craniofacial defects in dlx5-/- mice...craniofacial, vestibular and bone defects in mice lacking the...

INTRODUCTION

The Distal-less (Dll) gene of Drosophila is required for correctmorphogenesis of the distal portion of the legs, antennae andmouth parts (Cohen et al., 1989; O’Hara et al., 1993). Severalhomologues of Dll (called Dlx in the mouse) have been isolatedfrom vertebrate species ranging from zebrafish to human(Stock et al., 1996). These genes constitute a highly conservedfamily of homeobox genes, which are thought to act astranscription factors; however, their mode of action asregulatory molecules might be more complex as it has beenshown that members of the Dlx family can form dimericcomplexes with Msx homeoproteins mutually affecting theirDNA-binding properties (Zhang et al., 1997). In the mouse,there are at least six Dlx genes arranged as pairs facing eachother through the 3′ end and located near Hox clusters (Dlx1and Dlx2 near HoxD; Dlx3 and Dlx7 near HoxB; Dlx5 and Dlx6near HoxC) (Simeone et al., 1994a,b; McGuinness et al., 1996;Nakamura et al., 1996; Liu et al., 1997).

Dlx genes are all expressed in spatially and temporallyrestricted patterns in craniofacial primordia, basal

telencephalon and diencephalon, and in distal regions ofextending appendages including the limb and the genitaltubercle. The pattern of expression of Dlx5 differs from that ofthe other members of the family in two respects. First, it hasbeen shown recently (Yang et al., 1998) that Dlx5 is expressedmuch earlier than other Dlx genes during development interritories that define the rostral and lateral border of the neuralplate when these regions have organizing activities that patternthe adjacent rostral prosencephalon. Second, Dlx5 and Dlx6have the unique property to be expressed in all developingbones from the time of initial cartilage formation onward(Simeone et al., 1994a,b; Zhao et al., 1994). A furtherindication of the possible importance of Dlx5 in the control ofbone differentiation comes from a recent study (Ryoo et al.,1997) in which it has been shown, that this gene is expressedat specific stages of osteoblast differentiation and could repressosteocalcin gene expression by interacting with a singlehomeodomain-binding site in its promoter.

In situ hybridization studies on 9.5 and 10.5 dpc miceembryos have shown that Dlx1 and Dlx2 are expressed in themesenchyme of both the proximal and the distal domain of the

3795Development 126, 3795-3809 (1999)Printed in Great Britain © The Company of Biologists Limited 1999DEV2413

The Dlx5 gene encodes a Distal-less-related DNA-bindinghomeobox protein first expressed during early embryonicdevelopment in anterior regions of the mouse embryo. Inlater developmental stages, it appears in the branchialarches, the otic and olfactory placodes and theirderivatives, in restricted brain regions, in all extendingappendages and in all developing bones. We have createda null allele of the mouse Dlx5 gene by replacing exons Iand II with the E. coli lacZ gene. Heterozygous mice appearnormal. ββ-galactosidase activity in Dlx5+/−− embryos andnewborn animals reproduces the known pattern ofexpression of the gene. Homozygous mutants die shortlyafter birth with a swollen abdomen. They present a

complex phenotype characterised by craniofacialabnormalities affecting derivatives of the first fourbranchial arches, severe malformations of the vestibularorgan, a delayed ossification of the roof of the skull andabnormal osteogenesis. No obvious defect was observed inthe patterning of limbs and other appendages. The defectsobserved in Dlx5−−/−− mutant animals suggest multiple andindependent roles of this gene in the patterning of thebranchial arches, in the morphogenesis of the vestibularorgan and in osteoblast differentiation.

Key words: Homeobox, Dlx5, Gene disruption, Craniofacial, Innerear, Periosteal bone, Mouse

SUMMARY

Craniofacial, vestibular and bone defects in mice lacking the Distal-less-related gene Dlx5

Dario Acampora1,*, Giorgio R. Merlo2,3,*, Laura Paleari2, Barbara Zerega2, Maria Pia Postiglione1,Stefano Mantero2, Eva Bober4, Ottavia Barbieri2,5, Antonio Simeone1,‡ and Giovanni Levi2,3,‡

1International Institute of Genetic and Biophysics, CNR, via Marconi 10, 80125 Naples, Italy2Laboratory of Molecular Biology, National Cancer Institute-IST, Advanced Biotechnology Center, Largo R. Benzi no. 10, 16132Genova, Italy3Laboratoire de Physiologie Générale et Comparée, URA CNRS 90, Museum National d’Histoire Naturelle, 7 rue Cuvier, 75015Paris, France4Department of Molecular and Cellular Biology, Technical University Braunschweig, 38106 Braunschweig, Germany5Department of Oncology, Genetics and Biology, Università di Genova, Italy*These authors have contributed equally to the work‡Authors for correspondence (e-mails: [email protected]; [email protected])

Accepted16 June; published on WWW 5 August 1999

3796

first two branchial arches while Dlx3, Dlx5 and Dlx6 appear tobe expressed predominantly in the distal arch mesenchyme(Simeone et al., 1994a,b; Qiu et al., 1997). A mediolateralpatterning of Dlx genes within the branchial arches has alsobeen suggested (Robinson and Mahon, 1994).

So far only the functions of Dlx1 and Dlx2 have beenanalyzed by targeted inactivation in the mouse. Micehomozygous for Dlx1 or Dlx2 deletion shows that both genesare essential for correct craniofacial development in particularfor derivatives of the proximal regions of the branchial arches(Qiu et al., 1995, 1997). These observations lead to thehypothesis that Dlx genes contribute to the readout of aproximodistal pattern within the branchial arches.Furthermore, as mice lacking both Dlx1 and Dlx2 have uniqueabnormalities, such as the absence of maxillary molars, apartial functional redundancy of Dlx genes has been suggested(Qui et al., 1997). Similarly, as Dlx1 and Dlx2 are expressedtogether with Dlx3, Dlx5 and Dlx6 in the distal part of the firstand second branchial arch, the concept of functionalredundancy has been used by the same authors to explain thelack of defects affecting distal arch derivatives in Dlx1 andDlx2 mutant mice. The functional inactivation of othermembers of the Dlx family is critical to clarify these points.

We set out to inactivate the Dlx5 gene in the mouse byhomologous recombination. The DNA construct for genetargeting was engineered so to associate the disruption of Dlx5with a positional insertion of the E. coli β-galactosidasereporter gene, to provide a marker for Dlx5-expressing celllineages in developing structures.

MATERIALS AND METHODS

Targeting vectorA 400 bp HaeIII genomic fragment comprising exon III of murineDlx5 was used to screen a mouse (strain 129) genomic library clonedin the HindIII site of pBelo BAC-11 vector (Genome System, StLouis, MO USA). Of the four positive clones identified, one wasfurther analyzed and found to contain the complete Dlx5 and Dlx6genes. The Dlx5 targeting DNA construct, designated pGN-2lox X5,was prepared as follows. A 4.5 kb PstI-SmaI fragment spanning thepromoter region of the Dlx5 gene and the entire 5′ untranslatedsequence was cloned upstream of the E. coli lacZ coding sequence.The 3′ end of this fragment corresponds to the position −6 relative tothe ATG Start codon of the Dlx5 open reading frame (ORF).Downstream of the lacZ reporter, we introduced a RSV-neoR

expression cassette flanked by two Lox P sites. In the presence of Crerecombinase activity, this construction allows for removal of the RSV-neoR expression cassette. This control was devised for ruling out apossible interference of RSV-neoR with the expression of other genes.The downstream region of homology was cloned 3′ to the second LoxP site and consisted of a 1 kb fragment spanning part of the third exon.Homologous recombination of this construct results in the deletion ofexons I and II of Dlx5, including the Start Codon and the positionalinsertion of the lacZ ORF. Thus, Dlx5 protein synthesis should beabolished and replaced by the synthesis of bacterial β-galactosidase.

ES cell culture and generation of chimeric miceFor electroporation, 20 µg of pGN-2lox X5 KOB DNA linearized atthe unique KpnI site was added to 1.2×107 HM-1 cells at passage 18in a volume of 0.8 ml of PBS containing 0.1% β-mercaptoethanol.Electroporation was performed in a 0.4 cm width cuvette at 200 Vand using a capacitance of 1050 µF. After electroporation, the cellswere transferred to non-selective medium supplemented with 1000

U/ml Leukaemia Inhibitory Factor (LIF, Gibco-BRL). G418 wasadded to concentrations varying from 350 to 450 µg/ml after 24 hoursof culture and the selection was continued for 10 days. G418-resistantES cell clones were picked and transferred into 1.5 cm diameter wellsand subsequently expanded in 35 mm diameter Petri dishes forfreezing and for DNA analysis. Chimeric mice were generated fromrecombinant ES cells as described (Robertson et al., 1986).

DNA analysisDNA was extracted from ES cell clones, embryos or mouse tails usingstandard methods. Polymerase chain reaction (PCR) amplificationwas used for a primary screening of homologous recombinants and todetermine the genotype of embryos and newborn animals. PCRreactions were carried out under standard conditions usingSuperTherm thermostable polymerase (Eppendorf). The reactionprofile included a denaturation step at 94°C 5 minutes, 30 cycles of94°C 1 minute, 65°C 1 minute, 72°C 1 minute and a final elongationstep at 72°C 5 minutes. The upstream and the downstream primerswere chosen, respectively, in the neoR sequence (primer 4:TGCTGTGTTCCAGAAGTGTT) and immediately 3′ to thedownstream recombination boundary, i.e. external to the targetedsequence (primer 3: GCCCATCTAATAAAGCGTCCCGG). A 1,100bp fragment is expected from a correct homologous recombinationevent. To confirm correct targeting, Southern blotting was alsoperformed on BamHI-digested DNA using a 350 bp EcoRI fragment,external to the homology regions, as probe. For the typing of miceoffspring, a PCR reaction was utilized that included fouroligonucleotides: primers 3 and 4 for the mutated allele, and primers1 (GACAGGAGTGTTTGACAGAAGAGTCCC) and 2 (GTAGTCG-GCATAAGCCTTGGC) for the wild-type allele. The latter set ofprimers yields a 280 bp fragment.

The presence of Dlx5 mRNA was determined on total RNAsamples prepared from genotyped individual 12.5 dpc embryosgenerated by crossing heterozygous partners. The total mRNA wasprepared using Trizol Reagent (Gibco-BRL). 1 µg of RNA samplefrom two of each +/+, +/− or −/− embryos was subjected to RT-PCRamplification of the complete murine Dlx5 cDNA with the Titan OneTube RT-PCR kit (Boehringher) according to the manufacture’sinstructions. A set of oligonucleotides was designed to flank the ORF(sense: TCATGACAGGAGTGTTTGACAG; antisense: GGGCTA-AACCAGCACAACACTGTAG) and to yield a 820 bp fragment. Theidentity of the fragment was confirmed by complete sequencing. β-actin cDNA was amplified from the same samples and under the sameconditions to control for the quality of RNA preparation.

Mice carrying the Cre recombinase under the control of the CMVpromoter were obtained from Dr P. Chambon (Strasbourg, France)and were typed using published primer sequences. Mice obtainedfrom the breeding of CMV-Cre animals with Dlx5/lacZ heterozygouswere typed for Dlx5 by PCR replacing primer 4 with primer 5(TCCCTCGAAAAGGTTCACTA). Correct Cre-mediated removal ofthe PGK-neoR cassette was confirmed by PCR replacing primer 4 withprimer 6 (TACAAATAAAGCAATAGCATC), and later by Southernblotting of PstI-digested genomic DNA.

ββ-gal staining and histological analysesPostimplantation embryos were collected at the desired stages,considering the day of the plug as 0.5 dpc. For lacZ expressionanalysis, 8.5, 9.5 and 10.5 dpc embryos were fixed for 5-10 minutesin 2% paraformaldehyde (PFA) in PBS, while 12.5 dpc and laterstages embryos were fixed for 10 minutes in 2% PFA + 0.2%glutaraldehyde. X-gal staining was performed as described (Sham etal., 1993). Newborn and adult animals were stained by perfusion.Stained specimens were photographed in toto, then either embeddedin paraffin and used to obtain 10 µm serial sections, or dehydratedand clarified in a benzyl-benzoate/benzyl alcohol 2:1 mixture to revealthe staining of internal structures. For conventional histology, sectionswere counterstained with eosin-haematoxylin.

D. Acampora and others

3797Craniofacial defects in Dlx5−/− mice

Immunohistochemistry for the detection of osteocalcin in tissuesections was performed on paraffin sections of newborn mice previouslystained with X-gal by perfusion using anti-mouse-osteocalcin polyclonalantibodies (a gift of Dr Caren Gundberg, Yale University, Departmentof Orthopedics).

Alcian blue/Alizarin red staining of newborn skeletons was performedas described (Wallin et al., 1994).

Probes and in situ hybridizationIn situ hybridization experiments were performed as described(Simeone, 1998). The Shh, Tbrain1 and Gbx2 probes were PCRproducts spanning the regions between amino acids 109 and 177(Echelard et al., 1993), amino acids 599 and 680 (Bulfone et al., 1995)and amino acids 6 and 294 (Chapman et al., 1997), respectively. TheDlx1, Dlx6 and Otp probes have been previously described (Simeoneet al., 1994a,b). The Ihh probe corresponded to the 600 bp 3′end ofmurine Ihh cDNA. Cbfa1/Osf2 probe corresponded to 630 bp in the3′end of the mouse ORF, not including the runt domain. Both Ihh andCbfa1 probes were obtained by PCR.

BrdU labeling and detection of apoptotic cellsPregnant mice at E10.5 and E11.5 were injected intraperitoneally withBrdU solution (50 mg/kg body weight) and killed after 1 hour. Afterembryo genotyping, BrdU detection was performed according toXuan et al. (1995). Three embryos for each genotype were scored.Four comparable sections for each embryo were analyzed. Thefraction of BrdU-positive cells was determined by dividing thenumber of BrdU-positive nuclei by the total number of nucleiidentified in units of tissue corresponding to a square of 100 µm/side(Xuan et al., 1995). The proportion of BrdU-positive cells in wild-type embryos was considered 100%.

To detect apoptotic cells, the sections were processed by theTUNEL method as described (Gavrieli et al., 1992).

RESULTS

Targeted disruption of the Dlx5 gene in ES cells andmiceThe Dlx5 gene was disrupted in the plasmid pGN-2lox-X5by inserting the E. coli lacZ coding sequence and a neoR

expression cassette in replacement of the Dlx5 exon I and II(Fig. 1A).

Heterozygous disruption of the Dlx5 gene in ES cells wasobtained by homologous recombination after electroporationwith pGN-2lox X5. Recombination events at the Dlx5 locuswere identified among G418-resistant colonies initially byPCR amplification using primers 3 and 4 (Fig. 1A), andsubsequently confirmed by Southern blot analysis of BamHI-digested genomic DNA hybridized with the indicatedprobe (Fig. 1A). The expected 6.2 and 4.2 kb fragments,corresponding respectively to the wild-type and the mutatedallele, were observed in the DNA from recombinant cells (Fig.1B). Among 300 G418-resistant clones analyzed, 7 were foundheterozygous for the Dlx5/lacZ allele. Southern blot analysisof DNA from mice generated with these ES cells showed thesame restriction fragments (Fig. 1B) and no subsequentmodification was observed.

One ES cell clone corresponding to a correct replacementevent led to germline transmission after injection into C57Bl/6blastocysts. The chimeras obtained were used to establish afamily of heterozygous carriers by crossing with C57Bl/6 ×DBA/2 F1 females. The presence of the wild type or theDlx5/lacZ alleles was determined by PCR amplification of

genomic DNA using the oligonucleotides reported in Fig. 1A:primers 1 and 2 for the wild-type allele, and 3 and 4 for themutated allele (Fig. 1C).

The Dlx5/lacZ mutant allele is expected to be unable totranscribe Dlx5 exon I and II sequences, leading to the absenceof full-length Dlx5 mRNA. To confirm this, we checked fortranscription of Dlx5 mRNA in wild-type , heterozygous andhomozygous mutant embryos by RT-PCR, using primersflanking the Dlx5 ORF. The results show absence of full-lengthDlx5 mRNA in samples from homozygous embryos, whiletranscripts were detected in +/+ and +/- embryos at comparablelevels (Fig. 1D). The identity of the amplified cDNA wasdetermined by sequencing. Amplification of murine β-actinmRNA was used to control for the quality of the RNApreparations (Fig. 1D). Exon III sequences, although present,should not be transcribed due to the presence of apolyadenylation-addition signal downstream from the lacZsequence and upstream of the neoR cassette (Fig. 1A).

Cre-mediated removal of the PGK-neoR cassette wasobtained by crossing Dlx5/lacZ heterozygous animals withCMV-Cre transgenic partners. The offspring were genotypedfor the presence of the Cre transgene, the presence of theDlx5/lacZ allele and the correct modification of the latter toyield the Dlx5/lacZCre allele, by PCR (Fig. 1E) and Southernblotting. The analysis was carried out using the primersindicated in Fig. 1A: 3 and 5 for Dlx5/lacZ, and 3 and 6 forthe Dlx5/lacZCre allele. Correct removal of the sequenceflanked by Lox P sites was observed in every animal withthe genotype Cre+, Dlx5/lacZ+/−, as demonstrated by PCRanalysis (Fig. 1E). Southern blot analysis of PstI-digestedgenomic DNAs from mice carrying the Dlx5/lacZCre alleleconfirmed correct Cre-Lox P-mediated deletion (data notshown).

Heterozygous mutant mice are viable, fertile and do notexhibit any obvious abnormality. Genotype analysis of over500 individual mice representing the F1 of Dlx5/lacZheterozygous parents show genotype frequencies notsignificantly different from those expected by Mendeliansegregation of the mutated allele (+/+ 29%; +/− 49%; −/− 22%)indicating that lack of Dlx5 does not result in embryoniclethality. In contrast, homozygous Dlx5/lacZ animals are easilyrecognized at birth, in that they show decreased motility,gasping respiration, do not suckle, do not have milk in theirstomach and develop a bloated abdomen accumulating air intheir stomach and intestine. No mutant survived longer than 24hours after birth. Exencephaly was observed in about 12%homozygous mutant embryos and newborns, in addition to allother phenotypes. We shall refer to these animals as‘exencephalic phenotype’, to distinguish them from themajority of mutant embryos and newborn.

To our surprise, mice carrying one copy of the Dlx5/lacZCre

allele, derived from crossings between Dlx5/lacZ heterozygousanimals (either males or females) and CMV-Cre transgenicpartners, die 18 days after birth without presenting any obviousdefect or skeletal deformity. As both heterozygous parents arenormal and fertile and no defect is seen in the expressionpattern of either Dlx5 (Fig. 2J,K) or Dlx6 (data not shown) inDlx5/lacZCre heterozygous embryos, their death remainsunexplained. As Dlx5/lacZCre heterozygous animals did notreach sexual maturity, we could not analyze the phenotype ofDlx5/lacZCre homozygous animals.

3798

Expression of the Dlx5/lacZ mutant allele duringdevelopment The normal development of heterozygous Dlx5 mutant miceallowed us to use the lacZ gene as a sensitive reporter of Dlx5promoter activity during mouse embryogenesis. Furthermorecomparison of lacZ expression in heterozygous and homozygousmutant embryos helped us to identify the lesions induced bygene inactivation. In heterozygous embryos, the expression

pattern of lacZ reproduced in all cases the known profile ofexpression of Dlx5 obtained previously by RNA in situhybridization (Yang et al., 1998; Simeone et al., 1994a,b). In 8.0and 8.5 dpc embryos (Fig. 2A-D), lacZ activity is present in theventral cephalic epithelium, in the otic and olfactory placodes,in a narrow strip of cells at the neural-non-neural boundary alongthe length of the neural plate and in the tail bud. The signaldetected at the border of the neuroepithelium was more intense


Fig. 1. Disruption of the mouse Dlx5gene by homologous recombination.(A) Exon-intron organization andrestriction map of murine Dlx5 gene,targeting vector and mutated allelefollowing homologous recombination.Exons are indicated in roman numbers(I, II and III), oligonucleotides areindicated by solid arrowheads in Arabicnumbers (1-6). The probe used forSouthern blot hybridization is indicatedby a thick line. Open boxes, proteincoding sequences; striped boxes, non-coding exon sequences; open triangles,Lox P sequences. Restriction sites are:B, BamHI; E, EcoRI; H, HindIII;K, KpnI; P, PstI; S, SmaI. (B) Southernblot analysis of BamHI-digested genomicDNA from wild-type (+/+) andrecombinant (+/−) ES cells (lanes on theleft) and mice (lanes on the right). Thewild-type and mutant alleles yielded,respectively, a 6.2 and a 4.2 kb fragment,as expected (arrows). (C) Allele-specificPCR on genomic DNA from +/+, +/− and−/− mice. The wild-type (primers 1-2)and the mutant (primers 3-4) alleles areamplified and yield a 280 and 1,100 bpfragment, respectively (arrows). (D) RT-PCR analysis of Dlx5 (top) and β-actin(bottom) expression in +/+, +/− and −/−total RNA samples from 12.5 dpcembryos. The PCR product of theexpected sizes were obtained (indicatedby arrows). No expression of Dlx5 wasseen in homozygous mutant embryos.(E) Deletion of the PGK-neoR cassettefrom the Dlx5-lacZ allele, to generate theDlx5-lacZCRE allele using the Crerecombinase/Lox P system in vivo. PCRamplification of genomic DNA from twoindividual mice (#30 and #32) for themutated Dlx5 allele (left), the CREtransgene (middle) and the modifiedmutated Dlx5 allele (right panel), usingprimers 3-5, CRE-amplimer and 3-6,respectively (A). The expected fragmentswere always obtained (arrows). The 3-6fragment was detected only in +/−animals in the presence of the CREtransgene.


in regions rostral to the otic pit suggesting a possible expressionof Dlx5 in presumptive premigratory cephalic neural crest cells(Yang et al., 1998). No obvious changes in the lacZ expressionpattern nor any evident lesions were observed in homozygousembryos at these stages (Fig. 2D).

After anterior neuropore closure (8.5 dpc) and in allsubsequent stages, the distal portion of the first (mandibular)branchial arch is stained by X-gal. At 9.5 dpc expression of thereporter gene can already be seen in the maxillary branch ofthe first branchial arch (Fig. 2E,F) where it rapidly increasesat later stages (Fig. 2J-L). The second (hyoid) and, moreweakly, the third and fourth branchial arches show expressionof the reporter gene (Fig. 2E-G). The expression in the secondand third arch is characterized by two streaks of positive cellsat the anterior and posterior border of the arch (Fig. 2G). Theexpression in arch-derived structures persists later indevelopment. In homozygous mutant embryos at 9.5 dpc, noobvious difference could be observed in lacZ expression in the

branchial arches or in any other lacZ-expressing structures(Fig. 2E,F, see also Fig. 8I,K,M).

Expression in the brain begins around 9.5-10 dpc and, by10.5 dpc, is confined to the basal anterior telencephalon, theganglionic eminence and the thalamic region of thediencephalon. A detailed account of the effects of the mutationin these regions is given in a later section.

The first phenotypic differences induced by the inactivationof Dlx5 can be observed at 11.5 dpc (Fig. 2H,I) and becomesmore evident at 12.5 dpc (Fig. 2L,M), affecting derivatives ofthe branchial arches and of the otic and olfactory placodes(see below). Starting at around 12 dpc, the reporter gene isexpressed surrounding all endochondral bones (Fig.2L,M,R,S). The pattern of lacZ expression in heterozygousembryos did not change after removal of the PGK-neoR

cassette by crossing with CMV-Cre transgenic partners (Fig.2J,K) indicating that the activity of the Dlx5 promoter was notaffected by the presence of the PGK-neoR cassette.

Fig. 2. Expression of Dlx5/lacZ during embryogenesis, and phenotypes observed in homozygous mutants. (A,B) Whole-mount X-gal staining of8.0 dpc embryos in lateral (A) and dorsal (B) view. (C,D) 8.5 dpc-stained heterozygous (C) and homozygous mutant (D) embryos. In D, the firstbranchial arch (1) is indicated. Arrowheads in A-D indicate the otic placode. (E,F) 9.5 dpc embryos stained with X-gal showing expression of lacZin the otic vesicle, branchial arches (indicated by numbers 1-4, G), olfactory placode and limb buds. An heterozygous (E) and an homozygousmutant (F) embryo are shown. (G) Detail of the branchial arches (1-4) to show expression of Dlx5/lacZ. In the second and third arch staining isobserved in an anterior and a posterior streak of cells. (H,I) Expression of lacZ in normal (H) and homozygous mutant (I) 11.5 dpc embryos.(J-M) Expression of lacZ in 12.5 dpc embryos. Expression in Cre+ (J) and Cre− (K) heterozygous embryos is compared. Clarified heterozygous (L)and homozygous mutant (M) embryos are shown. The arrow in H indicates the genital bud. (N-S) Expression pattern of lacZ in the developinglimbs of 9.5 (N), 10.5 (O,P), 11.5 (Q), 13.5 (R) and 14.5 (S) dpc heterozygous embryos, in lateral view, except in P where a frontal view is shownto highlight the apical ectodermal ridge (AER). Limbs of homozygous mutant mice showed no difference in the β-gal-staining pattern at any stageof development. Arrowheads in N indicate the AER. White asterisks indicate a region of expression located at the anterior margin of the limb bud.At 13.5 (R) and 14.5 (S) dpc, expression in limb skeletal elements is also observed. For each pair of matched embryos, the same magnification isused. Abbreviations: de, diencephalon; sc, semicircular canals; tb, tail bud; te, telencephalon; vce, ventral cephalic epithelium.

3800

Dlx5, as all other Dlx genes, is strongly expressed in allextending appendages including the limb bud, the genitaltubercle and external ear. Expression in the limb bud isobserved beginning at 9.5 dpc and in all subsequent stages(Fig. 2N-S). Initially, it is confined to the apical ectodermalridge and to a wider region at the anteroproximal border of thelimb bud. In later stages, expression marks the epithelium andunderlying mesenchyme of the tip of all growing appendages,including finger and toe tips, the genital bud and the ear lobes.

Craniofacial defects during embryogenesisCraniofacial malformations in Dlx5/lacZ homozygousembryos were seen at 14.5 dpc (Fig. 3A-C). Mutant embryos

(Fig. 3B) could be recognized by their shorter snout and openfontanelle; in the few exencephalic embryos, the craniofacialdefects were more conspicuous (Fig. 3C). Limb developmentwas normal in all embryos as already observed for Dlx1 andDlx2 mutants (Qiu et al., 1995, 1997). Cartilage skeletonpreparations from 14.5 dpc embryos (Fig. 3D-F) confirmed thenormal development of limbs and axial skeleton and thedefective development of head structures.

The most obvious cranial alteration in Dlx5−/− 14.5 dpcembryos affects Meckel’s cartilage, which appears shorter andfuses to the contralateral partner with a wider angle comparedto normal embryos (Figs 3E,F, 4A,B). In addition it isinterrupted near its proximal end generating an additional jointand leaving the malleus primordium as an individual cartilageelement (Fig. 4D,E). One to three additional cartilage elements,form ectopically at the site of the interruption in Meckel’scartilage, at the position where the gonial and tympanic boneswill form. In some cases, one of these elements is fused withthe distalmost portion of the malleus. These additionalcartilages contribute to the development of part of the ectopicbones observed at birth (see below).

At 14.5 dpc, the middle ear ossicles hammer, incus andstapes appear normally shaped and positioned, and engage inproper articulations with one another (Fig. 4C-E), except fora few exencephalic embryos in which the stapes was absent(Fig. 4E). Likewise, at birth, the middle ear ossicles appearnormal. This was confirmed by serial histology of the earregion of normal and mutant animals, which indicated that, in


Fig. 3. Craniofacial defects in 14.5 dpc Dlx5−/− mutant embryos.(A-C) Frontal view of normal (A), homozygous mutant (B) andexencephalic phenotype (C) embryos. Note the shorter snout and theopen fontanelle of the mutant embryo (B) versus the normal (A), andthe dramatically abnormal head and brain development of theexencephalic case (C). (D,E) Lateral view of cartilage skeleton at 14dpc of normal (D), homozygous mutant (E) and exencephalicphenotype (F), stained with Alcian blue and clarified. Note thedefects of the middle and inner ear structures (detailed in Fig. 4), theshortening and rotation of the Meckel’s cartilage, and the profoundskull alterations in the exencephalic animal. The body and limbskeleton appears normal in all cases.

Fig. 4. Defects in the head cartilageskeleton at 14.5 dpc. (A,B) Ventral viewof the base of the skull of 14.5 dpcnormal (A) and homozygous mutant(B) embryos, stained with Alcian blue.(C-E) Lateral view of the proximal-most portion of the Meckel’s cartilageand the middle ear ossicles, dissectedfrom normal (C), homozygous mutant(D), or exencephalic phenotype (E)embryos. In the inserts is shown a detailof the stapes. In mutant animals, theMeckel’s cartilage is interrupted anddisconnected from the malleusprimordium, and gives rise to additionalskeletal elements directed toward themidline (arrows). The position andarticulation of the ossicles appearsnormal (arrowheads), except for thestapes which is missing in the exencephalic phenotype. Abbreviations: at, auditory tube; co, cochlea; i, Incus; m, malleus; mc, Meckel’scartilage; ph, pharynx; s, stapes; sty, styloid process; th, thyroid cartilage; ts, tympanic space; ve, vestibulum.


Dlx5-deficient animals, the malleus contacts the tympanicmembrane and the stapes contacts the vestibular window ofthe sacculus correctly (data not shown). The styloid processappears shorter than normal and is rotated toward the midline(Fig. 4A,B).

Craniofacial defects at birthAs expected from the analysis of the mutant embryos, bonesderived from branchial arches forming the base and sides of theskull are severely defective in newborn homozygous mutantmice (Fig. 5); while minor defects appear in neurocranial bones.Dlx5−/− animals present a cleft secondary palate; the horizontallaminae of the palatine bones are missing. This causes thepresphenoid bone to become visible in ventral view. The nasaland maxillary bones are shorter, resulting in a general reductionof the length of the snout. The palatine processes of the maxillaare reduced especially with respect to their posteriordevelopment and they fail to form proper connections with thepalatine bones (Fig. 5A,B). We observe a deformation of theanterior part of the pterygoids, which appear to have changedtheir angles with respect to the basisphenoid bone (Fig.5A,B,E,F). The tympanic ring is always reduced in length,although with considerable variation among individuals (Fig.5A,B,H,I). The region of the alisphenoid comprising theforamen rotundum and ovalis is misshapen, with the foraminafused to form one large irregular opening (Fig. 5E,F). The

remaining anterolateral portion of the lamina obturans and theali-cochlear commissure, connecting the ala temporalis with theotic capsule, appears normal although slightly mispositioneddue to the rotation of the otic region. Finally, the squamous andjugal bones are not obviously affected.

The gonial bone forms in a normal position but is misshapenand in several cases is fused to one or two ectopic bones notpresent in normal skulls (Fig. 5H,I). These novel bones extendfrom the gonial in the direction of the pterygoid, have anextremely irregular and variable shape, and do not resembleany other structure. The variability in size and shape of thisectopic bones is seen between individuals and within the sameindividual between the left and the right side. Examination ofthe skeleton of mutant embryos at 16.5 dpc indicated acontinuity between the proximal end of Meckel’s cartilage(which is disconnected from the malleus) and the lateral-mostportion of the ectopic bone. Thus Meckel’s cartilage and theextranumerary cartilage elements seen at 14.5 dpc contributeto the ectopic bone formation.

At the base of the skull, along the midline, we observe anelongation of the basioccipital bone (Fig. 5A,B), while thebasisphenoid and the presphenoid appear normal. Laterally,the cochlear part of the cartilaginous otic capsule is normalwhile the vestibular part is always reduced, deformed androtated. This alteration is likely to be a consequence of thedeformation affecting the membranous labyrinth hosted within

Fig. 5. Craniofacial defects in newbornDlx5−/− mutant animals. (A,B) Ventralviews of skulls of normal (A) andhomozygous (B) mutant animals afterremoval of the jaw. (A′,B′) Drawingsderived from images A and B of thecranial bones affected in Dlx5 mutantmice: green, unaffected bones; yellow,affected (reduced, rotated or deformed,see text) bones; red, the ectopic bone.(C,D) Dorsal view of normal (C) andhomozygous mutant (D) skulls.(E,F) Details of the region of thePterygoid-Lamina Obturans bones of thebase of the skull, in normal (E) andhomozygous mutant animals (F). Whiteasterisk indicates the ectopic bone.(G) Dissected jaws of normal (left) andhomozygous mutant (right) animals.Note that the coronoid process (arrow) ismissing in the mutant jaw.(H,I) Dissected middle and inner earregion of normal (H) and homozygousmutant (I) newborn animals, stained withAlcian blue-Alizarin. Note the positionof the ectopic bone (asterisk) and themalformation of the labyrinth.(J) Dissected hyoid bone and laryngealcartilages from normal (right) andhomozygous mutant (left) newbornanimals, stained with Alcian blue-Alizarin. Note the reduction of the smallhorns of the hyoid bone (blackarrowheads) and the missing superiorhorns of the thyroid cartilage (blackarrow). Abbreviations: bo, basioccipital; bs, basisphenoid; fo, foramen ovalis; fr, foramen rotundum; ft, frontal; g, gonial; hy, hyoid; ip, interparietal;lo, lamina obturans; mc, Meckel’s cartilage; mx, maxilla; n, nasal; p, parietal; pt, pterygoid; pl, palatine; ps, presphenoid; tr, tympanic ring.

3802

(see below). The mandible is shorter, deformed and lacking thecoronoid process (Fig. 5G).

Turning to the dermatocranial bones forming the roof of theskull, we observe delayed ossification affecting the parietal,interparietal and superoccipital bones, resulting in an openanterior and posterior fontanellae as well as wide cranial sutureswith multiple Wormian bones; the nasal bones are alwaysreduced in length and size (Fig. 5C,D). It is important to notethat Dlx5 (and lacZ in the mutant mice) is expressed in alldifferentiating bone tissue (see later). Defects of dermatocranialbones might derive from a generalized defect in osteogenesis. Inthe mice with exencephaly, the roof bones are missing altogether.

The lesser horns of the hyoid are reduced and rotated from

their normal angle of attachment with the central bonystructure, the bigger horns are less affected, but form a differentangle with the body of the hyoid bone. Finally, the thyroidcartilage lacks its superior horns (Fig. 5J).

The skeleton of the trunk and limbs of Dlx5−/− mice wasfound to be morphologically normal at all stages ofdevelopment and at birth (Fig. 3D-F).

Analysis of Dlx5−−/−− developing brainsDlx5 is expressed in several areas of the forebrain includingthe lateral ganglionic eminence, the septal area, the ventralthalamus and restricted regions within the hypothalamus(Simeone et al., 1994a,b).


Fig. 6. Expression pattern of forebrain markers in frontalsections of Dlx5 mutant embryos at 12.5 dpc.(A-P′) Dlx5+/− (A-P) and Dlx5−/− (A′-P′) embryoshybridized with lacZ (A,A′,F,F′,M,M′), Dlx1(B,B′,G,G′,N,N′), Dlx6 (C,C′,H,H′,O,O′), Tbrain1(D,D′,I,I′), Otx2 (E,E′,J,J′), Otp (K,K′,P,P′) and Shh(L,L′). Abbreviations: se, septal region; mge, medialganglionic eminence; lge, lateral ganglionic eminence;dTe, dorsal telencephalon; dt, dorsal thalamus; vt, ventralthalamus; poa, preoptic anterior area; emt, eminentiathalami; ZLI, zona limitans intrathalamica; mri, massacellularis reuniens pars inferior; pep, posteriorentopeduncolar area; sch, suprachiasmatic area.


In all these areas, Dlx5 is coexpressed with other membersof the Dlx gene family (Simeone et al., 1994a; Bulfone et al.,1993; Rubenstein et al., 1994). In contrast, a number of genesare known to be transcribed in regions adjacent and/orcomplementary to those expressing Dlx5. To evaluate possibleabnormalities in Dlx5−/− developing brains, we analysed at 12.5and 15 dpc the expression pattern of genes transcribed withinthe Dlx5 territory such as Dlx1 and Dlx6 (Simeone et al.,1994a) or bordering the Dlx5 expression domain such asTbrain1, Otx2, Orthopedia (Otp) and Sonic hedgehog (Shh)(Bulfone et al., 1995; Simeone et al., 1993, 1994b; Echelard etal., 1993). In Dlx5+/− embryos, the expression pattern of thelacZ gene fully overlapped that of the normal allele as deducedin adjacent sections (data not shown), thus indicating that lacZexpression only identified Dlx5 transcribing cells. We,therefore, compared the expression pattern of lacZ, Dlx1, Dlx6,Tbrain1, Otx2, Otp and Shh in Dlx5+/− and Dlx5−/− brains at12.5 and 15 dpc.

At 12.5 dpc no obvious difference was detected in theexpression pattern of all these genes, either within the territoryexpressing lacZ (Dlx5) or in the adjacent and complementaryareas (Fig. 6A-P′). In particular, no major difference wasobserved anteriorly, in sections through the dorsaltelencephalon, the medial and lateral ganglionic eminence andthe septal area (Fig. 6A-E′), medially, in sections through thedorsal thalamus, the ventral thalamus and the hypothalamicanterior preoptic area (Fig. 6F-L′) and posteriorly, in sectionsthrough the ventral thalamus, the posterior entopeduncolar areaand the suprachiasmatic area (Fig. 6M-P′). The minordifferences observed were due to a non-perfect orientation ofthe two embryos. To gain insight into the possibility that

abnormalities were generated in the brain of Dlx5−/− embryoslater than 12.5 dpc, the expression pattern of lacZ, Dlx1,Tbrain1, Otx2 and Otp genes was studied at 15 dpc. Also atthis stage, no obvious abnormality was detected in Dlx5 mutantbrain (Fig. 7A-H′). Although these findings fail to highlightany abnormality either in brain territories expressing Dlx5 orin adjacent regions, the possibility that more subtle phenotypescould be detected in more restricted areas or in specific celllineages remains still open.

Altered morphogenesis of the semicircular canalsThe Dlx5/lacZ allele is expressed in the otic pit and later in theotic vesicle starting 8.0 dpc (Fig. 2A). We have thereforeanalyzed the development of the inner ear in mutant animals.

In heterozygous animals, Dlx5/lacZ is initially expressed onthe dorsoposterior region of the otic vesicle and subsequentlyin the semicircular canals and in the endolymphatic duct andvesicle of the vestibular organ (Fig. 8). In Dlx5−/− embryos, thevestibulum is smaller in size and heavily deformed; the threecanals fail to form properly, the anterior and posterior canalsdo not develop and are fused into one single large vesicle, andthe horizontal canal is also reduced (Fig. 8B,D,F). Thedevelopment of the endolymphatic duct is much less affectedby the mutation. The morphology of the sacculus and thecochlea appears essentially normal. Although the lesion waspresent with complete penetrance and was similar betweenindividuals, the severity of the dysgenesis varied amongindividual mutant animals and between both ears withinindividuals. The inner ear epithelium of mutant embryos andnewborn animals appears much thinner compared to thenormal and is composed of large flat cells (Fig. 8G,H). Withinthis mutant epithelium, thickened regions are observed thatmay represent remnants of the cristae ampullaris, which couldnot be recognized. In contrast, the maculae of the utriculus andsacculus appear normal (not shown).

Similar vestibular defects have been observed in micemutant for Nkx-5.1/Hmx3, an NK-related homeobox gene(Hadrys et al., 1998; Wang et al., 1998). In order to evaluatewhether Dlx5 could regulate or be regulated by Nkx-5.1, wehave analyzed the expression of both genes in Dlx5−/− and inNkx-5.1−/− mice (Fig. 8I-N). Inactivation of either gene did notabrogate or profoundly modify expression of the other,excluding the possibility that they control reciprocally theirexpression. Furthermore, while Dlx5 was strongly expressed inthe endolymphatic duct at all stages of development, Nkx-5.1was never expressed in this structure indicating a differentregulation (Fig. 8I-N and data not shown).

Proliferation and apoptosis in Dlx5−−/−− embryosSome features of the Dlx5−/− phenotype may suggest thatproliferation and/or cell survival might be affected in tissuesand structures where Dlx5 is expressed. In order to address thisissue, we studied cell proliferation and survival in Dlx5+/− andDlx5−/− embryos at 10.5 and 11.5 dpc.

Cell proliferation was visualized by a short pulse ofbromodeoxyuridine (BrdU) incorporation and subsequentdetection of BrdU-positive cells. Apoptotic cell death wasstudied by the TUNEL method (Gravieli et al., 1992).

At 10.5 dpc, we concentrated our attention on the branchialarches (Fig. 9A-C′, G-I′), the primordium of the ganglioniceminence (Fig. 9D-F′) and the otic vesicle (Fig. 9J-L′). In

3804

particular, cell proliferation and survival were studied in adjacentsections and compared to the lacZ expression domain. Nosignificant difference was detected in the number of apoptoticcells labelled in the branchial arches (Fig. 9C,C′,I,I′), in theprimordium of the ganglionic eminence (Fig. 9F,F′) and in theotic vesicle (Fig. 9L,L′). A similar result was obtained in otherembryonic districts expressing the Dlx5 gene (data not shown).At 11.5 dpc, as compared to heterozygous or wild-type embryos,the pattern of apoptosis also remained unaltered (data notshown). The number of BrdU-positive cells in Dlx5+/− embryoswas compared to that of Dlx5−/− embryos in the same territory.As revealed in serial adjacent sections through the branchialarches of three embryos for each genotype, the percentage ofproliferating cells detected per unit of surface (see Material andMethods) was unaltered (Fig. 9B,B′,H,H′ and data not shown).In more medial sections, the lacZ expression domain includedthe rostral third of the first branchial arch of Dlx5+/− embryos(Fig. 9G). Interestingly, in the same territory, an increaseddensity of proliferating cells was detected (compare Fig. 9G toH) while, in the rest of the branchial arch, BrdU-positive cellsappeared lower in number (Fig. 9H). As compared to Dlx5+/−

embryos, in Dlx5−/− mutants, the lacZ expression domain wasexpanded into an area including about half or more of the firstbranchial arch (compare Fig. 9G′ to G). Noteworthy, the territorywith the highest density of proliferating cells also resultedexpanded and roughly coincident with the lacZ expressiondomain (compare Fig. 9H′ to G′).

This finding, therefore, suggests that, rather than controllingcell proliferation, Dlx5 is required to define a territory wherethe highest density of proliferating cells is detected. In theabsence of Dlx5, this territory expands and a new boundary is

defined. Cell proliferation was also studied in other districtssuch as the primordium of the ganglionic eminence (Fig. 9E,E′)and the otic vesicle (Fig. 9K,K′). No relevant difference wasdetected in these structures.

The effect of Dlx5 mutation on osteoblastdifferentiationDuring development, Dlx5/lacZ is strongly expressed in allsites of perichondral bone formation (Figs 2R,S, 10A-D). Inthe skeleton, β-galactosidase activity was first detected in theperipheral region of the cartilage model of long bones around13.5 dpc (Fig. 10A). At this stage, expression was confined toa population of osteoblasts located at the periphery of thediaphyseal part of the cartilage model with no labelling of themore centrally located chondrocytes. At later stages, β-galactosidase activity appeared progressively in all bones.Up to 16.5 dpc it could only be detected in periostealpreosteoblasts and osteoblasts. Perinataly, staining of someendosteal cells, presumably endosteal osteoblasts was alsodetected (Fig. 10C). During embryonic development, thecartilage was negative.

Although at a first macroscopic examination bones in mutantembryos appeared normal, histological analysis revealed alesion characterised by the presence of a more complexstructure of the endosteal component of the diaphysis, whichforms an elaborate mesh of woven bone, and by the reductionof the periosteal bone lamina. This defect is more obvious incertain bones, e.g. the ribs, where the endosteal space isstrongly reduced (Fig. 10E,F).

In heterozygous animals, we never detected osteocalcinexpression in the periosteum at birth; periosteal cells of


Fig. 7. Expression patternof forebrain markers infrontal sections of Dlx5mutant embryos at 15 dpc.(A-H′) Dlx5+/− (A-H) andDlx5−/− (A′-H′) embryoshybridized with lacZ(A,A′,E,E′), Dlx1(B,B′,F,F′), Tbrain1(C,C′,G,G′), Otx2 (D,D′)and Otp (H,H′).Abbreviations stand as inthe previous figure plus: st,striatum; spv,supraoptic/paraventriculararea; ah, anteriorhypothalamus.


Dlx5−/− animals were simultaneously stained for Dlx5/lacZ andosteocalcin. This might suggest a role for Dlx5 as a repressorof osteocalcin expression in vivo (Fig. 10G,H).

To check whether any major alteration occurred in genesinvolved in the control of cartilage and bone differentiation,the expression of Cbfa1 and Ihh was analyzed by in situhybridization on matching sections of 16.5 dpc embryoswithout finding any major difference (Fig. 10I-M).

DISCUSSION

We have demonstrated that the homeobox gene Dlx5 plays amajor role in the control of craniofacial structuresmorphogenesis, in the development of the vestibular organ andin bone formation. Newborn homozygous Dlx5−/− animals dieat birth accumulating air in their stomach and intestine.Perinatal death with similar symptomshas been observed in several othermutants with a cleft secondary palateincluding, between others, the twoother Distal-less related genes Dlx1and Dlx2 (Qiu et al., 1995, 1997).

Development of craniofacialstructures requires complexinteractions involving multipleembryonic tissues (Hanken and Hall,1993). Lineage studies mainly carriedout in the chick embryo show thatspecific subpopulations of cranialneural crest (CNC) cells participate incraniofacial morphogenesis. Some ofthese cells are responsible for directbone tissue deposition within thecranial mesenchyme, which thendevelop into bones of thedermatocranium. Other CNC cellsmigrate from the midbrain-hindbrainregion into the pharyngeal arches(Lumsden et al., 1991; Serbedzija et al.,1992; Kontges and Lumsden, 1996)to give rise to specific cranialstructures, either directly (arch-deriveddermatocranium) or through a cartilageintermediate (splanchnocranium)(Trainor and Tam, 1995; Kontges andLumsden, 1996).

The genetic code responsible forthe determination of craniofacialpatterning is now beginning to beelucidated thanks to gene targetingtechnologies (for review see Francis-West et al., 1998).

Our data confirm the observation thatDlx5 is expressed very early on inembryonic development in anteriorregions of the embryo (Yang et al.,1998). During early somite stages,Dlx5 expression is found in a stripe ofcells at the periphery of the neuralplate, which might correspond to the

position of the presumptive premigratory neural crest. Laterexpression continues in cranial neural crest derivatives thatform the mesenchyme of the branchial arches.

The expression territories of Dlx genes within the branchialarches have been determined by in situ hybridization on 10.5dpc embryos (Qiu et al., 1997). At this stage of development,nested expression pattern of Dlx3, Dlx5 and Dlx6 characterizethe distal part of the arch, while Dlx1 and Dlx2 have a largerexpression territory. These data have led to the hypothesis thatDlx genes would have partially redundant functions in thedistal part of the arch. According to this model, Dlx5inactivation should affect, if anything, skeletal elements distalto those observed in the Dlx1 and Dlx2 mutants. In the light ofour results, such model seems only partly true.

Dlx5 inactivation causes defects in skeletal derivatives of thefirst four branchial arches (Table 1). The craniofacial defects thatwe observe are in a sense more ‘distal’ than those produced by

Fig. 8. Defects of the inner ear in Dlx5-deficient mice. (A-F) X-gal stained embryos andnewborn in whole-mount clarified preparations. Semicircular canals and endolymphatic duct ofthe labyrinth of heterozygous (A,C,E) or homozygous Dlx5 mutant (B,D,F) mice. Embryos at10.5 (A,B) and 12.5 (C,D) dpc, or newborn animals (E,F) are shown. Note the reduction in sizeand deformation of the organ. (G,H). Histological appearance of the epithelium lining thesemicircular canals of the labyrinth of normal (G) and homozygous mutant (H) newborn mice.Note the flattening of the vestibular epithelial cells. (I-N) Whole-mount in situ hybridization on9.75 dpc embryos with Dlx5 (I,K,M) or Nkx-5.1 (J,L,N) probes. The genotype of each embryois indicated on the corresponding panel. Abbreviation: ac, anterior canal; ed, endolymphaticduct; hc, horizontal canal; pc, posterior canal; tr, tympanic ring.

3806

Dlx1 and Dlx2 inactivation. In particular, we have not observeddefects of the incus, the jugal and the squamous bones of themaxillary (proximal) portion of the first arch, seen in the Dlx2

mutant. Conversely, the Meckel’s cartilage, the mandible, thetympanic and gonial bones, from the mandibular (distal) part ofthe first branchial arch and the hyoid lesser horn derived fromthe distal part of the second arch are deformed in Dlx5−/− miceand are unaffected in other Dlx mutants. The presence of defectsin derivatives of the mandibular arch of Dlx5−/− animals, wherealso Dlx1, Dlx2, Dlx3 and Dlx6 are expressed at 10.5 dpcsuggests that redundancy between Dlx genes is not generalized,but occurs only in specific cases (e.g. the absence of molars inDlx1 and Dlx2 double mutants). Some craniofacial defectsobserved in Dlx5−/− mice cannot be simply explained by aproximodistal patterning of arch organization. For example, inboth Dlx2−/− and Dlx5−/− mice, defects of the maxilla and thepalatine bones are observed that derive from proximal positionof the maxillary arch where Dlx5 is not expressed at 10.5 dpc(but where is expressed at later stages). In our view, the originof the molecular patterning within the branchial arches shouldbe seen in a more dynamic perspective. Our data show (Figs 2and 8) that the territory of expression of Dlx5 in the firstbranchial arch changes during development. At 9.5 dpc, Dlx5 isexpressed in the distal part of the mandibular portion of the firstarch with low incipient expression in the maxillary arch. In


Fig. 9. Cell proliferation andapoptosis in Dlx5 mutantembryos at 10.5 dpc.(A-L′) Adjacent sagittalsections of Dlx5+/− (A-L) andDlx5−/− (A′-L′) embryosshowing lacZ expressiondomains (A,A′,G,G′,D,D′,J,J′)BrdU-positive cells(B,B′,H,H′,E,E′,K,K′) andTUNEL-positive cells(C,C′,I,I′,F,F′,L,L′)throughout branchial arches(A-C′,G-I′), primordium ofganglionic eminence (D-F′)and otic vesicle (J-L′). Thearrows in C,C′,I,I′,L,L′ pointto single or groups ofapoptotic cells that areidentified in both Dlx5+/− andDlx5−/− embryos. Dots inH,H′ define the boundarybetween lacZ-positive and -negative areas; Dots in C,C′define the border of branchialarches. Abbreviations: fg,foregut; ba, bulbus anteriosus;I and II, first and secondbranchial arches. Note that K′is not exactly adjacent to J′and L′.

Table 1. Defects caused by Dlx5 inactivation in skeletalderivatives of the pharyngeal arches

Affected Unaffected

First arch (maxillomandibular)Maxillary (upper, proximal) portion Pterygoid Jugal

Palatine IncusMaxilla SquamousAlisphenoid

Mandibular (lower, distal) portion Meckel’s cartilage MalleusMandibleTympanicGonial

Second arch (hyoid) Hyoid bone lesser Stapeshorns

Styloid

Third arch Hyoid bone greater horns

Fourth arch Thyroid cartilage superior horns


subsequent stages, the territory of expression rapidly extends sothat, at 10.5 dpc, Dlx5 is expressed along most of the mandibulararch and strongly in the maxillary arch. Precise timing in theexpression of sets of genes interacting in a complexspatiotemporal manner is required to assure correct embryonicdevelopment. Patterning within the branchial arches does notconstitute an exception. To better understand the mode of actionof Dlx genes in controlling craniofacial development, we studiedcell proliferation and survival in the branchial arches of Dlx5+/−

and Dlx5−/− embryos at E10.5 and E11.5. We found thatinactivation of Dlx5 alters the territory with the highest densityof proliferating cells within the first branchial arch. In theabsence of Dlx5, this territory results expanded and a newboundary is defined. Whole-mount in situ analysis of the patternof expression of Msx1 and Msx2, two potential modulators ofDlx5 activity, did not show any major difference between normaland mutant embryos (data not shown). As Dlx genes are mostprobably acting as transcriptional regulators, the identificationand characterization of their targets remains critical for theelucidation of their function.

In the mutant mice, we have also observed a deformation ofbones located along the midline of the base of the cranium (e.g.the basoccipital bone was more elongated). These bones arenot crest derived, the change in their shape might derive by thechange in boundary topological restrains imposed by thesurrounding crest-derived structures. However, one shouldconsider that Dlx5 is expressed in these bones, as in any otherbone, during later phases of osteoblast differentiation (see

later), it is possible that defects observed in midline-locatedbones and in neurocranial bone derive in part from a delay inosteoblast differentiation.

We did not find any obvious malformations in the limbs ofDlx5 mutant animals. In man, DLX5 and DLX6 genes areconsidered as candidate genes for certain types of split hand/footmalformations (SHFM) (for a review see Buss, 1994) since theyare expressed in the developing limb and map to the criticalinterval of SHFM1 on chromosome 7q21.1. Furthermore, insome families, SHFM with complete penetrance is correlated todeletions, inversions or translocations of the chromosomalregion 7q21.3-q21.1 (Scherer et al., 1994). We have recentlyfound (Pfeffer et al., unpublished data) that the first exon ofhuman and mouse DLX6 genes contain a CAG/CCG (poly-glutamine/poly-proline) repeat region with high homology to thetrinucleotide repeat present in the Huntington’s disease gene.This CAG repeat is polymorphic in the normal humanpopulation suggesting that DLX6 could have a role in the controlof limb patterning. Mutation analysis of Dlx6 will possiblycontribute to answer this question.

Dlx5 is one of the first genes to be expressed in the otic pitand later in the lateral wall of the otocyst and in the epitheliumof the vestibular apparatus. Our data show that inactivation ofDlx5 leads to severe malformations of the semicircular canalsof the inner ear. This lesion is in agreement with fate mapstudies that have traced the origin of vestibular cells to thelateral part of the otocyst (Li et al., 1978). Similar vestibulardefects have been observed in mice mutant for Nkx-5.1/Hmx3

Fig. 10. Expression of Dlx5 in developing bones and bonedefects in Dlx5-deficient mice. (A) Dlx5/lacZ pattern ofexpression in a section through the rib of a 13.5 Dlx5+/−

embryo. Staining is present only in the perichondral region.(B) Section through the diaphysis of the tibia at 14.5 dpc.Only preosteoblasts and osteoblasts within the periosteumexpress Dlx5/lacZ. (C) Expression of Dlx5/lacZ in a sectionthrough the growth plate of the tibia of a newborn Dlx5+/−

animal. Activity is seen in the periosteum and in fewendosteal osteoblasts (arrow). (D) Whole-mount X-galstaining of the tibia of a heterozygous animal at birth.(E,F) Histological analysis (Mallory trichromic) of ribs fromnormal (E) or homozygous mutant (F) animals.(G,H) Immunohistochemistry with anti-osteocalcin antibodyon the femur periosteal region from heterozygous (G) andhomozygous (H) mutant mice. Arrows in H indicateperiosteal osteoblasts positive both for Dlx5/lacZ activityand anti-osteocalcin immunoreactivity. Before anti-osteocalcin immunohistochemistry sections G, H weretreated with X-gal. (I-M) In situ hybridization on sectionsthrough the ribs of Dlx5+/− (I,J,L) or Dlx5−/− (K,M) 16.5 dpcembryos. Probes are indicated on the panel. Care was takento choose matching sections corresponding to the same rib,cut at the same level. Abbreviation: c, cartilage; hc,hypertrophic cartilage; po, periosteum; tb, trabecular bone.Magnification A-C, ×250; D, ×8; in E,F, ×80; G,H ×1000.

3808

(Hadrys et al., 1998; Wang et al., 1998). We have excluded thepossibility of a direct cross-regulation between these twogenes. It is, however, still possible that Dlx5 and Nkx-5.1 havea synergistic effect in the control of vestibular morphogenesis,possibly acting on different cellular compartments.

Our data indicate that Dlx5 expression is elevated duringosteoblast differentiation and disappears in fully differentiatedosteocytes. Its expression is more evident in periosteal bone,but is also seen in cells of the endosteal compartment, whichmight represent osteoblasts at a specific stage of differentiation.Dlx5−/− mice show a delayed ossification of dermatocranialbones, which closely resemble that observed in mice in whichone copy of the Cbfa1 gene is inactivated (Otto et al., 1997).The defect in osteogenesis that we observed in Dlx5−/− micesuggests that this gene plays a role in osteoblast differentiationand in bone formation; our data show an increased complexityof the structure of woven bone and a reduction of the periostealbone lamina. The expression of Cbfa1, a key regulator ofosteoblast differentiation, was not affected in Dlx5 mutants.However, we observed an increased osteocalcin expression inthe periosteum suggesting a lesion in osteoblast differentiation.Unfortunately, as the mice died at birth, we could not followthe effect of Dlx5 in later phases of mineralization and duringthe formation of compact bone. The increased osteocalcinexpression in the periosteum observed in mutant animals couldcorroborate the notion that Dlx5 can act as a repressor of theosteocalcin gene (Ryoo et al., 1997); however other morecomplex pathways of regulation cannot be ruled out.

In conclusion, we have shown that Dlx5 has multiple andindependent functions in the patterning of the branchial arches,in the morphogenesis of the vestibular organ and in osteoblastdifferentiation. The next challenge will be to unravel thenetwork of regulations that links this mutation to each of thesephenotypes.

G. L. was supported by grants from Association Pour la Recherchesour le Cancer, ARSEP, AISM, Consiglio Nazionale delle Ricerche(Progetto Finalizzato ‘Biotecnologie’) and Ministero della Sanità. Thesupport from Telethon (Italy) for the project: ‘Use of transgenicmutant mice as a model to study the molecular control of bonedevelopment and peripheral myelination and to develop new genetherapy strategies in the embryo’ (Project D76) is gratefullyacknowledged. A. S. was supported by the Associazione Italiana perla Ricerca sul Cancro (AIRC), the Telethon program (project n. D37),the ‘CNR target project on Biotechnology’, the ‘Murst CNRBiotechnology Programme Legge 95/95’ and the EC BiotechProgramme. L. P. is the recipient of a fellowship from FIRC(Fondazione Italiana Ricerca sul Cancro). We would like to thank MsBarbara Pesce and Dr Maja Adamska for excellent technicalassistance and Dr Caren Gundberg, Yale University, Department ofOrthopaedics for generous gift of anti-osteocalcin antibodies.

REFERENCES

Bulfone, A., Puelles, L., Porteus, M. H., Frohman, M. A., Martin, G. R.and Rubenstein, J. L. R. (1993). Spatially restricted expression of Dlx-1,Dlx-2 (Tes-1), Gbx-2, and Wnt-3 in the embryonic day 12. 5 mouse forebraindefines potential transverse and longitudinal segmental boundaries. J.Neurosci. 13, 3155-3172.

Bulfone, A., Smiga, S. M., Shimamura, K., Peterson, A., Puelles, L. andRubenstein, J. L. R. (1995). T-brain-1: A homolog of Brachyury whoseexpression defines molecularly distinct domains within the cerebral cortex.Neuron 15, 63-78.

Buss, P. W. (1994). Cleft hand/foot: clinical and developmental aspects. J.Med. Genet. 31, 726-730.

Chapman, G., Remiszeski, J. L., Webb, G. C., Schultz, T. C., Bottema, C.D. and Rathjen, P. D. (1997). The mouse homeobox gene, Gbx2: genomicorganization and expression in pluripotent cells in vitro and in vivo.Genomics 46, 223-233.

Cohen, S. M., Brönner, G., Küttner,F., Jürgens, G. and Jäckle, H. (1989).Distal-less encodes a homeodomain protein required for limb developmentin Drosophyla. Nature 338, 432-434.

Echelard, Y., Epstein, D. J., St-Jacques, B., Shen, L., Mohler, J.,McMahon, J. A. and McMahon, A. P. (1993). Sonic hedgehog, a memberof a family of putative signaling molecules, is implicated in the regulationof CNS polarity. Cell 75, 1417-1430.

Francis-West, P., Ladher, R., Barlow, A. and Graveson, A. (1998).Signalling interactions during facial development. Mech. Dev. 75, 3-28.

Gavrieli, Y., Sherman, Y. and Ben-Sasson, S. A. (1992). Identification ofprogrammed cell death in situ via specific labeling of nuclear DNAfragmentation. J. Cell Biol. 119, 493-501.

Hanken, J., and Hall, B. K., (1993). The Skull. Vol. 1: Development. Chicago:University of Chigago Press.

Hadrys, T., Braun, T., Rinkwitz-Brandt, S., Arnold H.-H. and Bober E.(1998). Nkx5-1 controls semicircular canal formation in the mouse innerear. Development 125, 33-39.

Kontges, G. and Lumsden, A. (1996). Rhombencephalic neural crestsegmentation is preserved throughout craniofacial ontogeny. Development122, 3229 – 3242.

Li, C. W., Van de Water, T. R. and Ruben, R. J. (1978). The fate mappingof the eleventh and twelfth day mouse otocyst. J. Morph. 157, 249-268.

Liu, J. K., Ghattas, I., Liu, S., Chen, S. and Rubenstein, J. L. R. (1997).Dlx genes encode DNA-binding proteins that are expressed in anoverlapping and sequential pattern during basal ganglia differentiation. Dev.Dynamics 210, 498-512.

Lumsden, A., Sprawson, N. and Graham, A. (1991). Segmental origin andmigration of neural crest cells in the hindbrain region of the chick embryo.Development 113, 1281-1291.

McGuinness, T., Porteus, M. H., Smiga, S., Bulfone, A., Kingsley, C., Qiu,M., Liu, J. K., Long, J. E., Xu, D. and Rubenstrin, J. L. R. (1996).Sequence organisation and transcription of the Dlx-1 and Dlx-2 locus.Genomics 35, 473-485.

Nakamura, S., Stock, D. W., Wydner, K., Zhao, Z., Minowada, J.,Lawrence, J. B., Weiss, K. M. and Ruddle, F. H. (1996). Genomic analysisof a new mammalian distal-less gene: Dlx 7. Genomics 38, 314-324.

O’Hara, E., Cohen, B., Cohen, S. M. and McGinnis, W. (1993). Distal-lessia a downstream gene of Deformed required for ventral maxillary identity.Development 117, 847-856.

Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C.,Rosewell, I. R., Stamp, G. W., Beddington, R. S., Mundlos, S, Olsen, B.R. and others (1997). Cbfa1, a candidate gene for cleidocranial dysplasiasyndrome, is essential for osteoblast differentiation and bone development.Cell 89, 765-771.

Qiu, M., Bulfone, A., Martinez, S., Meneses, J. J., Shimamura, K.,Pedersen, R. A. and Rubenstein, J. L. R. (1995). Null mutation of the Dlx-2 results in abnormal morphogenesis of proximal first and second branchialarch derivatives and abnormal differentiation in the forebrain. Genes Dev.9, 2523-2538.

Qiu, M., Bulfone, A., Ghattas, I., Meneses, J. J., Christensen, L., Sharpe,P. T., Presley, R., Pedersen, R. A. and Rubenstein, J. L. R. (1997). Roleof the Dlx homeobox genes in proximodistal patterning of the branchialarches: mutations of Dlx-1, Dlx-2, and Dlx-1 and Dlx-2 alter morphogenesisof proximal skeletal and soft tissue structures derived from the first andsecond arches. Dev. Biol. 185, 165-186.

Robertson, E., Bradley, A., Kuehn, M. and Evans, M. (1986). Germ-linetransmission of genes introduced into cultured pluripotent cells by retroviralvector. Nature 323, 445-448.

Robinson, G. W. and Mahon, K. A. (1994). Differential and overlappingexpression domains of Dlx-2 and Dlx-3 suggest distinc roles for Distal-less homeobox genes in craniofacial development. Mech. Dev. 48, 199-215.

Rubenstein, J. L. R., Martinez, S., Shimamura, K. and Puelles, L. (1994).The embryonic vertebrate forebrain: the prosomeric model. Science 266,578-580.

Ryoo, H. M., Hoffmann, H. M., Beumer, T., Frenkel, B., Towler, D. A.,Stein, G. S., Stein, J. L., van Wijnen, A. J. and Lian, J. B. (1997). Stage-specific expression of Dlx-5 during osteoblast differentiation: involvement



in regulation of osteocalcin gene expression. Mol. Endocrinol. 11, 1681-1694.

Scherer, W. S., Poorkaj, P., Massa, H., Soder, S., Allen, T., Nunes, M.,Geshuri, D., Wong, E., Belloni, E., Little, S. and others (1994). Physicalmapping of the split hand/split foot locus on chromosome 7 and implicationin syndromic ectrodactyly. Hum. Mol. Genet. 3, 1345-1354.

Serbedzija, G. N., Bronner-Fraser, M. and Fraser, S. E. (1992). Vital dyeanalysis of cranial neural crest cell migration in the mouse embryo.Development 116, 297-307.

Sham, M. H., Vesque, C., Nonchev, S., Marshall, H., Frain, M., Gupta, R.D., Whiting, J., Wilkinson, D., Charnay, P. and Krumlauf, R. (1993).The zinc finger gene Krox20 regulates HoxB2 (Hox2. 8) during hindbrainsegmentation. Cell 72, 183-196.

Simeone, A., Acampora, D., Mallamaci, A., Stornaiuolo, A., D’Apice, M.R., Nigro, V. and Boncinelli, E. (1993). A vertebrate gene related toorthodenticle contains a homeodomain of the bicoid class and demarcatesanterior neuroectoderm in the gastrulating mouse embryo. EMBO J. 12,2735-2747.

Simeone, A., Acampora, D., Pannese, M., D’Esposito, M., Stornaiuolo, A.,Gulisano, M., Mallamaci, A., Kastury, K., Druck, T., Huebner, K. andBoncinelli, E. (1994a). Cloning and characterization of two members of thevertebrate Dlx gene family. Proc. Natl. Acad. Sci. USA 91, 2250-2254.

Simeone, A., D’Apice, M. R., Nigro, V., Casanova, J., Graziani, F.,Acampora, D. and Avantaggiato, V. (1994b). Orthopedia, a novelhomeobox-containing gene expressed in the developing central nervoussystem of both mouse and Drosophila. Neuron 13, 83-101.

Simeone, A. (1998). Detection of mRNA in tissue sections with radiolabelledriboprobes. In: In situ hybridization. A practical approach. D. G. Wilkinson(ed. ), 2nd edition, pp 69-86, Oxford University Press.

Smith, K. K. and Schneider, R. A. (1998). Have gene knockouts causedevolutionary reversals in the mammalian first arch ? BioEssays 20, 245-255.

Stock, D. W., Ellies, D. L., Zhao, Z., Ekker, M., Ruddle, F. H. and Weiss,K. (1996). The evolution of the vertebrate Dlx gene family. Proc. Natl. Acad.Sci. USA 93, 10858-10863.

Trainor, P. A. and Tam, P. P. L. (1995). Cranial paraxial mesoderm and neuralcrest cells of the mouse embryo: Co-distribution in the craniafacialmesenchyme but distinct segregation in branchial arches. Development 121,2569-2582.

Wallin, J., Wilting, H., Koseki, R., Fistsk, B., Christ, B. and Balling, R.(1994). The role of Pax-1 in axial skeleton development. Development 120,1109-1121.

Wang, W., Van De Water, T. and Lufkin, T. (1998). Inner ear and maternalreproductive defects in mice lacking the Hmx3 homeobox gene.Development 125, 621-634.

Xuan, S., Baptista, C. A., Balas, G., Tao, W., Soares, V. C. and Lai, E.(1995). Winged helix transcription factor BF-1 is essential for thedevelopment of the vertebral hemispheres. Neuron 14, 1141-1152.

Yang, L., Zhang, H., Hu, G., Wang, H., Abateé-Shen, C. and Shen, M. M.(1998). An early phase of embryonic Dlx5 expression defines the rostralboundary of the neural plate. J. Neurosci. 18, 8322-8330.

Zhao, G. Q., Zhao, S., Zhou, X., Eberspaecher, H., Solursh, M. and deCrombrugghe, B. (1994). rDLX, a novel distal-less-like homeoprotein, isexpressed in developing cartilages and discrete neuronal tissues. Dev. Biol.164, 37-51.

Zhang, H., Hu, G., Wang, H., Sciavolino, P., Iler, N., Shen, M. M. andAbate-Shen, C. (1997). Heterodimerization of Msx and Dlx homeoproteinsresults in funtional antagonism. Mol. Cell. Biol. 17, 2920-2932.

craniofacial defects in dlx5-/- mice...craniofacial, vestibular and bone defects in mice lacking the...

Documents