (Fig.10). These findings further support the hypothesis that theNAD level affects erythropoiesis in hematopoietic stem cells.

In conclusion, we have cloned and characterized a novelNADase specifically expressed in rabbit reticulocytes. Thisnovel NADase showed only NADase activity but not ART activ-ity. Although homologs of this enzyme were not found in otherspecies, this enzyme shows unique characteristics in enzymaticfunction as well as in exclusive expression in erythrocytes, con-sistent with its role in regulating erythropoiesis.

REFERENCES1. Cho, Y.-S., Han, M.-K., Kwark, O.-S., Phoe, M. S., Cha, Y.-S., An, N.-H.,

and Kim, U.-H. (1998) Auto-ADP-ribosylation of NAD glycohydrolase

from Neurospora crassa. Comp. Biochem. Physiol. B Biochem. Mol. Biol.120, 175–181

2. Ghosh, J., Anderson, P. J., Chandrasekaran, S., and Caparon, M. G. (2010)Characterization of Streptococcus pyogenes �-NAD� Glycohydrolase.J. Biol. Chem. 285, 5683–5694

3. Kim, U.-H., Kim, M.-K., Kim, J.-S., Han, M.-K., Park, B.-H., and Kim, H.-R.(1993) Purification and characterization of NAD glycohydrolase from rab-bit erythrocytes. Arch. Biochem. Biophys. 305, 147–152

4. Kim, U.-H., Rockwood, S. F., Kim H. R., and Daynes, R. A. (1988) Mem-brane-associated NAD� glycohydrolase from rabbit erythrocytes is solu-bilized by phosphatidylinositol-specific phospholipase C. Biochim. Bio-phys. Acta 965, 76 – 81

5. Okazaki, I. J., Kim, H.-J., McElvaney, N. G., Lesma, E., and Moss, J. (1996)Molecular Characterization of a glycosylphosphatidylinositol-linkedADP-ribosyltransferase from lymphocytes. Blood 88, 915–921

6. Zocchi, E., Franco, L., Guida, L., Benatti, U., Bargellesi, A., Malavasi, F.,Lee, H. C., and De Flora, A. (1993) A single protein immunologicallyidentified as CD38 displays NAD� glycohydrolase, ADP-ribosyl cyclaseand cyclic ADP-ribose hydrolase activities at the outer surface of humanerythrocytes. Biochem. Biophys. Res. Commun. 196, 1459 –1465

7. Aksoy, P., White, T. A., Thompson, M., and Chini, E. N. (2006) Regulationof intracellular levels of NAD: a novel role for CD38. Biochem. Biophys.Res. Commun. 345, 1386 –1392

8. Issaad, C., Croisille, L., Katz, A., Vainchenker, W., and Coulombel, L.(1993) A murine stromal cell line allows the proliferation of very primitivehuman CD34��/CD38� progenitor cells in long-term cultures and semi-solid assays. Blood 81, 2916 –2924

9. Elliott, S., Pham, E., and Macdougall, I. C. (2008) Erythropoietins: a com-mon mechanism of action. Exp. Hematol. 36, 1573–1584

10. Hattangadi, S. M., Wong, P., Zhang, L., Flygare, J., and Lodish, H. F. (2011)From stem cell to red cell: regulation of erythropoiesis at multiple levels bymultiple proteins, RNAs, and chromatin modifications. Blood 118,6258 – 6268

11. Xie, G.-H., Rah, S.-Y., Kim, S.-J., Nam, T.-S., Ha, K.-C., Chae, S.-W., Im,M.-J., and Kim, U.-H. (2005) ADP-ribosyl cyclase couples to cyclic AMPsignaling in the cardiomyocytes. Biochem. Biophys. Res. Commun. 330,1290 –1298

12. Maehama, T., Hoshino, S., and Katada, T. (1996) Increase in ADP-ribo-syltransferase activity of rat T lymphocyte alloantigen RT6.1 by a singleamino acid mutation. FEBS Lett. 388, 189 –191

13. Hara, N., Tsuchiya, M., and Shimoyama, M. (1996) Glutamic acid 207 inrodent T-cell RT6 antigens is essential for arginine-specific ADP-ribosy-lation. J. Biol. Chem. 271, 29552–29555

14. Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) Rapid and efficientsite-specific mutagenesis without phenotypic selection. Methods Enzy-mol. 154, 367–382

15. Ziegler, M., Jorcke, D., Zhang, J., Schneider, R., Klocker, H., Auer, B., andSchweiger, M. (1996) Characterization of detergent-solubilized beef livermitochondrial NAD� glycohydrolase and its truncated hydrosolubleform. Biochemistry 35, 5207–5212

16. Graeff, R. M., Walseth, T. F., Fryxell, K., Branton, W. D., and Lee, H. C.(1994) Enzymatic synthesis and characterizations of cyclic GDP-ribose. Aprocedure for distinguishing enzymes with ADP-ribosyl cyclase activity.J. Biol. Chem. 269, 30260 –30267

17. Moss, J., and Stanley, S. J. (1981) Histone-dependent and histone-inde-pendent forms of an ADP-ribosyltransferase from human and turkeyerythrocytes. Proc. Natl. Acad. Sci. U.S.A. 78, 4809 – 4812

18. Weng, B., Thompson, W. C., Kim, H.-J., Levine, R. L., and Moss, J. (1999)Modification of the ADP-ribosyltransferase and NAD glycohydrolase ac-tivities of a mammalian transferase (ADP-ribosyltransferase 5) by auto-ADP-ribosylation. J. Biol. Chem. 274, 31797–31803

19. Han, M.-K., Song, E.-K., Guo, Y., Ou, X., Mantel, C., and Broxmeyer, H. E.(2008) SIRT1 regulates apoptosis and Nanog expression in mouse embry-onic stem cells by controlling p53 subcellular localization. Cell Stem Cell 2,241–251

20. Lutton, J. D., Abraham, N. G., Drummond, G. S., Levere, R. D., and Kap-pas, A. (1997) Zinc porphyrins: potent inhibitors of hematopoieses inanimal and human bone marrow. Proc. Natl. Acad. Sci. U.S.A. 94,

FIGURE 10. Erythroid differentiation of bone marrow cells prepared fromCD38 WT or KO mice. A, RT-PCR and Western blot analysis of CD38 in bonemarrow cells from CD38 WT or KO mice. B, intracellular NAD concentration inCD38 WT or KO mouse bone marrow cells. *, p � 0.0005, WT versus KO. C,CFU-E formation and mature BFU-E formation were scored at day 10. Meanvalues of three independent experiments �S.D. (error bars) are shown. *, p �0.001, WT versus KO.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

1432–143621. Aslesen, R., and Jensen, J. (1998) Effects of epinephrine on glucose metab-

olism in contracting rat skeletal muscles. Am. J. Physiol. 275, E448 –E45622. Graeff, R., and Lee, H. C. (2002) A novel cycling assay for nicotinic acid-

adenine dinucleotide phosphate with nanomolar sensitivity. Biochem. J.367, 163–168

23. Tong, L., Lee, S., and Denu, J. M. (2009) Hydrolase regulates NAD� me-tabolites and modulates cellular redox. J. Biol. Chem. 284, 11256 –11266

24. Takada, T., Iida, K., and Moss, J. (1994) Expression of NAD glycohydrolaseactivity by rat mammary adenocarcinoma cells transformed with rat T cellalloantigen RT6.2. J. Biol. Chem. 269, 9420 –9423

25. Okazaki, I. J., Kim, H.-J., and Moss, J. (1996) Cloning and characterizationof a novel membrane-associated lymphocyte NAD:arginine ADP-ribosyl-transferase. J. Biol. Chem. 271, 22052–22057

26. Ferguson, M. A. (1992) Colworth Medal Lecture. Glycosyl-phosphatidy-linositol membrane anchors: the tale of a tail. Biochem. Soc. Trans. 20,243–256

27. Udenfriend, S., Kodukula, K., and Amthauer, R. (1992) Cell-free process-ing of nascent proteins destined to be linked to the plasma membrane bya phosphatidylinositol-glycan anchor. Cell. Mol. Biol. 38, 11–16

28. Zolkiewska, A., Nightingale, M. S., and Moss, J. (1992) Molecular charac-terization of NAD:arginine ADP-ribosyltransferase from rabbit skeletalmuscle. Proc. Natl. Acad. Sci. U.S.A. 89, 11352–11356

29. Bortell, R., Kanaitsuka, T., Stevens, L. A., Moss, J., Mordes, J. P., Rossini,

A. A., and Greiner, D. L. (1999) The RT6 (Art2) family of ADP-ribosyl-transferases in rat and mouse. Mol. Cell. Biochem. 193, 61– 68

30. Bieganowski, P., and Brenner, C. (2004) Discoveries of nicotinamide ribo-side as a nutrient and conserved NRK genes establish a Preiss-Handlerindependent route to NAD� in fungi and humans. Cell 117, 495–502

31. Canto, C., Houtkooper, R. H., Pirinen, E., Youn, D. Y., Oosterveer, M. H.,Cen, Y., Fernandez-Marcos, P. J., Yamamoto, H., Andreux, P. A., Cettour-Rose, P., Gademann, K., Rinsch, C., Schoonjans, K., Sauve, A. A., andAuwerx, J. (2012) The NAD� precursor nicotinamide riboside enhancesoxidative metabolism and protects against high-fat diet-induced obesity.Cell. Metab. 15, 838 – 847

32. Okazaki, I. J., Zolkiewska, A., Nightingale, M. S., and Moss, J. (1994) Im-munological and structural conservation of mammalian skeletal muscleglycosylphosphatidylinositol-linked ADP-ribosyltransferases. Biochemis-try. 33, 12828 –12836

33. Okazaki, I. J., and Moss, J. (1998) Glycosylphosphatidylinositol-anchoredand secretory isoforms of mono-ADP-ribosyltransferases. J. Biol. Chem.273, 23617–23620

34. Glowacki, G., Braren, R., Firner, K., Nissen, M., Kuhl, M., Reche, P., Bazan,F., Cetkovic-Cvrlje, M., Leiter, E., Haag, F., and Koch-Nolte, F. (2002) Thefamily of toxin-related ecto-ADP-ribosyltransferases in humans and themouse. Protein Sci. 11, 1657–1670

35. Higgins, D. G., and Sharp, P. M. (1988) CLUSTAL: a package for perform-ing multiple sequence alignment on a microcomputer. Gene 73, 237–244




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Youngho Kim, Joel Moss and Uh-Hyun KimTae-Sik Nam, Kwang-Hyun Park, Asif Iqbal Shawl, Byung-Ju Kim, Myung-Kwan Han,

Hematopoietic Stem Cells through Control of Intracellular NAD ContentCritical Role for NAD Glycohydrolase in Regulation of Erythropoiesis by

doi: 10.1074/jbc.M114.560359 originally published online April 23, 20142014, 289:16362-16373.J. Biol. Chem.

10.1074/jbc.M114.560359Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/289/23/16362.full.html#ref-list-1

This article cites 35 references, 15 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M114.560359

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;289/23/16362&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/289/23/16362

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=289/23/16362&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/289/23/16362

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/289/23/16362.full.html#ref-list-1

http://www.jbc.org/

criticalrolefornadglycohydrolaseinregulationof ... · superscript ii reverse transcriptase by...

Documents