conditional knockdown of nanog induces apoptotic cell ... · recently, a role for nanog in gonadal...

4011RESEARCH ARTICLE

INTRODUCTIONCore regulators, including Oct4 (Pou5f1 – Mouse GenomeInformatics), Sox2 and Nanog, play key roles in thetranscriptional network that maintains the pluripotent state ofhuman and mouse embryonic stem cells (ESCs). Thehomeodomain transcription factor Nanog is expressed in thenuclei of ESCs in vitro and of morulae, in the inner cell mass(ICM) cells of blastocysts, in the epiblast of E6.5 and E7.5embryos (Chambers et al., 2003; Mitsui et al., 2003; Hatano et al.,2005), and in the primordial germ cells (PGCs) of E8.5-13.5embryos (Hart et al., 2004; Yamaguchi et al., 2005) in vivo.Nanog plays an essential role in the maintenance of thepluripotency of the epiblast shortly after implantation (Mitsui etal., 2003). Overexpression of Nanog promotes the clonalexpansion of mouse ESCs (Chambers et al., 2003) and of ES-somatic hybrid cells (Silva et al., 2006) and enhances the stablepropagation of human and monkey ESCs (Darr et al., 2006;Yasuda et al., 2006).

Nanog is cis-regulated via Octamer and Sox elements in itspromoter region by a synergistic action induced by the binding ofOct4 and Sox2 (Kuroda et al., 2005; Rodda et al., 2005).Furthermore, Sall4 and FoxD3 activate Nanog transcription,

whereas p53 (Trp53) and Tcf3 are implicated in repressing Nanogtranscription (Wu et al., 2006; Pan and Thomson, 2007). It has beenshown that dimer formation by self-association of Nanog throughits C-terminal domain is functionally important (Mullin et al., 2008;Wang et al., 2008), and Nanog-Oct4 protein complexes areassociated with several repressive protein complexes, including theNuRD, Sin3A and Pm1 complexes in mouse ESCs (Liang et al.,2008). Thus, it has been hypothesized that certain key regulatorscontrol Nanog transcription through several independent pathways.However, the molecular mechanism of transcriptional regulation ofNanog in germ cells is not fully understood.

PGCs are first observed in E7.25 embryos at the base of theallantois and in the caudal end of the primitive streak as a groupof 20-25 alkaline phosphatase (ALP)-positive cells. Onsubsequent days, PGCs proliferate and migrate into the hindgutof developing embryos and finally reach, and enter, the genitalridge of E11.5 embryos. After a few further mitotic divisions inthe genital ridge, the developmental pathways of male and femalegerm cells diverge. Thus, the developmental stages of mitoticgerm cells are roughly classified into germ cell specification,migration in developing embryos, and sexual divergence of germcell behavior in gonads. In germ cell specification prior to theinitiation of high-level Nanog expression, Dppa3 (Stella),Fragilis (Ifitm3) and Prdm1 (Blimp1) are key players in themechanism involved in the acquisition of germ cell competence(Hayashi et al., 2007). In post-mitotic spermatogenesis andoogenesis, when dramatic morphological changes occur, a largenumber of differentiation-specific molecules are involved, andloss-of-function mutagenesis through conditionally targeteddisruption by knockout or knockin of these genes often results inimpaired fertility (O’Bryan and de Kretser, 2006; Roy andMatzuk, 2006). However, in migrating PGCs, only a few geneshave been identified as key regulators, including Nanos3 andDnd1 (Tsuda et al., 2003; Youngren et al., 2005). Nanog protein,which is first detected in male and female PGCs of E7.75-8.0embryos, is expressed throughout the migration stages and issubsequently downregulated in the gonads in male and femalemitotic arrest and meiotic germ cells, respectively (Yamaguchi et

Conditional knockdown of Nanog induces apoptotic celldeath in mouse migrating primordial germ cellsShinpei Yamaguchi1, Kazuki Kurimoto2, Yukihiro Yabuta2, Hiroyuki Sasaki3, Norio Nakatsuji4,5, Mitinori Saitou2,* and Takashi Tada1,6,†,‡

The pluripotency factor Nanog is expressed in peri-implantation embryos and primordial germ cells (PGCs). Nanog-deficient mouseembryos die soon after implantation. To explore the function of Nanog in germ cells, Nanog RNA was conditionally knocked downin vivo by shRNA. Nanog shRNA transgenic (NRi-Tg) mice were generated through the formation of germline chimeras with NRi-Tgembryonic stem cells. In E12.5 Cre-induced ER-Cre/NRi-Tg and TNAP-Cre/NRi-Tg double-transgenic embryos, the number of alkalinephosphatase-positive and SSEA1-positive PGCs decreased significantly. In the E9.5 and E10.5 migrating Nanog-knockdown PGCs,TUNEL-positive apoptotic cell death became prominent in vivo and in vitro, despite Oct4 expression. Single-cell microarray analysisof E10.5 Nanog-knockdown PGCs revealed significant up- and downregulation of a substantial number of genes, including Tial1,Id1 and Suz12. These data suggest that Nanog plays a key role in the proliferation and survival of migrating PGCs as a safeguard ofthe PGC-specific molecular network.

KEY WORDS: Nanog, Knockdown, Primordial germ cell, Apoptosis, Mouse

Development 136, 4011-4020 (2009) doi:10.1242/dev.041160

1Stem Cell Engineering, Institute for Frontier Medical Sciences, Kyoto University, 53Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. 2Laboratory forMammalian Germ Cell Biology, RIKEN Center for Developmental Biology, 2-2-3Minatojima-Minamimachi, Chuo-ku, Kobe 650-0047, Japan. 3Department ofIntegrated Genetics, National Institute of Genetics, Research Organization ofInformation and Systems, 1111 Yata, Mishima-shi, Shizuoka 411-8540, Japan.4Development and Differentiation, Institute for Frontier Medical Sciences, KyotoUniversity, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. 5Institutefor Integrated Cell-Material Sciences (iCeMS), Kyoto University, Kyoto 606-8501,Japan. 6JST, CREST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012, Japan.

*Present address: Department of Anatomy and Cell Biology, Graduate School ofMedicine, Kyoto University, Yoshida-Konoe-cho, Sakyo-ku, Kyoto 606-8501, Japan†Present address: Laboratory of Stem Cell Engineering, Stem Cell Research Center,Institute for Frontier Medical Sciences, Kyoto University, 53 Kawahara-cho, Shogoin,Sakyo-ku, Kyoto 606-8507, Japan‡Author for correspondence ([email protected])

Accepted 29 September 2009 DEVELO

PMENT

4012

al., 2005). The predominance of Nanog expression suggests thatit plays an important role in early germ cell development.Recently, a role for Nanog in gonadal germ cells has beensuggested by the contribution of Nanog-null germ cells of E11.5,but not of E12.5, chimeric embryos (Chambers et al., 2007).However, it remains unclear whether the lack of Nanog-null cellsin the gonads of E12.5 chimeric embryos indicates Nanogfunction in gonadal PGCs. It also remains unclear whether theseresults reflect the role of wild-type ES and embryonic cells ingerm cell development. Therefore, it is necessary to investigatethe molecular function of Nanog in germ cells by otherapproaches.

Post-transcriptional gene silencing through RNA interference(RNAi), which is mediated by degradation of RNA complimentary to~20-nt small interfering RNAs (siRNAs) after incorporation into anRNA-induced silencing complex, is widely used to investigate themolecular function of a target gene in cells cultured in vitro(Filipowicz, 2005). Cre/loxP-regulated conditional RNAi of CD8 andp53 mediated by lentiviral vectors has been successfully demonstratedby mating with tissue-specific Cre-expressing transgenic mice in vivo(Ventura et al., 2004). The crucial roles of sprouty2 (Spry2) and CREB(cAMP-responsive element binding protein; Creb1) have beenrevealed by in vivo lentiviral short hairpin RNA (shRNA)-mediatedknockdown (KD) in mice (Shaw et al., 2007; Cheng et al., 2008).Although it is desirable to avoid genetic manipulation of theendogenous gene when analyzing the biological role of genesexpressed in mouse germ cells, in vivo lentivirus-mediated conditionalKD of a germ cell-specific gene has yet to be reported.

Here, we made Nanog shRNA transgenic mice (NRi-Tg) forCre/loxP-mediated conditional KD. These mice were crossed withestrogen receptor (ER; Esr1)-Cre or tissue non-specific alkalinephosphatase (TNAP; Alpl)-Cre transgenic mice. Cre expression isinduced by the administration of tamoxifen (TM) to pregnant micewith E7.5 ER-Cre/NRi-Tg embryos and upregulated in E9.0 TNAP-Cre/NRi-Tg embryos. In both cases, a reduction in the number ofPGCs in E12.5 male and female embryos was apparent. Oct4-independent cell apoptosis was evident by TUNEL staining of E10.5migrating PGCs. Similar to PGCs in vivo, cell death shortly afterNanog KD was detected in PGCs cultured in vitro. A decrease in thenumber of germ cells occurred transiently during germ celldevelopment of some adult TNAP-Cre/NRi-Tg males. Single-cellmicroarray analysis of E10.5 Nanog KD PGCs demonstratedmarked changes at the transcription level in over 700 genes,including several key factors, such as Tial1 (Tiar), Id1 and Suz12.These data demonstrate that Nanog is functionally associated with

the proliferation and survival of migrating PGCs as a safeguard ofthe PGC-specific molecular network in mice. Nanog KD-mediatedapoptotic cell death may be triggered by the disruption of thisorchestrated molecular network.

MATERIALS AND METHODSConstructionsNanog target sequences were designed using pSico-Oligomaker 1.5(http://web.mit.edu/jacks-lab/protocols/pSico.html). A random sequencewas designed as a negative control. The following target sequences werecloned into HpaI/XhoI-digested pSico vector (Ventura et al., 2004):shNanog, 5�-GTTAAGACCTGGTTTCAAA-3�; negative control, 5�-GCCTTCACTCGATGCAATG-3�.

The silent mutant form of Nanog was constructed with pCAG-Nanog(Hatano et al., 2004) by introduction of the mutation into the shRNA targetregion through PCR-mediated nucleotide replacement. pCAG-Mut-Nanogwas co-transfected with pPgk-Neo into NRi ES cells using Lipofectamine2000 (Invitrogen). G418 (250 g/ml)-resistant colonies were cloned andexpanded.

Lentiviral infectionsThe supernatant, which was collected 48 hours after co-transfection of theSIN vector and each packaging vector into HEK 293T cells, was centrifugedat 6000 g for 16-24 hours (Miyoshi et al., 1998). The pellet was dissolved inDulbecco’s modified Eagle’s medium (DMEM) (Sigma) and stored at–80°C. Lentiviral infectivity was estimated by counting GFP-positive cellsafter infection of the titrated supernatants into the 293T cells. Followingovernight culture of ESCs at 1�105 cells per well of a 12-well culture plate(BD Falcon), the cells were infected with the supernatant at MOI15 andcultured overnight. After washing out the virus several times with PBS, theESCs were plated on an inactivated mouse embryonic fibroblast (MEF)feeder layer. GFP-positive cells were cloned and expanded. Expression ofshRNA was induced in vitro by treatment with adenovirus expressing Crerecombinase (AdCre; AxCANCre) (Kanegae et al., 1995).

Culture of ESCs and MEFsMouse R1 ESCs were maintained in DMEM F-12 HAM (Sigma)supplemented with 15% fetal bovine serum (FBS; BioWest), 0.1 mM 2-mercaptoethanol and 400 units/ml recombinant LIF (Chemicon) (ESmedium) on MEF feeder cells inactivated with mitomycin C.

MiceTNAP-Cre and ER-Cre mouse lines were maintained by mating them withC57BL/6J mice. The PCR primer sets for genotyping are summarized inTable 1. C57BL/6J blastocysts, into which the NRi-shRNA-infected ESCswere microinjected, were transferred into the uteruses of pseudo-pregnantICR females. Chimeras were mated with C57BL/6J females, and germlinetransmission to the next generation was checked by coat color and GFPfluorescence. Mice homogenous for the NRi-Tg were detected by genomicPCR with a specific primer set (Table 1). For Cre induction in embryos, 3.0

RESEARCH ARTICLE Development 136 (23)

Table 1. Primers and probes for genomic PCR, qPCR and northern blot analysesPrimer set Forward primer (5� to 3�) Reverse primer (5� to 3�)

TNAP-Cre GGCTCTCCTCAAGCGTATTCAAC CAAACGGACAGAAGCATTTTCCAGER-Cre CTCTAGAGCCTCTGCTAACC CCTGGCGATCCCTGAACATGTCCpSico excision CAAACACAGTGCACACCACGC CGCACAGACTTGTGGGAGAAGInverse PCR 1st GCCAAGTGGGCAGTTTACCG GGCTGCTCGCCTGTGTTGCCInverse PCR 2nd AATGGGCGGGGGTCGTTGGG CCAGCGGACCTTCCTTCCCGCNRi-Wt allele CGTAATGAGATCTGACGTCC GGGAGTCTACACAGCAAACNRi-Tg allele Same as Wt allele GGCTGCTCGCCTGTGTTGCCNanog CTTTCACCTATTAAGGTGCTTGC TGGCATCGGTTCATCATGGTACId1 CAACAGAGCCTCACCCTCTC AGAAATCCGAGAAGCACGAATial1 GGCATGCAAGGAAATGTCTC TTGGCTTTAGTTGGCCTCTCSuz12 AAGGCTAGCATTGTTTGCAC TTGTACCATTCAAATGCTTTATCAGapdh ATGAATACGGCTACAGCAACAGG CTCTTGCTCAGTGTCCTTGCTG

shNanog probe GTTAAGACCTGGTTTCAAA shNC probe GCCTTCACTCGATGCAATG D

EVELO

PMENT

mg TM/40 g body weight was intra-peritoneally injected into pregnant NRi-Tg mice 7.5 or 9.5 days after mating them with ER-Cre males. Experimentswith mice were performed according to the institutional guidelines of KyotoUniversity, Japan.

Blastocyst cultureBlastocysts collected from super-ovulated NRi-Tg mice mated with ER-Cremales were treated with acidic Tyrode’s solution (Sigma) to remove the zonapellucida. Blastocysts attached to the bottom of a gelatin-coated 1-cm wellwere cultured with ES medium for an initial 24 hours and then in thepresence of 1 M 4-hydroxytamoxifen (4OH-TM; Sigma) for 6 days. Eachexpanded blastocyst that was morphologically analyzed was genotyped bygenomic PCR with specific primer sets (Table 1).

PGC cultureFor collection of PGCs, the dorsal mesentery of E10.5 embryos obtained byintercrossing NRi-Tg and ER-Cre transgenic mice was dissociated with0.05% trypsin and 1 mM EDTA for 1 minute at 37°C (Matsui et al., 1992;Kawase et al., 1994). The cells were cultured in PGC medium [DMEM F-12 HAM with 15% FBS, 0.1 mM 2-mercaptoethanol, 400 units/ml LIF, 25ng/ml recombinant human bFGF, and 10 M forskolin (Sigma)] on Sl4-m220 feeder cells inactivated with mitomycin C. One-quarter of the cellsuspension was seeded in each well of a gelatin-coated 1-cm well or acollagen-coated cell-culture chamber slide (BD Falcon) containing feedercells. After 12 hours culture, the PGCs started multiplying in PGC mediumcontaining 5 M 4OH-TM and were harvested at 0, 12, 36 and 60 hours.PGCs fixed with 4% paraformaldehyde (PFA) in PBS for 15 minutes atroom temperature were used for further analyses.

Inverse PCR and sequencingThe integration site of the lentivirus in the NRi-shRNA-ESCs was detectedby inverse PCR as previously described (Li et al., 1999) with minormodifications. ApaI-ApaI genomic DNA fragments of NRi-shRNA-ESCswere self-circularized. Flanking genomic DNA was PCR amplified andcloned into the pGEM-T Easy vector (Promega). DNA sequencesdetermined with a CEQ2000XL DNA sequencer (Beckman Coulter) werealigned using the NCBI BLAST and EBI Ensembl databases.

Northern and western blottingTotal RNA (10 g) isolated from ESCs or embryos using TRIzol(Invitrogen) was separated through 15% polyacrylamide/7M urea gels andelectroblotted to Hybond XL (Amersham). The membrane was hybridizedwith a 32P 5�-end-labeled oligonucleotide probe at 42°C overnight. Themembranes were washed twice in 2�SSC/0.1% SDS at 65°C for 30 minutesand twice in 0.1�SSC/0.1% SDS at 65°C for 15 minutes.

Whole lysate (20 g/lane) of ESCs was separated by 12% SDS-PAGE andtransferred onto a nitrocellulose membrane (Millipore). The membrane wasprobed with anti-Nanog (1:1500 dilution) and anti-histone H3 (1:3000)antibodies at 4°C overnight. The membrane was incubated with a HRP-linkedanti-mouse or rabbit IgG secondary antibody (1/3000, Amersham) for 1 hour.Signals were visualized using the ECL Western Blotting Detection Kit(Amersham).

ImmunohistochemistryImmunohistochemistry analyses of ESCs, PGCs and cryosections (10 m)were performed as described previously (Yamaguchi et al., 2005). Theantibodies used were: anti-Nanog (1:1000; Cosmo Bio), anti-Oct4 (1:100;Santa Cruz), anti-SSEA1 (MC480, 1:1000; DSHB), anti-phospho-histoneH3 (1:2000; Upstate) and TRA98 (1:500; Cosmo Bio; this antibody detectsa mouse testicular germ cell-specific antigen). For counting E12.5 PGCs,~10-15 transverse sections taken at regular intervals throughout the entiregonad were analyzed. For the TUNEL assay, the In Situ Cell DeathDetection Kit (Roche) was used according to the manufacturer’sinstructions. ALP signals in genital ridges and cultured PGCs were detectedusing the ALP staining mixture (Ginsburg et al., 1990).

Single-cell microarray and quantitative (q) PCRE10.5 genital ridges (TM administered at E7.5) were incubated in 0.5 mMEDTA in PBS for 20 minutes at 37°C and then transferred to 2% BSA inPBS. PGCs were released from the genital ridges by piercing with fine glass

needles. PGCs were identified by their morphological characteristics andtransferred into lysis buffer by mouth pipette. PGCs were genotyped withthe remaining genital ridges. The amplified cDNA library of each PGC wasclassified by qPCR-based expression analyses of Nanog, Oct4 and Dppa3(Kurimoto et al., 2007). cDNAs were labeled by in vitro transcription(Affymetrix). The cRNAs were hybridized with the GeneChip MouseGenome 430 2.0 Array (Affymetrix). Data were analyzed using MicrosoftExcel and Multiple Experimental Viewer (MeV) software.

qPCR was performed using the ABI Prism 7700 (Applied Biosystems)and Power SYBR Green PCR Master Mix according to the manufacturer’sinstructions (Applied Biosystems), with gene-specific primer sets (Table 1).Microarray data have been deposited in ArrayExpress (accession numberE-MEXP-2411).

RESULTSGeneration of Nanog-knockdown ESCs andtransgenic miceA temporally and spatially controlled in vivo Nanog KD system wasconstructed with a lentiviral vector for conditional Cre/loxP-regulated RNAi (Ventura et al., 2004). Before Cre recombinaseexpression, the GFP reporter driven by the CMV promoter is widelyexpressed and Nanog shRNA is repressed, whereas after Cre-mediated recombination, GFP is flipped out and Nanog shRNAexpression is then driven by the U6 promoter (Fig. 1A).

The most effective shRNA was introduced by viral infection ofR1 ESCs for establishment of Nanog KD ESCs (NRi-ESCs).Transcription of the shRNA after infection with adenovirus Cre(AdCre) was confirmed by northern blot analysis in NRi-ESCs (Fig.1B). Western blot analyses showed efficient reduction of Nanogexpression to a relative value of 0.14 [compared with AdCre(–) NRi-ESCs] 96 hours after AdCre infection (Fig. 1C). Cre-dependentNanog repression was verified by GFP expression andimmunostaining of Nanog 48 hours after AdCre infection (Fig. 1D).Downregulation of Nanog was detected within the first 24 hours(data not shown). Differentiation of ESCs was detected 96 hoursafter AdCre infection with NRi shRNA, indicating that celldifferentiation was induced 72 hours after Nanog KD (Fig. 1E).Clonal expansion of ESCs was disturbed by transcription of NRishRNA (see Fig. S1A,B in the supplementary material).

shRNA silences a target gene with a completely homologoussequence through a post-transcriptional cleavage mechanism. It hasbeen noted that siRNA often triggers off-target effects, which couldbe caused by unintended RNAi-specific toxic events or cleavage ofan unintended RNA target (Ui-Tei et al., 2008). Cre-dependentexpression of the non-specific negative control shRNA resulted in anormal ESC phenotype (Fig. 1C-E). Disappearance of Cre-dependent NRi shRNA-mediated repression of Nanog andpromotion of differentiation by co-transfection with the silent-mutation form of Nanog (Mut-Nanog) again showed that the NRishRNA was highly specific to Nanog (see Fig. S1B-D in thesupplementary material). Inverse PCR and DNA sequence analysesdemonstrated that the NRi lentiviral vector was integrated betweenCdh2 and Dsc3, near to the proximal region of chromosome 18 (seeFig. S2A in the supplementary material). No known gene wasdisrupted by the lentiviral integration. Therefore, the NRi shRNA-infected ESCs were used for further in vivo experiments.

Nanog shRNA transgenic mice were made by mating a malegermline chimera carrying NRi shRNA-infected ESCs withC57BL/6 females. NRi-Tg founder mice were detected byexpression of GFP (see Fig. S2B in the supplementary material). Bycrossing mice heterozygous for NRi-Tg, homozygous NRi-Tg micewere generated and stably maintained as a transgenic line.

4013RESEARCH ARTICLESafeguard of PGC survival by Nanog

DEVELO

PMENT

4014

Effect of Nanog knockdown on somatic cellsTo further examine possible off-target effects in vivo, we analyzedperi-implantation development of ER-Cre/NRi-Tg double-transgenic embryos generated by mating females homozygous forNRi-Tg with males heterozygous for ER-Cre driven by the CAGpromoter [C57BL/6.Cg-Tg(cre-Esr1)5Amc/J]. In the ER-Cretransgenic embryos and mice, Cre activity is induced by thesynthetic estrogen-like agonist tamoxifen (TM), but not byendogenous estrogens (Hayashi and McMahon, 2002). Zonapellucida-free blastocysts were cultured in the presence of TM for 7days. Each blastocyst that expanded on the bottom of a culture wellwas genotyped by genomic PCR. The ICM cells were poorlydeveloped in the ER-Cre/NRi-Tg double-transgenic embryos,similar to previous findings in Nanog-knockout embryos (Mitsui etal., 2003), whereas ICM cells were well developed in the NRi-Tgsingle-transgenic embryos (Fig. 1F). Furthermore, the normaldevelopment of E12.5 ER-Cre/NRi-Tg double-transgenic embryos,in which Nanog shRNA was transcribed in all tissues of the body(Fig. 2A,C), indicates that no off-target effects were apparent,although one cannot necessarily assume that Nanog knockout andKD result in the same molecular consequences and embryonicphenotypes.

Decrease in PGCs in E12.5 ER-Cre/NRi-Tg embryosTo examine the effect of Nanog KD on early PGC development,NRi-Tg females were mated with ER-Cre males, and then TM (3mg/40 g body weight) was intra-peritoneally administered topregnant mice at 7.5 days post-coitum (dpc) for Cre-dependenttranscription of Nanog shRNA. Normal development, without anyretardation, was observed in the gross external morphology of theE12.5 single ER-Cre and NRi-Tg embryos, and even in the ER-Cre/NRi-Tg double-transgenic embryos (Fig. 2A), in whichtranscription of Nanog shRNA was detected (see Fig. S2C in thesupplementary material).

A striking decrease in the number of ALP+ PGCs was evident bythe sparsity of red-stained cells in the gonads of E12.5 ER-Cre/NRi-Tg double-transgenic embryos, in contrast to the high number ofred-stained cells in the gonads of single-transgenic NRi-Tg embryoscollected from the same littermates (Fig. 2A). Cre activity (excisionas assessed by genomic PCR) was nearly 100% in the liver and~75% in the gonads, although in PGCs it was difficult to determinethe Cre activity precisely.

To calculate the number of PGCs, cells positive for SSEA1(stage-specific embryonic antigen 1; Fut4 – Mouse GenomeInformatics) were counted in transverse sections of E12.5 gonads.In single-transgenic gonads, 43 SSEA1+ PGCs were detected onaverage per section, versus only 14 in the double-transgenic gonads(Fig. 2B). Nanog KD resulted in a ~70% reduction in PGCs in maleand female ER-Cre/NRi-Tg embryos. The majority of SSEA1+

PGCs were negative for Nanog (Fig. 2E). Similarly, in E11.5 ER-Cre/NRi-Tg embryos, the number of ALP+ gonadal PGCs wasmarkedly reduced (see Fig. S3A-C in the supplementary material).

Next, to determine whether Nanog KD induces detrimental effectson early gonadal PGCs, TM was administered at 9.5 dpc to pregnantNRi-Tg mice that had been mated with ER-Cre Tg males.Interestingly, no decrease in ER-Cre/NRi-Tg PGCs was observed atE12.5 by ALP staining (Fig. 2C,D), irrespective of the repression ofNanog in SSEA1+ PGCs (Fig. 2E). These data indicate that Nanogmainly plays a role in migrating PGCs, but not in gonadal PGCs.

Decrease in PGCs in TNAP-Cre/NRi-Tg embryosTo verify the function of Nanog in migrating PGCs, NRi-Tg micewere mated with the PGC-specific Cre recombinase transgenic mouseline TNAP-Cre, which was generated by knockin of Cre into theTNAP (Alpl) locus. Cre excision was first detected in early PGCs atE9.0, and Cre activity in PGCs was detected in ~50% of E13.5 PGCs(Lomeli et al., 2000). E12.5 TNAP-Cre/NRi-Tg, NRi-Tg, TNAP-Creand wild-type embryos developed normally (Fig. 2F). When E12.5TNAP-Cre/NRi-Tg double- and single-transgenic embryos werecompared, the intensity of staining of ALP+ cells was drasticallyreduced in the TNAP-Cre/NRi-Tg gonads (Fig. 2F). To estimate thenumber of PGCs, SSEA1+ cells were counted in each transversesection of the E12.5 gonads. The number of PGCs in the TNAP-Cre/NRi-Tg gonads was half that in the control gonads (Fig. 2G).

Immunohistochemical analysis demonstrated that SSEA1+ PGCswere frequently Nanog– in the TNAP-Cre/NRi-Tg gonads, whereasthe majority of SSEA1+ PGCs were Nanog+ in the controls (Fig.2H), indicating that Nanog KD resulted in a reduction in PGCs, asseen in ER-Cre/NR1-Tg transgenic mice.

Decrease in proliferation and increase in celldeath in PGCs in vivoTo examine the sequential expression of PGC markers, cellproliferation and apoptosis during migration, immunohistochemicalanalyses and TUNEL assays were performed in E9.5 and E10.5 ER-


Fig. 1. Effect of Nanog shRNA on the differentiation of mouseESCs and blastocysts. (A)Lentiviral vector for conditional Cre/loxP-regulated RNAi of Nanog. (B)Transcription of NRi-shRNA in ESCderivatives 96 hours after adenovirus Cre (AdCre) infection as assessedby northern blotting. (C)The efficiency of NRi-shRNA in ESC derivatives96 hours after AdCre infection as assessed by western blotting. HistoneH3 was used as a loading control. (D)Suppression of Nanog by NRi-shRNA 48 hours after AdCre infection. (E)Induction of ESCdifferentiation by NRi-shRNA 96 hours after AdCre infection.(F)Outgrowth of the inner cell mass cells of blastocysts cultured for 7days with 4-hydroxytamoxifen. NC, non-specific shRNA as a negativecontrol.

DEVELO

PMENT

Cre/NRi-Tg double-transgenic embryos and their littermates. AtE9.5 and E10.5, the gross morphology of the ER-Cre/NRi-Tgdouble-transgenic embryos was normal. No sex-specific differenceswere detected.

At E9.5 (2 days after TM administration), Nanog–/SSEA1+

migrating PGCs were detected in the ER-Cre/NRi-Tg double-transgenic, but not NRi-Tg, embryos (Fig. 3A). The number ofNanog+/SSEA1+ PGCs was significantly reduced (to ~70%; Fig.3B). At E10.5 (3 days after TM administration), Nanog–/SSEA+

PGCs were more abundant in the ER-Cre/NRi-Tg embryos ascompared with the control embryos (Fig. 3C). Nanog+/SSEA1+

PGCs were markedly decreased (to ~40%; Fig. 3D). An importantfinding was that the number of TUNEL+ PGCs noticeably increasedin the ER-Cre/NRi-Tg embryos. TUNEL+/SSEA1+ PGCs were firstdetected in E9.5 PGCs (Fig. 4A,B), and at E10.5 their abundancewas about three times that in the control PGCs (Fig. 4C,D). Thenumber of PGCs positive for the mitotic marker phosphorylated-histone H3 was significantly lower in ER-Cre/NRi-Tg than incontrol embryos (Fig. 4E). Notably, the majority of SSEA1+/Oct4+

PGCs were positive for Nanog in the control embryos, whereasalmost half were negative for Nanog in the ER-Cre/NRi-Tg embryos(Fig. 4F). Thus, the majority of E7.5 TM-treated Nanog–/TUNEL+

apoptotic PGCs stopped migrating before entry into the genitalridges.

Cre-mediated recombination is detectable in embryos within 24hours of TM administration to pregnant mice (Hayashi andMcMahon, 2002). Taking this into consideration, following Cre-

mediated recombination within the first day after TM injection atE7.5, Nanog–/Oct4+/SSEA1+/TUNEL– PGCs had appeared by thesecond day. Within the next 24 hours, apoptosis occurred in PGCsmarked as Nanog–/SSEA1+/TUNEL+ (Fig. 4A,B). Oct4 expressionwas observed in all Nanog–/SSEA1+ PGCs, but not TUNEL+ PGCs(data not shown). Following TM injection at E9.5, Nanog KD didnot occur sufficiently in E10.5 migrating PGCs, while inducedmarkedly with no significant reduction in the number of E12.5gonadal PGCs (Fig. 5A-C), suggesting that Nanog function isdispensable for the survival of gonadal PGCs (Fig. 2C-E). Theeffects on PGC development of Nanog KD induced by TM injectionat E7.5 and E9.5 are summarized in Fig. 5D.

Decrease in proliferation and increase in celldeath in PGCs in vitroTo examine whether the reduction in PGCs was caused by the deathor differentiation of PGCs, dissociated gonads of E10.5 embryoswere cultured on inactivated Sl4-m220 cells expressing themembrane-associated form of steel factor (kit ligand) with culturemedium containing leukemia inhibitory factor (LIF), basic fibroblastgrowth factor (bFGF) and forskolin (Koshimizu et al., 1996). Theproliferation of PGCs was clearly repressed in the ER-Cre/NRi-Tgdouble-transgenic PGCs as compared with control PGCs after 12hours of culture in the presence of TM (Fig. 6A). Although a gradualdecrease in the number of ALP+ PGCs was observed even in thecontrol embryos from 12 to 60 hours after TM administration, ER-Cre/NRi-Tg PGCs were significantly less abundant than control


Fig. 2. Reduction in the number of PGCs in E12.5 ER-Cre/NRi-Tg and TNAP-Cre/NRi-Tg embryos. (A)Reduction in the number of alkalinephosphatase (ALP)-positive PGCs in E12.5 ER-Cre/NRi-Tg genital ridges. Tamoxifen was injected into pregnant mice at 7.5 dpc (TM7.5). (B)Thenumber of SSEA1+ PGCs in E12.5 ER-Cre/NRi-Tg and single-transgenic embryos from TM7.5. (C)There was no reduction in ALP+ PGCs in E12.5 ER-Cre/NRi-Tg genital ridges. TM was injected into pregnant mice at 9.5 dpc (TM9.5). (D)There was no difference in the number of SSEA1+ PGCs inE12.5 ER-Cre/NRi-Tg and single-transgenic embryos from TM9.5. (E)Expression of Nanog in SSEA1+ PGCs of E12.5 ER-Cre/NRi-Tg embryos.Transverse sections of E12.5 genital ridges were immunostained. The circles delineate genital ridges. No GFP signal was detected in thecryosections. (F)Reduction in ALP+ PGCs in E12.5 TNAP-Cre/NRi-Tg genital ridges. (G)The number of SSEA1+ PGCs in E12.5 TNAP-Cre/NRi-Tg andsingle-transgenic embryos. (H) Expression of Nanog in SSEA1+ PGCs of E12.5 TNAP-Cre/NRi-Tg embryos. The circles delineate genital ridges. No GFPsignal was detected in the cryosections. *P<0.01, **P<0.05. Error bars, s.e.m.

DEVELO

PMENT

4016

PGCs. Notably, immunocytochemical analyses revealed that Nanogexpression was repressed in the ER-Cre/NRi-Tg, but not in the NRi-Tg. PGCs 12 and 36 hours after TM administration (Fig. 6B). From12 to 36 hours after TM administration, TUNEL+ cells wereprominent in the ER-Cre/NRi-Tg embryos but not in the controlembryos (Fig. 6C). The number of SSEA1+/TUNEL+ PGCs in theER-Cre/NRi-Tg embryos was about twice that in the NRi-Tg controlembryos (Fig. 6D). Nanog–/Oct4+ PGCs were often detected in theER-Cre/NRi-Tg culture, but not in the control, 12 and 36 hours afterTM administration (see Fig. S4A in the supplementary material).The number of PGCs positive for the mitotic marker phosphorylatedhistone H3 was significantly reduced in ER-Cre/NRi-Tg PGCs (seeFig. S4B,C in the supplementary material). Cre-mediatedrecombination was efficiently induced in more than 50% and nearly100% of MEFs 12 and 24 hours after culture in the presence of TM,respectively (see Fig. S4D in the supplementary material).Differentiation of ESCs was induced 72 hours after Nanogrepression (Fig. 1E), suggesting that apoptotic cell death prior to celldifferentiation was induced within 24 hours of Nanog repression inPGCs.

Effect of Nanog knockdown on adult gonadsAfter injection of TM at 3 mg/40 g body weight to 7.5 dpc pregnantfemales, embryos developed normally until E13.5 but died in thesecond semester of pregnancy, although most embryos were viableand developed normally until E13.5. Thus, the testes or ovaries of6-week-old TNAP-Cre � NRi-Tg F1 mice were analyzedmorphologically and immunohistochemically. The testes, but not theovaries, tended to be smaller in the TNAP-Cre/NRi-Tg double-

transgenic embryos than in the control embryos, although both thetestes and ovaries varied in size (see Fig. S5A,B in thesupplementary material).

In two out of six testes examined from 6-week-old TNAP-Cre/NRi-Tg adults, spermatogonia, marked as TRA98+ germ cells,were dissociated from the tubule wall and scattered in the emptytubules (see Fig. S5C in the supplementary material). These featuresare observed in germ cells undergoing mitotic division in pre-pubescent newborn mice, demonstrating that developmentalretardation of the seminiferous tubule in some regions of adult testesmay be caused by the loss of Nanog– germ cells during the peri-gonadal stage. Consistently, the number of TRA98+ germ cells inTNAP-Cre/NRi-Tg newborn (P1) testes was reduced (see Fig.S5D,E in the supplementary material).

No significant difference in the number of oocytes was detectedin 6-week-old TNAP-Cre/NRi-Tg versus control mice byimmunostaining of cryosections with anti-Oct4 antibody (data notshown).


Fig. 3. Expression of Nanog in migrating PGCs in E9.5 and E10.5ER-Cre/NRi-Tg embryos. (A)Expression of Nanog in SSEA1+ PGCs ofE9.5 ER-Cre/NRi-Tg mouse embryos. (B)The proportion of Nanog+

PGCs in SSEA1+ PGCs in E9.5 ER-Cre/NRi-Tg embryos. (C)Expression ofNanog in SSEA1+ PGCs of E10.5 ER-Cre/NRi-Tg embryos. (D)Theproportion of Nanog+ PGCs in SSEA1+ PGCs in E10.5 ER-Cre/NRi-Tgembryos. The arrowheads indicate SSEA1+ PGCs. The circles indicateSSEA1+/Nanog– PGCs. *P<0.01, **P<0.05. Error bars, s.e.m.

Fig. 4. Apoptosis and proliferation of Nanog-negative migratingPGCs in E9.5 and E10.5 ER-Cre/NRi-Tg embryos after E7.5tamoxifen administration. (A)TUNEL assay in E9.5 ER-Cre/NRi-Tgmouse embryos. The arrowheads indicate SSEA1+/TUNEL+ PGCs. (B)Theproportion of TUNEL+ cells in SSEA1+ PGCs in E9.5 ER-Cre/NRi-Tgembryos. (C)TUNEL assay in E10.5 ER-Cre/NRi-Tg embryos. Thearrowheads indicate SSEA1+/TUNEL+ PGCs. (D)The proportion of TUNEL+

cells in SSEA1+ PGCs in E10.5 ER-Cre/NRi-Tg embryos. (E)The proportionof phosphorylated histone H3+ cells in SSEA1+ PGCs of E10.5 ER-Cre/NRi-Tg embryos. (F)Expression of Oct4 in Nanog– PGCs of E10.5 ER-Cre/NRi-Tg embryos. Arrowheads indicate Oct4+/SSEA1+ PGCs. Circles indicateNanog– PGCs. *P<0.01, **P<0.05. Error bars, s.e.m.

DEVELO

PMENT

Changes in gene expression profile upon Nanogknockdown in each PGCTo explore the molecular mechanism involved in apoptotic celldeath by Nanog KD, the global gene expression profile of eachE10.5 PGC was analyzed by a single-cell microarray assay(Kurimoto et al., 2007). A PGC-specific cDNA library wasidentified by RT-PCR of Oct4 and Dppa3 (Fig. 7A). The librarieswere classified into Nanog low [Nanog (L)] and Nanog high[Nanog (H)] by qPCR. Hybridization with the amplified cDNAsto the Affymetrix GeneChip Mouse Genome 430 2.0 Array(Affymetrix) demonstrated that 759 out of 45,101 probes weresignificantly different between Nanog (L) and (H) in their relativeexpression level (P<0.05; greater than 2-fold change) (Fig. 7B).No change was detected in the Oct4 expression level betweenNanog (L) and (H), in agreement with immunostaining (Fig. 4F).Furthermore, Sox2, Dppa3, Sll4, Kit, Dnd1, Zfp42 (Rex1), Prdm1,Utf1 and Klf5 were highly transcribed even in Nanog (L) PGCs,similar to in control PGCs. The expression of a few genes in thedevelopment and lineage-annotated sequences in the geneontology list (Affymetrix) had changed in the Nanog (L) PGCs(see Fig. S6A in the supplementary material). These data suggestthat Nanog KD leads PGCs to apoptotic cell death and not todifferentiation. Notably, the expression level of some genes wassignificantly up- or downregulated (Fig. 7C; see Table S1 in thesupplementary material). For example, those encoding the RNA-binding protein Tial1 (Beck et al., 1998), helix-loop-helix (HLH)family protein Id1 (Norton et al., 1998) and Polycomb repressivecomplex 2 (PRC2) subunit Suz12 (Lee et al., 2006), weremarkedly repressed in Nanog (L) PGCs. Disruption of the PGC-specific molecular network, at least that due to downregulation ofthese key genes, might trigger prompt mitotic arrest and cell death(Fig. 7D).

Some genes downstream of Nanog (Kim et al., 2008) were up-or downregulated in Nanog (L) PGCs (see Fig. S6B in thesupplementary material). The significant decrease in Id1transcription was verified by qPCR with a single-cell cDNAlibrary (see Fig. S7A in the supplementary material). Although themechanism of transcriptional regulation of Id1, which bypassesthe BMP/phosphorylated Smad pathway (Dudley et al., 2007), isunclear, Id1 might be directly downstream of Nanog in PGCs,as shown by the binding of Nanog to Id1 in ESCs (Kim et al.,2008).

DISCUSSIONNanog is expressed not only in the pluripotential cells of peri-implantation embryos, but also in the migrating and early gonadalPGCs of post-implantation embryos (Yamaguchi et al., 2005). A keyfunction of Nanog at the peri-implantation stage is to maintain thepluripotency of early embryonic cells, as revealed in Nanog-deficient embryos produced by genetic disruption of Nanog (Mitsuiet al., 2003). Here, to investigate the function and mechanism ofNanog in PGCs, we constructed the NRi-Tg transgenic line, inwhich Nanog activity is controlled in vivo through inducibletranscription of Nanog-specific shRNA with a pSico lentiviral vector(Ventura et al., 2004). In combination with two independent Cre-expressing transgenic lines, ER-Cre and TNAP-Cre, Cre expressionbeginning at ~E8.5-9.0 resulted in a significant reduction in the


Fig. 5. Effects of E9.5 tamoxifen administration on ER-Cre/NRi-TgPGCs. (A) The efficiency of Cre-mediated recombination in the genitalridges of E10.5 and E12.5 ER-Cre/NRi-Tg mouse embryos after E7.5and E9.5 tamoxifen administration. Pre, pre- recombination; Post, post-recombination. (B) Nanog expression in SSEA1+ PGCs of E10.5 ER-Cre/NRi-Tg embryos after TM9.5. The arrowhead indicates a Nanog–

PGC. (C) The proportion of Nanog+ cells in SSEA1+ PGCs in E10.5 ER-Cre/NRi-Tg embryos. *P<0.01. Error bars, s.e.m. (D)Induction of Nanogknockdown and apoptosis by TM7.5 and TM9.5.

Fig. 6. Effects of Nanog knockdown on PGC development inculture in vitro. (A)The relative number of ER-Cre/NRi-Tg double-transgenic to single-transgenic PGCs after 12, 36 and 60 hours ofculture with TM. PGCs were detected by ALP staining. (B)Repression ofNanog 12 hours after TM treatment. (C)TUNEL staining of PGCs after36 hours of culture with TM. Arrowheads indicate TUNEL+ PGCs.(D)The proportion of TUNEL+ cells in SSEA1+ PGCs after 36 hours ofculture with TM. *P<0.01. Error bars, s.e.m.

DEVELO

PMENT

4018

gonadal PGCs of E12.5 male and female embryos.Immunohistochemical analyses of the migrating PGCs of E9.5 andE10.5 TM-administered ER-Cre/NRi-Tg embryos demonstratedthat Nanog–/Oct4+ PGCs were first detected at E9.5, and thenNanog–/TUNEL+ PGCs appeared at E10.5. The immediateinduction of cell apoptosis following Nanog repression in PGCscultured in vitro suggests that cell death, but not cell differentiation,is the key reason for the decrease in PGC numbers. The adult TNAP-Cre/NRi-Tg males and females were fertile. Notably, some maleTNAP-Cre/NRi-Tg adult mice showed partially retardeddevelopment of the seminiferous tubule. A single-cell microarrayanalysis revealed that changes in gene expression, includingdownregulation of Tail1, Id1 and Suz12, were associated withapoptotic cell death of Nanog KD PGCs. Our data provideconclusive evidence that (1) Nanog is required for the survival of

migrating PGCs, (2) a deficiency in Nanog triggers apoptosis but notcell differentiation in PGCs, and (3) Nanog is involved insafeguarding the PGC molecular network.

The use of an inducible KD system without genetic alteration ofthe endogenous gene is a powerful tool for analyzing the molecularfunction of a possibly heteroinsufficient germ cell-specific gene.This is the first report of a successful conditional KD of a germ cell-specific gene in vivo. A conditional KD system is quicker to buildthan a conventional conditional knockout system, although possibleoff-target effects have to be carefully examined in order to avoid anoverestimation of gene function resulting from non-specific genesilencing.

In migrating germ cells, only a few genes have been identified askey regulators. Following germ cell specification, Nanog, Kit, Tial1,Nanos3 and Dnd1 are known to be highly transcribed in migratingPGCs (Beck et al., 1998; Tsuda et al., 2003; Youngren et al., 2005;Yamaguchi et al., 2005). Kit plays a crucial role in the survival ofmigrating PGCs (Loveland and Schlatt, 1997). Tial1-deficient miceare sterile owing to the loss of PGCs at ~E11.5 (Beck et al., 1998).Knockout of Nanos3 results in the complete loss of PGCs in bothsexes in E12.5 embryos (Tsuda et al., 2003). A similar phenomenonwas detected after germ cell-specific knockout of Oct4. Oct4-deficient PGCs undergo apoptosis, and a marked reduction in PGCsis detected in E10.5-12.5 embryos (Kehler et al., 2004). Importantly,a common consequence of the loss of gene expression is apoptoticcell death, not cell differentiation. Single-cell microarray analysisdemonstrated that abnormal transcription of various types of coreregulators, including the RNA-binding protein Tial1, differentiationinhibitor Id1, and PRC2 subunit Suz12, occurred within 24 hours ofNanog downregulation in E10.5 PGCs. Notably, the absence of anysignificant change in the expression level of genes downstream ofId1 and Suz12 suggests that the prompt cell death response might beinduced by abrupt disruption of the PGC molecular network prior tothe disordered expression of peripheral genes. Thus, we speculatethat the apoptotic cell death of PGCs is triggered by ‘disharmony’ inthe gene regulation network. The molecular mechanism involved inmonitoring ‘harmony’ in the PGC molecular network is unclear. Itis also unknown whether the apoptosis of Nanog (L) PGCs dependson the Bax pathway, as reported in Steel (Kitl)-deficient (Runyan etal., 2006) and Nanos3-deficient (Suzuki et al., 2008) PGCs.Apoptotic cell death triggered by a deficiency in any core gene,including Nanog, might play an important role in preventing thetransmission of abnormal genetic information to the next generation.

An interesting point is that Oct4 and Nanog exhibit similar dualphysiological roles, which are essential for maintaining pluripotencyin early embryonic cells and for supporting survival in migratingPGCs. It is still unclear why a deficiency in Nanog and Oct4 inducesa distinctive phenotype in early embryonic cells and PGCs. Apossible explanation is that the molecular network supporting theproperties of pluripotent embryonic cells differs from that ofunipotent PGCs (Kato et al., 1999). In pluripotent embryonic cells,differentiation-associated genes may be ready to be transcribedquickly following the downregulation of pluripotent guardian genesincluding Nanog and Oct4, whereas in unipotent PGCs, which arespecialized toward generating germ cells through tight epigeneticregulation of gene activation and silencing, a defect in the PGC-specific molecular network triggered by a lack of Nanog or Oct4may cause apoptosis without the alternative option of trans-lineagedifferentiation. We found no evidence that Nanog– PGCsdifferentiated into another type of somatic cell instead of undergoingapoptosis, although apoptosis and differentiation are induced in theICM cells of Nanog-deficient blastocysts (Silva et al., 2009). In this


Fig. 7. Single-cell microarray analysis of E10.5 ER-Cre/NRi-TgPGCs. (A)Scheme of the single-cell microarray analysis. (B)Comparisonof global gene expression profiles, shown as a heat map. Genes thatshow a greater than 2-fold change in Nanog (L) versus Nanog (H) PGCsare represented. (C)Changes in the expression of selected genesbetween Nanog (L) and Nanog (H) PGCs. The ontology of the genes issummarized in Table S1 in the supplementary material. (D)A model ofthe molecular network involved in PGC survival and apoptosis inducedby Nanog knockdown.

DEVELO

PMENT

context, the fate of migrating PGCs may be strictly determined bythe fixed transcriptional circuitry regulated by stable epigeneticmodifications that is inappropriate for trans-differentiation tosomatic cells.

Id1 is downstream of the BMP/phosphorylated Smad pathwayand functions as a dominant-negative binding factor for HLH genes(Norton et al., 1998). However, phosphorylated Smad1, 5 and 8 arenot detected in migrating PGCs (Dudley et al., 2007). Thus, Id1 hasto be upregulated by another pathway. Considering that Nanog bindsto the upstream sequence of Id1 in ESCs, as determined by ChIP-on-chip analysis (Kim et al., 2008), and that Id1 is downregulated inNanog (L) PGCs, as revealed by single-cell microarray analysis (seeFig. S7B in the supplementary material), one may suggest thatNanog is involved in the regulation of Id1 in PGCs.

Oct4 and Sox2 activate Nanog expression through binding to theOctamer/Sox elements upstream of the transcription start site(Kuroda et al., 2005; Rodda et al., 2005), although fulltranscriptional regulation of Nanog is complicated by its associationwith many other regulatory factors. In Oct4-deficient PGCs, it is notevident whether Nanog and Sox2 are expressed appropriately(Kehler et al., 2004). It is possible that apoptosis of the Oct4-deficient PGCs might be detected as a consequence of the promptrepression of Nanog, which is downstream of Oct4. Apoptosis ofNanog–/Oct4+ PGCs in our KD analyses clearly demonstrated thatOct4 expression is insufficient to prevent apoptosis in Nanog-deficient PGCs.

Interestingly, Nanog-null ESCs can self-renew indefinitely withan undifferentiated status, although they are prone to differentiation,suggesting that Nanog stabilizes ESCs in culture by resisting orreversing alternative gene expression programs (Chambers et al.,2007). Nanog-null ESCs have the potential to generate chimericfetuses and adults through multi-lineage differentiation in somaticcells, indicating that Nanog expression is not required for thedevelopment and maturation of somatic tissues. In germ cells, thecolonization of Nanog-null cells was detected in the PGCs of thegenital ridges of E11.5, but not E12.5, chimeric embryos (Chamberset al., 2007). This finding differs from our present observation thatNanog-deficient PGCs start dying due to apoptosis within 48 hoursof Nanog KD during the migrating stages. Survival of the Nanog-null PGCs in E11.5 chimeras could be a consequence ofcompensation by other transcriptional circuitries acquired in ESCculture (Chambers et al., 2007). This would explain the discrepancythat Nanog KD in normal ESC lines induces cell differentiation (Fig.1E) (Hough et al., 2006), whereas selected Nanog-null ESCsmaintain a capability for self-renewal and pluripotency. Notably,Nanog is specifically required for the proliferation and survival ofmigrating PGCs of wild-type embryos.

AcknowledgementsWe thank Dr Tyler Jacks for the pSico vector, Dr Hideki Enomoto for the ER-Cretransgenic mouse, Dr Masakazu Hattori for the AdCre adenovirus, and DrsYoshio Koyanagi and Jun Aoki for instructions for lentivirus manipulation. Thiswork was partly funded by grants from the Japan Society for the Promotion ofScience, the Ministry of Education, Culture, Sports, Science and Technologyand the Core Research for Evolutional Science and Technology (Japan Scienceand Technology Agency) to T.T.

Supplementary materialSupplementary material for this article is available athttp://dev.biologists.org/cgi/content/full/136/22/4011/DC1

ReferencesBeck, A. R., Miller, I. J., Anderson, P. and Streuli, M. (1998). RNA-binding

protein TIAR is essential for primordial germ cell development. Proc. Natl. Acad.Sci. USA 95, 2331-2336.

Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S. andSmith, A. (2003). Functional expression cloning of nanog, a pluripotencysustaining factor in embryonic stem cells. Cell 113, 643-655.

Chambers, I., Silva, J., Colby, D., Nichols, J., Nijmeijer, B., Robertson, M.,Vrana, J., Jones, K., Grotewold, L. and Smith, A. (2007). Nanog safeguardspluripotency and mediates germline development. Nature 450, 1230-1234.

Cheng, J. C., Kinjo, K., Judelson, D. R., Chang, J., Wu, W. S., Schmid, I.,Shankar, D. B., Kasahara, N., Stripecke, R., Bhatia, R. et al. (2008). CREB isa critical regulator of normal hematopoiesis and leukemogenesis. Blood 111,1182-1192.

Darr, H., Mayshar, Y. and Benvenisty, N. (2006). Overexpression of NANOG inhuman ESCs enables feeder-free growth while inducing primitive ectodermfeatures. Development 133, 1193-1201.

Dudley, B. M., Runyan, C., Takeuchi, Y., Schaible, K. and Molyneaux, K.(2007). BMP signaling regulates PGC numbers and motility in organ culture.Mech. Dev. 124, 68-77.

Filipowicz, W. (2005). RNAi: the nuts and bolts of the RISC machine. Cell 122, 17-20.

Ginsburg, M., Snow, M. H. and McLaren, A. (1990). Primordial germ cells in themouse embryo during gastrulation. Development 110, 521-528.

Hart, A. H., Hartley, L., Ibrahim, M. and Robb, L. (2004). Identification, cloningand expression analysis of the pluripotency promoting Nanog genes in mouseand human. Dev. Dyn. 230, 187-198.

Hatano, S. Y., Tada, M., Kimura, H., Yamaguchi, S., Kono, T., Nakano, T.,Suemori, H., Nakatsuji, N. and Tada, T. (2005). Pluripotential competence ofcells associated with Nanog activity. Mech. Dev. 122, 67-79.

Hayashi, K., de Sousa Lopes, S. M. and Surani, M. A. (2007). Germ cellspecification in mice. Science 316, 394-396.

Hayashi, S. and McMahon, A. P. (2002). Efficient recombination in diversetissues by a tamoxifen-inducible form of Cre: a tool for temporally regulatedgene activation/inactivation in the mouse. Dev. Biol. 244, 305-318.

Hough, S. R., Clements, I., Welch, P. J. and Wiederholt, K. A. (2006).Differentiation of mouse embryonic stem cells after RNA interference-mediatedsilencing of OCT4 and Nanog. Stem Cells 24, 1467-1475.

Kanegae, Y., Lee, G., Sato, Y., Tanaka, M., Nakai, M., Sakaki, T., Sugano, S.and Saito, I. (1995). Efficient gene activation in mammalian cells by usingrecombinant adenovirus expressing site-specific Cre recombinase. Nucleic AcidsRes. 23, 3816-3821.

Kato, Y., Rideout, W. M., Hilton, K., Barton, S. C., Tsunoda, Y. and Surani, M.A. (1999). Developmental potential of mouse primordial germ cells.Development 126, 1823-1832.

Kawase, E., Yamamoto, H., Hashimoto, K. and Nakatsuji, N. (1994). Tumornecrosis factor-alpha (TNF-alpha) stimulates proliferation of mouse primordialgerm cells in culture. Dev. Biol. 161, 91-95.

Kehler, J., Tolkunova, E., Koschorz, B., Pesce, M., Gentile, L., Boiani, M.,Lomeli, H., Nagy, A., McLaughlin, K. J., Scholer, H. R. et al. (2004). Oct4 isrequired for primordial germ cell survival. EMBO Rep. 5, 1078-1083.

Kim, J., Chu, J., Shen, X., Wang, J. and Orkin, S. H. (2008). An extendedtranscriptional network for pluripotency of embryonic stem cells. Cell 132, 1049-1061.

Koshimizu, U., Taga, T., Watanabe, M., Saito, M., Shirayoshi, Y., Kishimoto,T. and Nakatsuji, N. (1996). Functional requirement of gp130-mediatedsignaling for growth and survival of mouse primordial germ cells in vitro andderivation of embryonic germ (EG) cells. Development 122, 1235-1242.

Kurimoto, K., Yabuta, Y., Ohinata, Y. and Saitou, M. (2007). Global single-cellcDNA amplification to provide a template for representative high-densityoligonucleotide microarray analysis. Nat. Protocol 2, 739-752.

Kuroda, T., Tada, M., Kubota, H., Kimura, H., Hatano, S. Y., Suemori, H.,Nakatsuji, N. and Tada, T. (2005). Octamer and Sox elements are required fortranscriptional cis regulation of Nanog gene expression. Mol. Cell. Biol. 25,2475-2485.

Lee, T. I., Jenner, R. G., Boyer, L. A., Guenther, M. G., Levine, S. S., Kumar, R.M., Chevalier, B., Johnstone, S. E., Cole, M. F., Isono, K. et al. (2006).Control of developmental regulators by Polycomb in human embryonic stemcells. Cell 125, 301-313.

Li, J., Shen, H., Himmel, K. L., Dupuy, A. J., Largaespada, D. A., Nakamura,T., Shaughnessy, J. D., Jr, Jenkins, N. A. and Copeland, N. G. (1999).Leukaemia disease genes: large-scale cloning and pathway predictions. Nat.Genet. 23, 348-353.

Liang, J., Wan, M., Zhang, Y., Gu, P., Xin, H., Jung, S. Y., Qin, J., Wong, J.,Cooney, A. J., Liu, D. and Songyang, Z. (2008). Nanog and Oct4 associatewith unique transcriptional repression complexes in embryonic stem cells. Nat.Cell Biol. 10, 731-739.

Lomeli, H., Ramos-Mejia, V., Gertsenstein, M., Lobe, C. G. and Nagy, A.(2000). Targeted insertion of Cre recombinase into the TNAP gene: excision inprimordial germ cells. Genesis 26, 116-117.

Loveland, K. L. and Schlatt, S. (1997). Stem cell factor and c-kit in themammalian testis: lessons originating from Mother Nature’s gene knockouts. J.Endocrinol. 153, 337-344.


DEVELO

PMENT

4020

Matsui, Y., Zsebo, K. and Hogan, B. L. (1992). Derivation of pluripotentialembryonic stem cells from murine primordial germ cells in culture. Cell 70, 841-847.

Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K.,Maruyama, M., Maeda, M. and Yamanaka, S. (2003). The homeoproteinnanog is required for maintenance of pluripotency in mouse epiblast and EScells. Cell 113, 631-642.

Miyoshi, H., Blomer, U., Takahashi, M., Gage, F. H. and Verma, I. M. (1998).Development of a self-inactivating lentivirus vector. J. Virol. 72, 8150-8157.

Mullin, N. P., Yates, A., Rowe, A. J., Nijmeijer, B., Colby, D., Barlow, P. N.,Walkinshaw, M. D. and Chambers, I. (2008). The pluripotency rheostatNanog functions as a dimer. Biochem. J. 411, 227-231.

Norton, J. D., Deed, R. W., Craggs, G. and Sablitzky, F. (1998). Id helix-loop-helix proteins in cell growth and differentiation. Trends Cell Biol. 8, 58-65.

O’Bryan, M. K. and de Kretser, D. (2006). Mouse models for genes involved inimpaired spermatogenesis. Int. J. Androl. 29, 76-89; discussion 105-108.

Pan, G. and Thomson, J. A. (2007). Nanog and transcriptional networks inembryonic stem cell pluripotency. Cell Res. 17, 42-49.

Rodda, D. J., Chew, J. L., Lim, L. H., Loh, Y. H., Wang, B., Ng, H. H. andRobson, P. (2005). Transcriptional regulation of nanog by OCT4 and SOX2. J.Biol. Chem. 280, 24731-24737.

Roy, A. and Matzuk, M. M. (2006). Deconstructing mammalian reproduction:using knockouts to define fertility pathways. Reproduction 131, 207-219.

Runyan, C., Schaible, K., Molyneaux, K., Wang, Z., Levin, L. and Wylie, C.(2006). Steel factor controls midline cell death of primordial germ cells and isessential for their normal proliferation and migration. Development 133, 4861-4869.

Shaw, A. T., Meissner, A., Dowdle, J. A., Crowley, D., Magendantz, M.,Ouyang, C., Parisi, T., Rajagopal, J., Blank, L. J., Bronson, R. T. et al. (2007).Sprouty-2 regulates oncogenic K-ras in lung development and tumorigenesis.Genes Dev. 21, 694-707.

Silva, J., Chambers, I., Pollard, S. and Smith, A. (2006). Nanog promotestransfer of pluripotency after cell fusion. Nature 441, 997-1001.


Silva, J., Nichols, J., Theunissen, T. W., Guo, G., van Oosten, A. L.,Barrandon, O., Wray, J., Yamanaka, S., Chambers, I. and Smith, A. (2009).Nanog is the gateway to the pluripotent ground state. Cell 138, 722-737.

Suzuki, H., Tsuda, M., Kiso, M. and Saga, Y. (2008). Nanos3 maintains the germcell lineage in the mouse by suppressing both Bax-dependent and -independentapoptotic pathways. Dev. Biol. 318, 133-142.

Tsuda, M., Sasaoka, Y., Kiso, M., Abe, K., Haraguchi, S., Kobayashi, S. andSaga, Y. (2003). Conserved role of nanos proteins in germ cell development.Science 301, 1239-1241.

Ui-Tei, K., Naito, Y., Zenno, S., Nishi, K., Yamato, K., Takahashi, F., Juni, A.and Saigo, K. (2008). Functional dissection of siRNA sequence by systematicDNA substitution: modified siRNA with a DNA seed arm is a powerful tool formammalian gene silencing with significantly reduced off-target effect. NucleicAcids Res. 36, 2136-2151.

Ventura, A., Meissner, A., Dillon, C. P., McManus, M., Sharp, P. A., Van Parijs,L., Jaenisch, R. and Jacks, T. (2004). Cre-lox-regulated conditional RNAinterference from transgenes. Proc. Natl. Acad. Sci. USA 101, 10380-10385.

Wang, J., Levasseur, D. N. and Orkin, S. H. (2008). Requirement of Nanogdimerization for stem cell self-renewal and pluripotency. Proc. Natl. Acad. Sci.USA 105, 6326-6331.

Wu, Q., Chen, X., Zhang, J., Loh, Y. H., Low, T. Y., Zhang, W., Zhang, W.,Sze, S. K., Lim, B. and Ng, H. H. (2006). Sall4 interacts with Nanog and co-occupies Nanog genomic sites in embryonic stem cells. J. Biol. Chem. 281,24090-24094.

Yamaguchi, S., Kimura, H., Tada, M., Nakatsuji, N. and Tada, T. (2005). Nanogexpression in mouse germ cell development. Gene Expr. Patterns 5, 639-646.

Yasuda, S., Tsuneyoshi, N., Sumi, T., Hasegawa, K., Tada, T., Nakatsuji, N.and Suemori, H. (2006). NANOG maintains self-renewal of primate ES cells inthe absence of a feeder layer. Genes Cells 11, 1115-1123.

Youngren, K. K., Coveney, D., Peng, X., Bhattacharya, C., Schmidt, L. S.,Nickerson, M. L., Lamb, B. T., Deng, J. M., Behringer, R. R., Capel, B. et al.(2005). The Ter mutation in the dead end gene causes germ cell loss andtesticular germ cell tumours. Nature 435, 360-364.

RESEARCH ARTICLE

DEVELO

PMENT

conditional knockdown of nanog induces apoptotic cell ... · recently, a role for nanog in gonadal...

Documents