ELSEVIER Journal of Orthopaedic Research 20 (2002) 747 755

Journal of Orthopaedic

Research www.elsevier.com/locate/orthres

Collagen-targeted BMP3 fusion proteins arrayed on collagen matrices or porous ceramics impregnated with Type I collagen

enhance osteogenesis in a rat cranial defect model Bo Han a, Natalya Perelman a, Baowei Tang a, Fredrick Hall a, Edwin C. Shors

Marcel E. Nimni a Surgical Reseurch Laboratories, Dcpartments of’Surgery, Orthopuedics and Biochemistry, University of Southern Cal[fiirnia. Keck School of Medicine,

IIMR-810, Los Angeles, CA 90033, USA

Received 27 June 2001; accepted 4 October 2001

Interpore-Cross Intemutional, Irrine, CA 92718, USA

Abstract

Bone morphogenetic protein 3 (BMP3) is a potent osteoinductive growth factor belonging to the TGF-P superfamily. In this study, we engineered a recombinant BMP3 protein to include an auxiliary collagen-targeting domain derived from von Willebrand coagulation factor (vWF). The collagen-targeted BMP3 fusion protein (rhBMP3-C) was expressed in E. coli, purified from bacterial inclusion bodies, renatured under controlled redox conditions, and assayed for biological activity in vitro and in vivo. The renatured rhBMP3-C fusion protein bound tightly to collagen matrices and inhibited DNA synthesis in normal rat calvaria cells and in two out of three human osteosarcoma cell lines tested. Alkaline phosphatase activity was increased in rat calvarial cells and was de- creased in osteosarcoma cells in vitro in a dose-dependent manner. Collagen sponges impregnated with rhBMP3-C and implanted subcutaneously in Fischer-344 rats induced dose-dependent dystrophic calcification of the collagen matrix, with no evidence of ectopic bone formation. However, local injection of rhBMP3-C infused in a collagen suspension induced new bone formation on the periosteal surface of rat calvaria. Finally, in a rat cranial defect model, surgical implantation of rhBMP3-C arrayed on either collagen sponges or on porous ceramics coated with Type 1 collagen exhibited marked osteoinductive properties. Taken together, these results demonstrate the feasibility of engineering and manufacturing targeted-BMPs which exhibit an integral gain-of-function that may be exploited to therapeutic advantage in (i) the enhancement of effective local concentrations, (ii) the prevention of sys- temic biodistribution and side effects, and (iii) the design of improved osteoinductive matrices. 0 2002 Orthopaedic Research Society. Published by Elsevier Science Ltd. All rights reserved.

Keyivord.r.. Bone morphogenetic proteins; von Willebrand factor; Extrdceliular matrix; Targeted growth factors; Osteogenesis; Bone formation Abbreuiulions; BMP3: Bone morphogenetic protein 3; TGF-B: Transforming growth factor-B; IPTG: Isopropyl P-D-thiogalactopyranoside; GSH: Reduced glutathione; GSSG: Oxidized glutathione; PMSF: Phenylinethysulfonyl fluoride; vWF: von Willebrand factor; TFA: Trifluoroacetic acid; PAI-1: Plasminogen activator inhibitor-1; HAc: Acetic acid; PEG: Polyethylene glycol; L-Arg: L-arginine; rhBMP3-C: Recombinant human collagen-targeted BMP3 fusion protein; rhBMP3: Recombinant human BMP3 fusion protein without a collagen-binding domain; pNPP: p-Nitrophenyl phosphate

Introduction

Bone formation depends on the recruitment and modulation of a population of osteoprogenitor cells which respond in a sequential manner to a multi-step cascade of events [20-221 involving chemotaxis, cell

*Corresponding author. Tel.: + 1-323-442-2783; fax: + 1-323-442- 3335.

division, and cytodifferentiation, controlled, in part, by the local availability of a series of growth factors with bone morphogenetic potential. Bone morphogenetic protein 3 (BMP3), also known as osteogenin, as de- scribed by Reddi and associates [15,26], is a member of the growing transforming growth factor-beta super- family. Its DNA sequence and primary structure are well defined [26], exhibiting a characteristic motif con- taining seven highly conserved cysteines located near the

E-maii nddre.s.s: nirnni007@cs.com (M.E. Nimni). carboxyl-terminal region. However, BMP3 remains one

0736-0266/02/$ - see front matter 0 2002 Orthopaedic Research Society. Published by Elsevier Science Ltd. All rights reserved PI I: S 0 7 3 6 - 0 2 6 6 (0 1 ) 0 0 1 5 7 - 7

748 B. Hun et ul. I ./ourniil of' Ortkoptrt~tlic~ Re.seuwli 21) (2002) 747-755

of the lesser-investigated members of this important family of growth factors.

BMP3 appears to be involved with the growth and differentiation of mesenchymal cells, chondroblasts, and osteoblasts in developing limb-buds [6,25]. Definitive studies of BMP3 localization, performed in both human and mouse tissues, have demonstrated high levels of both mRNA expression and protein synthesis in bone, cartilage, kidneys, lungs, small intestine, hair follicle, teeth and ovary [1,11,31]. Current evidence suggests that BMP3 may be involved in numerous aspects of the proliferation and differentiation of mesenchymal cells at various stages of embryogenesis, as well as in the adult animal [29,31]. Therefore, BMP3 appears to be a mul- tifunctional growth factor whose physiological effects are influenced by the state of commitment and differ- entiation of the target cells and by the tempero-spatial environment.

The biological activity of BMP3 was initially identi- fied in the extracts of demineraliied bone [26] and was characterized by its ability to stimulate osteoblastic differentiation and bone formation [ 15,261. Although subsequent studies in vivo support the role of BMP3 in modulating bone formation [ 10,13,16,24], the molecular mechanisms of its biological activities remain poorly understood. The limited availability of purified BMP3, which is extracted from skeletal tissues, continues to hamper such studies. To overcome the problems of limited availability and purity, we used a bacterial sys- tem to express genetically engineered human recombi- nant BMP3 fusion proteins bearing a purification tag, as well as an auxillary ECM-binding domain, which were then purified and refoldedkenatured in vitro to recon- stitute their native biologically active dimer conforma- tion. The relatively large quantities of the various recombinant BMP3 species obtainable with this system enabled us to scale-up and perform more extensive preclinical studies of this growth factor.

Therapeutic concentrations of growth factors are notoriously difficult to maintain at wound sites, as they are washed away, leached out, or diluted extensively by extracellular fluids. Periodic addition of growth factors often requires invasive procedures, such as injection or infusion, which may be clinically impractical, while ex- cessive doses may have undesirable systemic side effects. Therefore, the concept of targeting and/or tethering therapeutic growth factors to specific sites in order to increase the effective local concentrations [S, IS] and/or prolong their biological half-lives [9,30] becomes an important consideration for future clinical objectives. With this concept in mind, we engineered a tripartite fusion protein which contains (i) the primary structure of the mature human BMP3 polypeptide, (ii) a collagen- binding decapeptide derived from the D2 collagen- targeting domain for von Willebrand factor (vWF) propolypeptide [8,9,30] bracketed by strategic linkers,

and (iii) a 6 x histidine purification tag to enable ex- traction and purification under stringent denaturing conditions.

The current study was designed to evaluate the po- tential utility of incorporating this recombinant collagen- binding BMP3 fusion protein (rhBMP3-C), combined with either collagen Type I matrices or coral-derived liydroxyapatite ceramics coated with a thin layer of Type 1 collagen. The biological effects of these constructs were tested in vitro on fetal rat calvaria cells and various human osteosarcoma cell lines, followed by an evalua- t ion of the physiological effects of rhBMP3-C impreg- nated composites on animal models of osteogenesis.

Materials and methods

Reconihincrrzt BMP3 fusiori pr.oteiii.s

The full coding region of BMP3 was generously provided Dr. H. Reddi (University of California, Davis). The cDNA sequence encoding the conserved carboxy terminal region of BMP3 (generated normally by proteolytic cleavage of the precursor protein at an RXXR site) was engineered to include a high-affinity collagen-binding decapeptide, Trp Arg-Glu-Pro-Ser-Met Ala-Leu-- Ser. derived from von Wille- brand factor [S] and bracketed by strategic linkers [9] in frame with an N-terminal6x His purification tag (provided by the expression vector) was generated by design of the PCR primers as follows: The sense primer designed for generating the recombinant rhBMP3 (rhBMP3-C) tripartite fusion protein was CATATGTGGCGCGAACCGAGCT- TCATGGCTCTGAGCGGTGCTAGCTCTACCT and the antisense primer including the termination (stop) codon was TTATCTGCAA- GCGCAAG ACT.

The PCR amplified cDNA fragment was purified from an agarose gel using the Geneclean kit (BiolOl, Carsbas, CA), inserted into a high-performance bacterial expression vector. pET28b (Novagen, Madison. WI), and transformed into the BL21(DE), strain of E. coli. Protein expression was induced with 0.4 mM isopropyl P-D-thioga- lxtopyranoside (IPTG) at 37 "C for 5 h. The recombinant proteins, which accumulated in the insoluble inclusion bodies, were isolated from the cell lysate by centrifugation and solubilized with 8 M urea containing the proteinase inhibitor, 10 m M phenylmethysulfonyl flu- oride (PMSF). The solubilized rhBMP3-C was purified from extrane- ous bacterial proteins under denaturing conditions by Ni-NTA chelating chromatography (Qiagen, Valencia, CA). Purified rhBMP3- C monomers were gradually renatured over 24 h at 4 "C by rapidly lowering the concentration of urea (1.5-2.0 M) and employing a controlled glutathione redox system, which includes 0.2 mM of oxi- dized glutathione (GSSG) and 2.0 mM of reduced glutathione (GSH). The refolding procedure was completed by stepwise dialysis into a 10%1 sucrose phosphate buffer (0.01 M , pH 8.0). and the renatured fusion proteins were stored at -20 "C prior to use. Purity and yields of re- combinant proteins were analyzed by electrophoresis on an 8 16% SDS-PAGE gel. A recombinant BMP3 fusion protein lacking the collagen-targeting domain but containing the polyhistidine purification sequences (rhBMP3) was also prepared and expressed using the same approach t o serve as a control.

Chlltrscn-hintling USSUJ,

Acid soluble Type I collagen from rat tail tendon was prepared as described [17]. One hundred microliters of 1.5 mg/ml of Type I colla- gen in 0.5 M acetic acid were pipetted into 24-well flat bottom plates and air-dried in a fume hood overnight. Before use, the wells were washed three times with phosphate buffered saline (PBS). Two hundred microliters of the rhBMP3 or rhBMP3-C solutions (0.1 pg/ml) were added to each well and incubated at 37 "C for 1 h. At the end of the incubation period, the respective BMP3 solutions were aspirated and

B. Hun et UI. / Journul qf Orthopuedic Restarch 20 (2002) 747-755 749

the wells washed extensively with PBS. To dissociate the rhBMP3-C or rhBMP3 retained on the collagen matrices, increasing concentrations of urea were used. In individual wells, 0.5 ml of urea solution (from 1-6 M) was added and incubated at 37 "C for 30 min with gentle shaking. At the end of the extraction procedure, thc urca clute was discarded and wells wcre further rinsed with PBS prior to immunoassay.

The rhBMP3-C (or rhBMP3) remaining on the surface of the col- lagen-coated wells was quantitated by a modificd ELISA assay, uti- lizing anti-tetra His antibodies (Qiagen, Valencia. CA) as the primary antibody for both fusion proteins, since both rhBMP3-C and rhBMP3 contained a (His), purification tag at the extreme N-terminus. Wells were first blocked with 5% dry-milk/PBS for 2 h on a platform shaker followed by the addition of 200 p1 (1:lOOO dilution) anti-tetra His antibodies and incubation at room temperature for 2 h. The unbound primary antibodies were removed by three washes with PBS. Alkaline phosphatase-coiijugated goat--anti-mouse IgG (Cappel, West Chester, PA, 1:20OO) was used as a secondary antibody. The alkaline phos- phatase reaction product was developed by incubation with ptm-ni- trophenylphosphate @NPP) (Sigma, St. Louis, MO) for 30 min at 37 "C, and the results were quantilied at 410 nni using a plate reader (Molecular Devices, Sunnyvale, CA).

Cell cultures

Rat calvaria cells were isolated from parietal bones of 20-day-old Fischer-344 rat fetuses, stripped of periosteum, dissected free of frontal and occipital bones, minced into 1-2 inn1 pieces, and digested at 37 "C with collagenase (2.0 mg/ml, 160 units/mg, Worthington, Freehold, NJ). Cell populations released before 25 min were discarded and, thereafter, the digested cells were plated at a density of 1 .5 x 1 06/T75 cell culture flask and cultured as monolayers with 10%) fetal bovine serum (FBS, Sigma) in Dulbecco's modified Eagle medium (DMEM, Gibco, Grand Island, NY). At confluence, the cells were trypsinized and plated into 24-well cell culture plates at a density of 10' cellslwell for overnight attachment, and the medium was changed into 0.5%) FBS/DMEM followed by the addition of different amounts of rhBMP3-C fusion proteins. Four hours before the end of the incuba- tion period, the cells were incubated with 1 .O pCi/inI3 H-thymidine in a medium containing 0.5% FBS.

Human MG-63, U2OS, and TE-85 osteosarconia cells (America Type Culture Collection, ATCC, Rockville, MD) were also used to evaluate rhBMP3-C induced DNA synthesis. Approximately 10' cells/ well were plated in 24-well plates in IOh FBS/DMEM for overnight attachment. Cells were deprived of serum for 48 h and then exposed to rhBMP3-C solutions for 24 h before being labeled with ' H-thymidine, for the last 4 h of incubation, followed by precipitation with 10'%1 tri- chloroacetic acid (TCA). Cellular DNA was solubilized with 0.2 m10.2 N NaOH and the incorporation of radioactivity was determined using a scintillation counter (Beckman LS60001C, Fullerton, CA).

Alkciline pliospliutrr.se

After 48-h stimulation with rhBMP3-C or rhBMP3, pre-confluent rat calvaria cells o r human osteosarcoina e l l s were lysed using I'%l

Triton- 100/PBS and repeatedly frozedthawed for three times to dis- rupt the cell membranes. Alkaline phosphatase activity was determined as described [2]. In 50 pl aliquots of each clarified cell lysate, 150 pl of 0.3 mM p N P P was used as a substrate. The resulting absorbance at 410 nm was recorded after 30 min of incubation at 37 "C, and the activity was normalized to the protein content (BCA protein assay, Pierce, Rockford, IL).

Collagen syithesis

Cells were placed in 24-well plates at cell densities of N 10'/well in 10%) FBS overnight, and the medium was changed to assay medium, which included 0.5% FBSlDMEM plus growth factors (rhBMP3-C, 40 ng/ml), labeling agents and co-factors ( S O pg/ml ascorbic acid, 50 pg/ml p-aminopropionitrile (BAPN) and SO pCi/ml' H-proline). Cells were maintained for 48 h before being analyzed for the biosyn- thesis of labeled collagen. Briefly, at 4 "C, samples were acidified with

glacial acetic acid to a final concentration of 0.5 M and pepsin was added (2500 U/mg, Worthington Biochem.) to 0.5 mg/ml. Platei were placed on a rocker platform and shaken overnight at 4 "C. Digested samples were lyophilized twice prior to dissolving in I x sample buffer. and adjusting the pH to pH 7.4 with 1 M Tris. Collagen synthesis was measured either directly, by counting incorporated ' H-OH-Proline. or alternatively, the samples were subjected to SDS PAGE and autora- diography with band densities qnantified using a computerized image analysis program SCINO (Scino, Frederick, MD).

Subcutcineous inipluntution

Collagen sponges (derived from rat tail tendon collagen) were prepared in our laboratory a s described [17]. Sponges were cut into 5 mm diameter disks, 2 mm in height, for implantation. One to fifteen pg of rhBMP3-C (100 pl) was applied to each collagen disk and iniplantcd subcutaneously on the backs of one-month-old male Fischer-344 rats. Collagen matrices exposed only to 100 pI PBS buffer were used as controls. Twelve rats were used in this study. To ensure internal con- sistency, the experimental and control implants were inserted in con- tralateral sides of the same host. After four weeks of implantation. explants were cut into two-halves. One half was evaluated histologi- cally with hematoxylin and eosin (H&E) for visualization of cells and tissue formation or by von Kossa's silver nitrate staining for demon- stration of matrix mineralization. Calcium content in the remaining halves was quantitated by atomic absorption spectrophotometry (Beckman). Alkaline phosphatase was determined in the same half of the homogenized explants as described above.

Ptiru-cnlcuriul inj i~i ion o/ r-liBMB3-C

Two-month-old Fischer-344 rats were administered rhBMP3-C proteins by subcutaneous injection over the right parietal bone of the calvaria as described by Chen [4]. Soluble rat tendon Type I collagen (2.0 mg/ml, pH 7.4) was used as a carrier. Rats received either carrier alone, or I .O pg of rhBMP3-C, two times per day, for 3 days. The rats were euthanized 14 days after commencing the injections and the calvaria bones were removed upon sacrifice for histological study.

Cruniul tlclfi.ri tnodiJl

Both a fibrous collagen matrix (as described above) and porous resorbable ceramic blocks (ProOsteon SOOW, Interpore Cross Interna- tional, Irvine, CA) were used as carriers in these studies. Test matrices were prepared and cut into 8 mm discs. An 8 mm diameter circular opening was created in the skull of Fischer-344 rats using a specially manufactured drill bit, including a lip to restrict the depth of the cir- cular cutting. When using collagen sponges, 20 pg of rhBMP3 or rhBMP3-C was applied directly into the collagen sponge (8 mm di- ameter) before implantation. When preparing porous ceramic discs, the units were machined to present an over-extended rim, which pre- vented the insert from impinging on the brain tissue. The ceramic discs, in the form of 'upside-down hats', were then placed in the cranial defects (Fig. 1). To enable the delivery of the targeted recombinant growth factors, the porous ceramic blocks were first impregnated with Type 1 collagen by soaking them in a collagen solution (2.0 mg/ml) for 1 h, followed by incubation at 37 "C to stimulate fiber formation, and lypholization to dry the matrix composites and enhance attachment to the mineral surface. Different amounts of rhBMP3 or rhBMP3-C so- lution were added to the collagen-coated blocks and allowed to adsorb for 10 min. Controls included untreated porous ceramic discs, as well as collagen-coated discs without added growth factors. After four weeks of implantation, bone growth and healing status were evaluated histologically.

Sratistirul niethot1.t

Data presented represent the mean &S.D. of the means. Statistical differences between groups were calculated using a Student's !-test.

750 B. Hnn et ul. I Journal oj Orthopuedic Research 20 (2002J 747-755

4

Fig. 1. Diagram illustrating a porous ceramic disc shaped to fit in an 8 mm cranial defect in a rat.

Results

Expression of recombinant BMP-3: collagen-hinding ,fusion pro feins

When rhBMP3-C fusion proteins were expressed in E. coli following induction by IPTG, the proportion of recombinant proteins were found to represent approxi- mately 30% of the total bacterial proteins, as shown in Fig. 2(A) (Lane 3). After purification, the rhBMP3-C protein could be identified as a monomer with a mo- lecular weight of w 26 kDa (Fig. 2(A), Lane 4). Under the conditions describer herein, a native rhBMP3 con- formation could be reconstituted from the purified monomers over time using a controlled glutathione redox system, resulting in dimers with a molecular weight of N 46 kD (Fig. 2(B)). Refolding for 24 h under these conditions appeared to be optimal for dimer for- mation (lane3), as a longer refolding time (72 h) resulted

Fig. 2. (A) Expression of rhBMP3-C fusion protein from E. coli Lane I . molecular marker; Lane 2, bacterial protein without the rhBMP3-C construct: Lane 3, bacterial protein with the rhBMP3-C construct; Lane 4, rhBMP3-C recombinant protein purified by Ni-NTA chro- matography, and visualized on the 8-16'%1 gradient SDS-PAGE gel under reducing conditions. (B) rhBMP3-C refolded into dimer con- formation under redox conditions (non-reducing condition). Lane I . molecular marker; Lane 2. 0 refolding time; Lane 3, refolded for 24 h; Lane 4. refolded for 72 h.

rhBMP3-C

!\

i a ! I ~ ~ - _ _ _ ~ I 0 3 t ~~

0 1 2 3 4 5 6 7

Urea (M)

Fig. 3. Binding of rhBMP3-C fusion proteins to Type I collagen. rhBMP3-C or rhBMP3 were applied to the collagen membrane first. The binding between BMP3 and collagen was dissociated with serial urea gradient. The BMP3 retained on collagen was determined by His- tetra antibodies. rhBMP3-C could not be released until the urea con- centration reached 3.0 M (open circle). rhBMP3, the fusion protein without a collagen-binding domain does not bind with such high af- finity to collagen (closed circle).

in aggregate formation and decreased yields (Lane 4). 1Jnder optimal conditions, the yield of purified rena- tured rhBMP3-C from E. coli was w 10 pg/ml of bac- terial broth, while the yield of rhBMP3 was - 14 kg/ml.

rhBMP3-C binds to collugen with high aflnity

The purified renatured rhBMP3-C binds to collagen with extremely high affinity, as it requires 3 3.0 M urea to completely dissociate the polypeptide from the col- lagen matrix (Fig. 3). In contrast, the rhBMP3 poly- peptide, which is identical in structure except that it lacks the collagen-targeting decapeptide, does not bind strongly to collagen and is readily eluted under 1 M urea washing conditions. These results demonstrate that the desired gain-of-function (collagen-binding) is attribut- able to the vWF-derived collagen-binding domain.

rhBMP3-C and c,ell prolijkrution

As shown in Fig. 4(A), rat calvaria cells treated with either rhBMP3 or rhBMP3-C for 48 h exhibited a sim- ilar dose-dependent inhibition of DNA synthesis. Half- maximal inhibition was obtained at - 15 ng/nil for both polypeptides and maximal inhibition was observed at concentrations over 60 ng/ml, indicating that the two species of purified, renatured polypeptides exhibit simi- lar specific activities. The effects of rhBMP3-C on cell proliferation were further examined on several osteo- sarcoma cell lines. The two human osteosarcoma cell lines, U20S and TE-85, responded to rhBMP3-C with a

B. Hun c't al. I Journal of' Ortliopmetl'ic Re.sctrrch 20 (2002) 747-755 75 I

? I - - - 4 0 20 40 60 80 100 120 140 160

BMP-3 (nglml)

0 10 20 30 4 0

rhBMP3-C (ng/ml)

Fig. 4. Effect of rhBMP3-C and rhBMP3 on cell proliferation, inea- sured by 'H-thymidine incorporation into DNA. Cells were cultured for 48 11 with different doses of rhBMP3-C, 0.5'%1 FBS/DMEM and labeled with ["HI-thymidine during the last 4 h of incubation. (A) Calvaria cells. (B) Osteosarcoina cells, TE-85 and U20S. Data repre- sent mean * S.D. ( n = 4).

significant dose-dependent inhibition of DNA synthesis (Fig. 4(B)), while rhBMP3-C had no discernable effect on the proliferation of MG-63 osteosarcoma cells (data not shown).

A lkuline ph osplza tare LX t iu ity und co llugen synthesis

The application of rhBMP3-C to rat calvarial cells significantly increased cell alkaline phosphatase (ALP) activity when administered over a range of 1 0 4 0 ng/ml during a 48 h incubation period (Fig. 5(A)). Maximal stimulation of alkaline phosphatase activity was ob- served at - 40 ng/ml (1.8-fold (p < 0.001) higher than control), as doses above 40 ng/ml rhBMP3-C appeared to be less efficient. As shown in Fig. 5(B), a dose- dependent inhibition of alkaline phosphatase activity was observed with rhBMP3-C in both U20S and TE-85 osteosarcoma cells, further verifying the biological ac- tivity of the renatured polypeptides. In MG-63 cells treated with 40 ng/ml of either rhBMP3 or rhBMP3-C,

E .- 1 6 - t

5 1 4 -

Q 1 2 -

. c s! a E 1 0 a ul 0 8 -

>

v 0 6

2 0 4

0 0 O 2 L 0 10 20 40

rhBMP3-C (ng/ml)

... 0 8

c E . 0,

g 0 5

! 0 4 - a In 5 0 3

0 2

I

Y

~- 0 5 10 1s 20 2 s

rhBMP3-C (ng/ml)

Fig. 5 . Alkaline phosphatase activity measured in calvaria or osteo- sarcoma cells treated with rhBMP3-C. Cells were incubated with dif- ferent doses rhBMP3-C for 48 11, and alkaline phosphatase in the cell layer tested. (A) Rat calvaria cells; (B) ostcosarconxd cells, TE-85 (open circle) and U2OS (closed cirlce). Data represent rneaii&S.D. ( I I = 5 ) .

Fig. 6. rhBMP3-C stimulates rat calvaria cell Type I collagen synthesis. Both medium and cell-layer l'ractjons of newly synthesized 'H-proline radiolabeled collagen were measured by SDS-PAGE gel electropho- resis aEter limited pepsin digestion. The amounts of protein loaded on the gels were normalized by protein assay prior to electrophoresis. Lane 1, cells grown in 0.5'5) FBSIDMEM; Lane 2, cells grown in 40 ng/ml rhBMP3 for 48 h: Lane 3. cells grown in 40 ng/inl rhBMP3- C for 48 h.

the synthesis of Type I collagen was increased 3.2-fold and 3.5-fold (p < 0.01) above controls, respectively, as quantified after SDS-PAGE and autoradiography of rl(1) and ct2(I) chains using a computerized image analysis program (Fig. 6).

752 B Hun et u1 I Journnal of Orthopueclic Research 20 (2002) 747 755

Subcutaneous inqplun tat ion

In these studies, collagen sponges were impregnated with specified concentrations of rhBMP3-C, prior to subcutaneous implantation. After four weeks of im- plantation, the retrieved collagen sponges that were impregnated with rhBMP3-C felt noticeably harder and stiffer than the controls. Subsequent von Kossa staining revealed extensive calcium deposition in the rhBMP3-C treated sponges (at 15 pg rhBMP3-C), while very little calcium deposition was detected in the control sponges (Fig. 7(A)). While significant increases in alkaline phosphatase activity were not observed in the rhBMP3- C implants, the calcium deposits were strongly depen- dent upon the dosage of rhBMP3-C applied to the sponges (Fig. 7(B)). Histological (H&E) examination of explants did not reveal indications of bone formation under these conditions (data not shown).

Crunial injection of rlzBMP-3

Histological examination of rat calvaria obtained from animals injected locally with 1.0 pg rhBMP3-C applied in a collagen suspension revealed the presence of new bone on the periosteal surface after 14 days of treatment. In contrast, control animals injected with the collagen vehicle only exhibited little or no bone forma- tion (Fig. 8). This result suggests that the biological

activity of the collagen-tethered rhBMP3-C is not compromised by its physical association with collagen matrices.

Fig. 8. Supra cranial injection. Soluble type 1 collagen (2.0 mg/ml, pH 7.4) was used as a carrier for rhBMP3. (A) Carrier alone. (B) 1.0 pg of BMP-3. Rats were injected twice a day for three days at the same site. After 14 days, H&E staining reveals new bone formation in group B treated with rliBMP3 recombinant protein. F: fibrous tissue: OB: old bone; NB: new bone.

1.8

0 Allkaline Phosphatase 1.6 4 Calcium

1.2 I

0 5 10 15 rhBMP3-C in collagen disc (kg )

(B)

Fig. 7. (A) Histology of rhBMP3-C combined with collagen after four weeks of subcutaneous implantation (von-Kossa staining): (a) control (100 p1 PBSlcollagen); (b) 15 pg rhBMP3-C in a collagen sponge. Black stainings reflects Ca2.- deposition. (5x, counter stained with eosin). (B) Calcium deposition in subcutaneously implanted collagen matrices impregnated with rhBMP3-C (0-1 5 pg). Ca' ' deposited in the collagen was measured by atomic absorption spectropliotometry after 4 weeks of implantation (filled bar). Alkaline phosphatase activity in the sponge was also extracted and determined (blank bar). Data represent the mean*S.D. (n = 3).

B. Hun et ul. I Journal of Orthopuedic Resrtrrcli 20 (2002) 747-755 753

Cruniul defect model

The collagen sponges alone did not serve to stimu- late bone ingrowths in the rat cranial defect model (Fig. 9(A)), but when the collagen sponges were im- pregnated with 20 pg of rhBMP3-C, significant in- growth of new bone was observed. Importantly, there was consistently more bone formation in the rhBMP3- C treated group (Fig. 9(C)) than that in the rhBMP3 group (Fig. 9(B)). Collagen-coated ceramic blocks, by themselves, induced slightly little bone formation in the center of the block (Fig. 9(D)). However, when 20 pg of rhBMP3-C was added to the collagen-coated ce- ramic discs, extensive bone formation was observed (Fig. 9(F)). Under these conditions the rhBMP3 (lack- ing the collagen-binding domain) also appeared to en- hance new bone formation in the center of the implant, however, when compared with rhBMP3-C treated group, the volume of new bone was consistently much less (Fig. 9(E)).

Discussion

In this paper we report on the biotechnology, bio- logical activity, and potential therapeutic utility of a recombinant bone morphogenetic protein (BMP3) en- gineered to exhibit an extremely useful gain-of-function. We present the design, construction, and expression of rhBMP3-C in a prokaryotic system, followed by a sin- gle-step purification, and renaturation of this relatively complex cysteine-rich growth factor into a biologically active form. Reconstitution of the native dimer confor- mation of rhBMP3-C was visualized by SDS-PAGE and its biological activities established using in vitro and in vivo bioassays. The biotechnology presented herein is clearly amenable to manufacturing scale-up, and thus, has the potential to produce large quantities of BMPs and other TGF-P superfamily members [9,30]. The fact that the primary structure of this growth factor is de- rived from human sequences distinguishes it from par- tially purified bone-inducing preparations that may be

Fig. 9. Cranial defect model. Fibrous collagen matrix (A)-(C) and collagen-coated porous ceramic (D)-(F) were both used as growth factor carriers and bone substitutes. (A) Collagen alone. (B) Collagen sponge impregnated with 20 pg/ml rhBMP3. (C) Collagen sponge impregnated with 20 pg/ml rhBMP3-C. (Dj Collagen-coated porous ceramic alone. (E) Porous ceramics with 20 bg/ml rhBMP3. (Fj Porous ceramic with 20 pg/ml rhBMP3-C.

754 B. Hurl et ul. I Journal o f Orthopwdic Research 20 (2002) 747-755

contaminated with other proteins or can only be ob- tained in small amounts from xenogeneic bone [15,27]. The advantages of utilizing a prokaryotic expression system includes overall cost considerations, as well as numerous concerns raised about mammalian tissues and serum contaminants.

The reasons for selecting collagen as a medium for attaching immobilized growth factors are based on the following considerations: (1) collagen is the largest or- ganic component of bone; (2) it has been used success- fully as a biomaterial for numerous applications due to its biochemical, biomechanical, and biocompatible properties; and (3) the degradation rate of collagen can be controlled by chemical modification (crosslinking, mode of extraction, i.e. monomeric vs. polymeric, etc.). Moreover, as the collagen matrix is gradually resorbed, the bound growth factors are released over time, which extends their biological activities. The timing of release and/or resorption of the carrier is considered to be critical for optimal bone induction. Collagen is com- monly used as a carrier for both TGF-b and BMP’s [ I 8,191, although the reported results vary widely, pos- sibly due to differences in the biological sources and various degrees of collagen crosslinking. Endogenous BMPs present in demineralized bone matrix (DBM) also vary widely, and this presents another problem associ- ated with the clinical use of DBM currently available from clinical bone banks. While, attempts by suppliers to standardize the BMP activity of such material will clearly be of help, the main advantage of DBM may relate to the fact that the collagen in DBM is highly crosslinked, thus is biodegraded slowly and can release its complement of growth factors over a prolonged pe- riod of time. By the genetic engineering of these colla- gen-targeted growth factors, which bind to collagen matrices with high affinity, yet exhibit profound biologic activity both in solution and in physical association with collagen.

The complete spectrum of biological activities at- tributable to BMP3 (a.k.a. osteogenin) is not clearly elucidated, although it is the most abundant of all the BMP‘s [ I ,3 I]. However, in numerous animal models, specific BMPs appear to accelerate bone differentiation and to enhance bone formation to some degree. Nota- bly, Liu et al. [I41 found BMP3 to be highly elevated in thc carly phases of rabbit long bone fracture repair. Additionally, BMP3 is reported to enhance bone for- mation in hydroxyapatite orbital implants in rabbits [ 141 and to induce bone differentiation in calvarial defects when mixed with porous hydoxyapatite [23,24] or inac- tive DBM or collagen [6] in adult primates. BMP3 also stimulates bone formation in rat femoral diaphysis [28].

Interestingly, BMP3 and TGF-P were found to have opposing effects on bone marrow stromal cell prolifer- ation, differentiation, and mineral deposition [7]. At moderate doses, BMP3 is reported to stimulate both

alkaline phosphatase activity and calcium deposition, but not at the lower or higher extreme levels. In vitro, recombinant BMP3 is reported either to stimulate or inhibit osteosarcoma cell proliferation depending on the cell type, test dosage, and/or mode of administration. Thus, while a universal biological assay for BMP-3 ac- tivity is not presently available, dose-dependent re- sponses observed in vitro in the present study are consistent with potent biological activity: In this regard, the dose-dependent inhibition of DNA synthesis and the stimulation of alkaline phosphatase activity observed in primary rat calvarial cells are perhaps the most relevant. Furthermore, the stimulation of new periosteal bone formation in situ is definitive.

In the subcutaneous model, using rhBMP3-C and collagen as a carrier, only dystrophic calcification was evident. On the other hand, in the cranial defect models, rhBMP3-C induced new bone inside the collagen spon- ges and in the interstices of the porous ceramics im- pregnated with the recombinant growth factor. In both cases, the collagen-targeted construct of BMP3 (i.e., rhBMP3-C) induced consistently more bone formation than the non-targeted congener (rhBMP3). In these studies, coating the porous ceramic discs with a mono- layer of collagen served to enhanced the binding and localization of the growth factor and, thus, its biological activity. Overall, our observations correlate well with the findings of Kouri et al. [14], who postulated that BMP3, even though an osteoinductive factor, can only induce bone formation collaboratively in the presence of competent responsive cells [12,13]. BMP-3 had been postulated to be a modulator of osteogenic activity without intrinsic inductive ability of its own [3,5]. Ac- cordingly, BMP3 alone may not be sufficient to induce osteogenesis in all situations, however, in a physiological bone forming environment, in concert with resident cells and with other osteogenic factors present in the area, BMP3 can clearly stimulate and enhance the formation of new bone.

These studies emphasize the importance of the physicochemical mode of delivery, the rate of release, and the local retention of BMPs in maximizing thera- peutic effects while minimizing deleterious side effects. In a well-defined rat cranial defect model, surgical im- plantation of collagen-targeted rhBMP3-C arrayed on either collagen sponges or on porous ceramics coated with Type 1 collagen exhibited marked osteoinductive properties, while the non-targeted congener was signifi- cantly less effective under the same conditions. Taken together, these results demonstrate the feasibility of engineering and manufacturing targeted-BMPs which exhibit an integral gain-of-function that may be ex- ploited to therapeutic advantage in (i) the enhancement of effective local concentrations, (ii) the prevention of systemic biodistribution and side effects, and (iii) the design of improved osteoinductive matrices.

B Hun et a1 I Journal of Orthopaedic Research 20 (2002) 747 755 755

Acknowledgements

We wish to thank Dr. A. Hari Reddi for his generous gift of the cDNA for rhBMP3 and Interpore Cross ln- ternational for their financial support.

References

[l] Aberg T, Wozney J, Thesleff I. Expression patterns of bone morphogenetic proteins (BMPs) in the developing mouse tooth suggest roles in morphogenesis and cell dilkrentiation. Dev Dyn 1997;210(4):383-96.

[2] Alper G, Bernick S, Yazdi M, Nimni ME. Osteogenesis in bone defects in rats: the effects of hydroxyapatite and demineralized bone matrix. Am J Med Sci 1989;298(6):371-6.

[3] Bahamonde ME, Lyons KM. BMP3: to be or not to be a BMP. J Bone Joint Surg Am A 2001;83(Suppl l(Pt I)):S56-62.

[4J Chen D, Harris MA, Rossini G, Dunstan CR, Dallas SL, Feng JQ, et al. Bone morphogenetic protein 2 (BMP-2) enhances BMP- 3, BMP-4 and bone cell differentiation marker gene expression during the induction of mineralized bone matrix formation in cultures of fetal rat calvarial osteoblasts. Calcif Tissue Int 1997;60(3):283-90.

[5] DaIuiski A, Engstrand T, Bahamonde ME, Gamer LW, Agius E, Stevenson SL, et al. Bone morphogenetic protein-3 is a negative regulator of bone density. Nat Genet 2001;27( 1):84-8.

[6] Doll BA, Towle HJ, Hollinger JO, Reddi AH, Mellonig JT. The osteogenic potential of two composite graft systems using osteo- genin. J Periodontol 1990;61(12):745- 50.

[7] Faucheux C, Ulysse F, Bareille R, Reddi AH, Amedee J. Opposing actions of BMP3 and TGF beta 1 in human bone marrow stromal cell growth and differentiation. Biochem Biophys Res Commun 1997;241(3):787-93.

[S] Hall FL, Kaiser A, Liu L, Chen ZH, Hu J, Nimni ME, et al. Design, expression, and renaturation of a lesion-targeted recom- binant epidermal growth factor-von Willebrand factor fusion protein efficacy in an animal model of experimental colitis. Int J Mol Med 2000;6(6):63543,

[9] Han B, Hall FL, Nimni ME. Refolding of a recombinant collagen- targeted TGF-beta2 fusion protein expressed in Escherirhiu coli. Protein Expr Purif 1997;11(2):169--78.

[lo] Herr G, Hartwig CH, Boll C, Kusswetter W. Ectopic bone formation by composites of BMP and metal implants in rats. Acta Orthop Scand 1996;67(6):606-10.

[11] Jaatinen R, Rosen V, Tuuri T, Ritvos 0. Identification of ovarian granulosa cells as a novel site of expression for bone morphoge- netic protein-3 (BMP-3/osteogenin) and regulation of BMP-3 messenger ribonucleic acids by chorionic gonadotropin in cultured human granulosa-luteal cells. J Clin Endocrinol Metab 1996; 81(11):3877-82.

[I21 Khouri RK, Brown DM, Koudsi B, Deune EG, Gilula LA, Cooley BC, et al. Repair of calvarial defects with flap tissue: role of bone morphogenetic proteins and competent responding tissues. Plast Reconstr Surg 1996;98( 1 ): 103-9.

[I31 Khouri RK, Koudsi B, Reddi H. Tissue transformation into bone in vivo. A potential practical application. JAMA 1991; 266(14): 1953-5.

Liu J, Hu Y, Ma 2. The experimental study on expression of BMP3 gene during fracture healing. Zhonghua Wai Ke Za Zhi 1996;34(10):585 S. Luyten FP, Cunningham NS. Ma S, Muthukumaran N, Ham- monds RG, Nevins WB, et al. Purification and partial amino acid sequence of osteogenin, a protein initiating bone diKerentiation. J Biol Chem 1989;264(23):13377-80. Luyten FP, Cunningham NS. Vukicevic S, Pdralkar V, Ripamonti U, Reddi AH. Advances in osteogenin and related bone morpho- genetic proteins in bone induction and repair. Acta Orthop Belg

Nimni ME. The molecular organization of collagen and its role in determining the biophysical properties of the connective tissues. Biorheology 1980;17( 1-2):S1-82. Nimni ME. Polypeptide growth factors: targeled delivery systems. Biomaterials 1997;18(18):1201-25. Paralkar VM, Nandedkar AK, Pointer RH, Kleinman HK, Reddi AH. Interaction of osteogenin, a heparin binding bone morpho- genetic protein, with type I V collagen. J Biol Chem 1990; 265(28):17281-4. Reddi AH. Initiation of fracture repair by bone morphogenetic proteins. Clin Orthop 1998;(355 Suppl):S66 72. Reddi AH. Role of morphogenetic proteins in skeletal tissue engineering and regeneration. Nat Biotechnol 1998; 16(3):247 -52. Reddi AH, Wientroub S, Muthukumaran N. Biologic principles of bone induction. Orthop Clin North Am 1987;18(2):207 -12. Ripamonti U, Ma SS, Cunningham NS, Yeates L, Reddi AH. Reconstruction of the bone-bone marrow organ by osteogenin, a bone morphogenetic protein, and demineralized bone matrix in calvarial defects of adult primates. Plast Reconstr Surg 1993;91( I ) : 27-36. Ripamonti U, Ma SS, van den Heever B, Reddi AH. Osteogenin, a bone morphogenetic protein, adsorbed on porous hydroxyap- atite substrata, induces rapid bone differentiation in calvarial defects of adult primates. Plast Reconstr Surg 1992;90(3):382-93. Ripamonti U, Magan A, Ma S, van den Heever B, Moehl T, Reddi AH. Xenogeneic osteogenin, a bone morphogenetic protein, and demineralized bone matrices, including human, induce bone differ- entiation in athymic rats and baboons. Matrix 1991;11(6):404-11. Sampath TK, Muthukumaran N, Reddi AH. Isolation of osteo- genin, an extracellular matrix-associated, bone-inductive protein. by heparin affinity chromatography. Proc Natl Acad Sci USA 1987;84(20):7 109-1 3. Sciadini MF, Dawson JM, Johnson KD. Bovine-derived bone protein as a bone graft substitute in a canine segmental defect model. J Orthop Trauma 1997;11(7):496-508. Stevenson S, Cunningham N, Toth J , Davy D, Reddi AH. The effect of osteogenin (a bone morphogenetic protein) on the formation of bone in orthotopic segmental defects in rats. J Bone Joint Surg Am 1994;76(11):1676-87. Takahashi H, Ikeda T. Transcripts for two members of the transforming growth factor-beta superfamily BMP-3 and BMP-7 are expressed in developing rat embryos. Dev Dyn 1990; 207(4):43949. Tuan TL, Cheung DT, Wu LT, Yee A, Gabriel S, Han B. Engineering, expression and renaturation of targeted TGF-beta fusion proteins. Connect Tissue Res l996;4( I) : 1-9. Vukicevic S, Helder MN, Luyten FP. Developing human lung and kidney are major sites for synthesis of bone morphogenetic protein-3 (osteogenin). J Histochem Cytochem 1994;42(7):869-75.

1992;58(S~ppl 1):263- 7.