clinical and molecular characterization of collagen vi myopathies russell butterfield md/phd...
TRANSCRIPT
![Page 1: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/1.jpg)
Clinical and Molecular Characterization of Collagen VI Myopathies
Russell Butterfield MD/PhD
University of Utah
Departments of Neurology and Pediatrics
August 15, 2010
![Page 2: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/2.jpg)
Collagen VI myopathies Bethlem Myopathy
Proximal muscle weakness and atrophy Dynamic contractures in distal joints (fingers, wrists,
elbows, and ankles) Onset in first or second decade Slowly progressive in adult years
2/3 of patients >50 years-old require assistance for ambulation
Ullrich Congenital Muscular Dystrophy Severe weakness/hypotonia in early infancy Proximal joint contractures Distal joint hyperlaxity
Collagen VI myopathies likely represent spectrum of phenotypes defined by type and distribution of contractures
![Page 3: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/3.jpg)
Three genes of Collagen VI
C
1(VI)
2(VI)
3(VI)N10 N9 N8 N7 N6 N5 N4 N3 N2
N1
N1
C1 C2TH
C1 C2TH C4C3 C5
C
•C
von Willebrand factor A domain Alternatively spliced vWF A
Triple-helix Lysine/proline repeats
Fibronectin type III motif Kunitz protease inhibitor motif
![Page 4: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/4.jpg)
COL6A1- 4246 base pairs gctctcactctggctgggagcagaaggcagcctcggtctctgggcggcggcggcggccca ctctgccctggccgcgctgtgtggtgaccgcaggccccagacatgagggcggcccgtgct
ctgctgcccctgctgctgcaggcctgctggacagccgcgcaggatgagccggagaccccg agggccgtggccttccaggactgccccgtggacctgttctttgtgctggacacctctgag agcgtggccctgaggctgaagccctacggggccctcgtggacaaagtcaagtccttcacc aagcgcttcatcgacaacctgagggacaggtactaccgctgtgaccgaaacctggtgtgg aacgcaggcgcgctgcactacagtgacgaggtggagatcatccaaggcctcacgcgcatg cctggcggccgcgacgcactcaaaagcagcgtggacgcggtcaagtactttgggaagggc acctacaccgactgcgctatcaagaaggggctggagcagctcctcgtggggggctcccac ctgaaggagaataagtacctgattgtggtgaccgacgggcaccccctggagggctacaag gaaccctgtggggggctggaggatgctgtgaacgaggccaagcacctgggcgtcaaagtc ttctcggtggccatcacacccgaccacctggagccgcgtctgagcatcatcgccacggac cacacgtaccggcgcaacttcacggcggctgactggggccagagccgcgacgcagaggag gccatcagccagaccatcgacaccatcgtggacatgatcaaaaataacgtggagcaagtg tgctgctccttcgaatgccagcctgcaagaggacctccggggctccggggcgaccccggc tttgagggagaacgaggcaagccggggctcccaggagagaagggagaagccggagatcct ggaagacccggggacctcggacctgttgggtaccagggaatgaagggagaaaaagggagc cgtggggagaagggctccaggggacccaagggctacaagggagagaagggcaagcgtggc atcgacggggtggacggcgtgaagggggagatggggtacccaggcctgccaggctgcaag ggctcgcccgggtttgacggcattcaaggaccccctggccccaagggagaccccggtgcc tttggactgaaaggagaaaagggcgagcctggagctgacggggaggcggggagaccaggg agctcgggaccatctggagacgagggccagccgggagagcctgggccccccggagagaaa ggagaggcgggcgacgaggggaacccaggacctgacggtgcccccggggagcggggtggc cctggagagagaggaccacgggggaccccaggcacgcggggaccaagaggagaccctggt gaagctggcccgcagggtgatcagggaagagaaggccccgttggtgtccctggagacccg ggcgaggctggccctatcggacctaaaggctaccgaggcgatgagggtcccccagggtcc gagggtgccagaggagccccaggacctgccggaccccctggagacccggggctgatgggt gaaaggggagaagacggccccgctggaaatggcaccgagggcttccccggcttccccggg tatccgggcaacaggggcgctcccgggataaacggcacgaagggctaccccggcctcaag ggggacgagggagaagccggggaccccggagacgataacaacgacattgcaccccgagga gtcaaaggagcaaaggggtaccggggtcccgagggcccccagggacccccaggacaccaa ggaccgcctgggccggacgaatgcgagattttggacatcatcatgaaaatgtgctcttgc tgtgaatgcaagtgcggccccatcgacctcctgttcgtgctggacagctcagagagcatt ggcctgcagaacttcgagattgccaaggacttcgtcgtcaaggtcatcgaccggctgagc cgggacgagctggtcaagttcgagccagggcagtcgtacgcgggtgtggtgcagtacagc cacagccagatgcaggagcacgtgagcctgcgcagccccagcatccggaacgtgcaggag ctcaaggaagccatcaagagcctgcagtggatggcgggcggcaccttcacgggggaggcc ctgcagtacacgcgggaccagctgctgccgcccagcccgaacaaccgcatcgccctggtc atcactgacgggcgctcagacactcagagggacaccacaccgctcaacgtgctctgcagc cccggcatccaggtggtctccgtgggcatcaaagacgtgtttgacttcatcccaggctca gaccagctcaatgtcatttcttgccaaggcctggcaccatcccagggccggcccggcctc tcgctggtcaaggagaactatgcagagctgctggaggatgccttcctgaagaatgtcacc gcccagatctgcatagacaagaagtgtccagattacacctgccccatcacgttctcctcc ccggctgacatcaccatcctgctggacggctccgccagcgtgggcagccacaactttgac accaccaagcgcttcgccaagcgcctggccgagcgcttcctcacagcgggcaggacggac cccgcccacgacgtgcgggtggcggtggtgcagtacagcggcacgggccagcagcgccca gagcgggcgtcgctgcagttcctgcagaactacacggccctggccagtgccgtcgatgcc atggactttatcaacgacgccaccgacgtcaacgatgccctgggctatgtgacccgcttc taccgcgaggcctcgtccggcgctgccaagaagaggctgctgctcttctcagatggcaac tcgcagggcgccacgcccgctgccatcgagaaggccgtgcaggaagcccagcgggcaggc atcgagatcttcgtggtggtcgtgggccgccaggtgaatgagccccacatccgcgtcctg gtcaccggcaagacggccgagtacgacgtggcctacggcgagagccacctgttccgtgtc cccagctaccaggccctgctccgcggtgtcttccaccagacagtctccaggaaggtggcg ctgggctagcccaccctgcacgccggcaccaaaccctgtcctcccacccctccccactca tcactaaacagagtaaaatgtgatgcgaattttcccgaccaacctgattcgctagatttt ttttaaggaaaagcttggaaagccaggacacaacgctgctgcctgctttgtgcagggtcc tccggggctcagccctgagttggcatcacctgcgcagggccctctggggctcagccctga gctagtgtcacctgcacagggccctctgaggctcagccctgagctggcgtcacctgtgca gggccctctggggctcagccctgagctggcctcacctgggttccccaccccgggctctcc tgccctgccctcctgcccgccctccctcctgcctgcgcagctccttccctaggcacctct gtgctgcatcccaccagcctgagcaagacgccctctcggggcctgtgccgcactagcctc cctctcctctgtccccatagctggtttttcccaccaatcctcacctaacagttactttac aattaaactcaaagcaagctcttctcctcagcttggggcagccattggcctctgtctcgt tttgggaaaccaaggtcaggaggccgttgcagacataaatctcggcgactcggccccgtc tcctgagggtcctgctggtgaccggcctggaccttggccctacagccctggaggccgctg ctgaccagcactgaccccgacctcagagagtactcgcaggggcgctggctgcactcaaga ccctcgagattaacggtgctaaccccgtctgctcctccctcccgcagagactggggcctg gactggacatgagagccccttggtgccacagagggctgtgtcttactagaaacaacgcaa acctctccttcctcagaatagtgatgtgttcgacgttttatcaaaggccccctttctatg ttcatgttagttttgctccttctgtgtttttttctgaaccatatccatgttgctgacttt tccaaataaaggttttcactcctctaaaaaaaaaaaaaaaaaaaaa
![Page 5: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/5.jpg)
Where are we now in collagen VI myopathies?
Collagen VI disorders are increasingly recognized Likely among the most common muscular
dystrophies/myopathies Clinical spectrum expanding Progression/prognosis are not well defined No specific treatments
Treatments in development based on correction of abnormal mitochondrial function
Outcome measures for potential clinical studies are not well defined How do we measure success of a particular therapy?
![Page 6: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/6.jpg)
Where are we in genetics of Collagen VI
Dominant and recessive inheritance has been described for both BM and UCMD
Most mutations identified are specific to a single person/family
Variant vs. mutation is often unclear
Consistent genotype/phenotype correlations lacking
![Page 7: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/7.jpg)
Collagen VI at the University of Utah CLIA certified genetic testing has been available at
the Utah Genome Center since 2006 To date, testing has been completed almost 400
patients. Since patient samples are sent without clinical data we
do not know the clinical history of these patients
Natural history and genotype/phenotype project Re-contacting all patients who have had genetic testing
for collagen VI to collect detailed clinical data allowing correlation with the genotype data already obtained.
![Page 8: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/8.jpg)
United Dystrophinopathy Project Multi-centered natural history and
genotype/phenotype study Now >1000 participants from 7 participating
centers Children's Hospital of Philadelphia, Philadelphia, PA University of Minnesota, Minneapolis, MN Nationwide Children's Hospital, Columbus, OH University of Iowa, Iowa City, Iowa University of Utah, Salt Lake City, UT Washington University, St. Louis, MO University of California, Davis, Sacramento, California
Patients are seen on yearly basis Confirmation of genetic diagnosis
![Page 9: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/9.jpg)
390clinical
samples genotyped
163patients
with variant detected
141patients with no
mutation detected
47 negative
39positive
304Full
sequencing of
COL6A1,2,3
86Parent/sib
carrier testing
Of 163 with variant detected: 91 probably pathogenic, 72 unknown significance
![Page 10: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/10.jpg)
Genes
Muscle
Patient
COL6A
![Page 11: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/11.jpg)
Collagen VI myopathy study at Utah Catalog detailed clinical and genetic data in patients with
Collagen VI myopathies Clarify breadth of potential phenotypes Detail natural history (progression over time) Improve accuracy of genetic diagnosis and prognosis Define genotype/phenotype relationships
Stimulate development of potential therapies Provide a resource for investigators conducting clinical trials
Well defined cohorts Appropriate outcome measures
Improved understanding of molecular pathogenesis
Facilitate collaboration among investigators, families, and others Integration with CMDIR Establishment of collaborations leaders in the field
![Page 12: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/12.jpg)
Patient Recruitment Primary recruitment from Utah Genome Center
since Jan 2010 Over 400 patients with genetic testing since 2006
with 50 enrolled thus far
Goal is to re-contact patients for whom we have completed sequencing to collect clinical data Primary contact is through referring physician
Anticipated expansion of enrollment to include any patient with collagen VI myopathy diagnosis Summer 2010
![Page 13: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/13.jpg)
Enrollment/Participation All patients with collagen VI myopathy
phenotypes (ie. Bethlem myopathy or Ullrich CMD) are eligible to enroll A clinic visit is not required for participation Participants will fill out a short questionnaire
detailing symptoms and physical findings We will request records from treating physicians
including results of genetic testing (if done outside UGC) and other diagnostic tests
In some cases, we may request a sample from skin or muscle biopsy if they are already in existence
![Page 14: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/14.jpg)
A couple areas of interest in our lab
Mutation negative collagen VI patients 46% patients with no identifiable mutation
Some of these with decreased collagen VI on muscle or skin biopsy Potential explanations:
Deletion mutation not identifiable by sequencing from genomic DNA Mutation in non-coding regulatory region Allelic locus or secondary collagen VI defect Non-collagen VI disorder
Defining pathogenicity (or non-pathogenicity) “variants” 163/304 samples with sequencing of all 3 COL6A genes
identified variant 72 of these (44%) are of uncertain pathogenicity
High throughput genomics—transcriptome, exome sequencing
![Page 15: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/15.jpg)
Acknowledgements
Thank you to CureCMD for the opportunity to participate in this conference.
![Page 16: Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics](https://reader036.vdocuments.site/reader036/viewer/2022062515/56649cf95503460f949cb33c/html5/thumbnails/16.jpg)