Comparative Profiling and Discovery of Novel GlycosylatedMycosporine-Like Amino Acids in Two Strains of the CyanobacteriumScytonema cf. crispum

Paul M. D’Agostino,a,b Vivek S. Javalkote,a,c Rabia Mazmouz,a Russell Pickford,d Pravin R. Puranik,c Brett A. Neilana

School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW, Australiaa; Department of Chemistry, Technische Universität München,Garching, Germanyb; School of Life Sciences, North Maharashtra University, Umavinagar, Jalgaon, Maharashtra, Indiac; Bioanalytical Mass Spectrometry Facility, Universityof New South Wales, Sydney, NSW, Australiad

ABSTRACT

The mycosporine-like amino acids (MAAs) are a group of small molecules with a diverse ecological distribution among microor-ganisms. MAAs have a range of physiological functions, including protection against UV radiation, making them importantfrom a biotechnological perspective. In the present study, we identified a putative MAA (mys) gene cluster in two New Zealandisolates of Scytonema cf. crispum (UCFS10 and UCFS15). Homology to “Anabaena-type” mys clusters suggested that this clusterwas likely to be involved in shinorine biosynthesis. Surprisingly, high-performance liquid chromatography analysis of S. cf.crispum cell extracts revealed a complex MAA profile, including shinorine, palythine-serine, and their hexose-bound variants. Itwas hypothesized that a short-chain dehydrogenase (UCFS15_00405) encoded by a gene adjacent to the S. cf. crispum mys clusterwas responsible for the conversion of shinorine to palythine-serine. Heterologous expression of MysABCE and UCFS15_00405in Escherichia coli resulted in the exclusive production of the parent compound shinorine. Taken together, these results suggestthat shinorine biosynthesis in S. cf. crispum proceeds via an Anabaena-type mechanism and that the genes responsible for theproduction of other MAA analogues, including palythine-serine and glycosylated analogues, may be located elsewhere in the ge-nome.

IMPORTANCE

Recently, New Zealand isolates of S. cf. crispum were linked to the production of paralytic shellfish toxins for the first time, butno other natural products from this species have been reported. Thus, the species was screened for important natural productbiosynthesis. The mycosporine-like amino acids (MAAs) are among the strongest absorbers of UV radiation produced in nature.The identification of novel MAAs is important from a biotechnology perspective, as these molecules are able to be utilized assunscreens. This study has identified two novel MAAs that have provided several new avenues of future research related to MAAgenetics and biosynthesis. Further, we have revealed that the genetic basis of MAA biosynthesis may not be clustered on the ge-nome. The identification of the genes responsible for MAA biosynthesis is vital for future genetic engineering.

Cyanobacteria are photosynthetic prokaryotes with a globaldistribution ranging from meltwater ponds to hot springs,

from fresh to hypersaline waters, and from hot to cold deserts.Scytonema cf. crispum UCFS10 (� S. cf. crispum CAWBG524) andS. cf. crispum UCFS15 (� S. cf. crispum CAWBG72) were recentlyisolated in New Zealand and are notable for their distinct biosyn-thesis of paralytic shellfish toxins (1, 2). Both species are filamen-tous and form blackish-green mats that can survive severe expo-sure to sunlight (3).

Depletion of ozone in the atmosphere has occurred because ofanthropogenic activities, resulting in an increase in UV radiation(UVR) on the earth’s surface. It is reported that a 1% decrease inthe ozone layer causes a 1.3 to 1.8% increase in UVB penetration(4). UVR has adverse biological effects because of its photochem-ical absorption by biologically significant molecules such as pro-teins and nucleic acids (5). Absorption of UVR by these biomol-ecules can lead to the formation of photoproducts similar tocyclobutyl-type dimers, pyrimidine adducts, so-called “sporephotoproducts,” pyrimidine hydrates, and DNA protein cross-links, resulting in cell dysfunction, damage, and ultimately celldeath (6). In humans, overexposure to UVR can result in sunburnand skin cancer. Therefore, the identification of naturally derived

UVR-absorbing molecules is highly significant from a biotechno-logical viewpoint (7).

The production of sunscreen molecules by certain species ofcyanobacteria is a well-described response to UVR (8). Thesecompounds include both the yellow lipid-soluble dimeric pig-ment scytonemin and the water-soluble MAAs, which have beenshown to interact with UVR (9–11). The MAAs are a large familyof secondary metabolites and have been identified in a diverse

Received 30 May 2016 Accepted 19 July 2016

Accepted manuscript posted online 29 July 2016

Citation D’Agostino PM, Javalkote VS, Mazmouz R, Pickford R, Puranik PR, NeilanBA. 2016. Comparative profiling and discovery of novel glycosylatedmycosporine-like amino acids in two strains of the cyanobacterium Scytonema cf.crispum. Appl Environ Microbiol 82:5951–5959. doi:10.1128/AEM.01633-16.

Editor: H. Nojiri, The University of Tokyo

Address correspondence to Brett A. Neilan, b.neilan@unsw.edu.au.

P.M.D. and V.S.J. contributed equally to this work.

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.01633-16.

Copyright © 2016, American Society for Microbiology. All Rights Reserved.

crossmark

October 2016 Volume 82 Number 19 aem.asm.org 5951Applied and Environmental Microbiology

on May 16, 2021 by guest

http://aem.asm

.org/D

ownloaded from

range of organisms, including fungi, eukaryotic algae, and cy-anobacteria (12, 13). Structurally, MAAs contain an amino-cyclohexenone ring or an amino-cyclohexenimine ring andhave absorbance maxima (�max) ranging from 310 to 365 nm.Amino-cyclohexenimine MAAs possess a basic cyclohexeniminering attached to the amino acid glycine at the C-3 position andanother amino acid, an amino alcohol, or an enaminone systemattached at the C-1 position (Fig. 1). Structural diversity amongMAAs is achieved via the attachment of different amino acids tothe core, which can then be further modified by decarboxylationor demethylation, resulting in alteration of the �max (14).

MAAs have a high molar extinction coefficient (ε � 28,000 to50,000 liters · mol�1 · cm�1) in the UVA and UVB regions andprotect cyanobacteria by absorbing UVR energy, which is subse-quently released in the form of heat, without generating reactiveoxygen species (10, 14, 15). Apart from protection against UVR,MAAs are involved in different processes such as antioxidant ac-tivity, osmotic regulation, and protection against thermal stressand desiccation (16). They can also act as accessory photosyn-thetic pigments and intracellular nitrogen stores (16). Glycosy-lated MAAs found in cyanobacteria are believed to be associatedwith the cyanobacterial polysaccharide sheath (17).

Initially, it was believed that the aromatic amino acid-synthe-sizing shikimate pathway was associated with MAA biosynthesisand that 3-dehydroquinate (DHQ) was converted to 4-deoxygu-dasol (4-DG) prior to the formation different MAA analogues(18). However, heterologous expression of the MAA biosynthetic(mys) gene cluster by Balskus et al. (19) and targeted pathwayinhibition and gene knockouts by Pope et al. (20) have revealedthat both the pentose phosphate and shikimate pathways are in-volved in MAA biosynthesis, with the O-methyltransferase (O-MT; MysB) being essential. MAA biosynthesis begins with a de-hydroquinate synthase (DHQS; MysA) homolog and MysB,which produce the MAA precursor 4-DG from sedoheptulose7-phosphate (SH 7-P) (19). Next, MysC, an enzyme belonging tothe ATP-grasp superfamily, attaches glycine to 4-DG, formingmycosporine-glycine. The three genes (mysABC) present in bothAnabaena variabilis ATCC 29413 (Ava_3856 to Ava_3858) andNostoc punctiforme ATCC 29133 (NpR5598 to NpR5600) arethought to be essential for mycosporine-glycine biosynthesis,while additional genes are required to produce a range of MAAanalogues (21). The final step involved in the biosynthesis of the

common MAA shinorine can occur via two distinct enzymes,which catalyze functionally identical reactions via the addition ofserine to mycosporine-glycine. One mechanism involves a nonri-bosomal peptide synthetase (NRPS) (Ava_3855) encoded in whatis known as an “Anabaena-type” cluster (19). Alternatively, a D-Ala–D-Ala ligase (NpF5597; MysD) may add serine to mycospo-rine-glycine to form shinorine, as occurs in N. punctiforme ATCC29133 and Aphanothece halophytica. The genes involved in thispathway are located within so-called “Nostoc-type” mys clusters(21–23). However, the genes responsible for the formation ofmany other MAA analogues have yet to be identified.

The present study was initiated to explore the MAA chemicaldiversity and biosynthesis in S. cf. crispum strains UCFS10 andUCFS15. Genome mining identified a putative Anabaena-typemys gene cluster with high homology to the mys cluster of A.variabilis ATCC 29413. While preliminary bioinformatic predic-tions suggested that the S. cf. crispum mys cluster is involved inshinorine biosynthesis, the discovery of an adjacent short-chain dehydrogenase gene (UCFS15_00405) led us to hypoth-esize that other MAA analogues (palythine-serine, in particu-lar) may be produced via modification of shinorine. Theidentification of novel MAAs and their associated genes is an im-portant step forward in genetic engineering and the developmentof next-generation sunscreens.

MATERIALS AND METHODSCyanobacterial cultures. The cyanobacterial strains S. cf. crispumUCFS10 and UCFS15 were isolated from two different freshwater lakes inNew Zealand (2) and are available from the Cawthron Institute CultureCollection of Microalgae (24). Both strains were cultivated in BG11 me-dium at 25°C under white fluorescent light at 50 �mol · m�2 · s�1 with a12-h–12-h light-dark cycle.

MAA extraction and partial purification. Cyanobacterial or Esche-richia coli biomass was washed with 1 volume of 20 mM NaH2PO4 andcentrifuged at 5,000 � g for 15 min at 4°C. Cyanobacterial cells wereresuspended in 100% high-performance liquid chromatography(HPLC)-grade methanol and stored overnight at 4°C. E. coli cells wereresuspended in HPLC-grade methanol and lysed on ice by sonication withfive 20-s pulses at 40% amplitude with 1 min of recovery time betweenpulses (Branson Digital Sonifier M450, 3-mm probe). Lysed cellular de-bris was removed by centrifugation (5,000 � g for 15 min at 4°C). Cya-nobacterial and E. coli methanolic extracts were desiccated with a rotaryvacuum evaporator at 35°C (Buchi rotavapor R-210; Switzerland). Desic-

FIG 1 Structural diversity of MAAs. The structures of 4-deoxygudasol, shinorine, and palythine-serine are shown. Amino acid linkages to C-1 and C-3 of4-deoxygudasol and alterations in functional groups provide structural diversity for MAAs. For example, glycine and serine bound to the MAA core results in theformation of shinorine. Decarboxylation and demethylation are proposed to result in the formation of palythine-serine from shinorine.

D’Agostino et al.

5952 aem.asm.org October 2016 Volume 82 Number 19Applied and Environmental Microbiology

on May 16, 2021 by guest

http://aem.asm

.org/D

ownloaded from

cated extracts were dissolved in 1 ml of Milli-Q water and mixed vigor-ously with 500 �l of chloroform to remove pigments. Thereafter, theaqueous phase was carefully aspirated and filtered through a Millex-GPsyringe-driven 0.22-�m PES membrane filter (Millipore, USA) to obtainpartially purified MAAs. Shinorine and porphyra-334 were extractedfrom Helioguard 365 (Mibelle Biochemistry, Switzerland) and used asanalytical standards (see the supplemental material).

HPLC analysis. Aqueous partially purified MAA extracts were ana-lyzed by HPLC on an HP Agilent Series 1100 apparatus equipped withcontinuous degassing system JP73006883, binary pump DE72001480, au-tosampler ALS DE72003901, column oven Colcomp DE72003, and pho-todiode array detector DAD DE72002619. A 50-�l sample was injectedinto a Sphereclone 5-�m ODS (2) C18 column (250-mm length by4.60-mm inside diameter; Phenomenex) protected with a guard columnof similar material (20-mm length by 4.60-mm inside diameter). A wave-length of 330 nm was used for MAA detection, and a photodiode array(PDA) UV spectrum of 200 to 400 nm was obtained for each peak. HPLCchromatographic separation was adapted from the method developed byIngalls et al. (25). Buffer A was Milli-Q water, buffer B was methanol, andthe flow rate was 1 ml/min. The gradient employed for separation was 0%B at the start of the run, 20% B at 7 min, 50% B at 9 min, 80% B at 12 min,100% B at 13 min, where the gradient was held for 10 min, followed by a10-min equilibration at 0% B prior to the next injection.

RPLC-MS analysis. Reverse-phase liquid chromatography-massspectrometry (RPLC-MS) was performed on an LCQ DECA XP Plus iontrap mass spectrometer (Thermo Fisher Scientific) interfaced with a Sur-veyor HPLC, autosampler, and PDA detector via an electrospray interfaceoperating in the positive-ion mode. Chromatography was performed on aPhenomenex Luna C18 column (2.1 by 150 mm). Solvent A was Milli-Qwater with 0.1% formic acid, and solvent B was methanol. Solvent wasdelivered at 300 �l/min with a gradient program identical to that used forHPLC analysis. Full-scan mass spectra were acquired over a mass range ofm/z 200 to 800 with an automated, data-dependent tandem scan perform-ing MS (tandem mass spectrometry [MS2]) of the most intense ions in thefull scan. An exclusion list was used to ignore high-intensity backgroundions.

HILIC-MS2 analysis. MAAs were further analyzed by hydrophilicinteraction liquid chromatography (HILIC) with the same instrumen-tation as RPLC-MS, including an autosampler, an LC pump, a Sur-veyor PDA plus a detector, and an LCQ Deca XP Plus ion trap massspectrometer (Thermo Fisher Scientific). A Zic-HILIC 3.5-�m (100 by2.1 mm; Merck) column protected with a matching guard column wasused for separation. The PDA scan was performed from 190 to 400 nmwith 330 nm being monitored for the analytes. Mobile phase A was 5mM ammonium formate and 0.1% formic acid in water, and mobilephase B was 0.01% formic acid in acetonitrile. The system was run at aflow rate of 200 �l/min. The gradient employed for separation was95% B at the beginning of the run and held for 5 min, 5% B at 22 minand held for a further 2 min, and 95% B at 25 min and held for a further15 min. Ions were generated by positive electrospray and monitoredover the mass range m/z 200 to 800 by automated, data-dependent MS2

of the most intense ions in the full scan. An exclusion list was used toignore high-intensity background ions. MS files were analyzed with theThermo Xcalibur software package (version 2.2 SP1.48). MS2 and in

silico fragmentation predictions were obtained with the Thermo MassFrontier package (version 7.0.5.9 SR3).

DNA isolation, PCR amplification, and cloning. Genomic DNA iso-lation from S. cf. crispum UCFS10 and UCFS15 was performed by thephenol-chloroform extraction method (26). PCR amplification of DNAwas performed with a 50-�l reaction mixture containing 1� VelocityHi-Fi buffer (Bioline, Australia), 1,000 �M deoxynucleoside triphos-phates (Austral Scientific, Caringbah, Australia), 0.4 �M each gene-spe-cific primer (Table 1, Integrated DNA Technologies, Singapore), 32mU/�l Velocity DNA polymerase (Bioline, Australia), and sterile Milli-Qwater. Thermal cycling was performed in a Bio-Rad 96-well iCycler (Bio-Rad, Hercules, CA) and began with an initial denaturation cycle of 98°Cfor 2 min, followed by 30 cycles of DNA denaturation at 98°C for 30 s,primer annealing at 55°C for 30 s, DNA amplification at 72°C for 30 s/kbamplified, and a final extension at 72°C for 10 min.

Two expression constructs were generated. The first consisted ofpET28::mysABCE containing the mys cluster putatively responsiblefor shinorine biosynthesis, and the second construct, pET15b::UCFS15_00405, contained the coclustered short-chain dehydrogenase(UCFS15_00405; see the supplemental material). Primers incorporatingrestriction sites (NcoI/SalI) were designed to amplify the mys gene cluster,with subsequent ligation into the pET28b vector (Table 1). Primers incor-porating restriction sites (NcoI/XhoI) were designed to amplifyUCFS15_00405, with subsequent ligation into the pET15b vector. E. coliGB2005 competent cells were used for standard subcloning. E. coliBL21(DE3) cells (Novagen) cotransformed with the pRARE plasmid wereused for heterologous expression. The possible expression of incompati-ble plasmids over short times has been reported in the past (27, 28).Plasmid compatibility for the duration of culture expression was con-firmed by the identification of soluble protein products expressed fromboth coexpressed plasmids (see the supplemental material).

Heterologous expression of the S. cf. crispum UCFS15 mys gene clus-ter and coclustered short-chain dehydrogenase (UCFS15_00405) in E.coli. E. coli colonies freshly transformed with pET28::mysABCE andpET15::empty or pET28::mysABCE and pET15b::UCFS15_00405 wereused to generate a 50-ml pre-expression culture grown in LB medium andincubated overnight at 37°C with shaking at 200 rpm. These pre-expres-sion cultures were used to inoculate expression cultures (1% [vol/vol])into 200 ml of LB medium. Expression cultures were supplemented with50 �g/ml kanamycin and 100 �g/ml ampicillin to maintain the selectionof both the pET28b and pET15 plasmids. Expression cultures were incu-bated at 30°C with shaking (200 rpm) until an optical density at 600 nm of0.6 to 0.8 was reached. Cultures were then cooled on ice (to �18°C),induced with isopropyl--D-thiogalactopyranoside (IPTG; final concen-tration, 500 �M), and incubated for 16 h at 18°C with shaking (200 rpm).To ensure successful expression of all cloned proteins, proteins were ex-tracted from expression cultures, excised from an SDS-PAGE gel, andsubmitted for trypsinolysis and identification (see the supplemental ma-terial). MAAs were extracted from expression cultures with methanol aspreviously described.

Accession number(s). The nucleotide sequences of the UCFS10 andUCFS15 mys clusters are publically available and have been submitted toGenBank under accession numbers KX021865 and KX021866, respec-tively.

TABLE 1 Cloning primers used in this study

Oligonucleotidea Sequence (5= to 3=) ORF(s)b amplified

Scytonema_MAA_1-4_NcoI_F CTAGCCATGGGCAGTGTACCTTATGCAACT mysA-mysEScytonema_MAA_1-4_SalI_R ATGAAGTCGACTTATTTACACAAGCGATCG mysA-mysE5thMAANotIF ATTTTGCGGCCGCAATGCCGGTGGATAGACGTTTAGA UCFS15_004055thMAAXhoIR GGGGCTCGAGTTACTTAAGCGTCTGCGTTT UCFS15_00405a F, forward; R, reverse.b ORF, open reading frame.

Comparative MAA Profiling of S. crispum Strains

October 2016 Volume 82 Number 19 aem.asm.org 5953Applied and Environmental Microbiology

on May 16, 2021 by guest

http://aem.asm

.org/D

ownloaded from

RESULTSBioinformatic analysis. The S. cf. crispum UCFS10 and UCFS15genomes were mined for the presence of mys clusters, revealingfour genes with homology to mysA (DHQ), mysB (O-MT), mysC(ATP-Grasp), and the Anabaena variabilis-type NRPS we havedesignated mysE. In silico analysis of the mysE adenylation domainwith Antismash V3.0 (29) suggested that serine is likely to be in-corporated at the substrate binding site during shinorine biosyn-thesis. A putative short-chain dehydrogenase (UCFS10_04340/UCFS15_00405) was discovered at the 3= end of the mys cluster (inreverse orientation) in both strains (Fig. 2). This gene was mostsimilar to a short-chain dehydrogenase (WP_039738519) fromthe cyanobacterium Hassallia byssoidea. The mys gene clustersfrom UCFS10 and UCFS15 had an overall nucleotide sequenceidentity of 99.9% (Table 2). Genomic screening of the UCFS10and UCFS15 genomes revealed 84 and 85 putative glycosyltrans-ferases not involved in cell wall biosynthesis, respectively. Theflanking regions of all putative glycosyltransferase genes could notidentify further mys-like genes.

Comparison of UCFS10 and UCFS15 MAA profiles. Partiallypurified MAA extracts from S. cf. crispum UCFS10 and UCFS15were analyzed by HPLC and detected at an absorbance maximum(�max) at 330 nm (Fig. 3). The MAA profile and the relativeamounts of MAAs produced by each strain were consistent acrossmultiple extractions and HPLC runs. HPLC analysis of UCFS10revealed three major peaks at retention times of 2.24 min (I), 3.51min (II), and 4.03 min (III). Similarly, UCFS15 showed fourprominent peaks at retention times of 2.24 min (IV), 3.22 min(V), 3.51 min (VI), and 4.03 min (VII). The shinorine and por-phyra-334 analytical standards had retention times of 3.46 and3.57 min, respectively. These results suggest that both strains pro-duce multiple MAA analogues. The most abundant peak associ-ated with UCFS10 was peak III, followed by peak I, which dis-played half the intensity. The most abundant peak associated withUCFS15 was peak V, followed by equal proportions of peaks IVand VI. UV spectrum analysis revealed that peak I and peak IV hada UV �max of 330 nm while peaks II, III, V, VI, and VII had a UV

�max of 320 nm. To identify the molecule corresponding to eachpeak in the S. crispum MAA extract, each peak was purified byfractionation. Unfortunately, the quantity and purity of collectedfractions were too low for structural elucidation by nuclear mag-netic resonance. Thus, further structural analysis was conductedby high-resolution HILIC-MS2.

Analysis of fractionated MAAs by high-resolution HILIC-MS2. To identify the ions responsible for UV absorption, peaks I toVII were fractionated and analyzed by high-resolution HILIC-MS2 (Table 3; see the supplemental material). HILIC is a chro-matographic method designed to separate polar (hydrophilic)molecules and has recently been used for the analysis of MAAs(13). HILIC-MS of peak I resulted in two ions at 21 min (m/z495.1828 [M H]) and 22.22 min (m/z 495.1827 [M H]),designated peak Ia and peak Ib. MS2 of peak Ia and peak Ib m/z 495precursor ions resulted in a major fragment with a m/z of333.1296. The calculated mass difference between 495.1828 Daand 333.1296 Da is 162.0532 Da, whereas the difference between495.1827 Da and 333.1296 Da is 162.0531 Da. This mass differencecorresponds to the calculated mass of a hexose molecule(C6H10O5), similar to previous reports of glycosylated MAAs, in-cluding mycosporine-glutaminol-glucoside, mycosporine-glu-tamicol-glucoside, hexose-bound palythine-threonine, and pen-tose-bound shinorine (30–32). Further analysis of the peak Ia andpeak Ib MS2 data showed a mass fingerprint with high similarity toshinorine, which has a m/z of 333 [M H]. Thus, it is proposedthat the MAAs isolated in peak I represent a C6H10O5 (m/z 162)addition to shinorine and that two isomers may be present (on thebasis of differing retention times but with identical mass and MS2

fingerprints). Thus, peak Ia and peak Ib are proposed to corre-spond to different isomers of a glycosylated shinorine analoguetermed hexose-shinorine. HILIC-MS2 analysis of the purifiedpeak IV fraction identified an ion with a m/z of 495.1830 [M H] displaying a single retention time of 22 min, with an identicalMS2 fragmentation pattern as peak I, suggesting that it also corre-sponds to shinorine with an attached hexose group. Peaks II andVI consisted of a major ion with a m/z of 275.1238 [M H].

FIG 2 The mys gene cluster of S. cf. crispum strains UCFS10 and UCFS15. The genetic assemblage of the shinorine synthetase gene cluster (mysABCE) andadjacent short-chain dehydrogenase (UCFS10_04340/UCFS15_00405) is shown. The nucleotide sequence identity between the UCFS10 and UCFS15 genes is99.9%.

TABLE 2 Bioinformatic analysis of the UCFS10 and UCFS15 mys gene cluster

Gene(s) Enzyme family

Closest homologa

% nucleotide sequence similaritybName Accession no. % similarity

mysA 3DHQ Calothrix parietina WP_015199132 99 99.9mysB MT Calothrix parietina WP_015199131 93 99.9mysC ATP-Grasp Calothrix parietina WP_015199130 99 100mysE NRPS Chlorogloeopsis fritschii WP_016876762 99 99.8UCFS10_04340, UCFS15_00405 Short-chain dehydrogenase Hassallia byssoidea WP_039738519 92 100a Based on inferred peptide sequence similarity.b Between UCFS10 and UCFS15.

D’Agostino et al.

5954 aem.asm.org October 2016 Volume 82 Number 19Applied and Environmental Microbiology

on May 16, 2021 by guest

http://aem.asm

.org/D

ownloaded from

FIG 3 Comparative HPLC chromatogram profiles of partially purified MAAs from S. cf. crispum. Shown are UCFS10 methanolic extracts (A) with peaks at 2.24min (I), 3.51 min (II), and 4.03 min (III); UCFS15 methanolic extracts (B) with peaks at 2.24 min (IV), 3.22 min (V), 3.51 min (VI), and 4.03 (VII); and MAAstandards (C) extracted from Helioguard 365 with peaks at 3.46 and 3.57 min. Inset graphs depict the UV absorption spectra of respective peaks fromchromatograms and are represented by data labels of peak retention time and �max. Inset i shows absorption maxima at 333 nm (retention time, 2.24 min), 320nm (retention time, 3.51 min), and 320 nm (retention time, 4.03 min). Inset ii shows absorption maxima at 333 nm (retention time, 2.20 min), 320 nm (retentiontime, 3.22 min), and 320 nm (retention time, 3.50 min). Inset iii represents an absorption maximum at 333 nm for both peaks with retention times of 3.46 minand 3.57 min of standard MAAs shinorine and porphyra-334, respectively. DAD, diode array detector; mAU, milli-absorbance units.

October 2016 Volume 82 Number 19 aem.asm.org 5955Applied and Environmental Microbiology

on May 16, 2021 by guest

http://aem.asm

.org/D

ownloaded from

Tandem mass spectrometry of the m/z 275 ion of peaks II andVI yielded several fragment ions, which were previously iden-tified in the MS and MS2 spectra of palythine-serine (33). Takentogether, the UV absorbance maximum of 320 nm and the MS2

data from the literature suggest that peaks II and VI correspond topalythine-serine.

Peaks III, V, and VII contained an ion with m/z 437.2000 [M H], 437.1767 [M H], and 437.1766 [M H], respectively.Peaks III, V, and VII displayed highly similar fragmentation pat-terns upon MS2. Fragmentation of the m/z 437 ions resulted in amajor fragment ion with m/z 275, indicating an m/z loss of 162.Calculation of the mass difference between the parent ion (m/z437) and fragment ion (m/z 275) indicated a loss of the C6H10O5

glycosyl group, as suggested for peaks I and IV. Other fragmenta-tion ions of peaks III, V, and VII were similar to palythine-serine,indicating a glycosylated analogue of palythine-serine, designatedhexose-palythine-serine. While the high-resolution HILIC-MS2

suggests that a glucosyl group similar to mycosporine-glutaminol-glucoside and mycosporine-glutamicol-glucoside is bound to shi-norine and palythine-serine, the structure of the attached hexosecould not be confirmed with structural data. In an attempt to linkeach fractionated peak with a possible structural isoform, a bioin-formatic approach was taken; however, MS2 of each glycosylatedMAA could not be confidently assigned to a specific isoform (seethe supplemental material). Additionally, shinorine was not iden-tified in peaks I to VII and was most likely a minor constituentcoeluting with a fractionated peak. However, shinorine was iden-tified via liquid chromatography-MS2 analysis of crude methano-lic UCFS10 and UCFS15 extracts.

Heterologous expression of the S. cf. crispum strainUCFS15 mys gene cluster and short-chain dehydrogenase(UCFS15_00405) in E. coli. MysABCE and UCFS15_00405 weresuccessfully overexpressed in E. coli, as confirmed via SDS-PAGE, trypsinolysis, and peptide fragment analysis (Mascotserver; see the supplemental material). Heterologous expressionof MysABCE resulted in the biosynthesis of shinorine. liquid chro-matography-mass spectrometry (LC-MS) also indicated the pres-

ence of the shinorine precursor mycosporine-glycine; however,no other MAAs were identified (see the supplemental material).To investigate the putative role of the coclustered short-chain de-hydrogenase UCFS15_00405 in the conversion of shinorine toother MAA analogues (e.g., palythine-serine), MysABCE was co-expressed with UCFS15_00405. However, UV-LC-MS resultswere identical for the mysABCE expression strain and themysABCEUCFS15_00405 coexpression strain, regardless of thepresence or absence of the short-chain dehydrogenase. Chro-matograms of both expression strains repeatedly displayed UV�max, parent, and fragment ion fingerprints matching those ofshinorine and mycosporine-glycine. No other MAAs were de-tected (see the supplemental material).

DISCUSSION

S. crispum is a toxic filamentous cyanobacterium known to formheavily pigmented, UV-resistant mats (2, 3). Here we investigatedthe biosynthesis of MAA “sunscreens” in two New Zealand S.crispum isolates, UCFS10 and UCFS15. Bioinformatic analysis ofthe UCFS10 and UCFS15 genomes identified an Anabaena-typemys gene cluster (mysABC) and a coclustered NRPS (mysE) inboth strains, suggesting a genetic capacity for shinorine produc-tion. Homologous mys gene clusters have been identified in a va-riety of organisms, including, fungi, eukaryotic algae, and cyano-bacteria (13, 14). Previous studies (19, 22, 23, 34, 35) havesuggested that shinorine biosynthesis proceeds via a DHQS (en-coded by mysA) and an O-MT (encoded by mysB), leading to thesynthesis of 4-DG (20). 4-DG is then putatively linked to glycineby an ATP-grasp enzyme (encoded by mysC), resulting in theproduction of mycosporine-glycine. In the final step of shinorinebiosynthesis, serine is attached to mycosporine-glycine by eitheran NRPS or a D-Ala–D-Ala ligase.

In addition to shinorine, a variety of other MAA analogues maybe produced via the mys pathway. Different analogues are thoughtto arise via the addition of variable amino acid moieties onto theMAA core during the final step of biosynthesis (Fig. 1). For exam-ple, heterologous expression of the Nostoc-type mysA-to-mysD

TABLE 3 Summary of HILIC-MS2 fragment ions obtained from HPLC fractions

HPLC fraction HILIC-MS RTa

m/z, [M H]

Fragment ionsb Proposed MAA ReferenceParent ion Theoretical

Ia 21.00 495.1828 495.1826 480, 449, 436, 392, 347, 333, 318, 315, 303, 300,287, 274, 265, 256, 230, 214, 186

Hexose-shinorine This study

Ib 22.22 495.1828 495.1826 480, 445, 436, 392, 375, 333, 318, 315, 303, 300,287, 274, 265, 256, 230, 214, 186

Hexose-shinorine This study

II 18.18 275.1238 275.1243 260, 257, 245, 242, 229, 216, 207, 172 Palythine-serine 33III 20.52 437.2000 437.1771 390, 377, 364, 317, 275, 257, 245, 241, 229, 216,

207, 200, 197, 193, 187, 179, 171, 154, 142Hexose-palythine-serine This study

IV 22.00 495.1822 495.1826 480, 465, 436, 392, 333, 318, 315, 303, 300, 287,274, 265, 243, 230, 188

Hexose-shinorine This study

V 20.96 437.1767 437.1771 422, 407, 391, 378, 275, 257, 245, 239, 207 Hexose-palythine-serine This studyVI 18.18 275.1239 275.1243 260, 257, 245, 242, 229, 216, 207, 172 Palythine-serine 33VII 20.86 437.1766 437.1771 391, 275, 260, 257, 245, 242, 239, 229, 216, 213, 207 Hexose-palythine-serine This studyUCFS10 333c 333.1298 317, 303, 300, 274, 265, 230, 211, 196, 186 Shinorine 46UCFS15 333c 333.1298 318, 303, 300, 274, 265, 230, 212, 186 Shinorine 46Shinorine STD 333 333.1298 318, 303, 300, 286, 274, 265, 230, 211, 186 Shinorine 46a RT, retention time (minutes).b In bold are fragment ions that match the analytical standard or fragmentation fingerprint presented in the literature.c Identified by LC-MS in methanolic extracts of UCFS10 and UCFS15 but not isolated by fractionation.

D’Agostino et al.

5956 aem.asm.org October 2016 Volume 82 Number 19Applied and Environmental Microbiology

on May 16, 2021 by guest

http://aem.asm

.org/D

ownloaded from

cluster from Actinosynnema mirum DSM 43827 resulted in thebiosynthesis of three MAAs: the parent molecule shinorine, por-phyra-334, and mycosporine-glycine-alanine (35). In this organ-ism, biosynthesis of porphyra-334 and mycosporine-glycine-ala-nine occurred via the replacement of serine with threonine andalanine, respectively, by a promiscuous D-Ala–D-Ala ligase (35).

In the present study, HPLC and LC-MS analyses revealed thepresence of multiple MAA analogues in the S. crispum studystrains, including palythine-serine, hexose-palythine-serine, shi-norine (a minor component), and hexose-shinorine. The massspectral data also suggested that these MAAs were present in dif-ferent ratios in each strain. However, heterologous expression ofthe mys cluster in E. coli resulted in the production of only twoMAA analogues (at detectable levels): shinorine and its precursormycosporine-glycine. These results are in agreement with previ-ous heterologous-expression studies involving Anabaena-typemys clusters (mysABCE), which reported shinorine as the finalproduct (19). These results also concur with the bioinformaticdata available in the literature, which suggest that mysE NRPSsfrom group V cyanobacteria are predicted to preferentially bindserine (36). Thus, it is likely that substrate specificity is strictwithin Anabaena-type mys clusters, including the S. crispum clus-ter characterized in this study.

Coral species such as Pocillopora capitata and Stylophora pistil-lata and the dinoflagellates Pseudo-nitzschia multiseries, Emilianiahuxleyi, and Alexandrium catenella have been shown to containthe MAAs shinorine, mycosporine-methylamine-serine, and pa-lynthine-serine (33, 37, 38). On the basis of structure and thedistribution of MAAs in corals, the biosynthesis of palythine-ser-ine is proposed to occur via the decarboxylation of the serinegroup on shinorine, resulting in the production mycosporine-methylamine-serine. This intermediate is then demethylated toform palythine-serine (14). However, to date, there are no genecandidates for these tailoring reactions, nor is there any biochem-ical evidence to support this proposed pathway. However, it isimportant to note that palythine-methylamine-serine was not de-tected in either UCFS10 or UCFS15 and palythine-serine mightactually be produced via an alternate pathway that bypasses pa-lythine-methylamine-serine as an intermediate.

Analysis of the regions flanking the mys cluster in UCFS10 andUCFS15 revealed the presence of a putative short-chain dehydro-genase gene (UCFS15_00405) transcribed in the reverse orienta-tion to mysABCE. Enzymes belonging to the short-chain dehydro-genase family are known to catalyze a wide variety of reactions,including, but not limited to, decarboxylation, isomerization, ep-imerization, CAN bond reduction, dehydration, and carbonyl-alcohol oxidoreduction (39, 40). It was hypothesized thatUCFS15_00405 may be responsible for the conversion of shino-rine to palythine-serine in S. crispum. Homologous dehydroge-nase genes have also been observed adjacent to mys clusters inother cyanobacteria. For example, prephanate/arogenate dehy-drogenases are encoded alongside the mys clusters of Hapalosi-phon welwitschia UH strain IC-52-3 and Westiella intricata UHstrain HT-29-1 (36). In W. intricata UH strain HT-29-1, the de-hydrogenase gene is cotranscribed with the mys cluster and theentire operon is induced by UV light (M. L. Micallef, personalcommunication). However, in the present study, heterologous ex-pression of S. crispum MysABCE with the dehydrogenase did notresult in the production of additional MAA analogues. In fact, UVabsorbance spectra and LC-MS profiles were identical for both

heterologous expression strains, regardless of the presence or ab-sence of UCFS15_00405.

A possible explanation for these results is that UCFS15_00405is not active in E. coli. Alternatively, this enzyme may have a roleoutside MAA metabolism. In vitro characterization of the purifiedoverexpressed dehydrogenase may shed further light on this sub-ject. The fact that multiple MAAs are present in both S. cf. crispumstudy strains also raises the possibility that additional as-yet-un-identified shinorine tailoring genes are involved in MAA metabo-lism in this cyanobacterium, including those for palythine-serinebiosynthesis and MAA glycosylation. Genomic screening of bothgenomes revealed 84 and 85 putative glycosyltransferases inUCFS10 and UCFS15, respectively. Flanking regions of all glyco-syltransferase genes did not reveal any mys-like coding regions.Thus, the mys cluster expressed in this study is the only identifiablegenetic locus responsible for MAA biosynthesis and the genes thatfunction to alter shinorine to further MAA analogues are likely tobe located elsewhere in the genome.

In this study, we identified two novel glycosylated MAAs,hexose-shinorine and hexose-palythine-serine, that were presentin at least two isoforms, as evidenced by their distinct HPLC andHILIC retention times and identical masses. Surprisingly, a glyco-syltransferase gene could not be found in the immediate vicinity ofthe mys cluster in either S. crispum strain. Glycosylated MAA de-rivatives are produced by a variety of organisms, including fungiand cyanobacteria. For example, mycosporine-glutaminol-gluco-side is produced by the fungal species Rhodotorula minuta, R.slooffiae, and Xanthophyllomyces dendrorhous (Phaffia rho-dozyma), while mycosporine-glutamicol-glucoside is producedby the fungi Sarcinomyces petricola A95, Coniosporium sp. strainA28, Botryosphaeria-like AN13, and Coniosporium-like A148, aswell as the rock-inhabiting cyanobacterium Leptolyngbya foveola-rum (32, 41–43). In addition to its role in UVR protection, myco-sporine-glutaminol-glucoside is believed to protect cells from an-tioxidant damage (43, 44), which may account for its productionby microorganisms exposed to low levels of UVR.

Glycosylated MAAs, including 7-O-(-arabinopyranosyl)-porphyra-334, hexose-bound porphyra-334, and pentose-boundshinorine, are also produced by the terrestrial cyanobacteriumNostoc commune (17, 30, 31). The production of glycosylated andhybrid MAAs with different absorption maxima provides broad-spectrum protection against UVR across the entire UVA and UVBregions (30). In N. commune, glycosylated MAAs are thought to beassociated with the three-dimensional extracellular matrix, pro-viding protection against UVR, as well as desiccation and oxida-tive stress (45).

It has been suggested that glycosylated MAAs may be the phys-iologically inactive variant of aglycone MAAs, since glycosylationcan block degradation by hydrolases (41). However, it is also pos-sible that glycosylated and aglycone MAA isoforms have differentcellular functions. While the functions of hexose-shinorine andhexose-palythine-serine identified in S. crispum remain unknown,it is likely that these MAAs are also associated with the extracellu-lar matrix and involved in protection against UVR, desiccation,and/or oxidative stress. However, it is worth noting that whileboth S. cf. crispum strains were isolated from relatively similarenvironments with similar UVR exposure, they displayed distinctMAA profiles when grown in culture, highlighting the complexityof MAA metabolism in this cyanobacterium. Future investiga-tions of the regulation of MAAs and the corresponding biosynthe-

Comparative MAA Profiling of S. crispum Strains

October 2016 Volume 82 Number 19 aem.asm.org 5957Applied and Environmental Microbiology

on May 16, 2021 by guest

http://aem.asm

.org/D

ownloaded from

sis genes under different stress conditions may help clarify thephysiological roles of these compounds.

ACKNOWLEDGMENTS

We thank Susie Wood for donating the cyanobacterial cultures used inthis study and Emily Balskus for advice regarding obtaining shinorine andpalythine-334 analytical standards. Also, we thank Leanne Pearson andJohn Kalaitzis for editing the manuscript.

FUNDING INFORMATIONThis work, including the efforts of Vivek S. Javalkote, was funded byEndeavour Research Fellowship: Australian Government. This work, in-cluding the efforts of Vivek S. Javalkote, was funded by Research Fellow-ship for Meritorious Students: University Grants Commission, India.This work, including the efforts of Brett A. Neilan, Paul MichaelD’Agostino, Rabia Mazmouz, and Russell Pickford, was funded by Aus-tralian Research Council (ARC).

REFERENCES1. Wiese M, D’Agostino PM, Mihali TK, Moffitt MC, Neilan BA. 2010.

Neurotoxic alkaloids: saxitoxin and its analogs. Mar Drugs 8:2185–2211.http://dx.doi.org/10.3390/md8072185.

2. Smith FMJ, Wood SA, Wilks T, Kelly D, Broady PA, Williamson W,Gaw S. 2012. Survey of Scytonema (cyanobacteria) and associated saxi-toxins in the littoral zone of recreational lakes in Canterbury, New Zea-land. Phycologia 51:542–551. http://dx.doi.org/10.2216/11-84.1.

3. Smith FMJ, Wood SA, van Ginkel R, Broady PA, Gaw S. 2011. Firstreport of saxitoxin production by a species of the freshwater benthic cya-nobacterium, Scytonema Agardh. Toxicon 57:566 –573. http://dx.doi.org/10.1016/j.toxicon.2010.12.020.

4. Hollósy F. 2002. Effects of ultraviolet radiation on plant cells. Micron33:179 –197. http://dx.doi.org/10.1016/S0968-4328(01)00011-7.

5. Karsten U, Holzinger A. 2014. Green algae in alpine biological soil crustcommunities: acclimation strategies against ultraviolet radiation and de-hydration. Biodivers Conserv 23:1845–1858. http://dx.doi.org/10.1007/s10531-014-0653-2.

6. Diffey BL. 1991. Solar ultraviolet radiation effects on biological systems.Phys Med Biol 36:299. http://dx.doi.org/10.1088/0031-9155/36/3/001.

7. Gao Q, Garcia-Pichel F. 2011. Microbial ultraviolet sunscreens. Nat RevMicrobiol 9:791– 802. http://dx.doi.org/10.1038/nrmicro2649.

8. Singh SP, Kumari S, Rastogi RP, Singh KL, Sinha RP. 2008. Myco-sporine-like amino acids (MAAs): chemical structure, biosynthesisand significance as UV-absorbing/screening compounds. Indian J ExpBiol 46:7–17.

9. Rastogi RP, Richa, Singh SP, Häder D-P, Sinha RP. 2010. Mycosporine-like amino acids profile and their activity under PAR and UVR in a hot-spring cyanobacterium Scytonema sp. HKAR-3. Aust J Bot 58:286 –293.

10. Rastogi RP, Incharoensakdi A. 2014. UV radiation-induced biosynthesis,stability and antioxidant activity of mycosporine-like amino acids(MAAs) in a unicellular cyanobacterium Gloeocapsa sp. CU2556. J Pho-tochem Photobiol B 130:287–292. http://dx.doi.org/10.1016/j.jphotobiol.2013.12.001.

11. Rastogi RP, Incharoensakdi A. 2014. Characterization of UV-screeningcompounds, mycosporine-like amino acids, and scytonemin in the cya-nobacterium Lyngbya sp. CU2555. FEMS Microbiol Ecol 87:244 –256.http://dx.doi.org/10.1111/1574-6941.12220.

12. Sinha RP, Singh SP, Häder D-P. 2007. Database on mycosporines andmycosporine-like amino acids (MAAs) in fungi, cyanobacteria, macroal-gae, phytoplankton and animals. J Photochem Photobiol B 89:29 –35.http://dx.doi.org/10.1016/j.jphotobiol.2007.07.006.

13. Hartmann A, Becker K, Karsten U, Remias D, Ganzera M. 2015.Analysis of mycosporine-like amino acids in selected algae and cyanobac-teria by hydrophilic interaction liquid chromatography and a novel MAAfrom the red alga Catenella repens. Mar Drugs 13:6291. http://dx.doi.org/10.3390/md13106291.

14. Carreto JI, Carignan MO. 2011. Mycosporine-like amino acids: relevantsecondary metabolites. Chemical and ecological aspects. Mar Drugs9:387– 446. http://dx.doi.org/10.3390/md9030387.

15. Dunlap WC, Shick JM. 1998. Ultraviolet radiation absorbing mycospo-rine-like amino acids in coral reef organisms: a biochemical and environ-

mental perspective. J Phycol 34:418 – 430. http://dx.doi.org/10.1046/j.1529-8817.1998.340418.x.

16. Oren A, Gunde-Cimerman N. 2007. Mycosporines and mycosporine-like amino acids: UV protectants or multipurpose secondary metabolites?FEMS Microbiol Lett 269:1–10. http://dx.doi.org/10.1111/j.1574-6968.2007.00650.x.

17. Matsui K, Nazifi E, Kunita S, Wada N, Matsugo S, Sakamoto T. 2011.Novel glycosylated mycosporine-like amino acids with radical scavengingactivity from the cyanobacterium Nostoc commune. J Photochem Photo-biol B 105:81– 89. http://dx.doi.org/10.1016/j.jphotobiol.2011.07.003.

18. Rosic NN. 2012. Phylogenetic analysis of genes involved in mycosporine-like amino acid biosynthesis in symbiotic dinoflagellates. Appl MicrobiolBiotechnol 94:29 –37. http://dx.doi.org/10.1007/s00253-012-3925-3.

19. Balskus EP, Case RJ, Walsh CT. 2011. The biosynthesis of cyanobacterialsunscreen scytonemin in intertidal microbial mat communities. FEMSMicrobiol Ecol 77:322–332. http://dx.doi.org/10.1111/j.1574-6941.2011.01113.x.

20. Pope MA, Spence E, Seralvo V, Gacesa R, Heidelberger S, Weston AJ,Dunlap WC, Shick JM, Long PF. 2015. O-Methyltransferase is sharedbetween the pentose phosphate and shikimate pathways and is essentialfor mycosporine-like amino acid biosynthesis in Anabaena variabilisATCC 29413. Chembiochem 16:320 –327. http://dx.doi.org/10.1002/cbic.201402516.

21. Hu C, Völler G, Süßmuth R, Dittmann E, Kehr J-C. 2015. Functionalassessment of mycosporine-like amino acids in Microcystis aeruginosastrain PCC 7806. Environ Microbiol 17:1548 –1559. http://dx.doi.org/10.1111/1462-2920.12577.

22. Waditee-Sirisattha R, Kageyama H, Sopun W, Tanaka Y, Takabe T.2014. Identification and upregulation of biosynthetic genes required foraccumulation of mycosporine-2-glycine under salt stress conditions in thehalotolerant cyanobacterium Aphanothece halophytica. Appl Environ Mi-crobiol 80:1763–1769. http://dx.doi.org/10.1128/AEM.03729-13.

23. Gao Q, Garcia-Pichel F. 2011. An ATP-grasp ligase involved in the lastbiosynthetic step of the iminomycosporine shinorine in Nostoc puncti-forme ATCC 29133. J Bacteriol 193:5923–5928. http://dx.doi.org/10.1128/JB.05730-11.

24. Rhodes L, Smith KF, MacKenzie L, Wood SA, Ponikla K, Harwood DT,Packer M, Munday R. 2016. The Cawthron Institute Culture Collectionof Micro-algae: a significant national collection. N Z J Mar Freshw Res50:291–316. http://dx.doi.org/10.1080/00288330.2015.1116450.

25. Ingalls AE, Whitehead K, Bridoux MC. 2010. Tinted windows: thepresence of the UV absorbing compounds called mycosporine-like aminoacids embedded in the frustules of marine diatoms. Geochim CosmochimActa 74:104 –115. http://dx.doi.org/10.1016/j.gca.2009.09.012.

26. D’Agostino PM, Song X, Neilan BA, Moffitt MC. 2014. Comparativeproteomics reveals that a saxitoxin-producing and a nontoxic strain ofAnabaena circinalis are two different ecotypes. J Proteome Res 13:1474 –1484. http://dx.doi.org/10.1021/pr401007k.

27. Yang W, Zhang L, Lu Z, Tao W, Zhai Z. 2001. A new method for proteincoexpression in Escherichia coli using two incompatible plasmids. ProteinExpr Purif 22:472– 478. http://dx.doi.org/10.1006/prep.2001.1453.

28. Wang F, Qu H, Zhang D, Tian P, Tan T. 2007. Production of 1,3-propanediol from glycerol by recombinant E. coli using incompatible plas-mids system. Mol Biotechnol 37:112–119. http://dx.doi.org/10.1007/s12033-007-0041-1.

29. Weber T, Blin K, Duddela S, Krug D, Kim HU, Bruccoleri R, Lee SY,Fischbach MA, Müller R, Wohlleben W, Breitling R, Takano E,Medema MH. 2015. AntiSMASH 3.0 —a comprehensive resource for thegenome mining of biosynthetic gene clusters. Nucleic Acids Res 43:W237–W243. http://dx.doi.org/10.1093/nar/gkv437.

30. Nazifi E, Wada N, Asano T, Nishiuchi T, Iwamuro Y, Chinaka S,Matsugo S, Sakamoto T. 2015. Characterization of the chemical diversityof glycosylated mycosporine-like amino acids in the terrestrial cyanobac-terium Nostoc commune. J Photochem Photobiol B 142:154 –168. http://dx.doi.org/10.1016/j.jphotobiol.2014.12.008.

31. Nazifi E, Wada N, Yamaba M, Asano T, Nishiuchi T, Matsugo S,Sakamoto T. 2013. Glycosylated porphyra-334 and palythine-threoninefrom the terrestrial cyanobacterium Nostoc commune. Mar Drugs 11:3124 –3154. http://dx.doi.org/10.3390/md11093124.

32. Volkmann M, Whitehead K, Rütters H, Rullkötter J, Gorbushina AA.2003. Mycosporine-glutamicol-glucoside: a natural UV-absorbing sec-ondary metabolite of rock-inhabiting microcolonial fungi. Rapid Com-mun Mass Spectrom 17:897–902. http://dx.doi.org/10.1002/rcm.997.

D’Agostino et al.

5958 aem.asm.org October 2016 Volume 82 Number 19Applied and Environmental Microbiology

on May 16, 2021 by guest

http://aem.asm

.org/D

ownloaded from

33. Carignan MO, Cardozo KHM, Oliveira-Silva D, Colepicolo P, CarretoJI. 2009. Palythine-threonine, a major novel mycosporine-like amino acid(MAA) isolated from the hermatypic coral Pocillopora capitata. J Pho-tochem Photobiol B 94:191–200. http://dx.doi.org/10.1016/j.jphotobiol.2008.12.001.

34. Singh SP, Klisch M, Sinha RP, Häder D-P. 2010. Genome mining ofmycosporine-like amino acid (MAA) synthesizing and non-synthesizingcyanobacteria: a bioinformatics study. Genomics 95:120 –128. http://dx.doi.org/10.1016/j.ygeno.2009.10.002.

35. Miyamoto KT, Komatsu M, Ikeda H. 2014. Discovery of gene cluster formycosporine-like amino acid biosynthesis from Actinomycetales microor-ganisms and production of a novel mycosporine-like amino acid by het-erologous expression. Appl Environ Microbiol 80:5028 –5036. http://dx.doi.org/10.1128/AEM.00727-14.

36. Micallef ML, D’Agostino PM, Sharma D, Viswanathan R, Moffitt MC.2015. Genome mining for natural product biosynthetic gene clusters inthe subsection V cyanobacteria. BMC Genomics 16:669. http://dx.doi.org/10.1186/s12864-015-1855-z.

37. Carreto JI, Carignan MO, Montoya NG. 2005. A high-resolution re-verse-phase liquid chromatography method for the analysis of mycospo-rine-like amino acids (MAAs) in marine organisms. Mar Biol 146:237–252. http://dx.doi.org/10.1007/s00227-004-1447-y.

38. Carreto JI, Carignan MO, Montoya NG. 2001. Comparative studies onmycosporine-like amino acids, paralytic shellfish toxins and pigment pro-files of the toxic dinoflagellates Alexandrium tamarense, A. catenella and Aminutum Mar. Ecol Prog Ser 223:49 – 60. http://dx.doi.org/10.3354/meps223049.

39. Kallberg Y, Oppermann U, Persson B. 2010. Classification of the short-chain dehydrogenase/reductase superfamily using hidden Markov mod-els. FEBS J 277:2375–2386. http://dx.doi.org/10.1111/j.1742-4658.2010.07656.x.

40. Krozowski Z. 1994. The short-chain alcohol dehydrogenase superfamily:variations on a common theme. J Steroid Biochem Mol Biol 51:125–130.http://dx.doi.org/10.1016/0960-0760(94)90084-1.

41. Volkmann M, Gorbushina AA. 2006. A broadly applicable method forextraction and characterization of mycosporines and mycosporine-like amino acids of terrestrial, marine and freshwater origin. FEMSMicrobiol Lett 255:286 –295. http://dx.doi.org/10.1111/j.1574-6968.2006.00088.x.

42. Sommaruga R, Libkind D, van Broock M, Whitehead K. 2004. Myco-sporine-glutaminol-glucoside, a UV-absorbing compound of two Rho-dotorula yeast species. Yeast 21:1077–1081. http://dx.doi.org/10.1002/yea.1148.

43. Libkind D, Moline M, van Broock M. 2011. Production of the UVB-absorbing compound mycosporine-glutaminol-glucoside by Xanthophyl-lomyces dendrorhous (Phaffia rhodozyma). FEMS Yeast Res 11:52–59. http://dx.doi.org/10.1111/j.1567-1364.2010.00688.x.

44. Moliné M, Arbeloa EM, Flores MR, Libkind D, Farías ME, BertolottiSG, Churio MS, van Broock MR. 2011. UVB photoprotective role ofmycosporines in yeast: photostability and antioxidant activity of myco-sporine-glutaminol-glucoside. Radiat Res 175:44 –50. http://dx.doi.org/10.1667/RR2245.1.

45. Wright DJ, Smith SC, Joardar V, Scherer S, Jervis J, Warren A, HelmRF, Potts M. 2005. UV irradiation and desiccation modulate the three-dimensional extracellular matrix of Nostoc commune (Cyanobacteria).J Biol Chem 280:40271– 40281. http://dx.doi.org/10.1074/jbc.M505961200.

46. Whitehead K, Hedges JI. 2003. Electrospray ionization tandem massspectrometric and electron impact mass spectrometric characterization ofmycosporine-like amino acids. Rapid Commun Mass Spectrom 17:2133–2138. http://dx.doi.org/10.1002/rcm.1162.

Comparative MAA Profiling of S. crispum Strains

October 2016 Volume 82 Number 19 aem.asm.org 5959Applied and Environmental Microbiology

on May 16, 2021 by guest

http://aem.asm

.org/D

ownloaded from