System. Appl. Microbiol. 27, 18–26 (2004) http://www.elsevier-deutschland.de/syapm

0723-2020/04/27/01-18 $ 30.00/0

Clostridia relative on the basis of its 16S-based phylogeny[7], the four operons in F. magna are distributed differ-ently, being positioned at relatively equal intervals on thechromosomal circle. The significance of such variationsin rrn clustering is not well understood, however, cluster-ing of rrn operons near the origin of replication would beadvantageous to rapidly growing cells, as it would facili-tate the expeditious synthesis of ribosomes [8].

The sequences of rRNA genes in multiple rrn operonsare largely homogeneous within an organism, althoughminor differences exist. This homogeneity is thought toreflect some kind of homogenization mechanism. Whetherminor sequence differences in rRNAs within a singlebacterial cell affect the function of particular rRNAspecies or promote cell survival in changing environmentsremains to be resolved [8]. On the other hand, variationsin the 16S–23S internal transcribed spacer of a single cell,

Comparative Analysis of the Four rRNA operonsin Finegoldia magna ATCC29328

Kozo Todo1, 2, Takatsugu Goto1, Akio Honda1, Mieko Tamura1, Kazuaki Miyamoto1, Shigeyuki Fujita2,and Shigeru Akimoto1

1 Department of Microbiology, Wakayama Medical University, Wakayama, Japan2 Department of Oral and Maxillofacial Surgery, Wakayama Medical University, Wakayama, Japan

Received: September 4, 2003

Summary

There are four rRNA operons rrnA, rrnB, rrnC and rrnD on the genome of Finegoldia magna (formerlyPeptostreptococcus magnus) ATCC29328, which, in contrast to those of Clostridia, are dispersedaround the chromosome. Using a BAC library we determined the nucleotide sequences and structures ofall four operons, including their flanking regions, and performed comparative analyses. We identified pu-tative boxA sequences in the operons, which should be required for rRNA transcription antitermination,as well as their respective tandem promoters, AT-rich UP elements in the upstream region and Rho-inde-pendent terminators in the downstream region. The mosaic features of the operons were revealed. Multi-ple tRNAs were identified in the downstream region of two operons, 18 in rrnC and 11 in rrnD. Theywere presumed to form transcription units together with rRNAs. rrnA and rrnB had repeat units withRho-independent terminators instead of tRNAs in the downstream region. rrnB and rrnC were the mostsimilar in rrn upstream promoter region. Focusing on the sequence variations of rRNA genes, rrnB alonewas heterogeneous. In light of previous reports, we also assessed the correlation between intercistronicrRNA sequence differences and distances between the operons, but no positive correlation was seen inthis strain.

Key words: Peptostreptococcus – Finegoldia magna (formerly Peptostreptococcus magnus) – ribosomalRNA operon (rrn) – promoter – UP element – boxA – antitermination – Rho-independent terminator –tRNA – Gram-positive bacteria

Introduction

Finegoldia magna (formerly Peptostreptococcus mag-nus) is the most common species of Gram-positive anaer-obic cocci (GPAC) in human clinical specimens that arecommonly termed peptostreptococcus. GPAC are majorcomponents of normal human flora of mouth, upper res-piratory and gastrointestinal tracts, female genitourinarysystem and skin, and they are involved in a wide varietyof clinically significant infections, including septic arthri-tis and diabetic foot infections [16]. Despite their clinicalsignificance, there have been only limited genetic and ge-nomic investigations of GPAC. We previously constructedthe physical and genetic map of F. magna ATCC29328and showed that the size of its circular chromosome was1.9 Mbp and that this chromosome had four ribosomalRNA (rrn) operons [23]. Although rrn operons inClostridia have a tendency to cluster close to the origin ofreplication [4, 12, 21] and F. magna is regarded as a

Four rRNA operons in Finegoldia magna 19

which are useful in monitoring or identifying bacteria atspecies or serogroup levels, are higher than those inrRNA genes. It was recently reported that a positive cor-relation exists between the number of pair-wise sequencedifferences of 16S rRNA genes and 23S rRNA geneswithin an organism and the distance between the operonson the chromosome, as a result of homogenization bygene conversion [10]. This observation prompted us todetermine the sequences of all four rrn operons in F.magna and their relative dispersal on the chromosomeand to examine the correlation between the two.

Structures of rrn operons, and their transcription acti-vation, antitermination and termination mechanismshave been studied extensively in E. coli for severaldecades. It is well known that E. coli rrn operons consistof the following elements: P1, P2 tandem σ70 (sigma fac-tor 70) promoters with UP element-antiterminator-16S-spacer (with antiterminator and with or without tRNAgenes)-23S–5S-(with or without tRNA genes)- Rho-inde-pendent terminators. UP elements are AT-rich sequencesfound in the upstream region of E. coli rrn promoters andare believed an extension of core promoter that activatestranscription of rrn operons. The operons can producerRNA transcripts of over 6 kbp in size, thereby avoidingpremature termination induced by the termination factor,Rho. It has been shown that rrn antitermination is medi-ated by interaction of the boxA nucleotide motif with anrrn antitermination protein complex. Since, in general,homologs of those proteins are conserved in bacterialgenomes, these E. coli rrn transcription models are as-sumed to be applicable to rrn operons of other bacteria.Few studies, however, have been undertaken on rrn tran-scription motifs of other bacterial genomes.

Here, we have determined the nucleotide sequencesand structures, putative promoters, Up elements, tRNAs,and Rho-independent terminators, of all four F. magnaoperons using a BAC library. We have also attempted toidentify rrn boxA sequences in this strain, based on thecomparison with the rrn sequences of other Gram-posi-tive bacteria. The intercistronic heterogeneities in rRNAsequences, tRNAs, the promoter region, and the 16S–23Sinternal transcribed spacer are examined and the mosaiccharacteristic of rrn operons in F. magna is discussed.Furthermore, in the light of previous report we assessedthe correlation between pair-wise rRNA sequence differ-ences and inter-operon distances in this strain.

Materials and Methods

Screening rrn positive clones and sequencingA BAC library of F. magna ATCC 29328 was constructed as

previously described [3] It was composed of 385 clones, ofwhich average insert size was 55 kbp. Detailed properties of thelibrary will be described elsewhere (unpublished data). rrs- andrrl-specific probes were synthesized using a PCR DIG probe syn-thesis kit (Roche). BAC plasmids were isolated by alkaline lysis,dot-blotted, 100 ng per each clone, on nylon membranes [3] andscreened for rrn by Southern hybridization, 37 °C overnight,with rrs- and rrl-specific probes. Primers used were: #2(16S–27f,5′-AGAGTTTGATCMTGGCTCAG-3′: the number represented

E. coli rrn position) and #3(16S–1100r, 5′-GGGTTGCGCTCGTTG-3′) for the 16S-specific probe, and #10(23S-1948f, 5′-GTAGCGAAATTCCTTGTCG-3′), and 23S–2654r (5′-CCGGTCCTCTCGTACT-3′) for the 23S- specific probe. Positive cloneswere subjected to HindIII and EcoRI digestion and pulsed-fieldgel electrophoresis (PFGE), blotted and hybridized with thesame probes. For sequencing rrn sequences in positive clones,we prepared the plasmids in midi scale with PEG precipitation.BAC plasmids yielded by 40 ml culture of E. coli (TransformaxEC100, Epicentre) transformants afforded five rounds of se-quencing. Sequences in 16S–23S–5S regions were determinedusing thirteen kind of 16S- and 23S-specific primers as follows:#1(16S-109r, 5′-ACGCGTTACTCACCCGT-3′), #2(16S-27f,mentioned above), #3(16S-1100r, mentioned above), #4(16S-1492r, 5′-TACGGYTACCTTGTTACGACTT-3′), #5(16S-1406f,5′-CTTGTACACACCGCCCGT-3′), #6(23S-667r, 5′-TCACC-CGGTTTCGGGTCTA-3′), #6.5(23S-790f, 5′-CCAATCGAACTCGGATATAG-3′), #7(23S-1091R, 5′-ACTAGTGAGCTAT-TACGC-3′), #8(23S-1608r, 5′-CCTACCTGTGTCGGTTT-3′),#9(23S-2053r, 5′-CTCCACGGGGTCTTTCCGTC-3′), #10(23S-1948f, 5′-GTAGCGAAATTCCTTGTCG-3′), #11(23S-r-1, 5′-TTACTATCTTTACACCTCTGACCT-3′) and #12(23S-2758f,5′-AGTGCTGAAGGCATCTAA-3′). Among these primers, #6,#6.5, and #11 were custom designed to cover the whole16S–23S–5S region of this strain and the others were universalsequencing primers [13]. Sequences of downstream regions of16S–23S–5S were determined by primer walking [3]. The primersused were as follows: #A13(5′-ACGTCGTGGGAGAGTAG-3′),#A14(5′-AGGTTTCGCAAGATTTACAGT-3′), #A15(5′-GCTTTTCCATTTACATTGATT-3′), #B13(5′-TCTTTTTTGTGAGTTCTTTTAG-3′), #B14(5′-TGGATCTCACTCGCTCATAA-3′),#B15(5′-GTAAGGAAATGGCTCCGTATATT-3′), #C13(5′-GGTGGTTAAACACCGTATCGGT-3′), #C14(5′-GTTCAGTTGGTTAGAATGC-3′), #C15 (5′-CAGCCAATATGGTTCAT-TA-3′), #C16(5′-GCCACGACAAAGCATGCTTACGTATT-3′),#D13(5′-AACAAGTGGCGCGAAAACCA-3′), #D14(5′-ATTCAGCGGTTGTGTTATTTGA-3′), #D15(5′-CAAAGAAATTCATGCGGAAGT-3′), #D16(5′-CAATGAAATCAACAATAAAAC-GA-3′), #D17(5′-TAAAACAGGATACTTATGCCAA-3′).

Analysis of structures of the four rrn operons in F. magnaNucleotide sequences were aligned using the Clustal W soft-

ware program [22]. On the basis of the rRNA sequences of theRibosomal Database Project II and the Comparative RNA WebSite, 5′- and 3′- ends of 16S, 23S, and 5S rRNA genes in F.magna were deduced [5, 6]. Secondary structure diagrams of rrswere drawn also on the basis of those of Clostridiumperfringens, Eubacterium brachy, and Heliobacterium chlorumsequences that are available on the Comparative RNA Web Site.The tRNA genes were identified using tRNAscan-SE [14]. σ70

promoters and palindrome sequences of Rho-independent termi-nators were predicted using Genetyx-Mac Ver 8.0.5 (SoftwareDevelopment, Tokyo). Annotation of putative genes in flankingregions of the rrn operons was performed using BLASTX. Nu-cleotide sequences of the four rrn operons we determined in thisstudy have been assigned the following DDBJ/EMBL/GenBankaccession numbers AB109769-AB109772. Pair-wise differenceswere calculated for rrs and rrl genes and we plotted the differ-ences against the distance between operons to determine if theywere statistically positively correlated.

Identification of the rrn boxA motif in F. magna and Firmi-cutes

We attempted to identify putative antitermination motifs,one of the basic components of an rrn operon, which wouldalso be conserved in F. magna. The search was based on inter-generic and interspecific comparison of rrn leader and 16S–23S

20 K. Todo et al.

spacer regions among E. coli and Firmicutes (Gram-positivebacteria), since we considered that house-keeping functions,such as rrn antitermination, would be better conserved in thephylogenetic relatives than in other bacteria. Sequences of therrn leader and 16S–23S spacer regions of the completedgenomes to date in Firmicute were obtained from the DDBJ/EMBL/GenBank database through NCBI Entrez-Genome(http://www.ncbi.nlm.nih.gov/PMGifs/Genomes/micr.html).

Results and Discussion

Structures of four ribosomal operons of F. magna

F. magna ATCC29328 has four rrn operons on itschromosome [23]. We designated them rrnD, rrnC, rrnBand rrnA in clockwise order (Fig. 1). Their positions wereestimated to be +200, +630, –650 and –370 kb from theorigin of replication of the chromosome.

Fifteen out of 385 clones in our BAC library gave posi-tive signals in dot blot hybridization experiments with a16S-specific probe and were subsequently subjected tofingerprinting and hybridization with rrn-specific probes.As expected, on the basis of HindIII- and EcoRI-finger-printing these operons could be classified into fourgroups (Fig. 2A, B). The hybridization experiments with16S- (Fig. 2C, D) and 23S-specific (data not shown)probes revealed four distinct patterns (Fig. 2C, D). BACclones were designated as BF plus serial number. Both fin-gerprinting and hybridization revealed that each individu-al group represented a different one of the four operons.In fact, representative clones of the four groups, BF111,

Fig. 1. Location of 4 rrn operons in F. magna ATCC29328. Ar-rows indicate the transcriptional directions of rrn operons.IA(1), IA(2), IB, and IC indicate four I-CeuI restriction frag-ments of the chromosome. Numbers show the distance from theputative origin of replication (oriC) in kbp. Location of putativeoriC was deduced from that of dnaA-dnaN-recF on the physicalmap (Goto et al., unpublished data), since the rnpA-rpmH-dnaA-dnaN-recF-gyrB-gyrA cluster in oriC region are well con-served in many Gram-positive bacteria [20].

Fig. 2. Fingerprinting of four groups of rrn-positive BAC clones. BAC clones and Genomic DNA of F. magnaATCC29328 were di-gested with HindIII (A, C) and EcoRI (B, D) and subjected to pulse-field gel electrophoresis for fingerprinting; the conditions usedwere 1% agarose, 9Vcm-1, switch time 0.1 s, 5 h. Southern blot of the digests was hybridized with a 16S-specific probe (C, D).Lane 1, BAC clone BF89; lane 2, BF377; lane 3, BF246; lane 4, BF261; lane 5, BF170; lane 6, BF111; lane 7, BF197; lane 8, genomicDNA of F. magnaATCC29328; lane M, 1kbp ladder marker. The digests could be divided into four groups: BF89 and BF377, BF246and BF261, BF170, BF111 and BF197. Sequences had an EcoRI site in the 16S region.

BF89, BF246, and BF170, could be assigned, as expected,to the operons visualized on the physical map, as theycovered rrnA, rrnB, rrnC and rrnD, respectively.

We determined and assembled the complete nucleotidesequences of the 16S-23S-5S regions using thirteen rrn-specific primers and BAC plasmids. However, in primerwalking into the downstream regions of rrn operons, it

Four rRNA operons in Finegoldia magna 21

was necessary to twice re-design primers for rrnA andrrnB. This may have been due to unexpected repeats inthe downstream regions of both operons that can makespecificity of primers low. Gene organization of the fourrrn operons in this strain, including their flanking re-gions, is shown in Fig. 3. All operons comprise a typical16S–23S–5S structure, except that rrnD lacks the 5SrRNA gene. The sizes of 16S–23S spacer regions werefound to be variable, at 116 bp, 203 bp, 256 bp, and 256bp, respectively. The sequences of the rrnC and rrnDspacer regions were identical. tRNA genes were detectedin the 16S-23S spacer region; no tRNA gene in that ofrrnA, Ile-tRNA gene in that of rrnB, and Ala-tRNA genein those of rrnC and rrnD. Short segments adjacent to16S and 23S, of 37 bp and 34 bp, respectively, were con-served in all operons. Both segments involved boxA-likesequences as discussed below.

The operons could be divided into two classes on thebasis of multiple tRNA genes in the region downstreamof rrn. rrnC and rrnD had multiple tRNA genes, andrrnA and rrnB did not. rrnC had 19 tRNA genes (Ala-tRNA gene in the 16S-23S spacer region, and continuousAsn-Leu-Met-Glu-Val-Asp-Thr-Tyr-Gly-Arg-Gln-Lys-Ser-Ser-Met-Phe-Trp-Arg-tRNA genes) in the downstream re-gion. rrnD also had 12 tRNA genes (tRNA-Ala gene inthe 16S-23S spacer region, and continuous Asn-Leu-Met-Met-Glu-Val-Asp-Thr-Tyr-Gly-Arg-tRNA genes) in the

downstream region. Interestingly, two adjacent but sepa-rated parts of the downstream regions of both operons,which correspond to Asn-Leu-Met-tRNA genes and Glu-Val-Asp-Thr-Tyr-tRNA genes, were completely identical.Homogeneities in the 16S-23S spacer regions and down-stream regions of rrnC and rrnD suggested that there wasa mechanism responsible for this sequence identity, or,more likely, that either one was a duplication of the other.Judging from the fact that rrnD lacked the 5S rRNA geneand that almost all tRNAs in the downstream region ofrrnD were also present in rrnC, a feasible explanation forthe homogeneities was the duplication of rrnC and itsflanking regions, thereby generating rrnD, with the elimi-nation of some rRNA and tRNA genes. Total tRNAgenes in the 16S-23S spacer regions and downstream re-gions of the four rrn operons in ATCC29328 strain codedmost varieties of amino acids except for proline, histi-dine, and cysteine. Clustering of tRNA genes in the re-gions immediately downstream of rrn operons was pecu-liar to this strain, compared to the genomes of otherspecies of Bacillus/Clostridium. The significance of thisphenomenon, however, remains to be determined.

Next, we examined the putative promoters and Rho-independent terminators of the operons. The sequences ofthe rrn leader region were partly conserved along 400 bpamong the four operons. Putative tandem promoters forsigma factor σ70 were identified in the leader region of the

Fig. 3. Comparative analysis of four rrn operons in the F. magna ATCC29328 genome. Arrows indicate rrn genes and putative genesin their flanking regions. Those putative genes are numbered as annotated below. One closed box represents one tRNA gene. Therewere 18 and 11 contiguous tRNA genes in the downstream regions of rrnC and rrnD. Asterisks indicate conserved sequences be-tween tRNA gene regions downstream of rrnC and rrnD. Downstream regions of rrnA and rrnB consisted of repeated sequences in-stead of tRNA genes. Best BLASTX hits of putative genes are listed below together with accession numbers: 1) dihydroxyacetone ki-nase [E. coli], AAL61897; 2) P75 protein [Mycoplasma hominis], CAB62239; 3) thioredoxin [Streptomyces aurefaciens],CAA51317; 4) c-type cytochrome biogenesis protein [Clostridium perfringens], BAB82243; 5) aspartyl aminopeptidase [Clostridiumacetobutylicum], AAK79065; 6) general secretion pathway GSPG related transmembrane protein [Ralstonia solanacearum],CAD17292; 7) and 8) putative ORF, no significant hit.

22 K. Todo et al.

Fig. 4. Putative Rho-independent terminators in rrn operons. The numbering started from the 5’-end of the 16S rRNA gene.T-regions following the stem loop are underlined.

Four rRNA operons in Finegoldia magna 23

four and one additional promoter was identified in theleader region of both rrnB and rrnC. In rrnB and rrnC,putative Rho-independent terminators were also identi-fied between the first and the second promoters. In con-trast to the homogeneity observed in tRNA genes withinthe 16S-23S spacer and downstream regions, the promot-er regions of rrnC and rrnD were relatively heteroge-neous. When the leader regions were compared, rrnB andrrnC were most similar, suggesting that the leader regionshad been homogenized or that one region was a duplica-tion of the other. AT-rich sequences, termed UP elements,were identified in all of the upstream regions (from –60to –40) of putative core promoters, as well as in E. coli.The UP elements in E. coli were demonstrated to bind theα-subunit of RNA polymerase and to be an extension ofthe core promoter [8, 19]. Conservation of this motif sug-gested that its rrn transcription activation mechanism,through interaction with the α-subunit of RNA poly-merase, was also conserved. A putative promoter wasalso identified in the 132 bp-gap between Met-tRNA andGlu-tRNA in the downstream region of rrnC. No suchpromoter was present in the downstream tRNA genecluster of rrnD. Putative Rho-independent terminatorswere identified downstream of each of the four operons(Fig. 4). Those with a typical structure, GC-rich palin-dromic regions followed by a T region, were positionedimmediately after the 5S rRNA gene of rrn A and rrnB.Two types of repeat sequences were present downstreamof those two operons. The first repeat unit consisted ofthe 3′-terminal region of the 5S rRNA gene (17bp), a pu-tative Rho-independent terminator, and a downstreampalindromic region (Fig. 4A). The sequences of the re-peats were moderately conserved. Three and two repeatsof this unit were present in rrnA and rrnB, respectively.The F. magna rrnA and rrnB 3′-terminal regions bear sig-nificant similarity to the tandem terminators previouslyidentified and well studied in E. coli rrnA, rrnB, andrrnD operons with respect to the existence of both 3′-ter-minal 5S rRNA genes and Rho-independent terminatorrepeats [18]. The palindromic region may be a compo-nent of the rrn termination system, however, the signifi-cance of the palindrome and the second repeat units in F.magna rrnA and rrnB remain to be elucidated. Since pu-tative Rho-independent terminators could not be detectedimmediately downstream of the rRNA genes in rrnC andrrnD operons, it appears that the rrn and tRNA genesthat are positioned immediately downstream are tran-scribed as one unit, thereby forming rrn-multiple tRNAoperons. Predicted total length of the transcription unitsof rrnC and rrnD summed up to approximately 7.1 and6.3 kbp, respectively. On the other hand, shorter tran-scription units that start from promoters in the tRNAgene spacer and consist only of tRNAs would be compat-ible with this model.

rrn boxA-like antitermination motifs in F. magna andFirmicutes

We searched for a boxA rrn antitermination motif inthe F. magna genome that was similar to the E. coli con-

sensus dodecamer, TGCTCTTTAACA, but could notidentify it, despite allowing up to four sequence differ-ences. Subsequently, we searched for boxA-like sequencesin the bacterial genomes of Firmicutes, in an effort to pre-dict the boxA-like signal of F. magna (Fig. 5). The ratio-nale for focussing on those species was that we expectedthe antitermination motif to be conserved among relatedbacteria. We found two similar boxA-like sequences,TGCTCTTTGAAA in the rrn leader region ofOceanobacillus iheyensis, and TGGTCTTTGAAA in thatof C. perfringens, both of which belong to theBacillus/Clostridium group. Interestingly, we found thatthe boxA-like motif and subsequent bases, (A/T)GN-NCTTT GAAAA(C/T)T(A/G) AA(C/T)A, which summedup to a 20-mer, were highly conserved among Firmicutes.The distance between boxA-like sequences and the 16SrRNA gene was variable, ranging from 40 to 200 bp.BoxB-like hairpin structures were ambiguous and miss-ing in some species. The overview of boxA-like and sub-sequent motifs in Firmicutes provided a reference withwhich to identify the motif in F. magna. Candidates forthe rrn antitermination motif in F. magna were identifiedand are listed in Fig. 5. BoxA-like sequences in this strainseemed considerably different from those of other Firmi-cutes. Intermittent antiterminator-like sequences occurredboth in the leader and spacer regions of the F. magna rrnoperon.

The rrn antitermination mechanism in E.coli has beenof interest to molecular biologists for more than twodecades. The boxBAC motif was identified in the rrnleader region. Within this motif, boxA is essential butboxB and boxC appear to be dispensable for rrn antiter-mination [8]. The rrn boxA of E. coli is a dodecamer andis conserved in the leader and 16S-23S spacer regions ofall rrn operons. It is believed that the rrn antiterminationcomplex includes RNA polymerase, NusA, NusB, NusG,ribosomal protein (r-protein) S10 (NusE), and probably r-protein S4 or other additional ribosomal proteins [15,24]. The NusB and S10 heterodimer is likely to be indis-pensable for rrn antitermination although its RNA bind-ing site (boxA recognition site) is not completely under-stood [11, 17]. The genome projects have demonstratedthat homologs of both nusB and the gene that codes r-protein S10 are conserved in all eubacterial genomes thathave been completed to date. It was proposed more thana decade ago that the rrn boxA motif, and probablyboxB, is conserved in many other bacteria [2]. However,more recent investigations based on genomic databaseshave not centered on the hypothesis. The results of thepresent comparative study of boxA-like sequencesdemonstrated that there are considerable variations with-in rrn antitermination motifs, even if the rrn antitermina-tion mechanism is universally conserved. Compared withthe E. coli consensus boxA dodecamer, Firmicute consen-sus boxA-like sequences involve considerable base differ-ences with up to six changes observed. Since there areconsiderable amino acid sequence variations in bothNusB and S10 in various eubacterial genomes, variationswithin boxA-like sequences would contribute to thisoverall heterogeneity. Otherwise, the existence of other

24 K. Todo et al.

E. coli K 12rrnA ldr CACCCCGCGCCGCTGAGAAAAAGCGAAGCGGCAC TGCTCTTT AACAATTT ATCAGACAATCTGTGTGGGCrrnA spa CAGAGTGTACCTGCAAAGGTTCACTGCGAAGTTT TGCTCTTT AAAAATCT GGATCAAGCTGAAAATTGAAFinegoldia magna ATCC29328rrnA ldr AGTTGTCACTTGAGGCAACGAAATAATTTAACAA AGAACCTT AATAAATT AAATAAAGTAAATACTTTGA

TTTAACAAAGAACCTTAATAAATTAAATAAAGTA AATACTTT GAGAGAAG TACAAACCAAACAATAATTCrrnA spa ACCTCCTTTCTAAGGAGTGCTAACTCAACAAGTA TTTACTTT AAGGTTCA TTAAATTATGAACTTTTAGT

TCAACAAGTATTTACTTTAAGGTTCATTAAATTA TGAACTTT TAGTTTTT ATTAACTGAAGTTTGCACAGTGAACTTTTAGTTTTTATTAACTGAAGTTTGCAC AGAACATT GAAAATCG AATAACAGTATATATTTCCG

Clostridium tetani E88rrnA ldr TACTGTAAAAGTCGCTTGAGTGCGACAGACAAAT AGGTCTTT GAAAATTA AACAGAGAAATAAGCCAGTCrrnA spa TGTTTAATTTTGAGAGACTTAATGTCTTTCAAAT AGTTCTTT GAAAATTG CACAGAGTAAACTAAGGTAAThermoanaerobacter tengcongensis MB4T

rrnA ldr TTAAATTTGTGATAAGATAAAAAAGCTTTCTTGA GGGACCTT GAAAAGTG GACAGCGAGGCTAGGGAGAArrnA spa TTGCTGTTCACTTTTGAGGGGGGAACCCTCAGAA AGGACCTT GAGAACTG CACAAAGCCGAGAAGGGGTCClostridium perfringens strain 13rrnA ldr AAACTAAAGAAGTCGCTTGAGGGCGACAAAGAAA TGGTCTTT GAAAATTA AACAGAAGATATTAACATAArrnA spa CTCTGTTTAATTTTGAGAGACTATCTCTCAAAAT TGTTCTTT GAAAATTG CACATAATTTAATTTATAGAClostridium acetobutylicum ATCC824rrnA ldr TATTATAATTAAGCTGTCTAGTGCAGCGAACAAT TGAACTTT GAAAATTA AACAGAGAATTAAAGAACCArrnA spa TGTTTAATTTTGAGAGTTTAATTCTCTCTAAATT TGTACTTT GAAAATTG CATAGTAATCAATATAGAGTBacillus subtilisrrnA ldr TGATAATAAAGTCGCTTAAACGAGCGGTAAACAA AGTTCTTT GAAAACTA AACAAGACAAAACGTACCTGrrnA spa GTCAGCGGTTCGATCCCGCTAGGCTCCACCAACG TGTTCTTT GAAAACTA GATAACAGTAGACATCACATBacillus halodurans C-125rrnA ldr CATGTTATATTAATCTAGTCGCTAAAAACGACGC AGTTCTTT GAAAACTG AACAAAAGCCAAGCGAAATArrnA spa ACGAAGAGATGCGATGATGATCTGCCGTCAAAAT GGTTCTTT GAAAACTA GATAATGATAAATTGTAAGTOceanobacillus iheyensisrrnA ldr TAAAGTCGCCAATTTGAGTTAGCGACAACGAAAT TGCTCTTT GAAAACTG AACAAAACAACCAGTACGAArrnA spa ATTGAATAAACTTCTTTTACAGAAGTTACTACAT TGTACCTT GAAAACTA AATAAGAGTAACAACGACATStaphylococcus aureus strain Mu50rrn1 ldr AAATGTATAATTAATTCTTGTCGGTAAGAAAAAA TGAACATT GAAAACTG AATGACAATATGTCAACGTTrrn1 spa AAAGCAGTATGCGAGCGCTTGACTAAAAAGAAAT TGTACATT GAAAACTA GATAAGTAAGTAAAATATAGStaphylococcus epidermidis ATCC12228rrn-1 ldr TGAAGAGTATAATTAATTCTTGTCGGTAAGAAAA TGAACATT GAAAACTG AATGACAATATGTCAACGTTrrn-1 spa TTGTATTCAGTTTTGAATGTTTATTAACATTCTT TGTACATT GAAAACTA GATAAGTAAGTAAGATTTTAListeria monocytogenes strain EGDrrnA ldr AGAGTTGCTGCTAAAGGCAACAAAGAAGAAAAAG TGACCTTT GAAAACTG AACAAAGAAGAAGACGAAAArrnA spa TCAGTTTTGAGAGGTTAGTACTTCTCAGTATGTT TGTTCTTT GAAAACTA GATAAGAAAGTTAGTAAAGTListeria innocua Clip11262rrnA ldr AGAGTTGCTGCTAAACACGGCGACGAAGAAAAAG TGACCTTT GAAAACTG AACAAAGAAGAAGACGAAAArrnA spa CAGTTTTGAGAGGTTAGTACTTCTCAAGTATGTT TGTTCTTT GAAAACTA GATAAGAAAGTTAGTAAAGTStreptococcus agalactiae NEM316rrn1 ldr TGCTAGAATATAGAAGTTGTCTCAAGAGAGGCAA AGACCTTT GAAAACTG AACAAGATGAACGAATGTGCrrn1 spa CCCGCTAGGCTCCATTGAATCGAAAGGTTCAAAT TGTTCATT GAAAATTG AATATCTATATCAAATTCCAStreptococcus pneumoniae TIGR4rrnA ldr _ AATATAGTTGTCGCTTGAGAGAAGCAAGTGACAA AGACCTTT GAAAACTG AACAAGACGAACCAATGTGCrrnA spa CGCTAGGCTCCATTGGTGAGAGATCACCAAGTAA TGCACATT GAAAATTG AATATCTATATCAAATAGTAStreptococcus pyogenes M1rrnA ldr _ ATAGAATAAAGAAGTTGTCTCTTAGGAGACGTTA AGACCTTT GAGAACTG AATAAGACGAACCAAACGTGrrnA spa GCTAAAGCGAGCGTTGCTTAGTATCCTATATAAT AGTCCATT GAAAATTG AATATCTATATCAAATTCCAStreptococcus mutans UA159rrnA ldr GGTAGAATAAAGAAGTTGTCTCAGAAAGAGGCAG AGCCCTTT GAAAACTG AACAAGAAGACGAACCAACCrrnA spa AATCCACTTAGGATATGTTAAGTATCCTAGAGAT GGTTCATT GACAATTG AATAGCTAGTAAAAGCCCTALactococcus lactis subsp. lactisrrnA ldr GTCGCAAGAGACGAGGGTCTTGAAGCGATAAGCT AGACCATT GAAAACTG AATAAAGAAGAATGACTCATrrnA spa AGGCTCCATTGTCAGACAAGACGTTAAAATCACT TGAACATT GAAAACTA AATAACAATATCTAATAACG

Fig. 5. rrn antitermination boxA-like sequences in Gram-positive bacteria. The first eight bases of the consensus E.coli boxA dode-camer, TGCTCTTT, and subsequent eight bases are spaced. Lines with arrows under a sequence indicate dyad symmetry. Adjacentputative boxA-like motifs are underlined.

Four rRNA operons in Finegoldia magna 25

factors that recognize or interact with the latter A-richdodecamer, GAAA A(C/T)T(A/G)AA(C/T)A, might ex-plain their conservation and variation in Gram-positivebacteria. Further studies are needed to elucidate what theinterspecific variations of boxA-like sequences mean.

Comparison of rRNA gene sequencesand relative chromosomal position

Sequence variations and their locations within the sec-ondary structure diagram in rrs of F. magna ATCC29328are shown in Fig. 6. Only six bases of the 16S rRNA geneof rrnB were different from those of other operons. Fiveof these were located in “variable regions” of 16S. As pre-

viously suggested, compensatory mutation, from A-U inrrnA, rrnC and rrnD to G-C in rrnB, was observed in theend of helix H1118 of rrnB [1]. Since compensatory nu-cleotide substitution change at the helical region conservesthe secondary structure of rRNA, it would have less influ-ence on the function of rRNA in translation than non-compensatory base pair substitution would do and would,therefore, promote cell survival. The 16S and 23S se-quences in this strain were more homogeneous than wasexpected from previous data [10]. The sequences of alloperons, except for rrnB, were found to be almost identi-cal. Although rrnA and rrnC, rrnB and rrnDwere located850 kbp away from each other, that is, almost on the op-posite side of the chromosome, their sequences were iden-tical except that the rrnD 89 bp of the 3′ terminus weredeleted. Those deleted bases were not considered to con-stitute a sequence difference. The results of our studycombined with Hashimoto’s data suggested that the posi-tive correlation rule between sequence differences andpair-wise distance was not applicable to organisms withrelatively small (<2Mbp) chromosomes, such as F. magnaor Streptococcus. Instead, it seems to apply well to organ-isms with relatively large (2Mbp<) chromosomes.

In conclusion, this study elucidated the mosaic fea-tures of the four rrn operons in F. magna. We divided theoperons into three groups, rrnA, rrnB, and rrnC and D,on the basis of the 16S–23S spacer region. MultipletRNAs were identified in the downstream region of rrnCand rrnD. While rrnA and rrnB, and rrnC and rrnD werevery similar in their downstream regions, in the rrn up-stream region, rrnB and rrnC were most similar. Focusingon the sequence variations of rRNA genes, rrnB alonewas heterogeneous. There was no positive correlation be-tween intercistronic sequence differences and pair-wise

Fig. 6. Sequence variations in F. magna ATCC29328 rRNA and their locations within the secondary structure diagram. Helix num-berings on the right side follow those of the Comparative RNA Web Site [5]. Each helix is numbered with respect to the 5’ nucleotideof the initial base pair in E. coli.

Fig. 7. Comparison of pair-wise rrs and rrl sequence differencesand distance between operons in F. magna. There was no posi-tive correlation between the differences and the distance be-tween rrn operons in this organism. Open symbols representcorrelations in which rrnB participates.

distance. The mosaic nature of these operons is thoughtto reflect an evolutionary history of duplication and ho-mogenization. Comparative analysis of rrn upstream re-gions of Gram-positive bacteria revealed a highly con-served 20-mer sequence containing a conventional rrn an-titermination boxA-like sequence.

References

1. Antón, A. I., A. J. Martinez-Murcia, F. Rodriguez-Valera.:Intraspecific diversity of the 23S rRNA gene and the spacerregion downstream in Escherichia coli. J. Bacteriol. 181,2703–2709 (1999).

2. Berg, K. L., Squires C., Squires, C. L.: Ribosomal RNAoperon anti-termination. Function of leader and spacer re-gion boxB-boxA sequences and their conservation in di-verse micro-organisms. J. Mol. Biol. 209, 345–358 (1989).

3. Birren, B, Green, E. D., Klapholz, S., Myers, R. M.,Roskams, J.: Primer-directed Sequencing, pp. 384, Vol 1.;Bacterial Artificial Chromosome, pp 241–295. Vol 3. In:Genome Analysis Cold Spring Harbor Laboratory Press,New York (1997).

4. Brüggemann, H., Bäumer, S., Fricke W. F., Wiezer A.,Liesegang, H., Decker, I., Herzberg, C., Martínez-Arias, R.,Henne, A., Gottsschalk, G.: The genome sequence ofClostridium tetani, the causative agent of tetanus disease.Proc. Natl. Acad. Sci. USA 100, 1316–1321 (2003).

5. Cannone, J. J., Subramanian, S., Schnare, M. N., Collett, J.R., D’Souza, L. M., Du, Y., Feng, B., Lin, N., Madabusi, L.V., Muller, K. M., Pande, N., Shang, Z., Yu, N., Gutell, R.R.: The Comparative RNA Web (CRW) Site: an onlinedatabase of comparative sequence and structure informa-tion for ribosomal, intron, and other RNAs. BMC Bioinfor-matics. 3, 2 (2003).

6. Cole, J.R., Chai, B., Marsh, T. L., Farris, R. J., Wang, Q.,Kulam, S.A., Chandra, S., McGarrell, D.M., Schmidt, T.M., Garrity, G.M., Tiedje, J.M.: The Ribosomal DatabaseProject (RDP-II): previewing a new autoaligner that allowsregular updates and the new prokaryotic taxonomy. NucleicAcids Res. 31, 442–443 (2003).

7. Collins, M. D., Lawson, P. A., Willems, A., Cordoba, J. J.,Fernandez-Garayzabal, J., Garcia, P., Cai, J., Hippe, H.,Farrow, J. A. E.: The phylogeny of the genus Clostridium:proposal of five new genera and eleven new species combi-nations. Int. J. Syst. Microbiol. 44, 812–826 (1994).

8. Condon, C., Squires C., Squires, C. L.: Control of rRNAtranscription in Escherichia coli. Microbiol. Rev. 59,623–645 (1995).

9. Gourse, R. L., de Boer, H. A., Nomura, M.: DNA determi-nants of rRNA synthesis in E. coli: growth rate dependentregulation, feedback inhibition, upstream activation, andantitermination. Cell. 44, 197–205 (1986).

10. Hashimoto, J. G., Stevenson, B. S., Schmidt, T. M.: Ratesand consequences of recombination between rRNA oper-ons. J. Bacteriol. 185, 966–972 (2003).

11. Huenges, M., Rolz, C., Gschwind, R., Peteranderl, R.,Berglechner, F., Richter, G., Bacher, A., Kessler, H., Gem-mecker, G.: Solution structure of the antitermination pro-tein NusB of Escherichia coli: a novel all-helical fold for anRNA-binding protein. EMBO J. 17, 4092–4100 (1998).

12. Keis, S., Sullivan, J. T., Jones, D. T.: Physical and geneticmap of the Clostridium saccharobutylicum (formerlyClostridium acetobutylicum) NCP 262 chromosome. Micro-biology 147, 1909–1922 (2001).

13. Lane, D. J.: 16S/23S rRNA sequencing. In: Nucleic AcidTechniques in Bacterial Systematics. (Stackebrandt, E. andGoodfellow, M., Eds., New York, John Wiley and Sons(1991).

14. Lowe, T. M., Eddy, S. R.: tRNAscan-SE: A program for im-proved detection of transfer RNA genes in genomic se-quence. Nucl. Acids Res. 25, 955–964 (1997).

15. Luttgen, H, Robelek, R., Muhlberger, R., Diercks, T.,Schuster, S. C., Kohler, P., Kessler, H., Bacher, A., Richter,G.: Transcriptional regulation by antitermination. Inter-action of RNA with NusB protein and NusB/NusE proteincomplex of Escherichia coli. J. Mol. Biol. 316, 875–885(2002).

16. Murdoch, D. A.: Gram-positive anaerobic cocci. Clin. Mi-crobiol. Rev. 11, 81–120 (1998).

17. Nodwell, J. R., Greenblatt, J.: Recognition of boxA antiter-minator RNA by the E. coli antitermination factors NusBand ribosomal protein S10. Cell. 72, 261–268 (1993).

18. Ohnishi, M., Murata, T., Nakayama, K., Kuhara, S.,Hattori M., Kurokawa, K., Yasunaga, T., Yokoyama, K.,Makino, K., Shinagawa, H., Hayashi, T.: Comparativeanalysis of the whole set of rRNA operons between anenterohemorrhagic Escherichia coli O157:H7 Sakai strainand an Escherichia coli K-12 strain MG1655. System.Appl. Microbiol. 23, 315–324 (2000).

19. Ross, W., K. K. Gosink, J. Salomon, K. Igarashi, C. Zou, A.Ishihama, K. Severinov, R. L. Gourse.: A third recognitionelement in bacterial promoters: DNA binding by the α-sub-unit of RNA polymerase. Science 262, 1407–1413 (1993).

20. Salazar, L., Fsihi, H., de Rossi, E., Riccardi, G., Rios, C.,Cole, S. T., Takiff, H. E.: Organization of the origins ofreplication of the chromosomes of Mycobacterium smeg-matis, Mycobacterium leprae and Mycobacterium tuber-culosis and isolation of a functional origin from M. smeg-matis. Mol Microbiol. 20, 283–293 (1996).

21. Shimizu, T., Ohshima, S., Hoshino, K., Honjo, K., Hayashi,H., Shizu, T.: Sequence heterogeneity of ten rRNA operonsin Clostridium perfringens. System. Appl. Microbiol. 24,149–156 (2001).

22. Thompson, J. D., Higgins D. G., Gibson, T. J.: CLUSTALW: improving the sensitivity of progressive multiple se-quence alignment through sequence weightning, positionspecific gap penalties and weight matrix choise. NucleicAcids Res. 22, 4673–4680 (1994).

23. Todo, K., Goto, T., Miyamoto, K. and Akimoto, S.: Physicaland genetic map of the Finegoldia magna (formerly Pepto-streptococcus magnus) ATCC 29328 genome. FEMS Micro-biol. Lett. 210, 33–37 (2002).

24. Torres, M., Condon, C., Balada, J. M., Squires, C., Squires,C. L.: Ribosomal protein S4 is a transcription factor withproperties remarkably similar to NusA, a protein involvedin both non-ribosomal and ribosomal RNA antitermina-tion. EMBO J. 20, 3811–3820 (2001).

Corresponding author:Shigeru Akimoto, 811-1 Kimiidera Wakayama, Wakayama,641-0012, JapanTel.: ++81(73) 441-0640; Fax: ++81(73) 448-1026; e-mail: akimotos@wakayama-med.ac.jp

26 K. Todo et al.