congreso de biotecnología arequipa perú june 2011
TRANSCRIPT
Bioengineering fluorescent tags from phytochromes
found in Thermosynechococcus
elongatusMills CBST Research Project 2011
Presented by Rosa Meza-Acevedo, Alexandria Magallan
Tianling Ou, with support from Susan C. Spiller, PI
Mills College Center for Biophotonics, Science and
Technology (CBST) Bioengineer a fluorescent tag
Easy-to-detect protein marker Respond to different wavelengths of light Reporter of protein expression
Photographs made at CBST – UC Davis
Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html
Bioengineering A Fluorescent Tag
“DNA for fluorescent tag” can be bioengineered. In our work, we have engineered a nucleic acid sequence that will be translated into the fluorescent protein that we want.
Introduce the Bioengineered Fluorescent Tagged protein
into a living cell
Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html
Plasm
id w
ith n
ew D
NA &
tag
Nucleus
Tra
nsfe
cti
on
Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html
Transfected Eukaryotic Cell Containing
Bioengineered Plasmid with Fluorescent tag
Our Research Goal
Bioengineer a small, red fluorescent tag from a cyanobacteriochrome found in Thermosynechococcus elongatus
Develop this tag to be useful in cellular imaging techniques in vitro and eventually in vivo
Our Research Goal
Bioengineer a new red fluorescent tag
Red illumination of the cytoskeleton
Images modified from: cbst.ucdavis.edu
Why make a red fluorescent tag?
Market Fluorescent Tag:
• Proteins from jellyfish• Limited Imaging• Subject to Photobleaching• Longer Amino Acid
Sequence• Produce Reactive Oxygen
molecule
Introducing a New Fluorescent Tag
Market Fluorescent Tag:• Proteins from jellyfish• Limited Imaging• Subject to Photobleaching• Longer Amino Acid Sequence• Produce Reactive Oxygen Molecule
Our New Fluorescent Tag• Proteins from cyanobacteria• Brighter red, better imaging• Not subject to photobleaching• Shorter amino acid sequence
Introducing a New Fluorescent Tag
New fluorescent tag from T. elongatus
Thermophilic cyanobacteria isolated from hot springs in Beppu Japan
Cyanobacteriochromes Homologous genes to classical plant phytochromes
Photoreverse Absorb light energy Active or Non-active state Phytochromes: Red Far-red Cyanobacteriochromes: Blue Green Mutated GAF: red fluorescent
Genes from cyanobacteriochromes T.
elongatus
GAF Domain Phylogenetic Tree
Rockwell, Nathan. Biochemistry (2008)
Schematic model of the GAF domain and its associated
chromophore
Chromophore in the GAF binding pocket of protein
Rockwell, Nathan. Biochemistry (2008)
Procedure
Protein Purification
PCR genomic DNA
Site-Directed Mutagenesis
SDS-PAGE gel and Transblot
Protein Expression
Transfection
Visualization
!
Restriction enzyme and Ligation
Transformation
PCR genomic DNA:
Genomic DNA from T. elongatus and primers are used in PCR to capture GAF domain only, with the appropriate restriction enzyme recognition sequences at each end.
-- Genomic DNA gift from Dr. Ikeuchi, University of Tokyo, and Dr. J. Clark Lagarias, University of California, Davis
Restriction Enzyme and Ligation
After we obtain the GAF domain with recognition sites at each end from PCR, it is digested with the restriction enzymes, and then ligated by annealing to the sticky ends of the pBAD plasmid, which has been prepared by digesting with the same enzyme.
pBAD + inserted GAF domain (569)
Rolling Circle Site-Directed Mutagenesis:
Mutating Cysteine Aspartate Absorb light in the red region Prevent photoreversibility Fluorescence
Mutated plasmid
GGGTTGGCCACAAGCTCGAGATCAGGTAATTGATTGAGCAGGCAGCCAAATGTGCAGATTGCTTACGTCAGGCTGCGGTGCAGTTAAGTGAGTTGCGCGATCGCCAAGCCATTTTTGAGACCCTTGTGGCAAAGGGCCGTGAACTATTGGCCTGCGATCGTGTCATTGTCTATGCCTTTGATGACAACTATGTGGGAACAGTCGTAGCCGAGTCGGTGGCAGAAGGATCCCTGTTTCCGCGAACACTGGGTAGAGGCCTACCGCCAGGGCCGCATTCAAGCCACGACGGATATTTTCAAGGCAGGGCTAACGGAGTGTCACCTGAATCAACTCCGGCCCCTCAAGGTTCGGGCAAATCTTGTCGTGCCGATGGTGATCGACGACCAACTTTTTGGTCTCCTGATTGCCCACCAGTGCAGTGAACCACGCCAGTGGCAGGAGATCGAGATTGACCAATTCAGTGAACTGGCGAGCACCGGCAGCCTTGTCCTGGAGCGTCTCCATTTCCTTGAGCAGCCCGGG
Mutation of Cysteine (C) in the GAF domain of 569T
TGTGAT
Site-Directed Mutagenesis: Example
Absorbing in the red region makes the protein look blue!
Protein Peak
660nm
Red Region
Modified from: http://www.biology.duke.edu/model-system/ymsg/cloning.html
Transformation of E. coli with pBAD + 569TM
insert
E.Coli with pPL plasmid pPL plasmid
Contains genetic information to make PCB Hemoxygenase (Ho1) Reductase (PcyA)
Plasmids used to express the cyanobacteriochrome
569TM
pBAD plasmid + 569TM insert
pPL plasmid
Produce: GAF domain Phycocyanobilin (PCB)
Protein Expression Grow E. coli with pPL + pBAD plasmid in
batches in culture medium Add IPTG Add L-arabinose
E. Coli
Protein Expression Centrifugation results E. coli cells are colored
Protein Purification
Mechanical Cell LysisExtract crude protein from cellsCentrifuge to separate soluble protein from cellsNext Step: Chitin binding
www.diversified-equipment.com
Microfluidizer
http://www.microfluidicscorp.com/
Protein Purification
Column set up
Protein Purification
ChitinBead
ChitinBead
Protein of Interest
Cleave!
Elute
Chitin binding column
SDS-PAGE
The process of using an electric current to separate bands of proteins.
Determine the purity of the isolated protein. Pure protein is indicated by a single
band of a particular size The size of the protein can be
determined
SDS – sodium dodecyl sulfate
Anionic detergent
Proteins denature
Negative charge on proteins
Charged groups
Hydrophobic regions
http://www.bio.davidson.edu/courses/genomics/method/SDSPAGE/SDSPAGE.html#SDS
PAGE – PolyAcrylamide Gel Electrophoresis
Gel restrains large molecules from migrating as fast as smaller molecules
Two gel layers 12% Resolving – pH 8.8 4% Stacking – pH 6.68
Preparing PolyAcrylimide Gel
http://upload.wikimedia.org/wikipedia/commons/7/75/SDS-PAGE_Acrylamide_gel.png - Modified
Running Gel-Electrophoresis
Glass gel cassettes
Electrode assembly
Mini Tank
Inner chamber
Outer Chamber
Protein Sample
Lid
Power Source
Blue = NegativeRed = Positive
http://upload.wikimedia.org/wikipedia/commons/4/46/SDS-PAGE_Electrophoresis.png - Modified
SDS-PAGE Gel Results
Rockwell, Nathan .Biochemistry 2008.
Transblot treated with zinc acetate
Zinc Acetate Reveals Bilin Binding
Comassie stained gel
Rockwell, Nathan .Biochemistry 2008.
Rockwell, Nathan .Biochemistry 2008.
Transfection
The process of introducing nucleic acids into eukaryotic cells
Opening transient pores in the cell membrane to allow the uptake of material
There are biochemical methods and physical methods
Physical Method of Transfection:
Electroporation Use of high-voltage electric pulse
to perturb the cell membrane and form transient pores, introducing DNA
Highly efficient for the introduction of foreign genes in tissue culture cells, especially
mammalian cells
Electroporation
Transfection to Jurkat Cells
Jurkat Cells that are transfected by pDsRed-Monmer-Actin
Plasmid we currently use for transfection
http://www.clontech.com/images/pt/PT3827-5.pdf
Visualizing the Transfected Cells
Deconvolution fluorescence microscope at CBST
A video from CBST, taken on a deconvolution microscope