classification of bacterial isolates of the jordanian oil ... · mrayyan, b. and atoum, m. (2009)...

418 Int. J. Environment and Pollution, Vol. 36, No. 4, 2009

Copyright © 2009 Inderscience Enterprises Ltd.

Classification of bacterial isolates of the Jordanian oil refinery petroleum sludge

Mohammed N. Battikhi*, Bassam Mrayyan and Manar Atoum Faculty of Allied Health Sciences, Department of Medical Laboratory Sciences, Hashemite University, P.O. Box 150459, Zarqa 13115, Jordan E-mail: [email protected] E-mail: mrayyan@ hu.edu.jo E-mail: [email protected] *Corresponding author

Abstract: The aim of this study is to characterise the bacterial isolates of Jordanian oil refinery sludge for the purpose of using microorganisms in treating industrial wastewater effluents that contains hydrocarbons. Morphological, physiological, biochemical, antimicrobial susceptibility tests and 16S-23S rRNA spacer region polymorphism were used to characterise the isolated thermotolerant Bacillus, with specific reference to Bacillus strains. Data were coded and analysed by numerical techniques using the Gower coefficients and by average linkage (UPGMA) analysis. The study resulted in allocation of strains into two areas at 50.0% similarity levels and ten major phenons at 78.0% similarity level. Amplification of 16S-32S rRNA genes divided all strains into two areas at 48.0% similarity level; however, at 78.0% similarity level five taxonomically distinct phenons were evident.

Keywords: petroleum sludge; thermotolerant Bacillus; numerical taxonomy; 16S-23S rRNA; biodegradation.

Reference to this paper should be made as follows: Battikhi, M.N., Mrayyan, B. and Atoum, M. (2009) ‘Classification of bacterial isolates of the Jordanian oil refinery petroleum sludge’, Int. J. Environment and Pollution, Vol. 36, No. 4, pp.418–435.

Biographical notes: Mohammed Nizar Battikhi has obtained a PhD in Microbiology from UK. He was worked for the Ministry of Health Central Laboratories for several years and worked as Director of A-l-Battikhi Medical Labaratories from 1985–2000. Has been Chairman of Department of Medical Laboratory Sciences and Clinical Dietetics at Hashemite University, Zarqa, Jordan. Since 2000, he has been Chairman of the has established environmental programmes in managing medical, industrial water quality control that resulted incompliance with regulation and community evolvement, in which drew wide recognition and media attention. He has worked as a Consultant with local government and many agencies in solving medical food and water problems, which resulted in many projects and international scientific research papers.

Classification of bacterial isolates 419

Bassam Mrayyan has obtained a PhD in Environmental Engineering. Recently the Director of the Centre for Environmental Studies at the Hashemite University in Jordan. He worked many years in the USA as an Environmental Manager, established environmental programmes in managing industrial pollution in the state of Arkansas. He worked in Jordan as a consultant with local government and many international agencies in solving pollution problems associated with wastewater, groundwater and air pollution.

Manar Atoum has been an Assistant Professor in the Hashemite University, Zarqa, Jordan since 1999. Her research interests include gene mutation and polymorphism using advanced techniques in molecular biology such as PCR, polyacrylamide and agarose electrophoresis and gene mutation decoding.

1 Introduction

Biological systems are invariably composed of a multitude of different compounds and, although there are components that are more or less ubiquitous, some components show a more restricted distribution. The organisms isolated from petroleum sludge are part of this biological system, which has been received considerable interest recently (Wu et al., 2001; Sekiguchi et al., 1998; Schade et al., 2002; Mishra et al., 2001). Bacillus species are one of these member genus organisms that are able to survive in sludge owing to their spores’ resistance to extreme factors, such as high temperatures (Hazem and Mannar, 2003; Llarch et al., 1997). Therefore, there is an increasing interest in the spore-forming Bacillus owing to their possible spoilage and contamination of food products and medical supplies, and their biotechnological importance as a source of thermostable enzymes and other products of industrial interest (Gerhartz, 1990; Bergquist and Morgan, 1992; Mora et al., 1998). In addition, there is interest in the use of these microorganisms for environmental restoration, which has focused primarily on microbial degradation of organic contaminants (Lovely and Coates, 1997). However, there are still several difficulties in the identification and characterisation of new Bacillus isolates (Hazem and Mannar, 2003). This is mainly owing to the great genotypic and phenotypic variability that characterises strains belonging to Bacillus species (Sekiguchi et al., 1998; Lui et al., 1997).

In this framework, Bacillus represents a thermotolerant Bacillus species, which is not closely related to members of any of the newly described genera that accommodate former Bacillus species. The intention here is to review the contribution of phenotypic characteristics and DNA fingerprinting technique for classification and identification of any isolated bacteria (Hazem and Mannar, 2003; Fani et al., 1993; Leelayuwat et al., 2000; Kong et al., 2001). The Polymerase Chain Reaction (PCR) method was used for DNA fingerprinting and generates distinctively amplified patterns for different species of Bacillus (Mora et al., 1998; Ronimus et al., 1997; Pattanayak et al., 2001).

The intention in this study was to evaluate the taxonomy of Bacillus strains isolated from Jordanian petroleum sludge by using morphological, biochemical and antimicrobial susceptibility tests. The findings could assist in solving the sludge problems at the Jordanian oil refinery.

420 M.N. Battikhi et al.

2 Materials and methods

2.1 Reference strains

Bacillus circulans (ATCC 4513), Bacillus sphaericus (ATCC 14577), Bacillus marinus (ATCC 29841), Bacillus laterosporus (NCIB 9367), Bacillus schlegelii (DSM200) and Bacillus stearotherermophilus (ATCC 12980) were obtained as kind gift from Dr. Kalil from Yarmouk University, Irbid, Jordan.

2.2 Sampling and bacterial isolation

Sludge samples were collected from different resources in Jordan. Sludge samples were transported without temperature control and analysed within 24 h. They were incubated at 43°C for 24 h, then streaked on Thermus agar (ATCC medium 697) plates and incubated at 43°C for 24 h. Bacterial growth showed layers at the surface of Thermus broth, which were purified using serial transfers. Then, isolates were preserved in Thermus media containing 15% glycerol at –70°C (Hazem and Mannar, 2003). Colonies grown at 43°C were picked and incubated at highest temperatures to examine their tolerance at different temperatures.

2.3 Phenotypic studies

Seventy-one bacteria were collected from petroleum sludge sources; all of them were able to grow at 53°C on nutrient agar. Fifteen out of 71 isolates were Gram-positive rods and endospore forming. These strains were initially assigned to the genus Bacillus, according to the description of Gorden et al. (1973). Gram staining was performed according to the method of Murray et al. (1994). Catalase and oxidase reaction were done as described by Smibert and Krieg (1994) and Tarrand and Groschel (1982). Endospores were examined under the phase-contrast microscope (Nikon). Macroscopic (growth in broth; colonies shape, size and colour) was conducted according to Lillie modification (1928) and Schaeffer and Fulton (1933). The morphological and biochemical characters were used to identify these isolate. Isolated bacteria were clustered into groups using average linkage dendrogram based on similarities percentage and RNA 16S-23S spacer region polymorphism analysis. Pure growth was identified according to Cowan (1974). Hemolytic activity was determined according to Hazem and Manar (2003). For biochemical tests, API system was used according to the method of Logan and Berkeley (1984). Growth in 7.0% NaCl, casein and starch hydrolysis, catalase and oxidase tests was conducted according to Akbalik et al. (2004) and Horikoshi (1999). Ability of isolates to grow in various media (MacConkey agar, thioglycholate agar, eosin methyl red agar, tryptone glucose agar and xylose lysine desoxycholate agar) was tested. All aerobic cultures were identified based on standard method by Cowan (1974).

Effects of different temperatures (28°C, 37°C, 63°C, 73°C) and pH-values (5,9,11) on growth of isolates were conducted on peptone yeast extract agar.

Antimicrobial susceptibility test was performed using agar diffusion disc methods advocated by the National Committee for Clinical Laboratory Standards (2000). Bacterial isolates were evaluated for susceptibility to the following antibiotics:


Azlocillin (75 mcg), Amoxicillin (25 ug), Aztreonam (30 mcg), Cefadroxil (30 mcg), Bacitracin (10 U), Carbinicillin (10 ug), Cefactor (30 mcg), Ceprofloxacin (5 mcg), Cefoxitin (30 ug), Imipenem (10 ug), Cephalothin (30 ug), Cefamanadole (10 mcg), Norfloxacin (10 mcg), Piperacillin (10 ug), Streptomycin (10 ug), Risemycin (13 mcg), Tobramycin (10 mcg), Oxacillin (1 mcg).

2.4 Amplification of rRNA genes ITS region between 16S and 23S

The method of Ausubel et al. (1994) was used for genomic DNA isolation. Sixteen strains including six reference strains were characterised according to their 16S-23S rRNA spacer region. Analysis was performed in 50 µl solution containing: 1 µl bacterial genomic DNA (extracted by Wizard DNA purification kit from Promega), 5 µl MgCl2, 5 µl 10X PCR reaction buffer, 1 µl of Nucleotide mix, 10 µl of each primer (forward primer 5′ GTCGTAACAAGGTAGCCGTA 3′, and reverse primer 5′CAAGGCATCCACCGT 3′). The PCR amplification profile was five cycles consisting of 94°C for 1 min, 55°C for 1 min and 72°C for 2 min and 30 cycles consisting of 92°C for 45 s, 60°C for 60 s, 72°C for 2 min and final cycle was 72°C for 7 min.

After amplification DNA was detected on 6% single strand conformation polymorphism (SSCP BioRad). SSCP gel consist of 6 ml bis polyacrylamide, 10 X TBE buffer (4 ml), 5% glycerol (2 ml), TEMED (40 µl), 10% ammonium persulfate (400 µl) and distilled water up to 40 ml. Then 3.5 µl of DNA amplicon was mixed with the same volume of SSCP loading dye (BioRad) and completed to 14 µl with 7 µl of nuclease free water then the DNA mixture was heated for l min at 95°C to denature the DNA and it was placed immediately on ice. The mixture then loaded into SSCP wells and ran in 0.5 X TBE buffer at 100 volts for 1.5 h at 3–10°C. The gel stained with ethidium bromide in 0.5 X TBE buffer for 10 min and visualised and photographed under UV lamb (Vilber lourmat, France).

2.5 Numerical analysis

Gower coefficients, and clusters of strains were obtained by the un-weighted pair group method with arithmetic un-weighted average linkage (UPGMA) method was used for clustering analysis (Sneath and Sokal, 1973).

3 Results

3.1 Reproducibility

The similarity between duplicate strains varied from 91.6% to 98.2%, with an average of about 95.1%. Repeating 12 tests for all strains and comparing the two sets of data studied test reproducibility. The reproducibility obtained varied from 100.0% to 69.0% (Dodd and Jones, 1982) have suggested that tests showing errors in reproducibility of 10–15% are acceptable. Eight tests fell outside the 90.0% reproducibility level and four of these outside a level of 85.0% reproducibility.

The best reproducibilities were for antibiotic sensitivities (96.0–100.0% reproducible), and many of the biochemical tests such as catalase, gelatin, indol production, fell within this range of reproducibility also. Production of acid from


carbohydrates showed good reproducibility although the range was (99.3–88.2%). Poor reproducibility was due for the late production of acid. Results for utilisation of carbon sources were reproducible within the range of 87.0–96.0%.

3.2 Numerical analysis

Morphological characteristics of the isolates and reference strains used in this study are shown in Table 1. Fifteen isolates with six reference strains showed a wide variation in colony morphology from flat, rough, eroded, irregular, raised, smooth, circular and entire. Colour of colonies ranged from white, transparent to light yellow. In addition, spreading ability on surfaces varied from small spreading areas to growth covered the entire surface of the plate. The gram-stain showed also variation in the cell morphology from short to long, thick or thin rods. Broth growth of isolates showed one of the following: layer at surface only, sediment at bottom only or turbidity. All isolates except isolates SHUTB13 and SHUTB15 formed endospore. Morphology of sporulating cells, the shape of the colonies and growth abilities have proved to be insufficient for unequivocal identification of Bacillus strains (Logan and Berkeley, 1984; Blanc et al., 1997). Characters based on colonial morphology showed the poorest reproducibility, although a few gave high scores of 99% (spore position, type of hemolytic). Most of them were below 87% reproducibility and two (cell morphology, colony morphology) were less than 71% reproducible (Sneath and Sokal, 1973). In colony morphology, characters were subjective and only where the categories were well defined good reproducibility was obtained (Dodd and Jones, 1982). Phenotypic characteristics of the different strains and reference strains expressed as positive or negative result are shown in Tables 2 and 3. All isolates and reference strains were thermophilic spore formers; Gram positive and can utilise glucose. Other results were negative to arabinose, sucrose, xylose, amygdalin utilisation except strain SHUTB8 was positive to amygdalin utilisation, citrate negative except strain B. sphaericus, lactose negative except strains SHUTB8 and SHUTB10 (Table 3), grew optimally at 43°C except stain SHUTB13 and SHUTB15. All isolated Bacillus strains showed a layer at surface only when grown on nutrient broth. Antimicrobial susceptibility pattern for the isolates and reference strains are presented in Table 4. All isolates and reference strains were sensitive to norfloxacin; imipenem and ciprofloxacin except strain SHUTB7 while all strains were resistant to oxacillin.

The characteristics of the phenons and subphenons expressed as percentage of positive reactions for physiological, biochemical and antimicrobial susceptibility are shown in Table 5. Dendogram based on results of the numerical study based on phenotypic characteristics of the selected isolates and reference strains is shown in Figure 1. Two distinct areas were observed at overall similarity level of 50.0% (Table 5). Area 1 divided into four phenons A, B, C and D at 78.0% similarity level. Phenons A, B and C contains isolate number SHUTB2, SHUTB6 and SHUTB1 respectively, while Phenon D contains two isolates number SHUTB5 and SHUTB3 at intra-similarity level of 90.0%. Area II divided into two sub-areas at similarity level of 58.5%. Sub-area IIA contains phenons E, F, G and H. Phenon E contains one strain SHUTB8 at overall similarity level of 78.0%. Phenon F contains two reference strains B. circulans and B. sphaericus at 94.0% intra-similarity level. Phenon G contains three strains cluster at 80.0% overall similarity level and divided into two subphenon G1 and G11 contains strain SHUTB4 and two reference strains B. schlegelii and B. stearothermophilus at 88.0% intra-similarity level, respectively. Phenon H contains two reference strains


B. marinus and B. laterosporus at overall similarity level of 66.0% and intra-similarity level of 90.0%. Sub-area IIB contains phenons I, J and K at overall similarity level of 66.0%. Phenon I and J contains strains SHUTB7 and SHUTB11 with overall similarity level of 66.0% and 74.0% respectively, while phenon K, contains six strains with overall similarity level of 84.0% and divided into two subphenons. Subphenon KI contains two strains SHUTB15 and SHUTB10 at 88.0% intra-similarity level. Subphenon KII contains four strains at 92.0% intra-similarity level. Strains SHUTB13 and SHUTB12 at intra-similarity level of 94.0% while strains SHUTB14 and SHUTB9 showed 98.0% of intra similarity (Table 5).

Table 1 Morphological characteristics for isolated Bacillus strains and reference strains

Spore position

Spore morphology

Cell morphology

Colony morphology

Broth growth Hemolytic

B. stearothermophilus C.S&T Oval Short thick WFRER SAB Gamma B. laterosporus Terminal Oval Short thick WFRER SAB1 Beta B. sphaericus Terminal Round Long thick WFREI LAS Beta B. marinus Terminal Oval Short thick WFRER SAB1 Beta B. circulans C.S&T Round Short thick WFREI LAS Beta B. schlegelii C.S&T Oval Short thick WFRER SAB Gamma SHUTB1 Terminal Oval Short thick WFRER LAS Beta SHUTB2 Terminal Oval Short thick WFRER TURBID Beta SHUTB3 Terminal Round Short thick WFRER LAS Beta SHUTB4 Terminal Oval Short thick WFRER SAB Beta SHUTB5 Terminal Oval Short thick WFRER LAS Beta SHUTB6 Terminal Oval Long thick WFREI TURBID Beta SHUTB7 Terminal Oval Short thick WFREI SAB Gamma SHUTB8 Terminal Oval Short thick WFREI LAS Gamma SHUTB9 Terminal Oval Short thick WFREI LAS Beta SHUTB10 Terminal Oval Short rod WRSCE TURBID Gamma Bacillus spp. 72 1 1 3 4 4 2 Bacillus spp. 82 1 1 3 1 3 1 SHUTB11 Terminal Oval Short rod WRSCE LAS Beta 1 1 1 1 2 2 SHUTB12 Terminal Oval Short thick WRSCE TURBID Gamma SHUTB13 – – Short rod PCE LAS Gamma SHUTB14 Terminal Oval Short thick WRSCE TURBID Beta SHUTB15 – – Short rod CCE SAB Beta

T: Terminal; C: Central; S: Subterminal; WFRER: White, Flat, Rough, Arose and Raised colonies; WRSCE: White, Raised, Smooth, Circular and Entire colonies; WFREI: White, Flat, Rough, Arose and Irregular colonies; LYRSCE: Light Yellow, Raised, Smooth, Circular and Entire colonies, WRRCE: White, Raised, Rough, Circular and Entire colonies: LAS: Layer At Surface only; SAB: Sediment At Bottom only.


Table 2 Morphological and biochemical characteristics for isolated Bacillus strains and reference strains


Table 3 Biochemical characteristics for isolated Bacillus strains and reference strains


Table 4 Antibacterial susceptibility test for isolated Bacillus strains and reference strains


Table 5 Characteristics of phenons and subphenons expressed as percentage of positive reaction for isolated Bacillus strains and reference strains

Phenon A B C D E F G H I J K

Subphenon G1 GII K1 KII

No. of strains 1 1 1 2 1 2 1 2 2 1 1 2 4

Spore position 100 100 100 100 100 50 100 0 50 100 100 100 100

Spore morphology 100 100 100 100 100 100 100 100 50 100 100 50 100

Cell morphology 100 100 100 100 100 50 100 100 100 100 100 0 100

Colony morphology 100 100 100 100 100 50 100 100 50 100 100 0 0

Broth growth 0 100 100 100 100 100 0 0 50 100 100 50 50

Hemolytic 100 100 100 100 100 100 100 0 100 100 100 0 25

28°C 0 0 0 0 100 100 0 0 100 0 100 100 100

37°C 0 0 0 0 100 100 0 0 100 0 100 100 100

63°C 100 100 100 100 100 0 100 50 0 100 0 0 50

73°C 0 0 0 0 100 0 100 50 0 0 0 0 0

pH5 0 0 0 0 100 50 0 100 0 0 0 0 0

pH9 100 100 100 100 0 50 100 100 0 100 0 50 50

pH11 100 100 100 100 100 50 100 100 0 100 100 100 100

Casein 0 0 0 0 100 100 0 0 50 0 100 100 100

Starch 100 100 100 100 0 100 100 50 0 100 0 0 0

Gelatin 100 0 0 0 0 100 100 50 100 0 0 0 0

Anaerobic 100 0 100 50 0 100 100 100 0 100 0 0 0

7% NaCl 100 100 100 100 100 0 100 0 0 100 100 100 100

VP 0 100 100 100 0 0 0 0 0 100 0 100 100

IND 0 0 0 0 0 0 0 50 0 0 0 0 0

Oxidase 100 100 100 100 0 100 100 100 0 100 100 100 100

Urease 0 0 0 0 0 0 0 0 0 0 100 50 50

Catalase 100 100 100 100 100 100 100 100 50 100 100 100 75

TDA 100 100 100 50 100 100 0 0 0 100 100 100 100

ODC 0 0 0 0 100 100 0 0 0 0 0 100 50

LDC 0 0 100 50 0 0 100 0 0 0 0 50 0

ONPG 100 100 100 50 100 100 100 100 0 100 100 100 100

Citrate 0 0 0 0 0 50 0 0 0 0 0 0 0


Table 5 Characteristics of phenons and subphenons expressed as percentage of positive reaction for isolated Bacillus strains and reference strains (continued)

Phenon A B C D E F G H I J K

Subphenon G1 GII K1 KII

No. of strains 1 1 1 2 1 2 1 2 2 1 1 2 4

Glucose 100 100 100 100 100 100 100 100 100 100 100 100 100

Mannitole 0 0 0 50 100 0 0 0 100 0 100 100 100

Sucrose 0 0 0 0 0 0 0 0 0 0 0 0 0

Amygdalin 0 0 0 0 100 0 0 0 0 0 0 0 0

Inositol 0 0 0 0 100 0 0 0 100 0 0 50 100

Sorbitol 0 0 0 0 100 0 0 0 0 0 0 100 100

Melebiose 0 0 0 0 100 0 0 0 0 0 100 100 100

Lactose 0 0 0 0 100 0 0 0 0 0 0 50 0

Arabinose 0 0 0 0 0 0 0 0 0 0 0 0 0

Xylose 0 0 0 0 0 0 0 0 0 0 0 0 0

Arabinose 0 0 100 100 0 100 100 100 100 0 0 0 0

Amoxacillin 100 100 0 0 0 0 0 0 0 100 0 50 25

Aztreonam 100 0 100 100 0 100 100 100 100 100 0 0 25

Cafadroxil 0 100 0 0 100 0 0 0 0 100 100 50 50

Bacitracin 0 100 100 0 0 0 0 100 50 100 0 0 0

Carbenicillin 100 100 0 0 100 0 0 0 50 100 100 100 100

Cefactor 0 100 0 0 0 0 100 0 0 0 0 0 25

Ciprofloxacin 0 0 0 0 0 0 0 0 0 100 0 0 0

Cefoxitin 0 100 0 0 0 0 0 0 0 0 0 0 0

Imipenem 0 0 0 0 0 0 0 0 100 0 0 0

Cephalothin 0 100 0 0 0 0 100 0 0 0 0 0 0

Cefamanadole 0 100 0 0 0 0 100 0 0 0 0 0 0

Norfloxacin 0 0 0 0 0 0 0 0 0 0 0 0 0

Piperecillin 0 0 0 0 0 50 100 0 0 0 0 0 0

Streptomycin 100 0 0 0 0 0 0 0 0 0 0 0 0

Risemycin 0 100 0 0 0 0 0 0 0 100 0 50 0

Tobramycin 0 0 100 0 0 0 0 0 0 0 0 50 0

Oxacilllin 100 100 100 100 100 100 100 100 100 100 100 100 100


Figure 1 Dendrogram for isolated Bacillus strains and reference strains using complete linkage based on morphological, phenotypic characteristics and antimicrobial susceptibility test

Results of 16S-23S rRNA spacer region polymorphism analysis all strains are shown in Figure 2. Results of the numerical study according to 16S-23S rRNA spacer region polymorphism analysis using Gower coefficient revealed dendrogram is shown in Figure 3. Two distinct areas were observed at overall similarity level of 50.0% (Table 7).

Figure 2 Genetic polymorphism for amplified rRNA genes ITS region between 16S and 23S for isolated Bacillus strains and reference strains

Lane 1: DNA Ladder; Lane 2: SHUTB6; Lane 3: SHUTB3; Lane 4: B. schlegelii; Lane 5: SHUTB1; Lane 6: SHUTB5; Lane 7: B. circulans; Lane 8: B. stearotherermophilus; Lane 9: B. stearotherermophilus; Lane 10: SHUTB4; Lane 11: SHUTB2; Lane 12: B. laterosporuse 13: B. sphericus, lane 14: B. marinus, Lane 15: SHUTB14, Lane 16: SHUTB9, Lane 17: SHUTB13, Lane 18: SHUTB15.


Figure 3 Dendrogram using complete linkage based on genetic study for isolated Bacillus strains and reference strains

Area I contains phenons A, B and C at overall similarity level of 68.0% which include strains number HUTB2, B. schlegelii, SHUTB4, B. stearothermophilus and B. laterosporus, respectively.

Area II contains four phenons at overall similarity level of 86.0%. Phenon D includes strain SHUTB3 at overall similarity level of 78.0%. Phenon E contains two reference strains B. circulans and B. sphericus with overall similarity level of 82.0% and intra-similarity level of 95.0%. Phenon F subdivided contains two strains SHUTB11 and B. marinus at 85.0% over all similarity level and 92.0% intra-similarity level. Phenon G divided into three subphenon. Subphenon G1 contains one strain SHUTB15 at over all similarity level of 89.0%. Subphenon (G2) contains one strain SHUTB7 at over all similarity level of 91.0%. Subphenon (G3) contains four strains SHUTB9, SHUTB14, SHUTB12 and SHUTB13 at intra-similarity level of 97.0% (Table 6).


Table 6 Areas, phenons and subphenons based on phenotypic dendrogram for isolated Bacillus strains and reference strains

Similarity (%)

50.0 58.0 76.0

Area Sub Area Phenon Subphenon Strain

A SHUTB2

B SHUTB6

C SHUTB1

I

D SHUTB5 SHUTB3

E SHUTB8

F B. circulans B. sphericus

GI SHUTB4

II A

G

GII B. schlegelii B. stearothermophilus

H B. marinus B. laterosporus

I SHUTB7

J SHUTB11

KI SHUTB15 SHUTB10

SHUTB13 SHUTB12

II

II B

K

KII

SHUTB14 SHUTB 9

Table 7 Areas, phenons and subphenons for isolated Bacillus strains and reference strains based on to genotypic dendrogram

50.0 88.0 92.0

Area Phenon Subphenon Strain

A SHUTB2

B B. schlegelii SHUTB4

I

C B. stearothermophilus B. laterosporus

D SHUTB3

E B. circulans B. sphericus

F SHUTB11 B. marinus.

G1 SHUTB15

G2 SHUTB7

SHUTB9 SHUTB14

II

G

G3

SHUTB12 SHUTB13


4 Discussion

Bacillus endospore forming bacteria encompasses a heterogenic collection of bacteria, and in our opinion reliable, rapid methods should be used for classification and identification of Bacillus isolates. Morphological, physiological and genetic characterisations were used for microbial identification of all strains.

Numerical phenotypic taxonomic studies have led to the classification of these strains into clusters or phonon (Figure 1). These clusters differ depending on the method of clustering (average linkage) (Sneath and Sokal, 1973; Dodd and Jones, 1982). Clusters contain different numbers of strains depending on how similar strains appear to each other and to other clusters. For the production of stable and reliable taxonomy, the clustering obtained by numerical taxonomic procedures compared with data derived from other sources (16S-23S rRNA spacer region polymorphism analysis) (Shangkuan et al., 2001; Smibert and Krieg, 1994; Ausubel et al., 1994). In order to facilitate this study, a selection of strains made since the inclusion of all strain would make the study prohibited, particularly from the point of view of cost. The choice of strains was, of great importance since a random selection of strains might lead to data, which was of little significant value for testing the validity of the numerical taxonomic clustering (Sneath and Sokal, 1973; Dodd and Jones, 1982). In this study, representative strains of the major clusters were used for 16S-23S rRNA spacer region polymorphism analysis owing to the fact that there is no, or very little, published data on the phenotypic and genotypic taxonomy of the strains used in this study. The taxonomic relationships between thermophilic isolates used in this study based on un-weighted average dendrogram derived from traditionally acquired data were examined on relation to 16S-23S rRNA spacer region polymorphism analysis of DNA contents. The differential characteristics of the 11 phenons are summarised in Table 5, which also includes suggested reference strains for each phenon. This is to our knowledge the first systematic study of the taxonomy of Bacillus isolates from petroleum sludge in Jordan. The variety of taxonomic groups that we have found is much larger than the literature would suggest, and it seems that different groups of bacteria are capable of growing in petroleum sludge suggesting that these isolates may have the ability to degrade petroleum sludge. Such suggestion will extrapolate the ideas of using such organism in cleaning toxic dumps and transferring hazardous material to non-hazardous (Sekiguchi et al., 1998; Mishra et al., 2001). Many of the microorganisms included in this study cannot be classified in any previously defined taxonomic schemes, a situation that commonly occurs when dealing with bacteria from diverse and poorly studied habitats (Hauxhurs et al., 1980). The organisms that cluster in Area I could not be identified as compared to our reference strains suggesting that further study including more reference strains is required for identification. However, all isolates appeared in sub-area IIA suggesting close correlation with reference strains. Isolates clustered in sub-area IIB showed dissimilarity with our reference strains suggesting further work should be done on these strains.

Genetic dendrogram classified the studied strains into two areas at about 74.5% homology. Phenotypic dendrogram showed similar groups classification but at 75.0% homology. So 16S-32S rRNA could be a useful rapid method for clustering Bacillus isolates (Mora et al., 1998; Smibert and Krieg, 1994). 16S-23S rRNA and fingerprinting is a valuable method in classifying phylogenetically related strains (Blanc et al., 1997). Strain SHUTB9, SHUTB14, SHUTB12 and SHUTB13 showed similar 16SrRNA profile


despite some difference in the phenotypic characteristics which agrees with other study where phenotypic variable strains may have the same genetic content (Sunna et al., 1997). This phenotypic variability may be related to different sources of isolation (Mora et al., 1998). SHUTB2 was the most variable strain both genetically and phenotypically which indicates the assessment of genotypic study in classifying organisms (Hazem and Mannar, 2003; Rainey et al., 1994), also it gives more evidence that this strain might be new variable Bacillus isolates. Homology of the two strains SHUTB4 and B. shlegelii in both phenotypic and genotypic analysis gives more evidence for using genetic analysis for taxonomic purpose (Ronimus et al., 1997). Clustering of the two reference strains B. sphericus and B. circulans in the same phenon is even further support for using genetic analysis in taxonomic classification which agrees with other study (Mishra et al., 2001; Hazem and Mannar, 2003; Rainey et al., 1994). However, the two reference strains B. marinus and B. laterosporus did not show the consistency in clustering according to phenotypic and genetic studies which may require further analysis such as ARDRA, ARDRA-ITS, RSA and RAPD and DNA-DNA homology in addition to DNA-DNA re-association experiments. These results also supported by the 93.0% homology of the two reference strains B. lateropsporus and B. stearothermophilus in genetic study while phenotypic analysis showed 83.0% homology.

5 Conclusion

The validity of genetic study proved to be a valid procedure in assisting phenotypic taxonomy, indicating the chance of isolating new thermophilic Bacillus spp. that could assist in solving industrial sludge pollution problems and help decision makers and other researchers to conduct further studies that will lead to the establishment of environmental programs achieving sustainability.

References Akbalik, G., Gunes, H., Eyasa, I.Y., Harsa, S., Elmaci, S. and Yenidunya, F. (2004) ‘Identification

of extracellular enzymes producing alkalophilic bacilli from Izmair province by 16S-ITS rDNA RELP’, J. Applied Microbiology, Vol. 97, No. 4, pp.766–773.

Ausubel, F.M., Bert, R., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. and Gonzalez, M.F. (1994) Current Protocols in Molecular Biology, Vol. 3, Chapter 2, John Wiely & Sons, Inc., New York.

Bergquist, P.I. and Morgan, H.W. (1992) ‘The molecular genetics and biochemical application of enzyme from extremely thermophilic eu-bacteria’, in Herbert, R.A., Mair, N.S., Sharpe, M.E. and Holt, J.G. (Eds.): Molecular Biology and Biotechnology of Extremophiles, The Williams & Wilkins Co., Baltimore, Vol. 2, pp.1105–1127.

Blanc, M., Marilley, L., Beffa, T. and Aragno, M. (1997) ‘Rapid identification of heterotrophic, thermophilic, spore-forming bacteria isolated from hot composts’, International Journal of Systematic Bacteriology, Vol. 47, pp.1246–1248.

Cowan, S.T. (1974) Cowan and Steel’s Manual for the Identification of Medical Bacteria, 2nd ed., Manual for identification of Medical Bacteria, Cambridge University Press, Cambridge, London.

Dodd, C.E.R. and Jones, D. (1982) ‘A numerical taxonomic study of the genus Shigella’, Journal of General Microbiology, Vol. 128, pp.1933–1957.


Fani, R., Damiani, G., Di Serio, C., Gallori, E., Grifoni, A. and Bazzicalupo, M. (1993) ‘Use of Random Amplified Polymorphic DNA (RAPD) for generating specific DNA probes for microorganisms’, Molecular Ecology, Vol. 2, No. 4, pp.243–250.

Gerhartz, W. (Ed.) (1990) Enzymes in Industry, VCH Publishers, Weinheim (FRG), New York, p.129.

Gorden, R.E., Haynes, W.C. and Panco, C.H-N. (1973) The Genus Bacillus, Agricultural handbook no.427. Agricultural Research Service, US Department of Agricultural, Washington DC.

Hauxhurs, J.D., Krichevsky, M.I. and Atlas, R.M. (1980) ‘Numerical taxonomy of bacteria from the gulf of Alaska’, Journal of General Microbiology, Vol. 120, pp.131–148.

Hazem, A. and Mannar, A. (2003) ‘Genetic polymorphysim by Rapid-PCR and phenotypic characteristics of isolated thermotolerant Bacillus strain from Hot spring sources’, Microbiologica, Vol. 26, pp.249–256.

Horikoshi, K. (1999) ‘Extracellular enzymes: isolation procedures for alkaline enzymes’, Alkaliphiles, Kodansha, Eokyo, p.147.

Kong, L., Tzeng, D. and Yang, C. (2001) ‘Generation of PCR-based DNA fragments for specific detection of Streptomyces saracenticus N45’, Proceedings of the National Science Council, Republic of China Part B, Life Science, Vol. 25, pp.119–127.

Leelayuwat, C., Romphruk, A., Lulitanond, A., Trakulsomboon, S. and Thamlikitkul, V. (2000) ‘Genotype analysis of Burkholderia pseudomallei using randomly amplified polymorphic DNA (RAPD): indicative of genetic differences amongst environmental and clinical isolates’, ACTA Tropica, Vol. 77, pp.229–237.

Lillie, R.D. (1928) ‘The gram stain.1. A quick method for staining gram-positive organisms in the tissues’, Archives of Pathology, Vol. 5, p.828.

Llarch, A., Logan, N.A., Castellvi, J., Prieto, M.J. and Guinea, J. (1997) ‘Isolation and characterization of thermophilic spp. from geothermal environment on deception Island, South Shetland Archpelago’, Microbial Ecology, Vol. 34, No. 1, pp.58–65.

Logan, N.A. and Berkeley, R.C.W. (1984) ‘Identification of Bacillus strains using the API system’, Journal of General Microbiology, Vol. 130, pp.1871–1882.

Lovely, D.R. and Coates, J.D. (1997) ‘Bioremediation of metal contamination’, Current Opinion in Microbiology, Vol. 6, pp.285–289.

Lui, W.T., Marsh, T.L., Cheng, H. and Forney, L.J. (1997) ‘Characterization of microbial diversity by determining terminal restriction fragment length polymorphism of 16S ribosomal DNA’, Applied and Environmental Microbiology, Vol. 63, pp.4516–4522.

Mishra, S., Jyot, J., Kuhad, R.C. and Lal, B. (2001) ‘Evaluation of inoculum addition to stimulate in situ bioremediation of oily-sludge contaminated soil’, Applied and Environmental Microbiology, Vol. 67, No. 4, pp.167–1681.

Mora, D., Fortina, M.G., Nicastro, G., Parini, C. and Manachini, P.L. (1998) ‘Genotypic characterization of thermophilic bacilli: a study on new soil isolates and several references strains’, Research in Microbiology, Vol. 149, pp.711–722.

Murray, R.G.E., Doetsch, R.N. and Robinow, C.F. (1994) ‘Determinative and cytological light microscopy’, in Gerhardt, P., Murray, R.G.E., Wood, W.A. and Krieg, N.R. (Eds.): Methods for General and Molecular Bacteriology, American Society for Microbiology, Washington, pp.278–292.

National Committee for Clinical Laboratory Standards (2000) ‘Performance standards for antimicrobial susceptibility testing, eleventh informational supplement’, NCCLS Document M100-S11, Wayne Pennsylvania.

Pattanayak, D., Chakrabarti, S.K., Kumar, P.A. and Nair, P.S. (2001) ‘Characterization of genetic diversity of some serovars of Bacillus thuringiensis by RAPD’, Indian Journal of Experimental Biology, Vol. 39, No. 9, pp.897–901.

Rainey, F.A., Fritze, D. and Stackebrandt, E. (1994) ‘The phylogenitic diversity of the thermophilic members of the genus Bacillus as revealed by 16S rDNA analysis’, FEMS Microbiological Letters, Vol. 115, pp.205–212.


Ronimus, R.S., Parker, L.E. and Morgan, H.W. (1997) ‘The utilization of RAPD-PCR for identifying thermophilic and mesophilic bacuillus species’, FEMS Microbiological Letters, Vol. 147, pp.75–79.

Schade, M., Beimfohr, C. and Lemmer, H. (2002) ‘Phylogenetic and physiological characterization of a ‘Nostocoida limicola’-like organism isolated from activated sludge’, Water Science Technology, Vol. 46, Nos. 1–2, pp.91–97.

Schaeffer, A.B. and Fulton, M. (1933) ‘A simplified method of staining endospores’, Science, Vol. 77, p.194.

Sekiguchi, Y., Kamagata, Y., Syutsubo, K., Ohashi, A., Harada, H. and Nakamura, K. (1998) ‘Phylogenetic diversity of mesophilic and thermophilic granular sludges determined by 16S rRNA gene analysis’, Microbiology, Vol. 144, pp.2655–2665.

Shangkuan, Y.H., Chang, J.F., Lin, H.C. and Shaio, M.F. (2001) ‘Molecular characterization of Bacillus anthracis using multiplex PCR, ERIC-PCR and RAPD’, Letters in Applied Microbiology, Vol. 32, No. 3, pp.139–145.

Smibert, R.M. and Krieg, N.R. (1994) ‘Phenotypic characterization’, in Gerhardt, P., Murray, R.G.E., Wood, W.A. and Krieg, N.R. (Eds.): Methods for General and Molecular Bacteriology, American Society for Microbiology, Washington, p.614.

Sneath, P.H.A. and Sokal, R.R. (1973) ‘Numerical taxonomy’, The Principles and Practice of Numerical Classification, W.H. Freeman, San Francisco.

Sunna, A., Tokajian, S., Burghardt, J., Rainey, F., Antranikian, G. and Hashwa, F. (1997) ‘Identification of Bacillus kaustophilus strain HSR, Bacillus thermocatenulatus and Bacillus thermoleovorans’, Systemic Applied Microbiology, Vol. 20, pp.232–237.

Tarrand, J.J. and Groschel, D.H.M. (1982) ‘Rapid, modified oxidase test for oxidase variable bacterial isolates’, Journal of Clinical Microbiology, Vol. 16, pp.772–774.

Wu, J.H., Liu, W.T., Tseng, I.C. and Cheng, S.S. (2001) ‘Characterization of microbial consortia in a terephthalate-degrading anaerobic granular sludge systemic’, Microbiology, Vol. 147, pp.373–382.

classification of bacterial isolates of the jordanian oil ... · mrayyan, b. and atoum, m. (2009)...

Documents