choral journal • june/july 2010 - acda 한국 연락 ... · pdf file2 h. royce saltzman...

2 Choral Journal • June/July 2010

New Solutions for Lili Boulanger’sPsaume 130, Du fond de l’abîme

Part 2

35 Repertoire & Standards edited by Nancy Cox

Mixing it Up: Voicing and Seating a Women’s Choir

by Sandra Peter

The Choral Director as Voice Teacher: Suggestions for Selecting Solo Repertoire for Singers

by C. Andrew Blosser

41 The ACDA International Archives for Choral Music The Walter Stowe Collins II Collection

51 Choral Music in the Junior High/Middle School edited by Lynne Gackle

Choral Evaluation Survival Techniques - C'est la vie

by Bradley Olesen

59 Book Reviews edited by Stephen Town

65 An Index to Volume Fifty by Scott W. Dorsey

Contents June/July 2010Vol. 50 • no 11

Inside 8 A Beginner’s Guide to Prophecy: Orlande de Lassus’s Prophetiae Sibyllarum

by Jonathan Harvey

18 New Solutions for Lili Boulanger’s Psaume 130 Du fond de l’abîme, Part 2

by John Perkins

28 Encore! Advocating for the Arts in Education

by Terre Johnson

Articles

ColumnsThe Choral Journal is the offi cial publication of The American Choral Directors Associa-tion (ACDA). ACDA is a nonprofi t profes-sional organization of choral directors from schools, colleges, and universities; community, church, and professional choral ensembles; and industry and institutional organizations. Choral Journal circulation: 19,000.

Annual dues (includes subscription to the Choral Journal): Active $85, Industry $135, Institutional $110, Retired $45, and Student $35. One-year membership begins on date of dues acceptance. Library annual subscrip-tion rates: U.S. $45; Canada $50; Foreign Surface $53; Foreign Air $85. Single Copy $3; Back Issues $4.

Permission is granted to all ACDA members to reproduce articles from the Choral Journal for noncommercial, educational purposes only. Nonmembers wishing to reproduce articles may request permission by writing to ACDA. 545 Couch Drive, Oklahoma City, Oklahoma 73102. Telephone: 405/232-8161. All rights reserved.

The Choral Journal (US ISSN 0009-5028) is issued monthly except for July. Printed in the United States of America. Periodicals postage paid at Oklahoma City, Oklahoma, and additional mailing offi ce. POSTMASTER: Send address changes to Choral Journal, 545 Couch Drive, Oklahoma City, Oklahoma 73102..

2 From the Executive Director

4 From the President

5 From the Editor

34 Children's Honor Choir Conductor

40 Men's Honor Choir Conductor

49 JH/MS Honor Choir Conductor

64 Women's Honor Choir Conductor

72 Advertisers’ Index

Cover art by Efrain Guerrero, graphic artist, Austin, Texas.Interior art by Tammy Brummell. Musical examples by Tunesmith Music <www.Tunesmithmusic.com>.

A Place for Everyone in the Choirby Ron Sayer

edited by Marvin E. Latimerand Christina Prucha

282888 1818

d

Encore! Advocating for the Arts in Education

A Beginner’s Guide to Prophecy

Orlande de Lassus’sProphetiae Sibyllarum


National Offi cers

PresidentJerry McCoy

University of North Texas940/369-8389 (voice) [email protected]

Vice-presidentHilary Apfelstadt

The Ohio State University614/292-9926 (voice) [email protected]

President-electJo-Michael Scheibe

University of Southern California [email protected]

TreasurerJo Ann Miller

North Dakota State University [email protected]

Executive DirectorTim Sharp

405/232-8161 (voice); 405/232-8162 (fax) [email protected]

Central Division PresidentMary Hopper

Wheaton College630/752-5828 (voice)

[email protected] >

Eastern Division PresidentLynn Drafall

Pennsylvania State University814/863-4219 (voice)

[email protected]

North Central Division PresidentKevin Meidl

920/8324170 (voice) [email protected]

Northwestern Division PresidentRichard Nance

Pacifi c Lutheran University253/535-7613 (voice)

[email protected]@msn.com

Southern Division PresidentBradley Almquist

Murray State University270/809-6448

[email protected]

Southwestern Division PresidentGalen Darrough

University of Northern Colorado970/351-2290 (voice)

[email protected]

Western Division PresidentCheryl Anderson

Cabrillo College - VAPA832/479-6155 (voice)

[email protected]

Industry Associate RepresentativeAlec Harris

GIA Publications Inc.708/496-3800 (voice); 708/496-3828 (fax)

Chair, Past Presidents’ CouncilMichele Holt

Providence College401/822-1030 (voice)

[email protected]

National Past Presidents

Archie Jones † Maurice T. Casey Elwood Keister † Hugh Sanders † Warner Imig † David O. Thorsen J. Clark Rhodes † Diana J. Leland Harold A. Decker † William B. Hatcher Theron Kirk † John B. Haberlen Charles C. Hirt † Lynn Whitten † Morris D. Hayes † James A. Moore Russell Mathis Milburn Price Walter S. Collins † David Stutzenberger H. Royce Saltzman Mitzi Groom Colleen Kirk †

From the

Executive Director

Tim Sharp

In a previous column, I identifi ed our intercon-nectedness with other choral organizations and our need to mentor new conductors as critical steps in the advancement of our work. As I continue to ponder strategic imperatives for the American Choral Directors Association as we look to mentor

new conductors and leaders in our choral mission, inevitably I turn to our motivation for prioritizing this task.

In Daniel Pink’s new book Drive, the author of the game changing book A Whole New Mind explores why people are motivated to do the work they do. Motivation is categorized into extrinsic and intrinsic areas, with extrinsic rewards coming from the environment surrounding us, and intrinsic rewards coming from within us. Pink speaks of motivation in contemporary terms by classifying types by Motivation in digital-speak by exploring Motivation 1.0, Motivation 2.0, and Motivation 3.0.

Motivation 1.0’s rewards were the primitive motivators for survival such as food, safety, and shelter. Motivation 2.0 provided rewards through the “sticks and carrots” approach to extrinsic rewards and punishments, used through recent times and manifested in systems of raises, bonuses, promo-tion, and tenure. Motivation 3.0 is Pink’s contemporary paradigm, pointing to the twenty-fi rst century intrinsic rewards that come from a desire for autonomy, mastery, and purpose in our work and lives.

Nothing could more perfectly describe the process of generativity and mentoring than the notions of autonomy, mastery, and purpose. These in-trinsic rewards are the commonalities that unite mentor and protégé, and are truly the motivators we work with in the mentor-protégé relationship.

As conductor/leader/mentor, you may work with as few as twelve to sixteen individuals, or as many as a hundred in an ensemble, and you may work with one ensemble, or several. No matter the number of perform-ers or the number of ensembles, research tells us that three out of four people you work with remain in the ensemble primarily for the music and experience of choral singing. And, most healthy conductors would reply, “and that is the way it should be.”

But, what about that other individual in this three out of four statistic? Research tells us that 25 percent of the ensemble members state the con-ductor, in addition to the music and the experience, is a signifi cant reason for their continuing participation.1

To be sure, there are clearly additional important reasons why a person performs in an ensemble. Those reasons include the artistic opportunity to work and learn from other musicians, the experience of making music in an ensemble, the literature rehearsed and performed, the community formed by individuals making up the ensemble, and other important and healthy factors. It is equally clear, however, that each one of these areas relates to the mentoring process, since it is the conductor that infl uences the makeup of the overall musical community, the literature chosen for rehearsal and

Choral Journal • June/July 2010 3

The Element by Ken Robinson (Viking)

Outliers by Malcolm Gladwell (Little Brown)

Mendelssohn in Performance by Siegwart Reichwald (Ind

The New Yorker magazine

May

Jun

Jun

Jun

Jun

Jun

Jul

Jul

Executive Director’s Executive Director’s LogLog

ipod®

Kindle®

Carmina BuranaTulsa, OK

Chicago Interest sessionCommitee MeetingOkc, OK

Chicago Audition Commitee MeetingOkc, OK

Choral Composers ForumBethleham, PA

ACDA Executive CommitteeChicago, IL

ACDA Leadership ConferenceChicago, IL

NATS National ConferenceSalt Lake City, UT

Int'l Festival of the AegeanSyros, Greece

2 1 -2 1 - 2 3 2 3

4 -4 - 5 5

7- 7- 1 11 1

2 1 -2 1 -2 52 5

2 7-2 7-2 82 8

2 8 -2 8 -2 92 9

2-52-5

1 5 -1 5 -2 02 0

day planner

The Global Achievement Gap Tony Wagner

Prescription for Real Healthcare Reform Howard Dean

Mental Floss-The 5 Gutsiest World Leaders Sept/Oct

Democracy and the Arts ed. Arthur Melzer

Spaces Speak, are you Listening? Linda-Ruth Salter

World Choir Initiatives

performance, and core issues related to leadership. The men-toring conductor is mindful that the process of generativity permeates these choices.

Focusing on the one-in-four performers listing the conduc-tor as a primary reason they remain with the ensemble, it is apparent that these performers are present due to their desire to learn from the conductor in areas that relate directly to the unique teaching qualities and skill set of the person on the podium.

As we work through our rehearsals and performances in the days ahead, we should continue to think about reaching within our ensembles and communities to perpetuate the health and growth of choral music-making in the United States. It is important for us to be mindful of the possibilities for mentoring and generativity that are in front of us weekly in our own ensembles, and intentionally prepare for this ever-present reality.

NOTES

1 "The Conductor and the Ensemble-From a Psychological Aspect," Pi-Hua Chuang, DMA Dissertation, University of Maryland, 2005.

Tim Sharp

The Music of Eric Whitacre Elora Festival Singers

Take up the Song Univ. of Wis. Eau Claire

A History of American Classical Music Barrymore Scherer

Boards That Make a Difference John Carver

IFCM Update

The International Federation for Choral Music has taken signifi cant steps this spring. Because of other business ob-ligations, Lupwishi Mbuyamba resigned as President and the IFCM Board voted unanimously to name Michael J. Anderson as Interim President and Daniel Garavano, First Vice-President.

On March 26, 2010, the International Center for Choral Music in Namur, Belgium, was closed after 20 years of musical activity, succumbing to the same fi nancial crisis affecting the world’s economies. The IFCM Board is busy making decisions about the ongoing thrust of IFCM’s programs from a new home, assuring the continuance of the World Symposium on Choral Music in Argentina (August 2011), the International Choral Bulletin, the World Youth Choir, choral repertoire publications, and IFCM’s partnership with Music International and ChoralNet.


National R&S Chairs

National ChairNancy Cox


BoychoirsJulian Ackerley

Tucson Arizona Boys Chorus520/296-6277 (voice); 520/296-6751 (fax)

[email protected]

Children and Youth Community ChoirsRobyn Lana

Cincinnati Children’s Choir513/556-0338 (voice); 513/556-9988 (fax)

[email protected]

College and University Choirs William McConnell

St. Andrews Presbyterian College910/277-5262 (voice)

[email protected]

Community ChoirsRon Sayer

Marshall Community Chorus660/831-5197 (voice)

[email protected]

Ethnic and Multicultural PerspectivesSharon Davis GrattoUniversity of Dayton


Junior High/Middle SchoolGretchen Harrison

Frontier Trail Junior High913/780-7210 (voice); 913/780-7216 (fax)

[email protected]

Male ChoirsEthan Sperry

513/529-6009 (voice) [email protected]

Music in WorshipTerre Johnson

Vestavia Hills Baptist ChurchBirmingham, Alabama

[email protected]

Senior High ChoirsAmy Johnston BlosserBexley High School

614/539-5262 (voice) [email protected]

ShowchoirsRobert Lawrence

University of Central Missouri660/543-4973 (voice) [email protected]

Two-Year CollegesPaul Laprade

Rock Valley College815/921-3347 (voice)

[email protected]

Vocal JazzKirk Marcy

Edmonds Community College425/640-1651 (voice); 425/640-1083 (fax)

[email protected]

Women’s ChoirsIris Levine

Vox Femina909/869-4566 (voice) [email protected]

Youth and Student ActivitiesJoey Martin

Texas State University512/245-3830(voice)

[email protected]

From the President

Jerry McCoy

The following parable is quoted from A Change of Spirit by Robert Ward in the winter 2008 edition of OCDA news, the bulletin of the Ohio Choral Directors Association.

Consider the following parable: A monastery had fallen on hard times. It was once a part of a great order, which, as a result of religious persecution in the seven-teenth and eighteenth centuries, lost all its branches. It

was decimated to the extent that there were only fi ve monks left in the mother-house: the Abbot and four others, all of whom were over seventy. Clearly it was a dying order.

Deep in the woods surrounding the monastery was a little hut that the Rabbi from a nearby town occasionally used as a hermitage. One day, it occurred to the Abbot to visit the hermitage to see if the Rabbi could offer any advice that could save the monastery. The Rabbi welcomed the Abbot and commiserated. “I know how hard it is,’ he said, ‘the spirit has gone out of people. Almost no one comes to the synagogue anymore.” So the old Rabbi and the Abbot wept together, and they read parts of the Torah and spoke quietly of deep things.

The time came when the Abbot had to leave. They embraced. “It has been wonderful being with you,” said the Abbot, “but I have failed in my purpose in coming. Have you no piece of advice that might save the monastery?” “No. I am sorry,” the Rabbi responded, “I have no advice to give. The only thing I can tell you is that the Messiah is one of you.” The spirit of the monastery began to change. Believing that one of them might be the Messiah, the monks changed in their daily countenance and in their attitude toward each other. Their energy became one of hope versus despair, and their vision for the future was contagious to those who came to the monastery to picnic and visit. Word quickly spread about this special place and more visitors came to the monastery. After a few years, as the monks visited with the people, a few men asked if they could join the brotherhood. The moral of this story is that the Abbot came to the Rabbi seeking advice—a clear set of objectives that would set the monastery on a course of prosperity. What the Rabbi offered was not an easy answer but rather wisdom. He gave the Abbot permission and encouragement to believe that the power to change the situa-tion was alive in each of them. And when each of the monks began to think that they themselves might be the Messiah, they changed who they were, how they interacted, and how they looked to the future.

The power of ACDA or any other choral organization to impact our future does not reside in conventions, clinicians, honor choirs, festivals, articles, and such. It resides in each of us believing we can change our world—one rehearsal, one concert, one singer at a time. So, as you’re gearing up for the fall, remember the most important music-making often happens in rehearsals, rehearsals in which the Messiah of the parable just might be one of us.

Jerry McCoy


From the Editor

Carroll Gonzo

Editorial Board

EditorCarroll Gonzo

University of St.Thomas651/962-5832 (voice); 651/962-5876 (fax)

<[email protected]>

Managing EditorRon Granger

ACDA National Offi ce405/232-8161 (voice); 405/232-8162 (fax)

<[email protected]>

Editorial AssociateDavid Stocker

281/291-8194 (voice)<[email protected]>

Patricia AbbottAssn. of Canadian Choral Conductors


Terry BarhamEmporia State University


Richard J. Bloesch319/351-3497 (voice)

<[email protected]>

John DicksonMercer University

478/301-5639<[email protected]>

J. Michele Edwards651/699-1077 (voice)

<[email protected]>

Lynne GackleBaylor University


Sharon A. HansenUniversity of Wisconsin—Milwaukee


Edward LunderganSUNY-New Paltz845/257-2715

<[email protected]>

Donald OglesbyUniversity of Miami


Lawrence SchenbeckSpelman College


Lyn SchenbeckCoweta County Schools770/683-6837 (voice)

<[email protected]>

Ann R. SmallStetson University

386/822-8976 <[email protected]>

Magen SolomonUniversity of Southern California

213/740-3225<[email protected]>

Stephen TownNorthwest Missouri State University


In This Issue

The June/July issue of the Choral Journal marks the end of the publication year for the journal. Each issue of the Choral Journal (CJ) generally includes three feature articles that have been vetted by the editorial board and recommended for publication. For an author to have an

article appear in the CJ is considered a distinct honor, and such an accomplish-ment is recognized in the world of academe as an important professional success. Two or three times a year, the CJ includes focus issues on birth and death years of famous composers and/or on some timely aspect of the choral art that is of particular interest to our ACDA members.

Over the period of a year, our readers are presented with 9 columns, each overseen by a specifi c editor. The column titles and editors are: Book Reviews—Stephen Town; Recording Reviews—Lawrence Schenbeck; Choral Reviews—Lyn Schenbeck; On The Voice—Sharon Hansen; Hallelujah!—John Dickson; Technol-ogy—Don Oglesby, Choral Music in Junior High/Middle School—Lynne Gackle; and Children’s Choirs—Ann Small. A sampling of the authors of these columns includes professors, public school teachers and administrators, community and church choir conductors, and professional people in medicine, and/or some aspect of the science of singing,

The Repertoire and Standards (R&S) portion of the CJ is edited by Nancy Cox, national chair of R&S, and boasts 14 national chairs who serve as sub-editors for their contributions to the journal. Over a 12-month period, the division and state R&S chairs offer extended discourse on the entire range of R&S topics. Often, these practical narratives are authored by a host of division and state ACDA members.

In addition to monthly messages from Executive Director Tim Sharp and President Jerry McCoy, the CJ is the offi cial mouthpiece regarding the complete spectrum of ACDA’s divisional and national conferences, election of national of-fi cers, and relevant news, business, and activities of the national headquarters. The above account represents the essence of Choral Journal offerings, in addition to information about myriad topics of interest to our readers, not the least of which are the many advertisements by our colleagues and friends in the music industry.

The June/July CJ also includes the year-end index of each is-sue’s content. The chronicling of this invaluable information has been a yearly gift for seventeen years from Scott Dorsey. The Choral Journal and its yearly index can be accessed online, and it is with singular gratitude that we celebrate Scott’s manifold contributions to the Choral Journal and the American Choral Directors Association.

Carroll Gonzo

Scott Dorsey


Technology Committee

ChairPhilip Copeland

University of Alabama BirminghamHulsey 246 950

13th Street SouthBirmingham, Alabama 35296

205/975-2599 [email protected]

Howard MehargSt. Stephens Epsicopal Church

1428 22nd AvenueLongview, WA 98632


Ryan W. HolderNorthern Arizona University

P. O. Box 6040Flagtaff, AZ 86011-6040

928/[email protected]

Brian E. GalantePacifi c Lutheran University

MBR 341Tacoma, WA 98447


Julie ParsonsUniversity of Washington

School of MusicSeattle, WA 98195

[email protected]

Paul DubieACDA National Offi ce405/232-8161 (voice)

[email protected]

Letters to the EditorDear Editor,

I enjoyed Amelia Nagoski’s “Thoughtful Gestures: A Model of Conducting as Empathic Communication” (CJ, April 2010), and particularly appreciated her comprehensive review of the neuroscientifi c principles involved. That said, I respectfully submit that the conduct-ing model upon which the article is based is outdated, and needs to be replaced.

The traditional model Nagoski de-scribes holds the director responsible for the unifi ed emotional expression of the singers—with the director being the leading spark in the circuit. From director to singers to audience, the emotion goes, by way of emotional contagion, mirror neurons, empathy, and other processes relayed through the director’s “body, face, posture, and gesture.”

Unfortunately, this model disempowers choral singers—who are considered incapable of singing with unifi ed expression on their own. Thankfully, this is a false premise. After working with thousands of singers and hundreds of choirs, I know that choral singers are fully capable of being artists in their own right—while singing with unifi ed expression.

Just as it disempowers singers, the traditional paradigm also prevents the audience from experiencing the full power of the performance. Because the singers are the second spark in the expressive circuit, the audience doesn’t get what I call “Primary Affect.” They witness singers reacting to the director’s affect, but they don’t experience them having a primary experience on their own. In addition, the director’s affect is secondary in itself—a reaction to an internal response to the music and text, but not as the human compelled to express the words through song in the fi rst place.

That human can only be the singer. When each singer has a compelling purpose for singing, the audience experiences a vital and authentic human con-nection—by way of the very neuroscience that Nagoski describes. But since this progressive paradigm involves the audience catching the singers’ “emotional contagion” fi rsthand, it leads to even more powerful and transformative concert experiences.

Rehearsals are more fruitful as well, allowing directors to focus more com-pletely on the music—with the singers contributing earlier and more dynamically to the process.

Specifi cs? One method is to take the traditional paradigm and turn it (gen-tly) on its head. Instead of the director trying to impact the singers, have the singers try to impact the director. Example: With This Little Light of Mine, the singers create a story wherein they need to encourage someone to “let their light shine”—even though that person is terrifi ed to do so. The singers know the details, stakes, and circumstances surrounding their need to affect this other person—just as they know about their own light. As they sing, their director becomes this person who needs encouragement, and all singers do all they can to get that person to shine. Combine this with the authentically connected movement which Nagoski recommends—along with the respectful leadership


style she suggests—and we end up with a choir which is much more engaged and engaging than the one whose expression is being prompted by the director.

Even when the director’s affect is deadpan, such a choir will bring down the house. I’ve witnessed this time after time, watching choirs transform from singing with completely fl at affect to singing with dynamic expression—within the space of an hour. And because of the mind/body connection collectively shared, the sound becomes more dynamic and nuanced as well—and even more unifi ed.

Singers working within such paradigms are given the respon-sibility to be the primary spark in the expressive/connective process, and the results are profound. When choral directors have experienced this during clinics, they’ve said things like, “The choir was so much more expressive. But most signifi -cant, I didn't have to worry about the singers' expressiveness anymore. I could relax and make music with them!" For more about this, visit www.choralcharisma.com—especially the pages titled “Philosophy…,” “Director’s Face,” and “Movement.”

All my best,

Tom Carter, Author of Choral CHARISMA:

Singing with Expression(Santa Barbara Music Publishing, 2005)

Note from the Editorial Associate:

I think this is a particularly thoughtful response to the article. I agree with some amount of it—however, I fear the response errs about the same distance as the original author, only on the other side of the continuum. Singer-as-expressive-respondant has never been a particularly potent argument for me since the concept of "ensemble" is more limiting than Tom's verbiage implies. Although every choir member needs to own the expressive elements of a piece—both in a macro and micro way—expressive anarchy is hardly a substitute for profound expressive insight generated collectively, but primarily, from the concepts of the conductor.

The issue here is "What is an ensemble?" When that is answered, the rest of the argument can proceed accordingly. Neither our author nor our respondant has defi ned it to my satisfaction so that their continuing arguments have something to hang on.

Since this surely is a hot-button issue for our members, I would invite any reader to respond to any of the points made in the article, the Letter-to-the-Editor response, or the editorial comment. Perhaps a "Brahms vs. Wagner" dialogue would be interesting in print.

Please send any responses to [email protected] as soon as

possible and we will decide on how to proceed from there. Be succinct, and timely—no later than July 15th.

David StockerEditorial Associate

Dear Editor,

I just received my Choral Journal (April 2010), and I must say, I am very disappointed with the pictures on the front cover. I understand how some pictures of the Civil War would be appropriate to promote John Warren's article on Jef-frey's Van's Civil War poems set to music. But why in the world would you want to have pictures of dead soldiers, much less pic-tures of soldiers shooting at each other, on the front page of the Choral Journal. Wouldn't pictures of soldiers singing, or a picture of a band playing, have been much more appropriate?

Willem BleesKailua, Hawaii

Response:

1. There is nothing pretty about one of the most catastrophic disputes in our history. It was raw, savage, and as heart-rending as any moment in our past. To sanitize it is to back away from its reality.

2. Whitman's impetus for the poetry, as stated in the fi rst paragraph of the article, was to search for his brother George, a casualty of the battlefi eld.

3. The poems themselves speak of the harsh reality of this brutal confl ict: Whitman uses words such as "beat, scatter, make no parley, mind not the timid, let not the child's voice be heard, nor the mother's entreaties, ...shake the dead, O terrible drums," etc. Somehow, pictures of singing around the campfi re do not at all fi t the fury, frenzy, suffering and death that Whitman experienced and subsequently expressed. Although music can, and often does, speak about the loftier aspects of human experience, it can, as well, speak to the misery and pain.

David StockerEditorial Associate

A Beginner’s Guide to Prophecy

Orlande de Lassus’sProphetiae Sibyllarum

Jonathan Harvey


Jonathan Harvey is a lecturer at Elms College in Chicopee, Massachusetts. He holds a BA from Earlham College and an MM from the Indiana University Jacobs School of [email protected]

Introduction

Orlande de Lassus’s Prophetiae Sibyllarum is a col-lection about which very little is concretely known. The only version of the work to survive from Las-sus’s lifetime is a set of four small-format illuminated manuscript partbooks from Duke Albrecht V’s court in Munich. The date for the completion of the part-books is set between 1558 and 1560, since each of the partbooks contains a portrait of the composer captioned “Orlando di Lasso at 28 years of age.”1 As to the date of composition, there is no solid attribution.

Scholarship around Prophetiae Sibyllarum has tended to emphasize the composition’s adventur-ous harmonic idiom. The work, which consists of twelve motets, each titled after a specifi c sibylline prophetess and prefaced by a Prologue, does, indeed, move far beyond Lassus’s normal level of chromaticism.2 This chromaticism reaches the den-sity of Gesualdo’s at times, but serves a different purpose: to highlight the ancient, secret, unusual, and mysterious effect of the poetic texts.3 However, the chromaticism is not anachronistic in any way: it is the by product of a fashion for such music at the time, motivated largely by Nicola Vicentino and the use of the ancient Greek chromatic tetrachord.

The prophetic poetic texts are part of a history of literary works that draw a line between prophecies of antiquity, and the birth, life, and death of Jesus.4 In this formulation, the prophecies supposedly foretell details of Jesus’ existence. Considering the Renais-sance’s fascination with antiquity, this reinforcement of Christian thought originating in the ancient world would have been very important.

Lassus’s Prophetiae Sibyllarum is a product of its time, rather than a prophetically mystic beacon of the future of music, as it is sometimes described. If there are to be more performances of this piece, the scholarship around the work needs to be synthesized into a practical performance guide in English. It is the goal of this paper to be that guide. The guide will consist of: a brief familiarization with the outlines of the composer’s life; a historical survey of the prophetic tradition in which the collection of motets lies; an analysis of the cycle as a whole; and a proposal of performance methods. As the 450th anniversary of the creation of the Prophetiae Sibyl-larum partbooks approaches, such a guide may be useful for many choirs.



Biographical Context: Orlande de Lassus

There is a distinct lack of documentary evidence pertaining to Lassus’s early life. Some facts, however, are relatively widely accepted. He was born in the Flemish province of Mons in Hainaut in either 1530 or 1532. There are unconfi rmed accounts that he was a choirboy at St. Nicholas, and that he was abducted three times because of the beauty of his voice.5

The fi rst solidly known fact about Las-sus is that at the age of 12, he entered the service of Ferrante Gonzaga, a cadet of the Mantuan ducal court and a general in the army of Charles V. He remained in Gon-zaga’s service until 1549, during which time they travelled from the Low Countries to

Fontainebleau, Mantua, Palermo, and Milan. In 1549, Lassus left Gonzaga and travelled to Naples, where he entered the service of Constantino Castrioto. He probably began composing during this time.6

In 1551, Lassus moved to Rome, where he lived in the home of the Archbishop of Florence, Antonio Altoviti. Two years later, he obtained the position of maestro di cappella at St. John Lateran (a position Palestrina would hold two years later), in-dicating that his renown as a musician was growing. In 1554, he received word that his parents were ill, so he returned to Mons in Hainaut, only to fi nd them already deceased. At this point, there is another historical gap in the documentary evidence. It has been proposed that Lassus may have sojourned

to England and France at this point, in the company of G.C. Brancaccio, but this infor-mation is unverifi ed.7

In 1555, it is known that Lassus was in An-twerp, and although he held no offi cial post, he was making contacts with such infl uential fi gures as Tylman Susato, in whose publish-ing house he may have worked, and who published Lassus’s fi rst collection that year.8

One year later, Lassus received an invita-tion to join the court of Duke Albrecht V of Bavaria in Munich. He joined as a tenor singer under Kapellmeister Ludwig Daser. Lassus was one of several newly hired Flem-ish singers at the court, part of a plan by Al-brecht V to “netherlandize” the court music.9

When the Prophetiae Sibyllarum partbooks were created in 1558 or 1560,10 they were

Orlande de Lassus’s Prophetiae Sibyllarum


part of a collection of pieces by Lassus which he presented to Albrecht V in order to gain favor with his new patron. The collection also included the Sacrae lectiones and the seven Penitential Psalms.

The likeliest date of composition for Prophetiae Sibyllarum is sometime between Lassus’s appointment at Munich, and the copying of the manuscripts. The argument for this window of time is as follows: if they had been completed earlier (when he was in Antwerp or before), he almost certainly would have published them in Antwerp, where he had been publishing actively, and drawing liberally from his earlier works.11An argument could be made for a different time of composition: when he was in Naples be-tween 1549 and 1551, living close to the hill and the cave of the Cumaean Sibyl. This situ-ation could have served as inspiration for the subject matter, and word of Vicentino’s de-bates with Vicente Lusitano over the use of chromaticism in music in Rome in early 1551 could have served as an inspiration for the harmonic idiom.12 Whether Prophetiae Sibyl-larum was composed 1549–51 or 1556–60, Lassus's proximity to the Cumaean cave and the Vicentino debates certainly infl uenced the conception of the work.

Regardless of when the work was com-posed, the gift of the manuscript must have caught Albrecht V’s attention: when Daser was pensioned in 1563, Lassus took over leadership of the ducal chapel, a position he held until his death in 1594.13

Prophetiae Sibyllarum was not printed un-til after Lassus’s death. It was fi rst published in 1600 by his sons, but then was not includ-ed in the Magnum Opus Musicum, a gigantic collection of Lassus’s motets published in 1604 (also by his sons). Roth has speculated that interest in the Sibyls may have waned by the turn of the century, explaining the work’s sporadic inclusion in print.14

Historical Context: Prophecy and Chromaticism

The larger cultural historical context is, of course, another very important element to framing Prophetiae Sibyllarum, fi xing it in a web of cultural traditions far wider than Lassus’s personal biography. Two historical trends or ideas are particularly relevant to

this specifi c work: the Sibylline tradition, and the increasing use of chromaticism in the mid-sixteenth century.

Sibyls were prophetesses of Apollo from antiquity, specifi cally ancient Greece. Their signifi cance remained, through appropria-tion into Christian thought, into the Middle Ages. In the humanistic environment of the early to mid-sixteenth century, especially in Italy (where Lassus spent several formative years), the Sibylline oracles would have been well known and much studied fi gures, both because of their origins in antiquity, and because of their prophecies’ adoption into Christianity.15

Oracles were consulted in ancient Greece for personal, religious, or political advice. They were conduits to the gods, whose will they could reveal. To be consid-ered genuinely Sibylline, a prophecy had to contain two structural features: it had to be in hexametric verse, and an acrostic of some kind had to be present in the proclama-tion.16 Sibylline oracles (the oracle at Delphi being the most famous) were tremendously popular and powerful until the confl uence of two particular circumstances. First, the rise of the Roman Republic led to a general despiritualization of Greek life. Second, the popularization of astrology as an alternative method of seeking answers from the gods led to a loss of credibility for the Sibyls.17

By the Renaissance, the Sybilline tradition had been embellished through literary fan-tasy, appropriated fi rst by Roman and then Christian thinkers, and had been somewhat standardized into an accepted pseudo-canonic collection. Early Christians had seen the oracles as prophets of the coming of Jesus, similar to the Old Testament prophets. Until the fi fteenth century, the accepted number of Sibylline oracles was ten. Filippo Barbieri added two more oracles in a publi-cation in 1481, which prompted a new level of interest in the Sibyls.18 The new outpour-ing of publications in the late fi fteenth and early sixteenth centuries was yet another degree removed from the ancient Christian appropriations. These new publications were often in the vernacular, and were in popular sources. There was a return to the much older Sibylline writings in 1545, with the publication of a newly rediscovered Greek text containing 12 Christian-leaning prophe-



cies, one from each accepted oracle . Johannes Opori-nus published this work, titled Oracula Sibyllina, in Basel. A new 1555 Latin edition of these poems is the most likely source of the poems found in the Prophetiae Sibyl-larum, giving further credence to a later composition date, in Munich.19

This winding, multi-layered Sibyl-line tradition was one major infl uence on the composition of the piece. Another was the growing use of, and experimentation with, chromaticism. The mid-sixteenth century saw Cipriano de Rore’s sometimes highly exploratory works, the debate between Vicentino and Lusitano on the use of chromatic and enharmonic tetrachord genders in modern music,20 and Adrian Willaert’s famously esoteric expan-sion of the gamut in his motet Quid non ebrietas.21This chromaticism, however, was of a very different kind than later tonal and post-tonal chromaticism. Vicentino’s defense of the use of the chromatic gender in dia-tonic music referred to melodic, rather than harmonic, motion. Therefore, the chromati-

cism manifested itself as minor- second mo-tion outside the diatonic melodic gamut.22

Lassus’s harmonic language in Prophetiae Sibyllarum is in line with this zeitgeist, and is in some ways more conservative. Rather than being experimental, theoretical music, the piece is meant for actual performance, as indicated by its presentation as a set of partbooks. The voice leading is also some-times unorthodox, and the chromatic gamut is wide, but it rarely breaks contemporary voice-leading rules, and the gamut is con-sistent with the contemporary expansion occurring in many other pieces.23

By locating Prophetiae Sibyllarum within these trends of Sibylline fascination and chro-

matic expansion, its position as an adventur-ous but not revolutionary piece is revealed. Although this context generates more ques-tions about the place and time of its origin, rather than conclusively answering any, it is important to see the piece as Lassus and his contemporaries would have viewed it.

AnalysisThe poetry of Prophetiae Sibyllarum, as

has been noted earlier, adheres to the hexa-metric schema required of Sibylline utter-ances (with the exception of the Prologue, which is not a prophecy, and has only three lines). The stanzas all share other character-istics, as well. They are largely characterized by unusual syntactical constructions, such as incomplete thoughts, parenthetical inser-tions, and cut-off sentences. This aesthetic is in keeping with the ecstatic character of the utterances, and is depicted by Lassus through the highly chromatic, somewhat aurally disjunct harmonic idiom (Figure 1).24

There is a direct correspondence between the distorted verbal language of the Sibyls and the distorted harmonic language of the settings.

Beyond the general affect of mystery and distortion, the text has a subtler relation-ship to its setting. Because the declamatory texture is primarily homophonic, and all the pieces are in duple mensuration, Lassus has the opportunity to emphasize certain words or syllables, and bring out the syntax of the poems, by playing with metric placement. The shifts of accentuation, wherein a normal-


Text and Translation40

Carmina ulti sta quae audis ulti st tenore, Haec sunt ilia quibus nostrae olim arcana salutis Bis senae ulti sta cecinerunt ore Sibyllae.

I. PersicaVirgine matre satus, pando residebit asello, Iucundus princeps, unus qui ferre salutem Rite queat lapsis: tamen illis forte diebus Multi multa ferent, immensi fata laboris. Solo sed satis est oracula prodere verbo: Ille Deus casta nascetur virgine magnus.

II. Libyca Ecce dies venient, quo aeternus tempore princeps, Irradians sata laeta, viris sua crimina toilet, Lumine clarescet cuius synagoga recenti : Sordida qui solus reserabit labra reorum, Aequus erit cunctis, gremio rex membra reclinet Reginae mundi, sanctus, per saecula vivus.

III. Delphica Non tarde veniet, tacita sed mente tenendum Hoc opus. Hoc memori semper qui corde reponet, Huius pertentant cur gaudia magna prophetae Eximii, qui virginea conceptus ab alvo Prodibit, sine contactu maris. Omnia vincit Hoc naturae opera : at fecit, qui cuncta gubernat.

IV. Cimmeria In teneris annis facie praesignis, honore Militiae aeternae regem sacra virgo cibabit Lacte suo : per quem gaudebunt pectore summo Omnia, et Eoo lucebit sidus ab orbe Mirifi cum: sua dona Magi cum laude ferentes, Obiicient puero myrrham, aurum, thura Sabaea.

V. Samia Ecce ult, nigras quae toilet laeta tenebras, Mox veniet, solvens nodosa volumina vatum Gentis Judaeae, referent ut carmina plebis. Hunc poterunt clarum vivorum tangere regem, Humano quem virgo sinu inviolata fovebit. Annuit hoc coelum, rutilantia sidera monstrant.

VI. Cumana Iam mea certa manent, et vera, novissima verba, Ultima venturi qu6d erant oracula regis, Qui toti veniens mundo cum pace, placebit, Ut voluit, nostra vestitus carne decenter, In cunctis humilis. Castam pro matre puellam Deliget, haec alias forma praecesserit omnes.

VII. Hellespontica Dum meditor quondam vidi decorare puellam, Eximio (castam quod se servaret) honore, Munere digna suo, et divino numine visa, Quae sobolem multo pareret splendore micantem: Progenies summi, speciosa et vera Tonantis, Pacifi ca mundum qui sub ditione gubernet.

Polyphonic songs which you hear with a chromatic tenor, these are they, in which our twice-six sibyls once sang with fearless mouth the secrets of salvation.

I. Persica The son of a virgin mother shall sit on a crook-backed ass, the joyful prince, the only one who can rightly bring salvation to the fallen; but it will happen in those days that many shall tell many prophecies of great labor. But it is enough for the oracles to bring forth with a single word: That great God shall be born of a chaste virgin.

II. Libyca Behold the days will come, at which time the immortal prince, sowing abundant crops, shall take away their crimes from men, whose synagogue will shine with new light; he alone shall open the soiled lips of the accused, he shall be just to all; let the king, holy, living for all ages, recline his limbs in the bosom of the queen of the world.

III. Delphica He shall not come slowly (but this work must be held with quiet thought), he who will ever store this in a mindful heart, why his prophets may announce great joys of this exalted one, who shall come forth conceived from the virginal womb without taint of man. This conquers all the works of nature: yet he has done this who governs all things.

IV. Cimmeria In her tender years, distinguished with beauty, in honor the holy virgin will feed the king of the eternal host with her milk; through whom all things will rejoice with uplifted heart, and in the east will shine a marvelous star: Magi bringing their gifts with praise shall present to the child myrrh, gold, Sabaean frankincense.

V. Samia Behold, the joyful day which shall lift the black darkness will soon come and unravel the knotty writings of the prophets of the Judean tribe, as the people's songs tell. They shall be able to touch this glorious ruler of the living, whom an unstained virgin will nurture at a human breast. This the heavens promise, this the glowing stars show.

VI. Cumana Now my most recent words shall remain certain and true, because they were the last oracles of the king to come, Who, coming for the whole world with peace, shall be pleased, as he intended, to be clothed fi tly in our fl esh, humble in all things. He shall choose a chaste maiden for his mother; she shall exceed all others in beauty.

VII. HellesponticaOnce while I was refl ecting, I saw him adorn a maiden with great honor (because she kept herself chaste); She seemed worthy through his gift and divine authority to give birth to a glorious offspring with great splendor: the beautiful and true child of the highest Thunderer, who would rule the world with peaceful authority.

continued on page 15.


ly accented syllable is placed in a metrically weak area, or a nor-mally weak syllable is strengthened metri-cally, allow an even more heightened sense of distortion (Figure 2).25

Some scholars have interpreted Pro-phetiae Sibyllarum as a modally ordered cyclic piece, similar to Lassus's Lagrime di San Pietro. According to this analysis, the Prologue and I– II are in mode 8, III– IV in mode 1, V–VI in mode 2, VII–VIII in mode 7, IX–X in mode 3 mixed with 4, and XI–XII

in mode 6.26 These modal groupings corre-spond with the clef groupings of the pieces, as well. The 13 pieces in the cycle are thus divided into 6 subgroups, delineated by mode and clef.

The chromaticism of the work is remark-able, but the actual gamut used in the piece is consistent with usage at the time. Most com-posers limited themselves to a maximum fi fteen-step gamut: A♭/G♯, A, B♭/A♯, B, C, C

♯, D,

E♭/D♯, E, F, F♯, and G, with A♭ and A

♯ appearing

only rarely. This is the exact situation that is found in Prophetiae Sibyllarum.27

Formally, the pieces are all through-composed, to the extent that even repeated text units are set differently each time. The numbers do exhibit some formal parallels, though. They all contain episodes of tex-tural variety (added or subtracted voices, homophonic or verging on polyphony). Most strikingly, every motet ends with the last text fragment being repeated, but set to different music, in a rhetorical gesture suggesting fi nality.

Performance PracticeHistorical performance practices must be

informed fi rst and foremost by geographic location. During the Renaissance, musical composition was motivated and shaped primarily by specifi c performance contexts. Therefore, it is important to be familiar with the practices that were in use at the

composer’s intended time and place of per-formance. In the case of Lassus’s Prophetiae Sibyllarum (as was stated earlier), the best evidence available suggests that it was writ-ten as a gift of private music for Albrecht V’s court in Munich. Therefore, it is those performing circumstances that can inform a performance today.

When Lassus fi rst came to Munich, he was one of several new Flemish singers being brought to the court. Considering this fact, and Lassus’s own background, the pronunciation of the Latin text could poten-tially be shaded by mid-sixteenth-century Dutch pronunciation. The pertinent simpli-fi ed pronunciation rules in this case would be as follows:28

Consonants:

C: before E, I: [tj]; otherwise: [k]G: before E, I: [Z]; otherwise: [x]S: between vowels within a word: [z];

otherwise: [s]SC before E, I: [tj]X, XC: before a vowel: [kz]; otherwise: [ks] Vowels:

A: in closed syllables: [A]; in open syllables: [a:]E: in closed syllables: [E]; in open syllables: [e:]I: in closed syllables: [I]; in open syllables: [i]O: in closed syllables: [ç]; in open syllables: [o]U: [y]

Another less likely, but still possible, shad-



ing of pronunciation would be in the direc-tion of the “Classical” Latin of Cicero, which was the literary language of the Empire circa 100 B.C.E. until about halfway through the fi rst century C.E. There were some instances of humanistic Renaissance-era revivals of this pronunciation. In each case, however, it is ambiguous which rules would have been observed, and therefore specifi c performance recommendations are diffi cult to determine.29

The performing forces at Albrecht V’s court chapel varied widely, depending upon his fortunes. Members of the Kapelle pro-vided music for Mass, Vespers, and Vigils, in addition to music for meals and relaxation times. In a 1586 performance of Brumel’s twelve-part Missa ‘Et ecce terrae motus,’ 45 singers were specifi cally noted as hav-ing participated, including 12 boys singing

the three cantus lines.30 This performance took place when the Kapelle was at its largest, and was intended for a prestigious performance of a sacred work. Albrecht V was also known (and criticized) for his love of musical display.31 Because the Prophetiae Sibyllarum does not specifi cally fi t into the liturgy, and Albrecht V also enjoyed private performances, it is likely that the number of performers per part would have been slightly smaller than the Brumel forces of 1586, possibly only two or three performers on each line. Add to this evidence the fact that the extant manuscripts contain only one partbook for each part, and the possibility of larger forces seems unlikely.

Concerning issues of ornamentation, local traditions are harder to trace, so cues must be taken from widely consulted con-temporary treatises. Because of the soloistic

nature of the performing forces, it is possible that fi gures/graces and divisions/diminutions could have been used.32 However, the highly chromatic, generally triadic style of this par-

VIII. PhrygiaIpsa Deum vidi summum, ulti volentem Mundi homines stupidos, et pectora caeca, rebellis. Et quia sic nostram complerent crimina pellem, Virginis in corpus voluit demittere coelo Ipse Deus prolem, quam nunciet Angelus almae Matri, quo miseros contracta sorde levaret.

IX. EuropaeaVirginis aeternum veniet de ulti s verbum Purum, qui valles et montes transiet altos. Ille volens etiam stellato missus Olympo, Edetur mundo pauper, qui cuncta silenti Rexerit imperio : sic credo, et mente fatebor : Humano ulti st divino semine gnatus.

X. TyburtinaVerax ipse Deus dedit haec mihi munia fandi, Carmine quod sanctam potui monstrare puellam, Concipiet quae Nazareis in fi nibus, ilium Quem sub carne Deum Bethlemica rura videbunt. O nimium felix, coelo dignissima mater, Quae tantam sacro lactabit ab ubere prolem.

XI. ErythraeaCerno Dei natum, qui se demisit ab alto, Ultima felices referent cum tempora soles: Hebraea quem virgo feret de stirpe decora, In ulti s multum teneris passurus ab annis, Magnus erit tamen hic divino carmine vates, Virgine matre satus, prudenti pectore verax.

XII. AgrippaSummus erit sub carne satus, charissimus atque, Virginis et verae complebit viscera sanctum Verbum, consilio, sine noxa, spiritus almi: Despectus ulti stamen ille, salutis amore, Arguet et nostra commissa piacula culpa : Cuius honos constans, et gloria certa manebit.

VIII. PhrygiaI myself saw the high God wishing to punish the stupid men of the earth and the blind heart of the rebel. And because crimes shall thus fi ll our skin, God himself wished to send from heaven into the body of a virgin his son, which the angel shall announce to the fostering mother, so that he may raise the wretches from the uncleanness they have contracted.

IX. EuropaeaFrom the body of a virgin shall come forth the pure word eternal, who shall cross valleys and high mountains. He, willingly sent even from starry Olympus, will be sent into the world a pauper, who shall rule all creation with silent power. Thus I believe and shall acknowledge in my heart: He is the child of both divine and human seed.

X. TyburtinaThe truthful God himself gave me these gifts of prophecy, that I might proclaim in song the holy virgin who shall conceive in Nazareth's bounds that God whom Bethlehem's lands shall see in the fl esh. O most happy mother, worthy of Heaven, who shall nurse such a child from her holy breast.

XI. ErythraeaI behold the son of God, who sent himself from on high, when the joyful days shall bring the last times. He whom the comely virgin shall bear from the Hebrew lineage, he who shall suffer much on earth from his tender years on, he shall nevertheless be here a great seer in godly prophecy, the son of a virgin mother, truthful and of a wise heart.

XII. AgrippaThe highest and dearest shall be born in the fl esh the son of the true virgin, and the holy word shall fi ll the womb of the maiden through the pure intention of the nurturing spirit; although contemptible to many, he, for love of our salvation, will censure the sins committed by our guilt; his honor shall remain constant and his glory certain.

Text and Translation40 continued



ticular piece might have led performers to minimize such ornamentation, in favor of harmonic clarity.33

The idea of tempo at this time was closely bound up with the tactus, or the larger temporal unit. The tactus was generally regarded as moving at the pace of a healthy heartbeat. Another common comparison was with a steady walking stride.34 In other words, the longer units dictated tempo, and that tempo would be approximately 55–70 beats per minute. Tempi could be fl exible though, and varied to refl ect mood.35

Intonation is a performance issue diffi cult to address, because of the modern domi-nance of equal temperament. The system in use for voices and other fl exible-tuning instruments at the time was just intonation, in which all fi fths and major thirds were tuned pure.36 Practically, this means that it

will be diffi cult to rehearse with a keyboard instrument, because a pitch will not always be the same, depending on where it lies in the vertical musical space.

The pitch level at which music from the mid-sixteenth century was performed is an even thornier issue. Broadly speaking, vocal polyphony was written in two com-binations of clefs: “high clefs” (G2, C2, C3, F3), and “low clefs” (C1, C3, C4, F4). There was no universal pitch standard, so pitch level was determined by any accompanying instruments, or by the ranges of the vocal-ists. In particular, many theorists called for a downward transposition of pieces appearing in the “high clefs” confi guration.37 Prophetiae Sibyllarum contains pieces in both clef combi-nations, with an additional even lower third set (high: III, IV, VII , VIII; low: Prologue, I, II, V, VI, XI, XII; extra-low: IX, X).

Ideal vocal timbre for this repertoire is also diffi cult to pinpoint, primarily because of the inadequate descriptive vocabulary avail-able then and now. It is generally accepted based upon Renaissance descriptions, how-ever, that vocal timbre should be light but clear, with pure tone and expressive force.38

These performance conditions are not intended to discourage modern perfor-mances that are governed by modern ex-pectations. The purpose of this explication is to guide thinking about the piece, rather than constrict it. The most important concept is the relative fl exibility of performance at this time, as compared to modern thinking.39

ConclusionThe Prophetiae Sibyllarum of Orlande de

Lassus is a beautiful piece to hear performed.

An ISO 9001:2000-compliant manufacturer • Toll-free (Canada and USA): 1-877-246-7253 • Telephone and fax: +1 604.733.3995

The new MUSICFOLDER.com

RingBinder

Why blow it? Our PocketTones™ is more accurate and sanitary than mouth- blown pitch pipes, and has handy ON/OFF switch and volume control.

RingBinder lies flat when you unbutton its bottom strap.

Secure hand strap on all

our choral fold-ers helps you perform with

confidence.

Your music should be catchy, not your scores. Which is why the rings on our new RingBinder have patented, positive

fittings that always align properly – and open with a single tab. No more holes snagging on page turns. Our many folder options include clear pockets, retaining cords, custom logo imprinting (right), even a new Concert Band & Orchestra Folder for instrumentalists. Feel free to order any of our products from www.musicfolder.com or your local distributor. Or simply give us a ring. ones™ ii m™

mos iiss mom reee

outh-

New Duet2 dual-head music light provides brilliant accompaniment in darker venues. Ultra-efficient LEDs offer minimal power consumption and excellent battery life.

The Black Folder – our best-seller, customizable. ECBF-CP version shown.

CHORALEX™ Compact – narrow for tight spaces and

very light. Removable rings and extra cords are optional.

Snag-free rings never misalign.

SUDDENLY, YOUR MUSIC IS GRIPPING.


The harmonic language is unexpected and striking, and the texts are dense, allusive, and multi-layered. Unfortunately, there is a perception of the piece as an object more interesting for study than performance. This idea is reinforced by the very esotericism of the harmonies and texts which have the potential to engage listeners in a perfor-mance setting. It is hoped that the above exploration of the biographical and historical context of Prophetiae Sibyllarum, together with the analysis and exploration of the text and music, and the proposal of historically informed performance methods, will lead to a reconsideration of this piece. It is a work as appealing as Lassus’s other more commonly sung motets, and is ripe for performance by any group searching for repertoire from this period.

On the other hand, this demystifi ca-tion should be, in no way, interpreted as a dismissal of the mystic character of the composition. Quite the opposite: any effec-tive performance would need to highlight that character, in order to do Prophetiae Sibyllarum the full justice it deserves, and that Lassus no doubt envisioned.

NOTES

1 Marjorie A. Roth. “The voice of prophecy: Orlan-do di Lasso’s Sibyls and Italian Humanism.” (PhD diss., University of Rochester, 2005.), 9.

2 Peter Bergquist. “The Poems of Orlando di Lasso’s Prophetiae Sibyllarum and Their Sources.” Journal of the American Musicological Society32, no. 3 (Autumn, 1979), 516.

3 Karol Berger. Theories of Chromatic and Enharmonic Music in Late Sixteenth Century Italy. (Ann Arbor: UMI Research Press, 1976), 118.

4 Bergquist, 516. 5 Gustave Reese. The New Grove High Renaissance

Masters: Josquin, Palestrina, Lassus, Byrd, Victoria.(New York: W.W. Norton, 1984), 157.

6 Roth, 23. 7 Reese, 158. 8 Roth, 23. 9 Reese, 160.10 Jessie Ann Owens. “Review.” Notes 48, No. 4 (Jun.,

1992): 1442.11 Bergquist, 520.12 Karol Berger. “Tonality and Atonality in the

Prologue to Orlando di Lasso’s Prophetiae Sibyllarum: Some Methodological Problems

in Analysis of Sixteenth-Century Music.” The Musical Quarterly 66, no. 4 (Oct., 1980): 492.

13 Reese, 160.14 Roth, 9.15 Roth, 42.16 Ibid., 48.17 Ibid., 54.18 Bergquist, 523.19 Ibid., 52920 Berger, Tonality and Atonality, 489.21 Karol Berger. “The Common and the Unusual

Steps of Musica fi cta: A Background for the Gamut of Orlando di Lasso’s Prophetiae Sibyllarum.” Revue belge de Musicologie/ elgisch Tijdschrift voor Muziekwetenschap 39 (1985 - 1986): 73.

22 James Haar. “False Relations and Chromaticism in Sixteenth-Century Music.” Journal of the American Musicological Society 30, no. 3 (Autumn, 1977): 392.

23 Berger, “The Common and the Unusual Steps,” 73.

24 Roth, 26.25 Horst Leuchtmann. “Correct and Incorrect

Accentuation in Lasso’s Music: On the Implied Dependence on the Text in Classical Vocal Polyphony.” Orlando di Lasso Studies. Ed. Peter Bergquist. (New York: Cambridge University Press, 1999), 245.

26 Owens, 1441.27 Berger, “The Common and the Unisual Steps,”

72.28 Timothy J. McGee. Singing Early Music: The

Pronunciation of European Languages in the Late Middle Ages and Renaissance.

(Bloomington: Indiana University Press, 1996), 284.

29 Harold Copeman. Singing in Latin. (London: Harold Copeman, 1990), 6.

30 Clive Wearing. “Orlandus Lassus (1532– 94) and the Munich Kapelle.” Early Music 10, no. 2 (Apr., 1982), 150.

31 Reese, 161.32 Steven Eric Plank. Choral Performance: A Guide to

Historical Practice. (Lanham: Scarecrow Press, 2004), 86.

33 Ibid., 88.34 Brenda Smith. Cantare et sonare: A Handbook

of Choral Performance Practice. (Chapel Hill: Hinshaw Music, 2006), 200.

35 Howard Mayer Brown and Stanley Sadie. Performance Practice: Music Before 1600. (London: Macmillan, 1989), 126

36 Jeffery T. Kite-Powell. A Performer’s Guide to Renaissance Music. (Bloomington: Indiana University Press, 2007), 287.

37 Ibid., 295.38 Ibid., 16.39 Peter Phillips. “Great Men Think Alike? On the

400th Anniversary of His Death, Peter Phillips Re-Assesses the Work of Orlandus Lassus.” The Musical Times 135, No. 1816 (Jun., 1994): 363.

40 Bergquist, 532.

ARCHITECTURE THEATER RELIGION MUSIC LANGUAGE ART

Creating interesting tour combinations is our specialty & we are never short on ideas.www.Cu l t u ra l Tou rCon su l t an t s . c om To l l F r ee 866 .499 .3799


New Solutions for Lili Boulanger’s Psaume 130, Du fond de l’abîme, Part 2

Lili Boulanger the day she won the Prix de Rome. Photo courtesy of Nadia and Lili Boulanger international Fondation’s archives.

John Perkins, DMA, Choral ConductingAssistant Professor of MusicVisual and Performing ArtsAmerican University of SharjahP.O. Box 26666, Sharjah, [email protected]


Compositional similarities in text setting and melodic construction occur between the Pie Jesu from the fourth movement of Fauré’s Requiem and Boulanger’s setting of Pie Jesu for soprano solo, harp, organ, and string quartet. In light of Boulanger’s compositional interest in Fauré’s Requiem, these similarities led musicologist Benjamin-Gunnar Cohrs to a larger hypothesis that, combined together, Pour les fune’railles d’un soldat; Psaume 24; Psaume 129; Vielle Prière bouddhique and Psaume 130, written between 1912 and 1917, resemble a non-liturgical requiem, likely infl uenced by Fauré’s requiem setting. Cohrs makes a convincing case, comparing and analyzing the text, key relations, and histori-cal data.7 Furthermore, in her book, Nadia and Lili Boulanger, musicologist Caroline Potter’s description of a page from one of Boulanger’s sketchbooks further suggests that Bou-langer started a requiem setting in Latin (possibly where the Pie Jesu originated) and that she plausibly abandoned it for a non-liturgical setting:

The most interesting of these sketches (of the canon in measures 342 through 353) suggests that the work [Psaume 130] was originally going to be a Requiem. Although only one word of the Requiem text is present—“Dona” (eis requiem or nobis pacem)— the dedication of Du fond de l’abîme to the composer’s late father makes the possibility that it was conceived as a Requiem plausible. Instead, the sketch fi ts the words of ‘Car en Iahvé est la miséricorde’ [sic]…as Boulanger sketches rhythmic notation above the stave which fi ts these words. A few pages later, sketches for a Kyrie further reinforce the notion that this work was originally intended to be a Requiem.8

Cohrs’s detailed hypothesis combined with Potter’s discovery of Latin text in the sketchbook suggest that the unusual twenty-fi ve to twenty-nine minute length of Psaume 130 may be the result of a larger scheme within a non-liturgical requiem.

Intersections of Text, Form, and TonalityLili’s sister, Nadia, provides one of the few primary

sources of information about Lili’s approach to composi-tion. Nadia spoke mysteriously about Lili’s music: “[Lili] sealed her work in silence. She did not want to lay bare her thoughts because only the music counted.”9 Yet, we may be able to ascertain, indirectly, Lili’s musical approach through Nadia’s thoughts about composition and analysis: “[N]othing happens without reason, it is simply that the reasons sometimes remain unintelligible to us, because we do not see very far, [and] because we do not take

P art I, “A Historical and Pragmatic Approach to Lili Boulanger’s Psaume 130, Du fond de l’abîme,” published in the May 2010 issue of the Choral

Journal, addresses issues regarding historical oversight of Lili Boulanger and logistical challenges in bringing Psaume 130 to performance. This article provides solutions to some pragmatic score and performance challenges, and presents the discussion with a new presentation of Psaume 130’s analysis.1

This author approached the analysis under the assump-tion that Boulanger composed not only an aesthetically pleasing score, but also a purposeful compositional struc-ture. These assumptions proved to be true. Boulanger purposefully interrelates text, form, and tonality in order to convey structural continuity. In this article, the brief analysis is meant to (1) provide new research, which may help clarify previous research, and (2) help guide the conduc-tor through the macro-analysis, or large ideas, from which further detail may emerge.

In its present form, the score presents logistical chal-lenges for many conductors.2 The process toward a slightly reduced orchestral version of the score, previously pro-posed, is discussed in order to lead conductors to their own successful modifi cations of the work. Within such a modifi ed score, the conductor may afford more program-matic possibilities for Boulanger’s Psaume 130. To begin, a preliminary approach to the analysis, which offers a contex-tual discussion of the work’s size and scope, is addressed.

Infl uences on the Size and Scope of Psaume 130

In the liner notes to conductor Mark Stringer’s Timpani label recording,3 musicologist Harry Halbreich4 suggests that an earlier inspiration for Boulanger’s Psaume 130 was Florent Schmitt’s (1870-1958) Psaume 47.5 Rosenstiel’s biography confi rms Boulanger’s fascination and exposure to Schmitt’s work: “[Boulanger] was extremely excited by the premier [of Schmitt’s Psaume 47] in 1904…Lili followed every rehearsal with rapt attention.”6 Except for Schmitt’s choice of percussion (triangle, crash cymbals, and glocken-spiel), the scores resemble each other in instrumentation. Even an extended soprano solo appears in the middle of Schmitt’s work, as it does in Psaume 130. The overall, and likely initial, infl uence of Schmitt’s Psaume 47 on Boulanger is evident, resulting in similar characteristics between the two works: form, instrumentation, and choice of psalmodic text.

Moreover, Fauré’s infl uence on Psaume 130 is clear.


New Solutions for Psaume 130, Du fond de l' abîme

the trouble to look; but they surely exist.”10 Psaume 130 seems to unfold structurally within its own parameters. Cohrs, describes this unfolding as “organic.”11 Supporting this approach with another Boulanger composi-tion, musicologist, Bonnie Jo Dopp, in her article Numerology and Cryptography in the Music of Lili Boulanger: The Hidden Program in Clairières dans le ciel, demonstrates an organic structure based on the number thir-teen.12 These accounts and analyses suggest a unifi ed and logical structure to Boulanger’s compositional approach, and, more specifi -cally, Psaume 130.

There is little detailed analysis of Psaume 130 available for researchers. Boulanger’s main biographer, Léonie Rosenstiel, offers a general narrative about the piece, discuss-ing text, tonality, orchestration, and general

form.13 Cohrs adds a more detailed narrative in his analysis by labeling certain motives in the “organically” composed work and discussing Psaume 130 in the context of a possible non-liturgical requiem.14 Musicolo-gist Caroline Potter offers similar information but includes enlightening examples from Boulanger’s sketchbook.15 These narratives, however, lack a clear presentation about the analysis of Psaume 130 ’s formal structure.

Boulanger begins the work with a low, distorted orchestration that refl ects the depths or the abyss mentioned in the fi rst line of text: “Du fond de l’abime” [Out of the depths]. As with the murky orchestration and dense polyphony, the work’s architec-ture is non-standard and seems asymmetri-cal; however, Boulanger’s concept of organic structure becomes clear after comparing

her intersection of text and tonality with the large sections of Psaume 130.

Boulanger does not present the 130th psalm,16 also known in the Latin liturgy as De Profundis, in exact sequential order. She re-orders stanzas fi ve through seven and omits stanza six (“My soul longs for Yahweh”). In the middle of stanza seven, Boulanger inserts her own text “J’espère en toi, j’espère en ta parole” [I hope in you, I hope in your word] and “Je crie vers toi” [I cry to you]. Boulanger also adds Adonaï to the psalm’s existing name for God, Yahweh. She further inserts the exclamation “Ah”—a common trait in many of her choral works—toward the ends of large phrases.17 These and other examples demonstrate Boulanger’s penchant within Psaume 130 to insert portions of text from other stanzas. This style of inserting texts

311 Main St., Exeter, Ontario 116 - 255 West 1st St., North Vancouver B.C.

519 235-2000 • 1-800-265-7024 604 983-2470 • 1-866-983-2470

www.musictours-festivals.com

email: [email protected]

Est. 1980

reg. #2392471

Canada welcomes Adult and Youth Choirs to join us in celebration of the music & artistic influence of J.S. Bach

Concerts•Workshops•Masterclasses Gerald FaganArtistic Director

July 11-17, 2011Exeter, Ontario

www.bachmusicfestival.com


Table 1 Presentation of Text and Large Sections

Section I (“Thesis,” measures 1 through 59 – orchestral statement, “penitence”)

Section II (Measures 59 through 134 – fi rst choral statement, “penitence”)

“Du fond de l’abîme je t’invoque, Iahvé. Adonaï, ecoute ma prière! (Je crie vers toi.) Que tes oreilles soient attentives aux accents de ma prière!

Section III (“Development,” measures 134 through 189 – tempo and thematic variation, “penitence”)

“Si tu prends garde aux péchés, qui donc pourra tenir, Iahvé?

Section IV (“Contrast,” measures 190 through 379 – mezzo-soprano solo, “hope”)

“mais la clémence est en toi, afi n qu’on le révère. Mon âme espère en Iahvé; j’espère, je compte sur sa parole plus que les guetteurs de la nuit n’aspirent au matin. La clemence est en Iahvé. (J’espère en toi, j’espère en ta parole.) Car en Iahvé est la miséricorde et l’abondance de la délivrance.

Section V (“Conclusion and Juxtaposition of Sections I and IV,” measures 379 through 430 – overlap of “penitence” and “hope”)

“C’est lui qui délivrera Israël De toutes ses iniquités. Israël espère en la clémence de Iahvé.

From the depths of the abyss I call on you,Yahweh.Adonai, hear my prayer!(I cry to you.)May your ears be attentiveto the voice of my supplication!”

If you take into account your sins, Yahweh,who would be able to stand fast?”

But with you there is mercy, and so you areworshipped.My spirit hopes in Yahweh;I hope in and I count on his wordmore than the watchmen of the nightlong for the morning.There is mercy in Yahweh.(I hope in you, I hope in your word.)There is mercy in Yahweh,and abundant deliverance.”

It is he who will deliver IsraelFrom all its iniquities.Israel, trust in the mercy of Yahweh.”20

from other stanzas, similarly found in Berlioz’s Requiem, emphasizes the meaning of the text by re-ordering it for musical and dramatic purposes. Additionally, Boulanger accentuates the meaning from the opening lines of the psalm with a re-ordered text setting. Her local approach of re-ordering and recycling text does not alter her broad and successive presentation of the stanzas.

For the purpose of this study, the work is organized into fi ve sections. Table 1 contains an outline of the fi ve sections of Psaume 130, and the general order of the text (using Gordan Paine’s translation18) within each section19 (Table 1).

Section I is an orchestral ritornello and presents the essential motivic elements of the piece. Section II contains the fi rst choral statements of the work. In Section III, Boulanger develops the themes from Sections I and II through fragmentation, augmentation, transformation, and modulation. In Section IV, due to the change of text, Boulanger introduces new modes, new textures and a mezzo-soprano soloist. Section V is a summary of Sections I– III and Section IV, and affects of both hope and penitence are overlapped. Here, Boulanger accordingly overlaps previous motives relating to these affects.

Within this overall presentation of text, Boulanger forms a musical presentation in fi ve sections that coalesces with the two affects of penitence and hope. In sections I through III (189 measures), the text refl ects a penitential mood. To coun-terbalance, Section IV, also 189 measures, contrasts with a hopeful mood. Section V contains the last, short stanza, which Boulanger identifi es as a summary of the previous affects in the psalm (“It is he who will deliver Israel from all its iniquities. Israel, trust in the mercy of Yahweh”). Therefore, through musical means, she seems to present a psychological coexistence of penitential and hopeful affects (Figure 1).

Cohrs divides the work into thirteen sections.21 A brief mention of Boulanger’s



fi xation with the number thirteen exists in Rosenstiel’s biography, and is discussed at length in the aforementioned Dopp article.22

Dopp demonstrates Boulanger’s interest in the number thirteen with her analysis of the song cycle Clairières dans le ciel. Cohrs, without explaining his methodology as Dopp has, charts thirteen sections in Psaume 130.(Most subsections occur toward the end of the work.) Potentially, the analysis in this article and Cohrs’s may coexist; however, the evidence—an exact 189-measure balance of sections I-III and IV, which is closely linked to the text—suggests that a broader analysis better portrays Boulanger’s compositional plan.

Boulanger further conjoins text and form with her choice of harmonic language. Cohrs 23

and Potter24 defi ne the work in terms of modes. They concur that the Phrygian mode

is the predominant mode in the work. (The extended mezzo-soprano solo is one of these moments.) They are correct in terms of melody (horizontally); after analyzing the total pitch content in numerous pas-sages (vertically and horizontally), however, it seems clear that Boulanger frequently em-ploys octatonic sets as the harmonic and the melodic fabric of Psaume 130. For example, musical content in Figure 2 is built on an octatonic scale, which included the following pitches (and their enharmonic equivalents): F, G♭, A♭ A♮, B, C, D and E ♭.

Boulanger includes three types of smaller, scalar pitch collections in Psaume 130. She employs chromatic collections to intensify the mood and whole-tone collections to relax the tension. She frequently uses the octatonic scale, which serves as the median between the chromatic and whole-tone

collections and comprises equal parts of alternating major and minor seconds. In ad-dition to a cohesive structure between her overall form and text setting, Boulanger uses the octatonic scale to refl ect another layer of structural balance in Psaume 130: penitence (minor seconds) balanced with hope (major seconds). The way in which Boulanger allows these two affects to coexist in Section V25

(therefore balancing the form of the piece), suggests a similar coexistence of major and minor seconds within the octatonic scale.26

From this unifi ed, or “organic,” approach, deeper layers of structure, beyond the scope of this article, appear in Psaume 130.27

A New EditionWhen preparing a new edition that

reduces the orchestration, Boulanger’s compositional style greatly infl uences the process.28 In the original edition, Boulanger doubles instruments to create distinctive sounds. The English horn is often paired with other woodwind instruments, and the bass clarinet is often paired with the bassoon. In the new edition, because of the frequency of these doublings the “third” parts of the triple wind complement (piccolo, English horn, bass clarinet and contrabassoon) were maintained. These instruments also substitute for some of the eliminated brass instruments. Boulanger rarely uses the en-tire triple wind complement. Dropping the second part—second fl ute, second oboe, second clarinet and second bassoon—of the triple wind complement, loses little of the original orchestral color; in most cases, only the dynamic and size of the ensemble is lessened.

In the Durand edition, the horns either function as an independent group or sup-port the brass section. In a few cases, they double the woodwinds. In a reduced version, therefore, the horns may easily double in place of the removed brass parts. In several instances, they substitute for trombones in order to maintain the brass color. This sub-stitution only occurs when horns have a har-monic, rather than melodic, function. When horns are unavailable, bassoons substitute well for trombones.

Regarding orchestral reduction, decisions based upon Boulanger’s compositional ap-proach must be balanced with practical considerations. Priorities with regard to

Choral Conductors Workshopwith Rod Eichenberger

Workshop Locations Alexandria, Virginia Cannon Beach, Oregon July 19 – 23, 2010 August 2 – 6, 2010

For more information, contact:

George Fox University Performing Arts Department 503-554-2620 [email protected]

or visit choralconductorsworkshop.com

A five-day professionaldevelopment workshop

for choral conductorsat all levels



compositional considerations include main-taining orchestral colors and balance. Substi-tutions in the reduced edition are a practical consideration. The following general rules, in order of priority, should be applied to a reduction:

(1) Important motives are given aural priority.

(2) Boulanger’s orchestral style is retained as much as possible.

(3) Balance is achieved with careful rein-forcement based on Stringer’s insight. For example, the clarinet is used to reinforce a motive in the string sec-tion.29

(4) When re-voicing chords, families of like

instruments should be kept together as much as possible.

(5) If #4 is not possible, the instrument from an adjacent family should be se-lectively placed in the middle (rather than on the outside of a chord, where it would be more noticeable). For instance, in a four-part trombone chord, in which case, adding the bass clarinet was the only solution, the bass clarinet substituted for the third trombone in a portion of the bass clarinet’s range that could be easily blended. When a choral part needed to be reinforced—particularly in a low register—higher voice parts were added to the lower line.

Such a proposed edition would result in the

following instrumentation:

• 2 fl utes (the second player doubling piccolo)

• 2 oboes (the second player doubling English horn)

• 1 clarinet• 1 bass clarinet• 2 bassoons (the second player dou-

bling contrabassoon)• 2 horns• 2 trumpets• 2 trombones• 1 tuba• timpani• bass drum• tam-tam• celesta• organ• harp and strings

S H A W N E E P R E S S P R E S E N T S

Conductor, Educator, Speaker, Leader, Singer, Motivator, Writer, Guide, Friend, Parent & Funny Guy

THE MUSIC WITHIN Discovering the Joy – AGAIN! One Man’s Story, Everyone’s Journey 35027237 DVD $34.99

Visit www.halleonard.com/timseelig for a complete overview of choral resources by Tim Seelig.

TIM SEELIG’S QUICK FIXESPrescriptions for Every ChoralChallenge!35023658 Book $12.95

THE PERFECT CHORAL WORKBOOKEverything You Need to Organize Your Choral Program35022833 CD-ROM $34.95

THE PERFECT BLENDSeriously Fun Vocal Warm Ups35022829 Book $24.95

THE PERFECT REHEARSALEverything You Wanted to Know About Rehearsals!35022835 Book $24.99

ORDER TODAY! Please see any choral music retailer for these

and other fine Shawnee publications.

from Dr. Timothy Seelig


Table 2

Beethoven – Fantasia, Piano, Chorus, and Orchestra, op. 80 (Choral Fantasy), 19’ Mass, op. 86, C major, 43’Brahms – Alto Rhapsody, op. 53, 13’F.J. Haydn – Mass, no. 9, in C major, “Missa in tempore belli/Paukenmesse [Mass in a Time of War],” 45’ Mass, no. 12, B♭ major, Theresienmesse, 43’ Mass, no. 13, B♭ major, Schöpfungmesse, [Creation Mass], 46’ Mass, no. 14, B♭ major, Harmoniemesse, 48’Fauré – Pavane, op. 50 (optional chorus), 7’Finzi – In terra pax; Christmas Scene (large chorus, reduced orchestra version), 15’Honegger – Le roi David [King David], 74’Mendelssohn – Psalm 115, op. 31, Nicht unsern Namen, Herr [Not unto us, O Lord], 12’Mozart – Mass, K. 167, C major (Trinity), 31’Schubert – Mass(es) nos. 2, 3, and 4, 22–30’

Table 3

Beethoven – Christus am Ölberg (Christ on the Mount of Olives), 52’Brahms – Nänie, op. 82, 14’ Rinaldo, op. 50, 45’ Schicksalslied (Song of Destiny), op. 54, 18’Bruckner – Mass No. 1, D minor, 49’ Mass No. 3, F minor (Great), 60’ Missa solemnis, B-fl at major, 31’Cherubini – Requiem, C minor, 47’ Solemn Mass, G major, 50’Corigliano – Fern Hill (full orchestra), 18’F.J. Haydn – Die sieben letzten Worte, (The Seven Last Words), 60’ Mass, no. 11 in D minor, “Missa in angustiis (Nelsonmesse),” 42’ Stabat Mater, 80’ [Barenreiter edition includes larger wind compliment] Te Deum, for the Empress Maria Therese, 12’Fauré – Requiem, op. 48, 39’Finzi – In terra pax; Christmas Scene (large chorus version), 15’Frank – Psalm 150, 5’ Rédemption, 75’Handel – Israel in Egypt, 100’ Joshua, 105’ Judas Maccabaeus, 100’Hindemith – When Lilacs Last in the Door-Yard Bloom’d, 65’Mendelssohn – Christus, op. 97, 21’ Die erste Walpurgisnacht, op. 60, 35’ Lauda Sion, op. 73, 28’ Lobgesang, op. 52 (“Hymn of Praise” from Symphony no. 2), 27’/67’ Psalm 42, op. 42, “Wie de Hirsch schreit” [As Pants the Heart], 27’ Psalm 95, op. 46, “Kommt, last uns anbeten” [O Come Let Us Sing], 27’ Psalm 114, op. 51, “Da Israel aus Ägypten zog” [When Israel Came Out of Egypt], 15’Mozart – Mass(es), K. 257, 258, 262, 317, and 337 (all with same the orchestration), 17-30’ Mass, K. 427 (alternately Davidde penitente, derived from the mass with different text), 47’Rossini – Stabat Mater, 61’Schubert – Deutsche Messe, D. 872, 2nd version, 22’ Mass no. 1, 5 and 6, 43-58’ Stabat Mater, D. 383, F minor, 37’27

New Programming Options for the Choral ConductorA more accurate edition, and

with a rebalanced and reduced orchestration, alleviates budget is-sues and increases the possibility of performing Psaume 130 with a larger variety of choral/orchestral works. Shown in table 2 are works that have the same orchestration as Psaume 130 or slightly fewer wind/brass instruments.30

The works in Table 3 share a similar orchestration to Psaume 130 but require one to three more wind players.

ConclusionsCurrent analyses of Psaume

130 do not present the work as a balanced structure. This author, however, believes that such a plan exists. The main goal of the analysis above provides a point of departure for conductors as they prepare to perform the work. Furthermore, since Boulanger composed with such a well-conceived structure and purpose, and if she had heard the premier, she may have considered some or all of the suggested practi-cal revisions.

The new programming options, presented above for a slightly re-duced orchestration, may include Psaume 130 with a much larger gamut of choral/orchestral works. Whether Boulanger intended such a confi guration of her choral/orchestral works, conductors, us-ing the Durand edition of Psaume 130, may further consider Cohrs’s non-liturgical requiem format for a program, and additionally include Schmidt’s Psaume 47, as an infl uence on Boulanger’s Psaume 130, in this context.

The current edition of Lili Boulanger’s Psaume 130 incurred some light editing by her sister Nadia before the 1925 publication by Durand.32 In all likelihood, due to Nadia’s dedicated reverence for her sister’s works, she did not


New Solutions for Psaume 130, Du fone de l' abîme

attempt any major revisions or reductions to the score. On one hand, many musicians might agree with Nadia, that no one should consider the editing of another composer’s work; on the other hand, given that (1) the composer never heard the premier of the work, (2) other conductors have made changes in order to secure an orchestrically balanced performance, and (3) the staging of the work incurs diffi cult programming choices and a large budget, a new version of the work enables more frequent perfor-mances of Psaume 130.

NOTES

1 Lili Boulanger, Psaume 130 (Du fond de l’abîme), full score. (Paris: Durand, 1925).

2 John Perkins, “A Historical and Pragmatic Approach to Lili Boulanger’s Psaume 130, Du fond de l’abîme.” Choral Journal (May, 2010).

3 Mark Stringer, Lili Boulanger, Choral and Orchestral Works, Sonia de Beaufort, soprano, Martial Defontaine, tenor, Vincent le Texier, baritone, Choeur Symphonique de Namûr, Orchestre Philharmonique du Luxembourg, cond. Mark Stringer, Timpani 1 C1046, compact disc.

4 Harry Halbreich (1999), “The Wind Bloweth Where it L isteth,” in Li l i Boulanger Orchestral and Choral Works [CD booklet]. Luxembourg: Timpani Records.

5 Florent Schmitt, Psaume XLVII pour Orchestre, Orgue, Choeurs et Solo (Paris: Salabert, 1922).

6 Léonie Rosenstiel, The Life and Works of Lili Bou-langer (Cranbury, New Jersey: Associated University Presses, 1978), 43.

7 Benjamin-Gunnar Cohrs. “Die fünf grossen Chorwerke Lili Boulangers,” in Lili-Boulanger-Tage, 1993, Bremen: Zum 100. Geburtstag der Komponistin: Konzerte und Veranstaltungen (Zeichen und Spüren, 1993) 19 vol. 22: 93–113.

8 Caroline Potter. Nadia and Lili Boulanger (Aldershot, UK: Ashgate, 2006), 101–02.

9 Bruno Monsaingeon, Mademoiselle: Conversations with Nadia Boulanger (Manchester, England: Carcanet Press, 1985), 80–81.

10 Alan Kindall, The Tender Tyrant: Nadia Boulanger, a Life Devoted to Music (Wilton, Conn.: Lyceum, 1976), 113.

11 Cohrs, 106.12 Bonnie Jo Dopp, “Numerology and Crypto-

graphy in the Music of Lili Boulanger: The Hidden Program in ‘Clairières dans le ciel.’” The Musical Quarterly 78, no. 3 (Fall 1994): 556–83.

13 Rosenstiel, 191–97.14 Benjamin-Gunnar Cohrs. “Zur vegetativen

Einheit der fünf letzten grossen Chorwerke Lili Boulangers,” in Lili-Boulanger-Tage, 1993, Bremen: Zum 100. Geburtstag der Komponistin: Konzerte und Veranstaltungen (Zeichen und Spüren, 1993) 19 vol. 22: 106.

15 Potter, 97–102.16 The psalm is numbered 129 in the Vulgate and

regarded as one of the seven Penitential Psalms.

17 This trend, existing in many of Lili’s compositions,

was also an early twentieth century trend, exhibited in the works of Debussy and Fauré.

18 Gordon Paine. Translations and Annotations of Choral Repertoire, Volume III: French and Italian Texts (Covallis, OR: Earthsongs, 2007), 14.

19 Due to Boulanger’s tendency to excerpt text from other sections, the actual word-for-word order of the text does not appear below.

20 The text, not including analysis, above this note is quoted from Paine, 13. The quotation marks refer to Paine.

21 Cohrs. “Die fünf grossen Chorwerke Lili Boulangers,” 103–05.

22 Dopp, 556– 83, cited in Rosenstiel, Léonie, The Life and Works of Lili Boulanger (Madison, N.J: Farleight Dickinson University Press, 1978).

23 Cohrs. “Zur vegetativen Einheit der fünf letzten grossen Chorwerke Lili Boulangers,” 106–08.

24 Potter, 101–02.25 Boulanger’s choices of text, leading to the form

and harmony, were likely autobiographical.26 A detailed analysis of the work can be found

in the dissertation of John Douglas Perkins titled “An Analysis and Orchestral Reduction of Psaume 130, Du fond de l’abîme, by Lili Boulanger.”

27 John Perkins, “An Analysis and Orchestral Reduction of Psaume 130, Du fond de l’abîme, by Lili Boulanger” (DMA document, University of Arizona, 2009).

28 A reduced version containing these solutions is found in Appendix E of Perkins’ document.

29 John Perkins, “A Historical and Pragmatic Approach to Lili Boulanger’s Psaume 130, Du fond de l’abîme.” Choral Journal (May, 2010).

30 There are plenty of Bach cantatas with less orchestral complement than Psaume 130, but they are not listed since these works would likely be a strange programming choice. The interesting exception is Bach’s setting of Psalm 130, Cantata 131 (Aus der Tiefen rufe ich, Herr zu dir).

31 David Daniels, Orchestral Music, a Handbook, Fourth Edition (Oxford, UK: Scarecrow Press, Inc., 2005).

32 This author found that, upon examining the original manuscript, Nadia had added some expression and articulation marks to the score which were refl ected in the published version. This is likely due to the fact that besides the work’s premier, by Markevitch, Nadia owned the score and likely conducted from it in performances.

800-300-8841 212-580-0760 www.concept-tours.com [email protected]

Connect to the Worldin the

Great VenuesWe do the detailed preparation overseas

More than just another tour in a new placeSpecial collaborations, Socialize with peersWork with your budget to give good value

Concept ToursA bridge to the world


Encore! Advocating for the Arts in EducationTerre Johnson

Terre Johnson is Minister of Music for Vestavia Hills Baptist Church in Birmingham, Alabama and the National R&S chair for Music & Worship.


ACDA has taken a strong stand as an advocate for the arts in education. In this interview, the author interviews Terry Taylor, who was Minister of Music at the First Baptist Church of Dothan, Alabama from 2000 to 2008, and became a leading arts advocate in that community. He is now Minister of Music at the Shades Crest Baptist Church in Birmingham, Alabama. Terry describes an “Encore” program he initiated in the public schools of Dothan, through which he and many other volunteers from throughout the community provided singing opportunities for children in elementary schools where no music education was taking place. Consequently, those efforts led to the hiring of music educators for the elementary schools, the development of middle school choral music, and an arts program for the entire school system.

Johnson Describe your background, and how you became inter-ested in music education.

Taylor I went to Belmont College in Nashville, where I had music education courses, and Southern Seminary in Louisville, Kentucky, where I studied with Michael Hawn, a music education professor. I began to understand the dramatic impact that music has on children, particularly at younger ages, and the way it changes their brain and their lives for a lifetime. I began to spend more time and interest in this area.

Johnson How did your interests in childhood development and learning styles lead you to your concern for the elementary children in Dothan, Alabama?

Taylor Over the years, I’ve been involved in writing curriculum materials for children’s choirs in churches. When I arrived in Do-than and realized we had ten elementary schools and none of the students were receiving music education, I began to look for opportunities I might have to make a musical impact. Through a relationship I developed with an administrator, I received an invita-tion to go to one elementary school and volunteer to teach choral music and introduce fi fth-grade children to playing recorders. For three years, I went every week and taught in three classrooms.

It was interesting to see the impact the musical experiences had on these children. Teachers would point out children who would stand at the window waiting for my car, because they couldn’t wait for music class. The affect it had on student motiva-tion and engagement was signifi cant. And, seeing the joy they had as they learned and shared their music, made it a transformative experience for me.

One of the recorder songs we learned was Ode to Joy So I thought it would be interesting to bring a recording of Beethoven’s Ninth Symphony, and a poster of Beethoven. I was sharing with them a description of Beethoven, his peculiar personality and his wild, bushy hair. They didn’t really know what to think of him, and most of them thought he was funny. But I realized that they had never heard of him. To them, Beethoven was a dog in a children’s movie. It was an epiphany for me to realize that my teaching was the fi rst exposure to classical music for these fi fth graders. We want our children to be contributors and participants in the arts in the community, but in this case, they were given no background or foundation to enable them to do so.

Another motivativation for me to teach these children to sing was the fact that their musical/artistic infl uences came from a “pop

style” of singing. Very likely, they would never develop a head-tone, where they could have a beautiful expansive range. They would just stay in a limited chest voice tessitura. Of course, some experts say that 17–20 percent of the children will never discover their singing voice or match pitch without some instruction. We know that children who haven’t tapped into that singing style by third grade are more likely to have a limited range, and sing inaccurately throughout their life. So we have a limited window of time in which to impact the musical experience of children in the lower grades. I realized that we had 4,000 students in our elementary schools who were receiving no music instruction. That fact alone was a motivational force to fi nd some strategy or initiative to bring music to these students. There had been music educators in the past, but they had been cut in budget proration, and were a distant memory.

Johnson What is the “Encore” program? How did it begin, how did you raise the needed resources, and how did you get it acti-vated in the school system?

Taylor I was driven by the need for music education experi-ences for these students, and by a certain level of fatigue, after three years of volunteering, while being so busy in my work at the church. I was leaving the school one day thinking about how much the students received from their encounter with music. The teachers were telling me how, on music day, they had a different class, and how the whole atmosphere was different. Consequently, I was asking myself how I might multiply my efforts. I had asked others to help in the past, but they didn’t feel adequately prepared or have the appropriate musical resources.

The idea came to develop a songbook, with 27 songs, orga-nized thematically to accommodate the school year. We incorpo-rated simple teaching plans, including purposeful body movement, emphasizing the macro beat and matching the form of the song. Also, we included a CD for the purpose of playing a performance of the song under instruction, while the children moved, and as a means of providing accompaniment. This resource was fairly foolproof. We felt that any volunteer could teach in this manner. I had a radio spot to enlist volunteers that said, “If you have a little time in your schedule, a little music in your background, and a desire to make a big difference in the life of a child, you can be an Encore volunteer.” If someone could keep a steady beat and match pitch, they didn’t require special music education training to use the resources and guide the children through these musi-cal experiences.

I was fortunate to have a music educator in our system’s one magnet school named Kim Price, who collaborated with me to develop the songbook. We had a professional organizer in our church choir named Debbie Yurevich, who agreed to coordinate the assignment of volunteers and to organize the program ad-ministratively. I was then free to give creative guidance and work on promoting the Encore program.

We were joined by Dothan’s Cultural Arts Center, who gave great support and funded the program. My three years of volun-teering gave us credibility with the schools. They were assured that I didn’t have any motives other than giving the children a musical experience, and advocating for music education in all the schools. When we asked for an audience with the school administrators, the principal, at whose school I had volunteered, was able to


Advocating for the Arts in EducationEncore!

stand and give a recommendation that was followed by the others.

Once the administration, board of edu-cation, and Cultural Arts Center agreed to the program, we started to solicit volun-teers. We felt that any interested person could use the established resources and go into a classroom and give the children a singing experience. My colleagues at area churches pitched the idea to their choirs, and we received a lot of volunteers from the church choirs in the area. We also talked to civic clubs, and promoted Encore on the radio, in the newspaper, and on tele-vision. We had an organizational meeting at which we needed to perform background checks and give orientation and training, even though we didn’t know who would come. One hundred and forty-four vol-unteers appeared that day. Obviously, that number overwhelmed us. We discovered that our community had a lot of people who shared my passion for providing music to the students in our schools.

When the volunteers were trained and assigned to the schools, some of the city’s more artistic people went into the schools every week, and they were experiencing what I had been experiencing.

These students loved music. It changed the way they thought and felt about school and academics, and the way in which they related to their parents. The schools, on the other hand, discovered that a Parent Teach-ers’ Organization meeting that had received low participation before was suddenly full because the fourth grade Encore students were singing.

On those occasions, the principal would talk about academic successes at the school, and how music was seen as increasing the connection between the school and the parents, which, of course, is central to the success of the student. Music was creating that opportunity. All of a sudden, we had a much broader base of advocacy for music in the schools.

At the end of the academic year, we

would have an all-city concert, at which students in grades two through fi ve would sing their favorite Encore songs. Students would come in their school tee-shirts, and hundreds of parents and grandparents would come, frequently crying tears of joy after hearing their child sing for the fi rst time. It was an overwhelming experience, seeing that many children singing together.

At the end of the second concert, the su-perintendent stood and announced, “Ladies and gentlemen, we have funded hiring music teachers for all our elementary schools.” As music education advocates, it was the mo-ment for which we had been waiting.

Johnson After such a positive outcome from the Encore program, how did you channel your efforts and the interests of the volunteers of the community?

Taylor After the new elementary music teachers were hired, we began advo-cating for a new program called “Arts

www.singamilehigh.orgFor a free Sing A Mile High DVD, call Chrys Harris at 303-797-SING (-7464) or email [email protected]. Choirs accepted before July 1, 2010 will receive one free place for every 25 participants.

Sing A Mile High Children’s Choral Festival

Dr. Catherine SailerConducting Master Class

Yvonne FarrowChoralographer

Sing A Mile High

Denver, Colorado June 23 - 27, 2011

Dr. Rollo Dilworth Guest Conductor

• 5-days/4-nights for Treble Choirs ~ 5th-12th grade• Massed choir rehearsals and concert with Dr. Rollo Dilworth • Choralography with Yvonne Farrow of Got Choralography?• Conducting master class for directors with Dr. Catherine Sailer • ALL lodging, food, activities and social events included• Individual choir performances at the massed choir concert• Optional additional days/nights/performances

Jena DickeyResident Conductor


Integration”—a school reform model promoted by the Alabama Council on the Arts. It integrates more arts into the core curriculum of the school, which, in this instance, necessitated the hiring of several more music teachers.

We had four middle schools in Dothan without choral music. Now that we have music teachers in our elementary schools, I have turned my focus on advocating for the re-development of choruses in these schools. I have contacted several other min-isters of music, and we are volunteering to direct after-school choruses at these schools.

In the school where I was assigned, we were asked to meet in the band room. Dur-ing the last period, I was working to set up for rehearsal. Sixty-three students had been auditioned, so we needed more chairs. I was opening doors looking for chairs, and found a room with levels, and realized that it looked like a choir room. But, it had desks about eight feet apart on each level, which led me to asked a teacher friend what the choir room was being used for. She replied that the room was used for in-school sus-pension. I thought it was fascinating and ironic that this room that had been originally designed for creativity and artistry was used for punishment, especially given that artistic and creative students are far less likely to behave in a way that requires punishment.

I received permission to have the desks moved, and to use the choir room for its original purpose. For the fi rst time in many years, students could be heard singing in the choir room. The students responded unbe-lievably to the opportunity.

Another bit of irony was that there are two high schools in Dothan, both of which have choral directors. With no middle school programs, except for our volunteer efforts, and until recently, no elementary school singing experiences, these high school direc-tors received students with no knowledge base on which to build a choral program, or motivation to be involved in choral singing.

There is a direct link between children hav-ing singing experiences when they are young and in middle school, and having an exciting, vibrant high school choral program.

These middle school students didn’t know what a chorus was. So I went to a friend who taught middle school chorus in a nearby town, and asked to borrow her DVD from a recent concert. I showed it to the students, and let them see what a chorus looks like, how they stand, how they watch the director, and how they sing expressively. It was an interesting and tremendously re-warding experience.

Johnson How were the songbook resourc-es used by the volunteers in the “Encore” program? What were the criteria for the selection of the songs? Describe to what extent the CD provided an accompaniment for teaching the songs in the songbooks for volunteers with limited teaching experience

to succeed.

Taylor Without the resources, our volun-teers would have been overwhelmed. I was a volunteer myself, and it was interesting to arrive and see another volunteer coming out with a notebook and CD player, smiling because their class had been successful.

The challenge we faced was fi nding something affordable. We saw some very exciting resources, but they were cost-prohibitive, at a price of several dollars per child. Consequently, we drew on songs from “Music K–8” from Plank Road Publishing (www.musick8.com), that are used by many teachers as supplementary materials. Now that we have music teachers, we have fully accredited music education textbook re-sources. That is obviously the ideal. But to get started with our volunteers, we took songs that are used as supplementary materials by established music teachers, and made

Children at an elementary school singing in the Encore program


Advocating for the Arts in EducationEncore! them our core material. It was a little like giving the kids all dessert. The reason for this resource decision was that each school could subscribe, for pennies per child, and get the resources we needed. “Music K–8” also posts hundreds of songs online, and we were able to listen to them and glean our favorites to use in our resource material. This approach would not be the ideal one for the long term, but we needed it to capture the imagination of the students, teachers, and administrators.

Some of the songs had an undeniable pop quality, and the voices on the recordings exhibited some chest voice, but we encour-aged and trained our volunteers to get the students to sing using their head voice. We realized that there would be a “shelf-life” expectancy for volunteers, and we needed resources that would not add to the stress of their involvement, and be immediately useable.

In answer to the last part of your ques-tion, we took the selected songs, and made a CD for the volunteers, which included one with a performance of the song, and one with the accompaniment.

Johnson How did the investment of the Cultural Arts Center impact the activities of Encore?

Taylor Their contribution was huge. It was an enormous step of faith on their part. I just went and knocked on their door with my idea. By the time it was over, I was on their executive board. They paid for all the print-ing to duplicate 4,000 student books that include words and music, and notebooks for the volunteers. We also provided notebooks for the classroom teachers, so that if a volun-teer couldn’t come, the teacher could carry on without them. The Cultural Arts Center also paid for the CD duplication.

Johnson As you described your middle school volunteerism, I am realizing that the students in your middle school chorus must have been the children who were learning to sing in the Encore program. Talk about the continuum of music learning that has been created for these students through these volunteer efforts.

Taylor It’s an exciting thing to see a child who has no music or artistic expression in their background having these experiences, and having their “artistic light” awakened. I think once that light comes on, it stays on. Once a child learns to be expressive it not only affects them, but also changes their teacher in the process.

One year, I was the fourth grade Encore volunteer, and then I was assigned to the fi fth grade the next year, and the middle school effort started the next. So, after three years, these students came to know me as


their music teacher, despite the fact I was a volunteer. I, on the other hand, was able to see these children developing and growing through these years. We observed them developing the ability to create art, and to do it with increasing excellence. I think they intuitively know when what they are being taught is watered down. There is something about creating art at a higher level that en-gages and challenges them, and motivates them to participate.

Johnson You mentioned that your advocacy had led to this educational reform effort called “Arts Integration.” Where did you discover that program, and how did you infl uence local educators to not only con-sider it, but also have them understand the importance in the Dothan schools?

Taylor It was interesting that some people said, “You shouldn’t be volunteering, because you are rewarding poor choices on the part of the school system. If you provide volun-teers in music, they will never hire music educators.” I understand the validity in that argument, but at the same time, you have class after class going through school with no music, during critical times in their learn-ing process, while they wait for the school system to hire the needed teachers.

So while we provided the volunteer effort, we realized that there had to be a strong advocacy effort for what we were doing. As I was researching for this advo-cacy, a book was recommended to me by Diana Green of the Alabama Council on the Arts, called Third Space: When Learning Matters, from Arts Education Partnership. It described programs in which the arts are placed at the core of the curriculum of under-performing schools.

They are integrated into all subject mat-ter in every subject area. The Alabama Coun-cil on the Arts is fi nding that the arts are the way for students to exhibit higher-order thinking, and the escalation of student en-gagement. The Council is not just interested in teaching to “fi ll-in-the-blank answers,” but is more interested in the students learning to be critical, problem-solving thinkers. Schools that have begun this program are seeing the academic performance of their students ex-ponentially improving, which gets everyone’s attention. Schools in low-income areas that have adopted this program are out-perform-

ing schools in higher-income areas.I was speaking to an administrator in

Oklahoma who had implemented this pro-gram, and I asked how many arts teachers they had. She replied, “Everyone is an arts teacher.” They still have arts educators and those programs go on in a richer way, and the classroom teacher utilizes those people in a consulting role. The most dramatic change comes in student motivation and engagement. The school is no longer a place you have to attend, but a community to which you belong, where students get up in the morning eager to go. It has a great impact on the community. These arts-integrated schools keep databases of local artists, who regularly contribute to the school’s artistic life. Schools have waiting lists of teacher applicants, because they know they will be creatively engaging highly motivated learners.

I was able to present this initiative to music teachers, and then take teachers and administrators on a fi eld trip to a success-ful program in Mississippi. Now, two of our lowest-performing schools have become arts-integrated schools. They will become models for the rest of the schools in the sys-tem. Our goal is for each school to become arts-integrated, with a full complement of arts educators.

Johnson In addition to your role as minister of music at the First Baptist Church of Do-than, you have gone from being a volunteer in the elementary schools to soliciting a large corps of volunteers, to directing a middle school chorus, and to advocating system-wide change and enhancement in the arts. Summarize the magic that infl uenced and created the Encore program.

Taylor All these efforts involved a team of people from the community, and my church was very supportive. Twenty-one of the Encore volunteers came from my church. Many volunteers came from the other church choirs in the area. In addition, the two choirs from the high schools volunteered, so that we had high school students teaching music to elementary students and serving as mentors to them. Hopefully, some of those high school students will go on to become music teachers as a result of that experience. My point is that all of these things have been characterized by teamwork and community effort.


Henry Leck is an associate professor and director of choral ac-

tivities at Butler University in Indianapolis, Indiana. In 1986, he became

founder and artistic director of the Indianapolis Children’s Choir (ICC).

The Touring Choirs of the Indianapolis Children’s Choir have performed

regularly for National ACDA, MENC, OAKE, and AOSA Conferences.

Additionally, ICC tours internationally every year, having sung in con-

cert sites throughout Great Britain, Greece, Scandinavia, Europe, South

America, North America, Mexico, Guatemala, Australia, New Zealand, and China. In 2004, the Tour-

ing Choir performed in the Czech Republic and Russia, recording live with the Moscow Chamber

Orchestra in the Pavel Slobodkin Center for Music.

Leck is a frequent conductor of regional and national honor choirs, including ACDA

Southern, Southwest, North Central, Central, and Northwest Division honors choirs. In the spring

of 2003, he conducted the ACDA National Junior High/Middle School Honor Choir in New York

City and on three occasions has conducted national honor choirs for OAKE.

He has conducted international festivals including the Musica Mundi Tuscany Children’s Choir

Festival in Italy, the International Children’s Choir Festival in Beijing, China; the International Chil-

dren’s Choral Festival in Canterbury, England; and the Vienna Children’s & Boys Choir Festival with

the Vienna Sangerknaben. He conducts the Curso Internacional de Regencia Coral in Brazil, where

he founded the ARCI Sao Paulo Children’s Honor Choir. He is the Artistic Director of the Pacifi c

Rim Festival in Hawaii. He recently conducted the Tokyo International High School Honor Choir in

Japan, the International Festival of the Americas and the Festival Internacional de Coro de Ninos

en Mexico. For sixteen years, he has conducted the National Youth Choral Festival in Carnegie Hall.

Leck is widely known as a specialist in choral techniques, the child’s voice, Dalcroze Eu-

rhythmics, and the boy’s changing voice. He has produced three teaching videos titled Vocal Tech-

niques for the Young Singer, The Boy’s Expanding Voice: Take the High Road and Creating Artistry through

Movement, Dalcroze Eurhythmics.

Children's Honor Choir instructions are available on the ACDA Web site at www.acda.org/conferences.

Children's Honor Choir Conductor


<Nancy Cox, editor <[email protected]>

Women's Choirs

Debra Spurgeon, National ChairUniversity of Mississippi

Mixing it Up: Voicing and Seating a Women’s Choir

by

Sandra Peter

Here are some ideas to consider in voicing and seating a women’s choir. With a choir full of similar instruments, one must work hard to foster an atmosphere of openness and fl exibility. These are important attributes of any conductor, and we have an opportunity in the choral setting to embrace them. Labels and the inappropriate use of terminology can hinder the creative work a conductor is able to do through the voicing and seating process.

Terminology

Voice Classifi cation: the process by which a singer’s voice type is determined

Female Voice Types: soprano, mezzo so-prano, and contralto

Fach: A sophisticated system used to identify operatic roles a singer is well-suited for. A dozen specifi c categories are used to label females.

Choral Voicing: the process by which a singer is assigned a choral part, or parts

Female Choral Parts: SI, SII, AI, AII

For middle school and high school level females, their instruments are just beginning to develop. The instruction they are receiv-ing, coupled with their maturity to digest it, is at its earliest stages. For college-age females, taking applied voice as an academic course is probably a new experience and the intensity of that work can result in rapid growth. Recognize that the labels that appear in choral music (SI, SII, AI, AII) need not and should not apply to fach. Singers settle into a fach when they have years of training and experience under their belts. The assigning of choral parts may not even correlate with voice type. It is not uncommon for a woman to sing soprano repertoire, for example, with her voice teacher, but manage to comfort-ably sing any part in a choral setting.

Voicing a choir has a great deal to do with language: how we speak to singers about their own instruments, about issues of range, tessitura, color, timbre, and our own opinions about all of the above. For example, to say to a young singer “You are an alto” contrasts greatly with the statement, “It sounds like you

would be comfortable singing the alto parts in choir,” or, “Please sing alto this semester.” Singing an alto choral part has more to do with a singer’s vocal clarity over the break, than it has to do with her (sometimes im-plied) inability to sing in a higher tessitura. For some conductors, it may also have to do with a singer’s ability to read music and sustain harmony. All singers contribute, and all vocal parts within a score need to be sung by capable musicians. You are creating a com-munity, and all of its members have personal and vocal value.

Voicing In order to voice singers, have them sing

the melody of a folk song or hymn. The range of the tune should span an octave and en-able the singer to blossom at the top of her range. To reveal the freedom necessary for soprano I, try the keys of F or G♭ major. To hear them in the tessitura for soprano II, use the key of E♭ major. To hear if they can sing clearly and comfortably over the break (therefore, possible alto I singers), try the key of D♭ major. Lastly, to hear them sing below

Sandra Peter teaches at Luther College, Decorah, IA

Mexico International Children’s Chorus FestivalJune 27 - July 3, 2011

Join Henry Leck and otherchildren’s choirs for amusically and culturallyrewarding festivalexperience in San Miguelde Allende, a UNESCO

World Heritage Site. Located in the mountains of central Mexico, San Miguel deAllende is a safe, cosmopolitan city with picturesque cobblestone streets and world-famous mild climate. Contact Musica Mundi for details:

Henry Leck, Artistic Director

"Musica Mundi's festivals are phenomenal inall aspects."

Henry Leck,Founder and Director, Indianapolis Children's Choir

www.mexicomusicfestival.comwww.musicamundi.com / [email protected]

1 800 947 1991


the break and detect if sound is freely pro-duced and not pushed purely by chest voice, (therefore, potential Alto II candidates), use the key of B♭ major. Once you have four sections to work with, do short vocalises with your SI and AII sections to explore the extremes of those ranges. Know which SI singers have complete freedom to sing a high A or beyond, and know which AII singers have a free, low F and below.

Seating the Ensemble Table 1 shows the seating chart used

with Aurora, the author’s fi rst-year college women’s ensemble. This arrangement is also appropriate for high school festivals. In a clinic situation, if a choir is in an SSA column

formation, one can either move singers into this formation, or suggest that the conductor try it when time permits. The seating chart in Table 1 accomodates

SA, SSA, and SSAA music, plus any further divisi in the score, in the following ways:

• SA repertoire: rows 3–4 sing soprano and rows 1–2 sing alto;

• SSA repertoire: keep the same number of singers assigned to SI. Rows 3–4 SII stay on SII and are joined by the SII half of row 2. All Alto II and the AI half of Row 1 sing alto; and

• SSAA repertoire : SI = half of rows 3–4. SII = half of rows 3–4. AI = half of rows 1–2 . AII = half of rows 1–2.

Seating Person-To-Person Simple fi ve-note vocalises can be used to

arrange individual singers within sections. Have two women sing at a time, then the next two, etc. Each woman, then, will sing twice, once with the women on either side. You will fi nd pairs that sound natural together and those that do not. Experiment and move singers around until a row has an even, natural sound. Try the following phrases, vowels, and keys listed in Table 2.

Block formation (Table 1) can be most useful when learning repertoire. Once the music is mastered, however, the choir may be mixed. This is commonly done with SATB choirs and it can also be a helpful strategy with women’s choirs. First of all, singers love it, as is evident by their gleeful responses. In mixed formation, the singers report the following: they can hear all the parts, are more independent, accountable, try harder, and meet somebody new. After mixing up, singing a familiar piece, and then discussing, the singers know the piece has been transformed. They want to react. They quickly jump from what just happened in rehearsal to the openess and fl exibility the process emulates.

In a choral community, we hope people contribute, listen, and recognize how each person is unique; they know each other’s value. By simply changing the position in which you are standing in a choir, it is pos-

Row 4: SI (those with the highest range) SIIRow 3: SI SIIRow 2: AII (those with the lowest range) SII (on SSA)/AI (on SSAA)Row 1: AII AI

Table 1 Seating Chart


C. Andrew Blosser serves on the voice faculties of The Ohio State University and Capital University.

SIDo-re-mi-fa-sol-mi-do (Keys of B♭, B, C, D♭, maybe D)[zi-------------a---------] OR [za-----------------------]

SIIDo-re-mi-fa-sol-mi-do ( Keys of G, A♭, A, B♭)[zi-------------a---------] OR [za-----------------------]

AI Do-re-mi-fa-sol-mi-do (Key of D♭)[zi-------------a---------] OR Sol-sol-fa-mi-re-do ( Keys of D♭, C, B, B♭, A)

[zi---a---------------]

AII Sol-sol-fa-mi-re-do ( Keys of A, A♭, G, G ♭)[zi---a---------------]

Table 2 Phrases, Vowels, and Keysindividual basis. Often students will approach their teachers asking for assistance in selecting repertoire for college auditions and solo contests. For some directors, selecting appropri-ate solos can be a daunting task. Choral directors have the responsibility as voice special-ists to explore the issue of appropriate repertoire in order to better serve their students. Although many students par-ticipate in private voice instruc-tion, the choral music educator is ultimately responsible for their vocal health.

It is impor tant for any voice specialist to continue expanding their knowledge of solo repertoire by attending workshops, master classes, and

conferences. Instructors holding positions on college faculties have the opportunity to participate in symposia and other mas-ter classes in which renowned artists give feedback to singers. Participation in these types of activities is important for any voice instructor’s development. Educators not teaching in higher education should search for similar experiences. Some school districts allow for private vocal instructors to work with students during study halls, after school, etc. It can be benefi cial for all students to

observe a master class or recital involving their peers. This instruction not only enables students and teachers to hear how con-cepts and skills are addressed in a particular singer, but also can offer exposure to new repertoire.

When working with young singers, it is important to select literature that empha-sizes specifi c concepts and skills required for advanced singing, including: breath manage-ment, tone production and legato singing, evenness of registers and vowel modifi cation. Students should also have a general mastery of English, Italian, French, and German diction, and it is the teacher’s responsibility to see that these areas are addressed. It should be noted that an audition is an opportunity for singers to display their capabilities; therefore, the selections should "showcase" the singer’s strengths. When selecting repertoire, it is important to remember that voice facul-ties are not expecting a perfect instrument. They are more interested in the singer’s potential rather than if he/she has mastered a Puccini aria.

The table on the next two pages lists examples of repertoire for each voice clas-sifi cation, ranging from the young to interme-diate singer. Each piece emphasizes one or more of the previously stated basic concepts and skills. Since each singer is unique, certain selections will be more advanced, while oth-ers will be very basic.

sible to see (or hear) things differently and intellectual, emotional, and musical transfor-mation can occur.

Senior High ChoirsAmy Blosser, National ChairBexley High School<[email protected]>

The Choral Director as Voice Teacher: Suggestions for Selecting Solo

Repertoire for Singers

by

C. Andrew Blosser

Choral directors have many responsi-bilities that are an integral part of their daily tasks, including working with singers on an

Crescent City Choral FestivalA FESTIVAL FOR TREBLE AND MIXED CHOIRS

JUNE 17-21, 2011Cheryl Dupont, Artistic Director Bob Chilcott, Guest Artist

• Open to all treble and mixed choirs representing school, church, and community by audition• Accepting applications now• Performance in St. Louis Cathedral hotel near the French Quarter

You’ll fall in love with New Orleans all over again.

sponsored by the New Orleans Children’s Chorus

Announcing NEW

SATB track

For more information:New Orleans Children’s Chorus5306 Canal Blvd. New Orleans, LA 70124 (504) 482-2883 / (504) [email protected]


Voice Book or Title of Piece/Composer Class. Collection Pedagogical Value

The Vagabond Ralph Vaughan Williams

Bright is the Ring of WordsRalph Vaughan Williams

Vittoria mio coreGian Giacomo Carissimi

Come Away DeathRoger Quilter

There is a LadyeWinifred Bury

Plaisir d’amourJean Paul Martini

"For the Mountains Shall Depart" from ElijahFelix Mendelssohn

"Non siate ritrosi"from Così fan tutteWolfgang Amadeus Mozart

Die beiden GrenediereRobert Schumann

Vergin tutto amorFrancesco Durante

Flow My TearsJohn Dowland

Wie MelodienJohannes Brahms

Silent NoonRalph Vaughan Williams

O del mio amato benStefano Donaudy

Che faro senza il Euridicefrom Orfeo ed EuridiceChristoph Willibald Gluck

"O Rest in the Lord"from ElijahFelix Mendelssohn

Du Ring an meinem FingerRobert Schumann

Voi che sapetefrom La Nozze di FigaroWolfgang Amadeus Mozart

ZueignungRichard Strauss

Bass/Bar

Bass/Bar

Bass/Bar

Bass/Bar

Bass/Bar

Bass/Bar

Baritone

Baritone

Bass/Bar.

Mez-Sop

Mez-Sop

Mez-Sop

Mez-Sop

Mez-Sop

Mez-Sop

Mez-Sop

Mez-Sop

Mez-Sop

Mez-Sop

Songs of Travel (low voice)

Songs of Travel (low voice)

24 Italian Arias and Songs(Med. Low)

Standard Vocal Lit. (Bass) or Standard Vocal Lit. (Bar.)

single copy


Standard Vocal Lit. (Bar.)

Standard Vocal Lit. (Bar.)


24 Italian Arias and Songs(Med. Low)

Standard Vocal Lit.(Mez-Sop)

Fifty Select Songs:Brahms, Schubert, Schumann, and Wolf (Low Voice)

The Young Singer (Mez-Sop)

Standard Vocal Lit. (Mez-Sop)

Standard Vocal Lit. (Mez-Sop)

56 Songs You Liketo Sing (Low Voice)




Excellent for addressing breath management, accessing the upper register, and establishing good English diction habits

Excellent for addressing work in the passaggio, vowel modifi cation, legato singing, and breath management

An excellent way to introduce Italian art song, pure vowels, breath management, passaggio work, and agility

Great for working in the passaggio, vowel modifi cation, sustained/legato singing, and breathmanagement

Excellent for addressing legato singing, some passaggio work, and establishing good English diction habits

An excellent way to introduce French melodie, sustained/legato singing, vowel modifi cation, passaggio work, and establishing good French diction habits

An excellent introduction to oratorio, sustained legato singing, vowel modifi cation, passaggio work, and breath management

Excellent for addressing passaggio work, and sustained/legato singing

Great for addressing breath management, some passaggio work, legato singing, and establishing good German diction habits. This should be given to an intermediate/advanced singer.

An excellent introduction to Italian art song, pure vowels, breath management, legato singing, and establishing good Italian diction habits

This piece addresses breath management, passaggio work, and legato singing

An excellent introduction to German lieder, legato singing, breath management, and blend of registers

Great for addressing English diction issues, exposure to recitative, and sustained/legato singing

Great for focusing on legato singing, rubato style, passaggio work, and establishing good Italian diction habits

An excellent introduction to opera, legato singing, passaggio work, and exposure to recitative

A great way to introduce oratorio, legato singing, some passaggio work, and establishing good English diction habits

A great way to introduce German lieder, legato singing, breath management, some passaggio work

Excellent for addressing breath management, legato singing, and establishing good Italian diction habits

Great for addressing breath management, legato singing, rubato style, and establishing good German diction habits. This should be given to an intermediate/advanced singer

Repertoire for Young to Intermediate Singers


Voice Book or Title of Piece/Composer Class. Collection Pedagogical Value

Soprano

Soprano

Soprano

Soprano

Soprano

Soprano

Soprano

Soprano

Soprano

Soprano

Tenor

Tenor

Tenor

Tenor

Tenor

Tenor

Tenor

Tenor

Tenor

Tenor

Love Has EyesSir Henry Bishop

Das VielchenWolfgang Amadeus Mozart

Lass from the Low CountreeJohn Jacob Niles

Nel cor piu non mi sentoGiovanni Paisiello

Du bist die RuhFranz Schubert

Thy Beaming EyesEdward Alexander MacDowell

Ich Liebe DichEdvard Grieg

Into the NightClara Edwards

Si me versReynaldo Hahn

Deh vieni non tardarfrom La Nozze di FigaroWolfgang Amadeus Mozart

Tu lo saiGiuseppe Torelli

Where E’er You Walkfrom SemeleGeorge Frederic Händel

Now Sleeps the Crimson PetalRoger Quilter

Come again, Sweet LoveJohn Dowland

Du bist wie eine blumeRobert Schumann

Still wie die NachtCarl Böhm

Vaghissima SembianzaStefano Donaudy

Adieufrom Poem d’un jourGabrielle Fauré

If With All Your Heartsfrom ElijahFelix Mendelssohn

Total Eclipsefrom SamsonGeorge Frederic Händel

The Young Singer(Soprano)

56 Songs You Like to Sing (High Voice)

The Music of John Jacob Niles (High Voice)

24 Italian Arias and Songs (Med. High)

Standard Vocal Lit. (Sop)

The Young Singer (Sop)



First Book of SopranoSolos (Part II)

Standard Vocal Lit. (Sop)

24 Italian Arias and Songs(Med. High)

The Young Singer (Tenor)

Roger Quilter: 55 Songs(High Voice)

Standard Vocal Lit. (Tenor)


Single Copy

First Book of Tenor Solos, Vol. 1 (Tenor)

First Book of Tenor Solos, Vol. 1 (Tenor)


Oratorio Anthology (Tenor)

Great for addressing vocal agility, accessing the upper register, some passaggio work, and breath management

A great introduction to German lieder, agility work, upper register work, and establishing good German diction habits

Great for working with a student with limited exposure to classical repertoire. Great for addressing legato singing, some upper register work, and establishing good English diction habits

Great for working with Italian diction, pure vowels, some ornamen-tation, and vocal agility

A great introduction to German lieder, breath management, upper register work, and establishing good German diction habits

Excellent for addressing the upper register, legato singing, breath management, and establishing good English diction habits

An excellent introduction to German lieder, legato singing, breath management, and blend of registers

An excellent way to address legato singing, upper register work, and establishing good English diction habits

A great way to introduce French melodie, legato singing, breath management, some passaggio work

An excellent introduction to opera, lyric/legato singing, passaggio work, and exposure to recitative

Great for addressing legato phrases, breath management, work in the passaggio, vowel modifi cation, and pure Italian vowels

A great way to expose the singer to Baroque Da Capo arias, work with ornamentation, upper register work, legato singing, and ad-dressing English diction issues

Great for working on legato singing, some passaggio work, breath management, and addressing English diphthongs

Excellent for working in the passaggio, legato phrasing, breath management, and establishing good English diction habits

An excellent introduction to German lieder, legato singing, breath management, and passaggio work

Great for exposing students to German diction, work in the passag-gio, breath management, and legato phrasing

Excellent for working with Italian diction, work in the upper register, legato singing, and breath management

An excellent way to introduce French melodie, sustained/legato singing, vowel modifi cation, passaggio work, and establishing good French diction habits

This piece addresses breath management, working the upper reg-ister, legato singing, and vowel modifi cation. This piece should be given to an intermediate singer.

Great for accessing the upper register, breath management, legato singing, and establishing good English diction habits

Peter Bagley is Professor Emeritus of Music and special as-

sistant to the Dean of the School of Fine Arts at The University

of Connecticut. He received his BS in music education at the

Crane School of Music from the State University of New York at

Potsdam, and his DM in choral conducting under Julius Herford

at Indiana University. He taught public school music in Greenwich,

Connecticut, and prior to his appointment as director of choral activities at Connecticut,

was professor of music at the State University of New York, College at New Paltz.

Bagley has been invited as guest conductor and choral clinician for festivals and all-state

choirs throughout the country. Among many engagements, he recently conducted the

MENC All-Eastern Division Chorus in Pittsburgh, Pennsylvania, and launched his international

career as choral clinician for various choirs in a ten-city tour of New Zealand sponsored by

the New Zealand Choral Federation. Other engagements include an appointment to the

faculty of the Oklahoma Summer Arts Institute, an appointment for the Artist-in Residency

Program in Portland, Maine, and an invitation to conduct at the International Honor Band

and Choir Festival hosted by the International School at The Hague.

Bagley is an active member of the American Choral Directors Association, and was hon-

ored in October, 1990 by the Connecticut chapter as “... the Connecticut Choral Educator

of the Year.” He was an active member of the boards of Chorus America and the Hall

Johnson Institute, and his professional achievements are recognized in Who’s Who in the

East, and Who’s Who Among Black Americans. In April 2006, he received the University of

Connecticut's, School of Fine Arts Lifetime Achievement Award, and in the following year

he returned to his alma mater at the Crane School of Music, SUNY, Potsdam to receive the

Helen M. Hosmer Excellence in Teaching Award. In the spring of 2009, he appeared on a

panel with fi ve esteemed conductors titled, “Legends in the American Choral Tradition” at

the ACDA National Conference in Oklahoma City, OKlahoma.

Men's Honor Choir instructions are available on the ACDA Web site at www.acda.org/conferences.


Men's Honor Choir Conductor


the ACDA International Archives for Choral Music

Marvin E. Latimer Jr., [email protected], and Christina Prucha, [email protected], editors

Walter Collins (1926– 97) was the fi rst ACDA Archivist, the fi rst ACDA Archives Committee Chair, and the primary force behind the development of the ACDA International Archives for Choral Music. He was instrumental in the decision to create the fi rst physical space for the Archives in the Lawton, Oklahoma National Offi ce, and in the appointment of the fi rst Archivist, Marion Donaldson. For many years, Collins encouraged ACDA leadership to allocate the necessary funds to allow digital stor-age of the Archives holdings, a goal that is just now being realized.1 Shortly before he died, Collins donated a sizeable collection of books, letters, documents, and other artifacts to the Archives. This article seeks to prelimi-narily describe his contribution.

Part I: BiographyWalter “Wally” Stowe Collins II was

born January 12, 1926, in West Hartford, Connecticut to Kenneth G. Collins and Mary Elizabeth Foster Collins.2 He attended primary school in West Hartford and was a “day fellow” at the prestigious Loomis Chaffee School, a renowned New England boarding school in Windsor, Connecticut.3 His interests at Loomis Chaffee centered on sports, music, and drama. Several articles in the Loomis Log, the student newspaper, re-ported that Collins was one of the strongest tenors in the men’s glee club. In his senior year he sang in a popular barbershop quar-tet and performed the role of Frederick in the Pirates of Penzance.

The Walter Stowe Collins II Collection

by

Marvin E. Latimer, Jr.

The Yale WhiffenpoofsCollins attended Yale University from

1943 to 1948. According to the Yale 1948 class history, he was in the Battell Chapel Choir, the Whiffenpoofs, and the Glee Club for four years. It also notes that he served in

the Air Force from Febru-a r y 1 9 4 4 to October 1945, return-ing to Yale in N o v e m b e r 1945. He was president of the “Whiffs” his junior year (1946 – 47) , and president

of the Glee Club his senior year (1947–48).4

Collins’ singing experiences at Yale set in motion a lifelong interest in college glee clubs and their songs. One of his last major research projects was a history of American college and university songbooks. That col-lection, The Walter S. Collins Collection, is now housed in the American Music Research Center, a joint venture between the Univer-sity of Colorado Libraries and the University of Colorado College of Music. It consists of college songbooks and sheet music that Collins acquired throughout his lifetime and a comprehensive study of the Yale Songbook, 1853–78.5

In 1972, while a professor in Boulder, Colorado, Collins, along with a number of other former Whiffs, and some graduates from local universities, formed the New Wiz-

ard Oil Combination.6 The sixteen-member men’s ensemble is still active and is known for a distinctive jazz style that adapts “in-strumental sounds and rhythmic techniques to popular songs and ageless standards.”7

In 1988, as recognition for his commitment to such groups, Collins received the “Pan” distinguished service award from Spring Sing, a national association of unaccompanied singing groups.

Graduate School and Early Professional Life

Collins’ fi rst music teaching position was at the Hotchkiss School in Lakeville Con-necticut (1948–51).8 While teaching at Hotchkiss, he continued to attend Yale as a graduate student, and earned an MM in 1951. He left Hotchkiss in 1951 for Alabama Polytechnic Institute (now Auburn Univer-sity) to teach music theory, music apprecia-tion, choral conducting, and choral literature. He also built a choral performance program from the ground up. By 1955, his fi nal year, the choral department boasted four full time choruses with more than three hundred participating choristers.

Collins moved to the University of Michi-gan in 1955 to pursue further graduate study. While there, he was named acting director of the Men’s Glee Club and taught music theory. In 1957, he traveled to England as a Fulbright scholar to research English church music. He studied at Oxford University dur-ing the 1957–58 terms and was recognized in 1958 by the Groves Dictionary of Music with an invitation to write the entry on

Walter Stowe Collins


Thomas Weelkes. Upon his return to the United States,

Collins married Jane “Jenny Kate” Reynolds on June 21, 1958.9 In the fall of that same year, he began a position as assistant profes-sor at the University of Minnesota. He taught music theory and music history, and directed the University Chamber Singers and the Uni-versity Chorus while he continued to work on a PhD at the University of Michigan. He completed the degree in 1960 and moved to Oakland University in Rochester, Michigan. There, he founded the Meadow Brook Music Festival, which featured the Detroit Sympho-ny Orchestra in summer residence on the university campus, and the Meadow Brook School of Music, a credit bearing academic option for festival attendees. The school’s faculty included such prominent musicians as Isaac Stern, Robert Shaw, William Vennard, and Roger Wagner.

The School of Music at the University of Colorado appointed Collins Professor of Music and Associate Dean for Graduate Studies in 1971. Such as other appointments, Collins taught choral music and musicology. Also in 1971, his scholarly and performance interests merged with his appointment as President of the College Music Society (1971–74). At that time the society had

grown to over two thousand members and was in need of structural reorganization. Collins reported to the membership, “The growing success of the board attempts to put administrative affairs of the society on a more business-like basis.”10

He appointed the fi rst salaried busi-ness manager, which resulted in the highest percentage of membership renewals since the society’s inception. He also established a new publications project, Bibliographies in American Music. Two years later it published its fi rst edition on the works of George Gershwin and Charles Schwartz. Collins served an unprecedented second term as CMS President during which time he established two committees exemplary of his awareness of emergent needs in higher education. The committees, “The Status of Women” and “The Status of Minorities in the Profession,” offered signifi cant contribu-tions to the dialogue surrounding “both the administration and the professoriate of [the music] discipline.”11

Nearly a generation of University of Colorado graduates knew Collins as the Commencement Marshal, a post he served from 1974 to 1988. Apparently, he was proud of that distinction. He collected numerous photos and commencement an-

nouncements, many of which remain in his ACDA Archives collection. He retired from CU in 1988, but remained active in the CU College of Music through 1996.

Service to ACDAThough not a charter member of ACDA,

Collins was among the fi rst wave of choral directors who responded to the call for new members in 1959. His fi rst ACDA leadership role came in 1966 when the ACDA Execu-tive Board created a standing Committee on Choral Editing Standards. Its charge was to investigate and recommend improvements in editing choral music in the public domain. Collins chaired the committee, which con-sisted of editors, conductors, and publishers’ representatives. As a result of their work, a Resolution on Choral Editing Standards was presented at the Seattle ACDA Convention and unanimously approved by all ACDA Of-fi cers and Board Members.12

Collins served as ACDA President (1977–79) at a fulcrum point between the leadership of Executive Secretaries Wayne Hugoboom and Gene Brooks—at a time when the National Offi ce had just moved from Tampa, Florida to Lawton, Oklahoma. He worked to refine the language of ACDA’s constitution and bylaws, which he presented to the membership in 1979. He also implemented an improved protocol for fi nancial accountability and wrote and distributed two new organizational hand-books on the fi scal policies and procedures of ACDA.

A high point of Collins’ 1979 Kansas City National Convention was a performance of Requiem, by Maurice Durufl é, conducted by Roger Wagner. A letter, held in the ACDA Archives, suggests that Collins personally invited Durufl é to the convention, but Du-rufl é wrote,

Dear Mr. Collins, I have received your nice letter of October 16, and I am deeply grateful to you. I am particularly fl attered [by] your cordial invitation to assist at your convention on March 8, 1979. [My wife and I] are very



thankful to you. Unfortunately, we could not reach you in the USA in 1979 because we had a serious car accident in 1975 and we are not completely recovered. We regret it deeply … because our friend Roger Wagner will conduct my Requiem and I know that he will conduct it wonderfully. Would you also excuse us to all the members of your association, which I would have been happy to know.

[Sincerely yours],

Maurice Durufl é.13

In a speech at that convention, Collins happily reported that mem-bership during his term had grown from 7,500 to 11,000 active members. But he also related disappointment in his inability to devise a system of assur-ing that the United States was consistently represented abroad by its “best choruses” rather than “only those who could “raise the travel funds.”14 As past president, he continued to work to achieve that goal. In April of 1982, he announced the formation of the International Federation for Choral Music (IFCM). Its aim, according to Collins, was to increase international cooperation in choral music and to assist in international exchanges of choirs, conductors, students, research, and choral music. Collins served as charter member of the board of directors, and later secretary general.

Today, IFCM consists of more than two thousand members worldwide. About IFCM, Tim Sharp said,

IFCM has grown into the vision that was stated in 1982, and is now looking at a different future. As IFCM has done its work over the last twenty-five years, the world simultaneously became more fl at. The international networking, conductor exchange, symposia, and touring across continents are all taking place. ACDA continues its strong position of support for this important initiative.”15

Interest in TechnologyAccording to his son, Neil, Collins

possessed an innate interest in all things technical. That attraction precipitated in-tense curiosity about the potential utility of computers. He often communicated that particular bent in correspondence with colleagues about ACDA matters, especially his concerns related to data storage in the Archives and the contents’ accessibility to researchers.

In 1965, Collins wrote a seminal ar-ticle, “New Tools for Musicology.”16 In the paper, he reported on his collaboration with Ronald Read, of the University of West Indies Department of Mathematics, in identifying repeated musical patterns in Thomas Weelkes’ music, using an IBM 1620 Data Processing System. Though his results were inconclusive, primarily due to time limitations, he succeeded in forwarding some important digital musical analysis possibili-ties. Said Collins, “[I am convinced] that any facet of a composer’s style which can be translated into a computer program—and I expect that nearly all can—could easily be studied by similar means [as this study].”17

When not involved in the many profes-sional activities that he juggled throughout his career, Collins was an avid birdwatcher.

According to his daughter, Martha, he was one of a very few “birders” nationally to have seen over seven hundred United States bird species. In 1992, his experiences using the Internet for researching birds, and his fascination with the rapidly expanding medium, led to a recurring dialogue with Mark Gresham, Editor of Chorus! Maga-zine; Robert Reynolds, professor of music history at Arizona State University; and James Feiszli, director of music at the South Dakota School of Mines and Technology. Their discussions centered on the possibil-ity of connecting the International Center for Choral Music and MUSICA to choral musicians in the United States through the Internet.18

At the 1993 ACDA National Conven-tion, Collins, Feiszli, and ACDA President-elect Lynn Whitten, organized a meeting with other choral musicians who were interested in such matters. Shortly thereaf-

ter, Choralist, the fi rst e-mail list dedicated to choral music was created.19 Later renamed ChoralNet, it became a widely utilized means of communication for choral musi-cians. Collins was an avid promoter and user of the site for the rest of his life. One can still fi nd many of his postings.20

On November 30, 2009, ChoralNet merged with ACDA. According to Philip Copeland, ACDA Technology Chair,

ChoralNet was a brilliant creation of James Feiszli and Walter Collins; it has served choral directors extremely well over the past fifteen years. After its recent merger with ACDA, I expect ChoralNet to become an even more important part of the communication structure of choral musicians. It began as a place for choral musicians to ask questions and receive answers. Hopefully, it will evolve into a professional communications networking center for all choral organizations.”21

ScholarshipOne of Collins’ most signifi cant contribu-

tions to choral scholarship was his collabo-ration with Harold Decker, Julius Herford,

Collins in Favorite Raccoon Coat


Howard Swan, Lloyd Pfautsch, and Daniel Moe in writing Choral Conducting: A Sympo-sium, fi rst published in 1973 by Prentice Hall. This landmark choral conducting methods book recognized the widening scope of choral pedagogy, which, according to Decker, was largely a result of expanding musicology programs nationally. Decker, who was largely responsible for its publication, wrote,

[The book’s impetus was the] decisive change [that had occurred] as the emphasis of the choral musician shifted from sound or sonority per se to the totality of music, from mere subjective interpretations to a closer perception of the music itself.22

Collins also collaborated with David Brown, and Peter LeHuray to transcribe and edit an important collection of anthems by Thomas Weelkes for Musica Brittanica. This choral music volume was prepared with the demands of both musical scholarship and practical performance in mind. In addition to such book contributions and numerous articles, Collins edited the Research Memo-randum Series of The Voice of Chorus America from 1983–92. The series, which began in the 1950s now numbers nearly 200 issues. During his tenure, Collins edited twenty-seven issues, numbers 135 through 161. A selected bibliography of Collins’ scholarship, compiled by Joan Catoni Conlon, is included as an appendix to the present column.

Walter Collins RememberedCollins died unexpectedly of a brain an-

eurysm June 30, 1997, in Hyannis, Massachu-setts. He was 71. Jenny Kate, his companion of nearly forty years, tragically died in August of the following year from injuries she re-ceived in a vehicle accident. In an obituary on ChoralNet dated July 27, 1997, Joan Catoni Conlon posted reminiscences of several of Collins’ former students and associates. Dale Warland, one of Collins’ students, recalled,

He always made me feel like a colleague, respected my opinion,

included me in every event of consequence, and continued to support my work throughout his entire life. I am enormously proud and grateful to have known and worked with this master musician who has made such a signifi cant contribution to the world of choral music.

Conlon wrote,

Yale classmates who spoke at his memorial service gave eloquent testimony to lasting friendships formed through choral singing. They recalled Wally’s ebullience, and recounted tales when, as president of the Yale Glee Club and as an active member of the Whiffenpoofs, Wally clearly developed a keen appreciation for “serious irreverence” in song and in life.

She closed by saying,

Colleagues, fr iends, and former students will remember him as a generous and knowledgeable teacher, respected musicologist and editor, ardent proponent of choral singing throughout the world, enthusiast for friendships through choral music, and eternal optimist on the goodness of man.

In a recent communication, his daughter, Martha, wrote,

He was the greatest person in the world and one of my closest friends. He was a true and genuine person. As a teacher, he would always invite all of his students to our home for Thanksgiving dinner if they didn’t have anywhere else to go. I don’t think anyone actually ever took him up on it—although I always wanted to sneak into one of his classes and get all the students to raise their hands when he said that—just to see his face.

Part II: The Walter Stowe Collins II Collection

The Walter Stowe Collins II collection is one of the larger private collections. It totals nearly twenty linear feet of books, docu-ments, and other artifacts. The holdings have been stabilized and preliminarily sorted but not described.

Collins donated a large portion of his personal reference library to ACDA. Those holdings total seven large boxes of books (boxes one through seven, about 8.75 lf). The books include conducting methods texts, reference books, and other miscel-laneous publications. They have not at this time been catalogued.

Box eight (1.25 lf) includes sheet music, mostly octavos. We did not attempt to count or sort them. Boxes nine through eleven (3.75 lf) contain journals and pamphlets. Box twelve holds miscellaneous correspondence, IFCM papers, Collins’ hardbound dissertation and manuscript, and ACDA divisional papers. Boxes thirteen and fourteen (2.5 lf) contain numerous student theses and papers.

Boxes fi fteen, sixteen, and seventeen (small boxes, 1.5 lf total) contain Collins’ per-sonal correspondence and ACDA conven-tion papers. They include correspondence from Archives committee work (much of it with Harold Decker and Marion Donald-son), and correspondence about Research and Publications Committee concerns. Discussion and correspondence about early monographs, book reviews, and the Herford Prize fi gure prominently in these documents.

Generally the contents of the collec-tion refl ect many of Collins’ administrative responsibilities. For example, there are International Federation of Choral Music documents, newsletters, and American Cho-ral Foundation communications. We were interested to fi nd dozens of repertoire lists: some of them appear to be student projects. Those papers, presumably, could have been produced as a result of Collins’ work with the College Music Society and the Research Memorandum Series.

Like most of the early architects of ACDA, Collins was a prolifi c and elegant let-ter writer. He frequently corresponded with Alfred Mann, Editor of The American Choral



Review; Marion Donaldson, ACDA Archivist; Harold Deck-er, friend, frequent collabora-tor, and occasional adversary; and other ACDA leaders. They are written in a no-nonsense, direct, but collegial and cour-teous manner. Many of them begin with a recounting of some bird watching adventure that he and Jenny-Kate were either planning or had just completed. They also contain colorful evidence of occasional spirited disagreements among a handful of early organiza-tional power brokers about numerous and sundry ACDA policy decisions. The letters in the collection roughly span the years between 1970 and 1981.

Interesting documentsAs with the Hugoboom

Collection, the task of se-lecting a few representative documents for the Archives Web site was not an easy one. We chose, for this column, to feature some unique photo-graphs, revealing letters, and an interesting speech from the end of Collins’ ACDA presi-dency. One can view them by going to the ACDA Archives web page, <http://acda.org/archive>, and clicking on the ACDA Interna-tional Archives for Choral Music Column link.

1. Photograph, head shot, January 12, 1956.

2. News clipping, Oakland Observer, January 8, 1965. Photograph with Robert Shaw and story about the Meadow Brook Music Festival.

3. News clipping, Pontiac Press, April 9, 1965. Story about the Meadow Brook School of Music.

4. Undated photo, Collins in fur coat ice-skating. We were unable to fi nd out when and where this photo was taken, or who the little girl is. We found out

from Collins’ children, however, that he loved the raccoon coat and kept it for many years, often wearing it to ac-company them on Halloween trick-or treat adventures.

5. Undated photo, headshot (8.5 x 11), Oak-land University.

6. Undated photo, headshot, Oakland Ob-server.

7. Hand written letter from Jenny Kate Col-lins to Gene Brooks, January 30, about Walter Collins’ fi rst visit to the new National Offi ce in Lawton, OK.

8. Hand written letter from M. Durufl é to Collins about the performance of his Requiem, dated October 31, 1979.

9. Letter from Collins to Paul Koutney, September 10, 1977, ending ACDA support for the Vienna Symposium. The Vienna Symposia had been sponsored for a number of years by ACDA.

10. Letter from Harold Decker to Walter Collins, September 27, 1977, expressing concern about Collins’ letter to Kout-ney. Decker wanted ACDA to continue to sponsor the Vienna Symposia.

11. Letter from Walter Collins to Gene Brooks, January 25, 1978, regarding Gene Brooks’ fi rst year of service to ACDA as executive secretary. In the letter, Collins explains to Brooks that the “offi cers of the Association should be the primary spokesmen for the organization.”

12. Letter from Collins to President Carter, February 6, 1978. We have been unable to fi nd the impetus for this letter.

13. White house response to Collins’ letter to President Carter, February 21, 1978.

14. Letter from Collins to the ACDA Board of Directors, January 26, 1978.

15. Typed text of Collins’ president’s address, Thursday, March 8, 1979. Delivered at the Kansas City National Convention.

16. Letter from Collins to ACDA Research and Publications Committee, May 29, 1984.

17. Letter from Harold Decker to Collins, September 17, 1993, about the Ar-chives Committee.

18. Letter from Collins to Decker, September

Letter from Collins or President Carter, February 26, 1978.


27, 1993. These letters are exemplary of the unique relationship between Collins and Decker. Often, they did not see eye to eye on matters.

ConclusionWalter Stowe Collins II, through his

scholarship and professional leadership was a signifi cant fi gure in choral music in the twentieth century. However, very little of his work has been documented. Almost nothing is written, for example, about how he came to be interested in music or developed as musician and scholar. Also, while we know something of his research, very little schol-arship has addressed, even tangentially, his

work as a choral musician. Finally, numerous questions remain about the impact of the many choral music initiatives that he began or supported.

As in earlier writings about the Archives, we maintain that there is a great deal of work to be done. The Collins collection, like the Hugoboom collection, is so large that we were unable to peruse thoroughly the many documents, photographs, scores, and other writings in the holdings. Still, in our cursory look at the collection it became clear that numerous research foci might be supported by these documents. Those topics likely are related not only to Collins’ fascinating life, but also to his place in the expanding fi elds of choral research and choral pedagogy both nationally and internationally.

NOTES

1 For more about the development of the ACDA Archives, see, Marvin E. Latimer Jr. and Christina Prucha, “The American Choral Directors Association International Archives for Choral Music: Past, Present, and Future,” Choral Journal 49, no. 12 (June/July 2009): 20–30.

2 In Memoriam: Walter S. Collins, published in Choral Journal 38, no. 2 (September 1997): 23, provided a signifi cant point of departure for the collection of biographical information about Collins.

3 Day Fellow is a term for day student. Collins was from a nearby town that drew (and continues to draw) quite a few day students. Currently the school is about 60 percent boarding students and 40 percent day students. It is not clear what the percentages were in Collins day but the general understanding is that it was far more a boarding school than a day school so the numbers were even more tilted towards boarding.

4 The Whiffs began as a group of six Yale seniors who sang concerts at the renowned Mory’s Temple Bar, a private club adjacent to the Yale campus that dates back to 1849. Cole Porter (class of 1913) highlights the list of Whiff alumni, as does U.S. Senator Prescott Bush (class of 1917). Senator Bush, father of President George H. W. Bush and Grandfather to President George W. Bush, sang with three fellow Whiffenpoof alumni, who called themselves the Silver Dollar

Quartet, until his death in 1972.5 A complete guide for the songbook can be

found at <http://ucblibraries. colorado.edu/amrc/collection/collinswalterguide.pdf>. It was compiled by Cassandra M. Volpe, Archivist, and Kitty Galvin, Volunteer and completed in November of 2001.

6 The New Wizard Oil Combination comes from the nineteenth century medicine show where traveling hucksters often offered a magical potion (e.g., John Hamlin’s Wizard Oil). They consisted of a variety of ingredients, and generally were laced with alcohol or codeine. These wagon-based operations frequently used singing groups, known as combinations, to draw the town crowds that would eventually become the customers of the itinerate salesmen. One of Collins favorite pastimes was looking for wizard oil bottles at antique shops. New Wizard Oil Company Web site, accessed March 6, 2010 from <http://www.wizardoil. org>

7 Ibid.8 Maria Hotchkiss established the historic school

in 1891 with the guidance of Timothy Dwight, then President of Yale University, to prepare young men for Yale.

9 They adopted three children: Neil, born in 1961; Mary (nicknamed Mayley), born in 1964; and Martha, born in 1966.

10 Dean McIntire, Walter Collins Memorial, published on ChoralNet, November 13, 1997, accessed March 10 from < http://www.choralnet.org/194864>

11 Ibid.12 Resolution, Choral Editing Standards Committee,

Choral Journal 8, no. 5 (May/June 1968): 14.13 Translated by John Ratledge, director of choral

activities, University of Alabama.14 Walter Collins, President’s Address, Thursday,

8:00 P.M., March 8, 1979, Walter Stowe Collins II Collection, ACDA International Archives for Choral Music.

15 Tim Sharp, personal e-mail communication to author, March 5, 2010.

16 Walter Collins, “A New Tool for Musicology,” Music and Letters 46, no. 2 (April 1965): 122–25.

17 Ibid.18 James D. Feizli, Meet the President, posted on

ChoralNet May 8, 2006, accessed March 10, 2010 from <http://www.choralnet.org/view/216041>

19 Ibid.20 For Collins’ postings, go to <http://www.

with SINGERS demonstrating the parts!

NEW!!

LUX AETERNA by Morten Lauridsen

Plus master works such as:

Faure Requiem, Vivaldi Gloria, Messiah, Mozart Coronation Mass,

Schubert Mass in G,

Rutter's Requiem, Gloria, Magnificat

and more!

100s of Octavos and Anthems for

Treble, TTBB, SATB and SAB Choirs

Visit our website at

www.partpredominant.comORDER ONLINE!

Part Predominant Recordings2617 39th St NW Gig Harbor WA 98335

with SINGERSSS dddddddddddddddddeeeeeemmmmmmmmoonstrating the parts!

FOR CHORAL PART STUDY Since 1995



chor a lne t .o r g / sea rch ?keys=wa l te r+ collins&op=Search>.

21 Philip Copeland, personal e-mail communication to author, March 14, 2010.

22 Harold A. Decker and Julius Herford, Choral

Conducting: A Symposium (New York: Appleton Century-Crofts, 1973), p. 1.

23 Joan Catoni Conlon, Walter S. Collins, PhD: An Obituary, published on ChoralNet, July 26, 1997, accessed May 5, 2010 from <http://

www.choralnet.org/ 141737.

Books, Pamphlets, and Chapters: Author and Editor

Walter Collins, “Thomas Weelkes,” in Grove’s Dictionary of Music and Musicians, 5th ed., Supplementary Volume, Eric Blom and Denis Stevens (London: Macmillan & Co. Ltd., 1961).

Walter Collins, David Brown, and Peter Le Huray, “Thomas Weelkes, Collected Anthems,” Musica Brittannica, Vol. XXIII (London: Stainer and Bell Ltd., 1966).

Walter Collins, “When David Heard” and “O Jonathan,” New York Pro Musica Song Book, Noah Greenberg, ed. (New York: Associated Music Publishers, 1966).

Walter Collins, “The Choral Conductor and the Musicologist,” in Choral Conducting: A Symposium, Harold Decker and Julius Herford, eds., (New York: Appleton Century-Crofts, 1973).

Walter Collins, “Let Thy Merciful Ears,” Thomas Mudd and “Gloria in Excelsis Deo,” Thomas Weelkes, The Oxford Book of Tudor Anthems, Christo-pher Morris, comp. (London: Oxford University Press, 1978).

Walter Collins, “In Nomine Jesu,” Jacobus Handl, Something to Sing About, Vol. II (New York: G. Schirmer, Inc., 1982).

Walter Collins and David Jasper, The Birds of Grand County, Colorado, Including Rocky Mountain National Park West of the Continental Divide and Arapaho National Recreation Area (1983): 4 pp.

Walter Collins, Recommended Editorial Standards for Choral Publications (Oklahoma City, OK: ACDA and the Music Publishers Association, 1983/1985).

Walter Collins, “The Reconstruction of the Evening Service for Seven Voices by Thomas Weelkes,” Five Centuries of Choral Music: Essays in Honor of Howard Swan, Gordon Paine, ed. (Stuyvesant, NY: Pendragon Press, 1988).

Books: General Editor and/or PublisherLynn Whitten, A Classifi ed, Annotated Bibliography of Articles Related to Choral Music in Five Major Periodicals through 1980 (Oklahoma City, OK: ACDA, 1982).

Gordon Paine, The Choral Journal: An Index to Volumes 1-18 (Oklahoma City, OK: ACDA, 1978).

Book DedicationDavid Brown, Thomas Weelkes, A Biographical and Critical Study (London: Faber and Faber Ltd., 1969).

Articles, Addresses, and AnnouncementsWalter Collins, “A Survey of Early English Cathedral Music,” Bulletin of the American Choral Foundation 2, no. 4 (June 1960): 3–6.

Walter Collins, “A Selected List of Renaissance and Baroque Choral Works with Sacred English Texts in Practical Editions,” Research Memorandum No. 22 of the American Choral Foundation (March 1961): 6 pp.

Walter Collins, “Problems of Musicianship in the College Choir,” Choral Journal 1, no. 7 (May 1961): 11–12.

Walter Collins, “Recent Discoveries Concerning the Biography of Thomas Weelkes,” Music and Letters 44, no. 2 (April 1963): 123–31.

Appendix Walter Collins Selected Bibliography23

Continued on page 48



Appendix Walter Collins Selected Bibliography23 continued

Walter Collins and John Galloway, “First Annual Symposium on the Arts,” College Music Symposium 3 (1963): 23–31.

Walter Collins, “A New Tool for Musicology,” Music & Letters 46, no. 2 (April 1965): 122–25.

Walter Collins, Vito E. Mason, and Charles Mason, “The Art of Programming,” Jack Boyd, ed., Choral Journal 6, no. 3 (January-February 1966): 13–14.

Walter Collins, “A Resolution on the Standards of Editing Choral Music in the Public Domain,” Presented at the ACDA National Convention, Seattle, WA, March 1969, by the Choral Editing Standards Committee, Walter Collins, Chairman, Choral Journal 8, no. 5 (May-June 1968): 14.

Walter Collins, “Choral Editing Standards: A Report,” American Choral Review 12, no. 1 (January 1970): 23–27.

Walter Collins, “What is a Good Edition?” Choral Journal 12, no. 3 (November 1971): 15–18.

Walter Collins, “Introduction: Barry Brook, RILM Abstracts for Choral Specialists,” Choral Journal 16, no. 6 (February 1976): 27.

Walter Collins, “Announcement: Affi liation of the American Choral Directors Association and the American Choral Foundation, Inc.,” Choral Journal 22, no. 5 (January 1982): 40, repeated in 23, no. 3 (November 1982): 22; 23, no. 5 (January 1983): 35; and 23, no. 9 (May 1983): 34.

Walter Collins, “Announcement: International Federation for Choral Music,” Choral Journal 22, no. 8 (April 1982): 21.

Walter Collins, “Recommended Editorial Standards for Choral Publications,” Choral Journal 23, no. 2 (October 1982): 27–28.

Walter Collins, “ACDA Monograph Series on the Choral Music of Individual Composers,” American Musicological Society Newsletter 8, no. 1 (February 1983): 3.

Walter Collins, “Monograph Possibilities Explored,” Choral Journal 23, no. 5 (January 1983): 34.

Walter Collins, “Research Memorandum Series,” Choral Journal 24, no. 1 (February 1984): 22.

Walter Collins, “Report from Japan,” American Choral Review 24, no. 1 (Winter 1987): 21–23.

Walter Collins, “Birding with Mirrors,” Birding 23, no. 6 (December 1991): 364–65.

Regular Columns and Newsletters

“Da Capo,” Choral Journal (1971–74).

“President’s Report,” College Music Symposium (1972–74).

College Music Society Newsletter, March, June, and November, 1974.

“President’s Letter,” Choral Journal (1977–79).

Gentlemen Songsters, Newsletter of the Yale Whiffenpoofs Alumni Association (1989–92).

General Editor

International Choral Bulletin (1981– 89).

Research Memorandum Series (New York, Philadelphia: American Choral Foundation, Inc., 1983–92).

Music EditionsThirty-fi ve editions of works for mixed and men’s voices by Weelkes (14), Mudd (3), Beethoven, Farrant, Franck, Gallus [Handl], Gibbons, Graun, Hassler, Lassus, Marschner, Morley, Mozart, Praetorius, Purcell, Scheidt, Stainer, Tallis, and Victoria (one each) were printed between 1958 and 1988 by Associated Music Publishers, Hinshaw, Lawson-Gould, Oxford, G. Schirmer, and Stainer & Bell.


Rollo Dilworth was recently appointed an associate professor

of choral music education at Temple University’s Boyer School of

Music in Philadelphia, PA. In addition to teaching undergraduate and

graduate courses in choral music education, he serves as conduc-

tor for the University Chorale. Prior to his appointment at Temple,

Dilworth served as director of choral activities and music education

at North Park University in Chicago, IL for 13 years. Dilworth holds

degrees from Case Western Reserve University, University of Missouri-St. Louis, and Northwest-

ern University. Dilworth has written or arranged 150 choral works that are currently in print. His

choral compositions are a part of the Henry Leck Creating Artistry Choral Series with Hal Leonard

Corporation and Colla Voce Music Company. He has recently published pieces with the Santa

Barbara Music Publishing Company as part of the Mary Alice Stollak Choral Series. Dilworth is a

contributing author for the Essential Elements for Choir and the Experiencing Choral Music textbook

series, both published by the Hal Leonard Corporation/Glencoe/McGraw-Hill Publications, and

for Music Express! Teachers Magazine. He authored a book of choral warm-ups for elementary

and secondary choral ensembles titled Choir Builders: Fundamental Vocal Techniques for General and

Classroom Use. He frequently serves as a guest conductor or clinician for honors, festival, and all-

state choirs throughout the United States and abroad. Dilworth is an active member of the Music

Educators National Conference (MENC), the National Association of Negro Musicians (NANM),

the American Choral Directors Association (ACDA), and Chorus America. He is a member of the

American Society of Composers, Authors and Publishers (ASCAP), and currently serves on the

Pennsylvania ACDA State board as Director of Student and Youth Activities.

Dilworth has released a recording titled Good News, which features 12 of his choral composi-

tions. The St. Louis Symphony Orchestra and IN UNISON® Chorus recently commissioned and

premiered his choral/orchestral work titled Freedom’s Plow, which is based on the text of a Langston

Hughes poem that bears the same title.

JH/MS Honor Choir instructions are available on the ACDA Web site at www.acda.org/conferences.

JH/MS Honor Choir Conductor


Administrators with little or no musical background can pose serious complica-tions for the new teacher and the veteran teacher. The following are teaching tips taken from fi les collected over a period of years. Over time, these tips should help to give you complete ownership of your teaching evaluations. The pedagogical assessment ideas listed should assist you in educating administrators about what they can expect to observe if and when you have to explain certain aspects of your classroom to the untrained musical evaluator.

Think of this as an upside down pyramid, with the bottom portion your minute-by-

minute account of classroom activities. Get out a master calendar and attempt to iden-tify every possible confl ict i.e., testing days, holy days, or, "holier days" such as pep-rallies. Then, make sure you have scheduled dress rehearsals in your calendar prior to your concerts. Make sure you have given more time at the beginning of the year for your concerts. Pick out music for the entire year and give it to the students at the beginning of the year. To be specifi c:

• Design a year-long calendar of music to be rehearsed

• Design a performance-based calendar of music to be rehearsed. Determine your most diffi cult music and assign more time to that.

• Give the performance-based calendar to your students, and have a copy for your evaluator.

• Set up lesson plans with the selected repertoire in mind.

In this current climate of change, we owe it to our profession to be leaders and believers in what has been given to us in the national standards. Just as MENC and ACDA have been at the forefront of educating standards, we educators have to know and include these standards as part of our daily lesson plans. From the second fi le in the twenty-fi rst century drawer, the national standards give you a global basis to operate. They imply that if you do this, the musical and educational result will be greater for your students. Correlate that with your own classroom, and it could result in your becoming a better teacher. Specifi cally, this author rarely taught “improvisation” in his fi rst few years of teaching, which is regret-table because now the benefi ts are clearly understood. The time was spent struggling with getting students to think Do-Fa-Do and key signatures. Get into the habit of dong some sort of improvisation on a daily or almost daily basis. Improvisation may be one of the best under-used musical elements of teaching. You will defi nitely garner multiple

Choral Evaluation Survival Techniques - C’est la vie

by

Bradley Olesen

Lynne Gackle, editor [email protected]

Number 1

- Plan now for the end of the year. - Plan now for the end of the year.

Bradley Olesen, former Texas high school choral director and Fine Arts administrator, is completing his doctorate in music education at the University of Miami, Coral Gables. His research on successful high school choral directors warm-up philosophies and warm-up practices will be presented at the ISME-Bejing conference in August, 2010.

_ _ Always have a copy of the Always have a copy of the national/state standards at hand national/state standards at hand and find a way to make them and find a way to make them visible in your lesson plans each visible in your lesson plans each day. Your administrators will not day. Your administrators will not only thank you, but will give you only thank you, but will give you that extra “check” needed on your that extra “check” needed on your evaluation forms.evaluation forms.

Number 2_ _

Think of ways to incorporate Think of ways to incorporate improvisation into your lesson improvisation into your lesson plans.plans.


Teach the kids about the expectations when an administrator is in the room. If you involve them and give them responsibility, it allows the class to go on as usual instead of a clinched, discipline-fearing act. (In other words, you do not want to have to over-discipline students while an administrator is in the room.) The redirects and the error corrections are necessary; make sure you do them. Run “admin-drills” with your students. Put out a comfortable desk chair in the room with your administrator’s name on it. Have an extra folder of music for them, and a little writing desk beside it with a lamp turned on. Insist they join whatever section they actually sang. You may be surprised at the positive feedback this provides you and your students. The students were involved, you were engaged, and the kids around the principal, once they stopped giggling, were actually more on task than any other part of the year.

If your room looks like a disaster, expect the same outcome from your evaluations. Take fi ve minutes at the end of the day to clean up the room. Do not leave your music lying around. Put your music in a labeled class

positive check marks when your students demonstrate improvisation while an adminis-trator looks on. Begin with call-and-response. To the untrained observer, the administrator sees you presenting musical ideas, and the

students talk back musically to you. You re-spond in high praise, the kids will laugh and smile, and soon the whole class will be talking in musical languages. Start adding hand signs and toss in some rhythmic doo-bee-doos.

These activities would be effective in the assessment areas of implementing effective pedagogy and specifi cally, using effective questioning techniques that stimulate higher-order thinking. Improvisation opens students to their own possibilities at their own pace.

Dalcroze, or any body movement you can do, is another trick of the trade when an administrator is in the room. It is not a one-time trick. You have to get these students comfortable with moving before you spring it on them in front of an administrator, or the giggles and resistance will ensue. If the body can move to the music, the kids will know their way around the music. Even if it is as simple as The Water Is Wide and you have the students drag one hand from one side in an arc to the other side as they sing, they will visibly demonstrate that the musi-cal line is arc-like in direction—a rise and fall of the line. The breath should extend to the end of the phrase“I cannot get o’er” or “my love and I,” for example. These move-ment activities aid in the area of classroom environment: equity, excellence, and learn-ing. When you break down the barrier of movement, you build rapport and trust with the students, and you are able to model and maintain a courteous and respectful climate.

Number 3

- Use body movement/exercises to - Use body movement/exercises to demonstrate musical lines and rhythms demonstrate musical lines and rhythms.

Number 4

- Admin-drills: Run them periodically- Admin-drills: Run them periodically

- Have your room setup in such a way - Have your room setup in such a way that the administrator knows where that the administrator knows where to sit. to sit.

Number 5

- - Your classroom should be a welcom-ing, positive and clean environment – not a college dorm room. Keep your music in a folder specific to each class.

- - Develop student leadership. Make

entering the room a student-led active learning environment.

- - Have a video device ready to observe the students in this process.

- - Use listening examples to facilitate learning. Your students listen to their iPod music. Make some CD’s for them to add to their collection. Open their ears to the kinds of music you anticipate hearing.

Celebrating our 10th anniversary, the PacificRim Children’s Chorus Festival providestreble choirs the opportunity to experiencePacific Rim cultures through choral musicin an interactive, non-competitiveenvironment. Songs and dances taughtby native speakers invite participants toexplore worlds they never knew existed.

Provide your singers with excellent music,lifelong friendships and a new appreciationof the world around us. IndependentDirectors are welcome.

Wanda Gereben, Executive Director808-595-0233 • www.PacRimFestival.org

Pacific RimM U S I C R E S O U R C E S

Look Towardthe Pacific Rim

for theNext Decade

Henry H. LeckFestival Artistic DirectorFounder and DirectorIndianapolis Children’s Choir

Nola A. NahuluFestival Host Chorus DirectorHost ChorusHawaii Youth Opera Chorus

July 13 - 21, 2010July 12 - 20, 2011July 10 - 18, 2012

HAWAI‘I


folder. (Make sure you have a second folder of the exact same music in the trunk of your car at all times,

• This includes: scores for the parts of music for your musicals/oratorios/orchestral parts, your concert music, and anything else you are conducting. Make it a habit to create two folders for everything you do;

• Find incredible listening examples;

• Use multiple technologies available—in-cluding music writing software;

• Have students write music for the class; and

• Be an example to your students.

Taking attendance has become auto-mated/computerized. Unfortunately, our computers needed for this task may be in our offi ces in the other room. What do you do? Leaving a class when an administrator is in the room is, fi guratively speaking, a crime. If you have to turn in roll within 10 minutes of class, as most do, then here’s your new found trick: student-leadership. Teach your student-leaders how to lead stretches and breathing exercises. Videotape them doing this. You have about four different variables then to contend with:

• Your students, get opportunities to be a leader in a safe and nurturing envi-ronment;

• You have a video of your student to offer written praise, simple critique;

• You have a video of the class, should any-one not want to cooperate; and

• You can leave the room while the students are actively engaged in learning. You have taught students how to manage your class while you are taking care of other administrative responsibilities.

Your administrator should be checking high marks here for classroom environment: equity, excellence, and learning. You have in-

cluded ideas such as creating rapport among students in an environment of respect; es-tablishing a culture of learning; contributing to a positive behavior climate, and especially supporting the development, implementa-tion, and evaluation of the classroom man-agement plan; and managing routines and procedures that enhance student learning.

Warm-ups These are your bread-and-butter of your

evaluation (and the sound of your choir). They fall squarely into the category of man-aging routines and procedures that enhance student learning. Warm-ups are necessary in every class. Notwithstanding, they will assist you in the task of your day to impress the administrator.

• Try not to talk too much when you warm your students up to impress your administrator.

• Be sure you can connect some of your warm-ups to your music each time you warm your students up. Your les-son plans should be clear enough so you know a warm-up that you can use, which will connect with a piece of mu-sic that you are going to do while the administrator is observing you. Having that connection creates higher-order

thinking skills for your students. Not every warm-up should be designed that way; some could be designed to establish a sense of unifi ed vowel sounds. Some could be used for voice building and range extensions, while some could be used, for example, to show vowel releases. For example, in Hotaru Koi, a traditional Japanese song arranged by Ro Ogura, typical beginning students would end the “ho” with a closing “w” or “wuh.” What you might want to do is to design a warm-up based on a breath release with the mouth/tongue not moving in order to preserve the vowel sound [o], and utilizing the diaphragmatic inhale and exhale muscle actions. (Ho-ho-ho even on a 5 note scale up and down would be a great start).

• Find a way to purchase inexpensive hand-held mirrors. Put them in the folders, and your students can pull them out when you are trying to explain the shape of their mouth in an [o], for example.

Warm-ups show you have a clear pur-pose established at the beginning of class. That purpose, and self (student)-assessment/continuous improvement should get high check marks. Your pacing of instruction should be noted appropriate because you have an understanding of how long it takes to warm your students up. The mirror gives multiple opportunities for a student to prac-tice what they have been taught; it forces them to look at themselves to correct so

Number 6

- - Do warm-ups every day.

- - Do warm-ups in a way that focuses on their body as an instrument first.Then, focus on their vocal produc-tion and hearing.

- - Make sure you create a warm-up each day that is different, and that addresses something related to the music they are about to sing.

- I- Invest in hand mirrors for every stu-dent. Use them especially during the evaluation.

CHOIR ROBES$3595

& UPEXPERT

TAILORING

www.rcgown.com

Finest fabrics including permanentpress and wash & wear. Superior

quality. Free color catalog and fabric swatches on request.

GUARANTEED SATISFACTIONCall Toll Free: 1-800-826-8612

P.O. Box 8988-CJ Jacksonville, FL 32211


many things such as the tongue position, the neck strain, the eyebrows relaxed, the face relaxed. These are all good choral compo-nents but, more so, excellent pedagogical strengths for multiple checks in your favor.

Sight-singing/Ear-training Do it! I always tell my current pre-service

students this proverb, attributed to Chinese sage, Kuang Ztu: “Give a man a fi sh, and he’ll eat for a day. Teach a man to fi sh, and he’ll eat for a lifetime.” Each state has expecta-tions when it comes to sight-reading. Even my best choirs would sight-read everyday. More critical at this level to remember: In-vest in enough materials, or print off enough free-to-print materials, so that each student has his/her own materials to study or read. Sharing music in sight-reading is a distraction. Your administrator will defi nitely take note. While it may be a great time to show your principal that you do not have the funds to buy all your students books for your class, evaluation day is not directly centered around the students, it is about your ability as instructor to prove you are capable and able to get the deserved quality assessment marks.

• Make fl ash-cards, laminate them, and use them everyday. Introduce things like the very basics of musical notation, Italian and Latin phrases, and IPA for

Number 7

- - Sight-read everyday. - - Make Flashcards: Key signatures,

terms, IPA or anything you deem necessary. Laminate them.

- - Use solfege everyday.

- - Use sofege to audiate in your warm-up to introduce new melodic motives or phrases.

- - Use solfege to sightread.

- - Use solfege to first learn the music.

different languages, for example. Prac-tice how you would want students to answer the fl ash-cards so that it is not a free-for-all yell fest, either. The point is, you are giving fundamental and incremental abilities to these students to read music, to make music, and to speak a language of music that was foreign to them earlier and still foreign to many administrators. If you have no resources but you do have a piano, use the piano – make them play a type of ‘Simon’ game on the piano if your class is small enough.

• Audiation. Have them sing what you play and dictate back to you in hand signs what you play. Teach sound before you even offer a hand sign.

• Use your Curwen hand signs and audiate with your students. You show the signs, the students then sing and sign back at you. Sing your music on tonic sol-fa syllables for the administrator, too.

• Remember to stay in sequence with the learning, and not jump to the text of a piece, if you have not audiated, practiced the rhythms, audiated with rhythms, or sightsung on tonic sol-fa syllables. This disrupts the cognitive learning processes of your students.Read Eric Bluestine’s The Ways Children Learn Music6 for a better understand-ing.

Major points should be credited for the “engages students” categories of self-(student) assessment and critical think-ing. It also gives you the opportunity to demonstrate effectively in the assessment category of providing all students an equal opportunity to learn, regardless of cultural and linguistic background, economic status, gender, sexual orientation, ethnicity, religion, physical and personal attributes, and dis-abilities. You can modify these lessons to suit whatever potential social or learning external roadblocks your students come with through that door.

“Carmina Burana” Leipzig Youth Symphony, Amici Musicae Chorus, Pennsbury PA High School Choral Department. Gewandhaus Concert Hall, Leipzig, Germany. Sat. 16-Feb-08

www.TourResource.comToll-Free 888.330.5500We are “Musicians Serving Musicians”

TRC delivers genuine musical experiences, shared in a common language: music.


Print out your lesson plan. Give it to your administrators when they come in the door. Give your students a typical monthly rehearsal schedule of the music, and plan for assessing the students learning individually or in quartets at periodic intervals. If you happen to have an administrator enter while you are sending quartets off to record their ‘singing assessments’, for example, practice the art of not disturbing the class while this routine is going on. Practice by keeping a list of students in the quartet, and assigning a quartet leader to be in charge of getting the next quartet in the practice room recording area. Although this may be on the detailed side of things, the last thing you need in an observation is a classroom fi lled with unco-ordinated or unplanned disturbances and interruptions.

As to the routine of a daily class, we all know that a class of 15 is different from a class of 50, or in some of our cases, 100 students. Whatever I do, I will to sing through everything on the upcoming concert during rehearsal at least once every other class, even at the beginning of each learning ses-sion.

Make sure you have one piece of music that you can sing straight through to impress

your administrator. Offer praise at every pause for correction while offering positive corrective actions. You have just effectively planned culminating activities that clearly summarize and/or apply key knowledge and skills.

Furthermore, ask the students to look ahead and write about what the text seems to indicate. Craig Hella Johnson’s Will There Really be a Morning?, for example, uses the poetry of Emily Dickenson that can invoke wonderful insights from middle school/junior high school students’ perspectives. Hang on to those written observations until that administrator comes in the room. Captivate your students with “anonymous” comments from these written remarks. Ask for feed-back on those written thoughts; involve them in the knowledge of the text. Nod your head as if you agree with most of what you are hearing. Control the time they are talking, and give warm and appreciative feedback or redirection as necessary. You have time, if you allocated it. Stick to your lesson plan but show your fl exibility; invite students into the conversation about the text or about the emotion of the music ahead of time so you are prepared for the responses. You will have just paced your instruction appropri-ately, ensured that all students are engaged and actively participating in the lesson and taught strategies that help students become independent learners.

Have a clock that is visible to your students when they walk in the room, and visible to you while you are teaching. If pos-

Number 9

- - Hang a clock on the wall that is visible to you when you are in front of your students. Keep pace of your rehearsal so you do not feel frantic in trying to cover material in your lesson plans.

- - Acknowledge the administrator when they enter the room. Even from day one, enforce your no-gum policy.

May 26-30, 2011Charleston, W.Va.

presentsThe Fifth Annual

Rollo Dilworth,Composer in Residence

Selina Midkiff,Artistic Director

Please visit festivalofyoungvoices.com

or call304.343.1111

for more information!

Number 8

- - Write the basic lesson points on the board every day.

- - Utilize technology to your advantage.

- - Sing through everything you intend to perform – at least every other day.

- - Translate the text before you begin to rehearse your music. Provide an IPA breakdown of foreign texts to your students, too.

- - Get the students to write about the text ahead of the evaluation.

- - Save and utilize the students’ com-ments during your evaluation.


Get to know your pr incipal and administrator(s) who evaluate you. Because you spent time getting to know your ad-ministrator, ask your evaluator to answer a question or two for your students to refl ect on certain ideas. These principals were once really good teachers; they loved being in front of their students and they do not get to do it anymore and they probably have some great ideas tucked away in their heads.

The administrator's job is a thankless job, but if you can make them feel recognized and appreciated, you cannot go wrong in the evaluator/principal assessment of you. In a huge area of communication, you will have just fulfi lled the area of communicating with campus cooperating teacher, team members, students and administrators

.

Teachers who do not practice the admin-istrative drills generally have little idea what to expect from themselves or their students. Some would argue that if you practice the drill every day, then you do not have to

drill. If you do not practice the unexpected administrator drills, you have no idea what the students will do. This really is about giving students at this age responsibility. Run a few 15-minute drills with your students. If you have no idea what to expect, then this will be your last year of happiness until you can fi gure out how to get in the game of teaching and begin to understand the choral educa-tion survival techniques of teaching music education to our students in the twenty-fi rst century. The students already know it is uncomfortable to be observed. Remember, you have already videotaped the students and provided oral or written comments from File number four. Add the following to your fi le: If any student is sick, make sure that you have an evaluation form that is at least 2 pages stapled where they can offer written feedback about every aspect of the rehearsal as they sit out and listen. If they have their English literature book open, you have just invited the slippery slope of destructive classroom management behavior in the classroom and a trained evaluator will pick up on this immediately. All students should be on task, even if they cannot sing that day. If not, make sure they are in appropriate places out of your classroom with appropri-ate documented departure times.

Teach your students that it is not ac-ceptable to go to the restroom during the class when an administrator is in the room evaluating you.

When in doubt about what makes a teacher effective, ask your students and administrators who they feel represents the caliber of excellence in teacher standards they know on campus. Hunt these teachers down and ask to observe them, even if it is the freshman girl's volleyball coach or a fi rst-year physical science teacher. Hopefully, you will discover that it is not a lecture of boredom that is going on. You should see in-

Number 12

- - Find and observe the superior teachers on your campus.

sible, put the clock above the students where they normally stand/sit. Here’s a minor, but surprisingly major issue for some. Acknowl-edge that your administrator is in the room; the administrator will usually wave and sit down, if they enter when the bell rings. If the administrator arrives during the middle or end of your class, and you have not prepared your students expect most students to point or create a distraction. The unprepared students will over-react and your lesson becomes completely disrupted. However, if you fail to notice someone entering your room, a trained observer will wonder what you might do if a stranger were to enter the classroom. Maintain these expectations.

.

Number 11

- - Prepare drills for when an administrator arrives in a room.

- i- if students are sick and are sitting out, make sure they have an "evaluation form" of their own and not doing homework for another class.

Number 10

- - Write down reflective questions in your lesson plans to ask your students.

- - Know who your administrators are their strengths, their evaluating methods/preferences.

- - Think of a way to ask your administra-tor a reflective question during your evaluation.

TTeemmppoowwaattcchh..ccoomm

KKnnooww YYoouurrTTeemmppoo AAss IItt

HHaappppeennss

Toll Free

1-888-803-6287

AAllllTThhiinnggssMMuussiiccaall..ccoomm

““TThhee MMuussiiccEEdduuccaattiioonn

YYeellllooww PPaaggeess””

Sign-up for YourFREE ChoralE-Newsletter,

Choral ResourcePacket & CD-Rom

SSttaarrttiinngg aa MMuussiicc BBiizz??

MMuussiiccBBuussiinneessssOOwwnneerr..ccoomm

Learn How to Start & Grow

Your Music Business

Get FREE Music Marketing CalendarEmail: [email protected]


Adams, Charlotte. Daily Workout for a Beautiful Voice. Santa Barbara, CA: Santa Barbara Music, 1991.

Bluestein, Eric. The Ways Children Learn Music: An Introduction and Practical Guide to Music Learning Theory. (GIA) 2000.

Ehman, Wilhem, and Frauke Hassemann. Voice Building for Choirs. (Hinshaw Music Press) 1982.

Jordan, James. Evocking Sound: The Choral Warm-up: Method, Procedures, Planning, and Core Vocal Exercises. (GIA) 2005.

Leck, Henry. The Boy’s Changing Voice. Milwaukee, WI: Hal Leonard , 2002.

Pausch, Randy. “Last Lecture: Really Achieving Your Childhood Dreams.” September 18, 2007. http://download.srv.cs.cmu.edu/~pausch/Randy/pauschlastlecturetranscript.pdf (accessed February 11, 2010).

Seelig, Timothy. The Perfect Blend. (Shawnee Press) 2005.

Bibliography

volvement from the students on every level from the way the teacher engages students and the transitions between the subjects or actions taking place, to the use of imagery or metaphors.

Take note of the ease with which an idea is expressed without talking as though you know everything and with as few words as possible. The time a teacher gives in a silent response is also critical, so silence is acceptable especially when doing a writing assignment. Experiment with your students and then, when observation day comes, you have a new desk drawer full of fi les to unleash upon and hopefully impress your administrator.

The greatest gift, however, is that you taught students various ways to appreciate music and life. Is this any different than what we did in the twentieth century? Yes, because we have so much technological advances af-forded to students and various ways to give the students music and listening ideas. No, because the administrator is still subjectively observing and critiquing based on how he or she observes you that day; this is nothing new. It is hoped this column gives you the courage to be different, to be daring, to be

teaching styles. Your students will thank you, and your friends, family, and co-workers will defi nitely notice a reduction in the stress because you have just fi ne-tuned your class-room environment.

NOTES

1 Timothy Seelig, The Perfect Blend, (Shawnee Press) 2005.

2 Wilhem Ehman and Frauke Hassemann, Voice Building for Choirs, (Hinshaw Music Press) 1982.

3 James Jordan, Evocking Sound: The Choral Warm-up: Method, Procedures, Planning, and Core Vocal Exercises, (GIA) 2005.

4 Henry Leck, The Boy's Changing Voice (Milwaukee, WI: Hal Leonard , 2002).

5 Charlotte Adams, Daily Workout for a Beautiful Voice (Santa Barbara, CA: Santa Barbara Music, 1991).

6 Eric Bluestein, The Ways Children Learn Music: An Introduction and Practical Guide to Music Learning Theory, (GIA) 2000.

7 Randy Pausch, "Last Lecture: Really Achieving Your Childhood Dreams," September 18, 2007, http://download.srv.cs.cmu.edu/~pausch/Randy/pauschlast lecturetranscr ipt .pdf (accessed February 11, 2010).

prepared to laugh with your students, and, most of all, to both respect the profession you have chosen, and have some fun while you are being observed. Oh, and do not forget to turn in your fundraising money at the end of the day.

After reviewing the inventory of fi les, per-haps you begin to notice something. These are not just how-to lists for choir teachers getting evaluated. Randy Pausch, in his Last Lecture, presented life lessons that continue to stay with me today. He offered the follow-ing bits of information, not necessarily as life lessons for his audience, but for his own kids: (a) Don't complain; (b) Be good at some-thing. It makes you valuable; (c) Work hard; and (d) Find the best in everybody.7 Once you establish these basic principles, you may never have to run a drill. You will never have to look over your shoulder or be concerned about what the evaluator is writing.

Your students will feel empowered to make the daily learning of music a respect-able and informative hour of their day. Your attention to the details of concert planning, selection of music, moving to the music, music-specifi c designed warm-ups, constant sight-reading, and classroom discussions will become second nature after a few years. And, hopefully, you will have given your students some life lessons along the way and taught yourself a few, as well. It is never too late to make these alterations to your

Number 13

- - Talk less/Sing more. - - Remind students about the art of music

and the language of music.

- - Incorporate ways to discuss how your classroom is more about life than just singing

- - Be different.

- - Be humorous

- - Be daring.

- - Be prepared.

- - Turn in your fundraising money.

ValueOur goal is to provide your group with unique opportunities

for memorable and life-changing experiences. We provide

skilled handling of all the technical and logistical details;

securing the performance opportunities your group needs, and

balancing your musical, sightseeing and cultural schedules.

This tour was exceptional: The quality of performance venues; great audiences; the number of performances balanced with

relaxation time and sightseeing. We were well cared for and enjoyed every minute.

We hope we did our part in return by providing quality performances!

Deborah DeSantis

Artistic Director and Conductor

Colorado Children’s Chorale

I was extremely pleased with this tour and the highly professional manner in

which it was planned and carried out. The venues were excellent, our concerts were well publicized and attended, all travel

arrangements went on without a problem, and the itinerary was just right. Once

again, ACFEA has won my admiration, thanks and continuing business.

Jeffrey Riehl, Director

University of Richmond

Schola Cantorum

Even with considerable limitations of time and budget, ACFEA accomplished

an amazing feat in planning and implementing our tour. This was my fifth international tour, and it easily

superseded all the rest. I will never travel with another carrier.

Randy Haldeman, Director

University of North Carolina

Charlotte Chorale

800-886-2055 CST 2063085-40

Photos: Highland Park United Methodist Church Chancel Choir in La Madeleine,

Paris; Houston Symphony Chorus in Church of St. Simon and St. Jude in Prague;

Lafayette College Choir in Florence; Fairmont State University Collegiate Singers

at La Parroquia in San Miguel de Allende, Mexico

ACFEA Tour Consultants 777 Grand Avenue, Suite 206, San Rafael, CA 94901

www.acfea.com . email: [email protected]


Book ReviewsStephen Town, editor, <[email protected]>

The Finale Projects (The New Approach to Learning Finale) Carruth, Tom Chicago, IL: GIA Publications 360 pp with CD-ROM $39.95 G-7203 (spiral-bound)

I have been using Finale since 1991, only three years after it was introduced. I remem-ber the wonder and fascination of actually being able to put my music into a computer and print it out in clear, professional looking quality. Although, if the truth be known, as I look back on those scores, they were far from professional quality! Both my ability with Finale and the program itself have come a long way since the early days, and many now know Finale as one of the leading music printing and publishing programs available on the market today.

Those of us who have been dealing with Finale for a decade or more will also remem-ber that the program used to come with a printed reference manual and a couple of tutorials to get you started. In fact, I fi rst learned Finale by painstakingly following through a series of the provided tutorials, and it was as good a way as any to learn the basics of a very complicated program. For a number of years now Finale has only been packaged with a “built in” reference manual. While I have always believed that the Finale reference manuals are, for the most part, very user friendly, I can only imagine the challenge it would be to learn what has be-come a very complex program, from scratch without a tutor. It seems to me that most of those who might be trying to learn Finale this way do not have the luxury of multiple screens on which they might open both the Finale score and the user manual at the same time. Therefore, beginning Finale users have to switch continually back and forth between the manual and the score, a tedious and laborious process to say the least.

Tom Carruth is a MakeMusic, Inc. clinician and product specialist for Finale who has been involved in the music business, espe-cially in relation to sound engineering and music production for many years and has been involved with Finale since practically its beginnings in 1988. Carruth has authored The Finale Projects (A New Way of Learning Finale) which, as the preface says, “is designed to teach the most consistent, intuitive, and easiest method for using Finale.”

This book, which is spiral bound and over 300 pages, comes with a video training CD-ROM and is divided into ten chapters beginning with “Getting Acquainted with Finale” and fi nishing with “Miscellaneous Top-ics.” Finale is a tool palette driven program in which one selects the right “tool” for the job to be done, for example, entering notes or expression marks or adding lyrics or any of the myriad of other elements that go into creating a complete musical score. As the name suggest, this text is really a series of projects each of which is a little more in-volved than the one before. Simple score set up and note entry is dealt with early on and by the last few chapters one is working on Jazz notation, percussion scores and creating tests and worksheets. There are many pic-tures of screen shots from the program itself and a creative use of margins to show the primary computer keypad keys that need to be held down for a particular entry to be made. These margins also have a graphic of a student holding up his or her hand to ask a question, and these indicate that the text presents a possible question that may have arisen at that point in the particular project being completed.

The pages are easy on the eye and not crowded. Concepts covered in each chap-ter are summarized at the beginning of the chapter, and clear reference is made to the video samples that should be used in con-junction with each chapter.

A primary challenge faced by Carruth in

this text is the fact that Finale, while at the beginning exclusively a Mac program, has for many years now been available for both Mac and PC computers. As anyone who has used both Macs and PCs will know, however, there are some fundamental differences in the keystrokes and key combinations used on each platform for shortcuts and other internal functions. Carruth has taken time in his opening chapter to explain in some detail how this book deals with that challenge, and throughout the text there are always instruc-tions given for both Mac and PC users.

It seems now as though every year there is a new upgrade to Finale. Sometimes I have paused to ask myself what could possibly need to be updated again this year! This situ-ation does pose a problem for Carruth, who in this text had to decide how to handle the fact that, in order for this text to be useful to as wide a range of new Finale users as pos-sible, he needs to account for the variety of versions that they all might be using. This text

ProfessionallyTailoredGowns ofLastingBeauty

1.800.847.7977 • lyricrobes.com

FREEcatalog& fabricsamples

Lyric Choir GownCompany

AZ


Book Reviews

is really designed for Finale 2006 (the year they started the default view as studio view) through 2008; however, it would be effective in 2009 and 2010 versions as well, as not that much has changed. For the most part, it would also be useable in earlier versions of Finale, but as you can imagine, the older the version, the more accommodation that would need to be made for the idiosyncra-sies of each new edition. To accommodate the various versions covered in this text, Carruth has continually noted when there is a slight variation in the necessary keystroke sequence for affecting a particular aspect of the program. Once you are used to it, this is fi ne, but it can seem a little confusing at fi rst, especially as one is also dealing with the Mac versus PC differences at the same time.

Another factor to bear in mind is the fact that this is no “Finale for Dummies” text and there is an assumption that the user has a basic competency with computers. Equally, for this text to be effective, one must be comfortable with taking one’s time in each project. It is not easy to work through each of these projects if you are completely new to Finale. You have to read the text carefully, and then be prepared to reread sections of it as you work at the computer to accomplish the tasks in each project; but if you have the patience and time to put in, you will be rewarded with clear instructions that lead to a completed and informative project

each time.The addition of the video training CD-

ROM is excellent. Each selection compli-ments the chapters in the book, and are easy to watch and very informative. Not everyone easily assimilates information from the printed page, and the selections on the CD-ROM make much information available to those who prefer to learn by listening and watching. As mentioned above, whenever there is a specifi c part of the CD-ROM that is pertinent to the text a reference to the CD-ROM is clearly made in the margin of the text. Together the text and CD-ROM make a powerful learning tool.

So perhaps it would be best to summa-rize this review.

Less attractive qualities:

• Having to constantly accommodate both Mac and PC versions

• Dealing with multiple editions, which begs the question, how long will this book be effective—we are already two editions past the offi cial range of this text

Attractive qualities:

• Clear print and pages that are not crowded

• There are many pictures and a creative use of margin space

• Well-organized in a logical fashion

• “Teacher I have a Question” sections anticipate potential questions and problems

• The included CD-ROM is very helpful and effective

It is also worth noting here that this text, while its primary audience is supposed to be fi rst time Finale users, may be effective for a secondary audience. Those who have already gained a basic knowledge of how Finale works, but are interested in deepening their skills in certain areas (e.g. jazz notation or percussion notation) may well fi nd this a useful reference guide.

No matter how good a book like this may be, learning a complex program such as Finale is no easy matter. This text, if used patiently as it is intended, and complemented with good basic computer skills, will do what it claims, and give you a solid foundation in the function of Finale as you begin to take on your own creative music printing or composition projects.

Ian Coleman Liberty, Missouri

Gregorian Chant: A Guide to the History and Liturgy Saulnier, Don Daniel, OSB, and Mary Berry, CBE (translator) Brewster MA, Paraclete Press [English Translation] 2009 147 pp. $19.99 ISBN: 978-1-55725-554-9

Don Daniel Saulnier’s book, Le Chant grégorien par un moine de Solesmes, origi-nally published in 1995, is now available in an English version: Gregorian Chant: A Guide to the History and Liturgy. The translation, by English musicologist Mary Berry, was nearly completed at the time of her death in 2008 and subsequently pieced together by the


publisher. This volume is not a large-scale analysis or extensive history of the Gre-gorian chant repertoire but rather a short and simple introduction to the origins and forms of the musical and liturgical elements of the Roman rite (including the various parts of the Divine Offi ce and Mass). For a fuller and more comprehensive look at the corpus of music, one might consult Willi Apel’s Gregorian Chant.

Berry’s translation (or, at least, the pub-lisher’s ordering of it) follows a simple plan. First comes a history of what we now know to be “Gregorian” chant (but is really the collection of music accumulated throughout various areas of the Western Church in the two centuries leading up to Pope Gregory I), then a matter-of-fact introduction to the

liturgical services in the Roman church and brief descriptions of their many musical elements. Concluding the book is Saulnier’s assessment of the most important extant manuscripts of chant notation. A recurring theme in this book is the notion that per-formance of chant requires full knowledge of all texts regarding musical performance, even those that do not include notational symbols:

To gain any idea in our own day of the authentic sound of the Gregorian repertory requires, therefore, that we place, side by side, the melodic version (in staff notation) and the information we are given in the most ancient manuscripts with neumes” (p. 130).

Saulnier’s ranking of the various elements of the liturgy is quite interesting, particularly for conductors of modern choral music. After countless hours of conducting works set to the texts of the Mass Ordinary (Kyrie, Gloria, Credo, Sanctus, Agnus Dei), we often tend to consider these texts supreme. For Saulnier, the Mass Ordinary texts come in the chapter labeled “Other Chants” near the end of the book. To put yourself into the minds of medieval musicians, you must fi rst realize that the chants for the Ordinary originally did not have the special status they do today. The most signifi cant texts for your everyday monk were the Psalms, and Saulnier gives a very detailed and engaging discussion on how the practice of cantillation, what he calls “stylized declamation” (p. 31),

Come and meet the international choral world in the United States!All choirs from all continents are welcome!Competitions, gala concerts,encounter concerts, seminars and workshops.Also upcoming:The American International Choral Festival,Reno, May 4-8, 2011

www.interkultur.comINFORMATION & CONTACT:Christina Prucha, [email protected]: (405) 232-8161Hugh Ballou, [email protected] Phone: (888) 398-8471

November 17– 21, 2010

INTERKULTUR event in partnership with the American Choral Directors Association,in collaboration with St. Louis represented by St. Louis Convention and Visitors Commission and the Regional Arts Commission


Book Reviews

was instead the beginnings of Western chant. He emphasizes the early link between text and music and how this symbiosis was easily adapted by Mediterranean languages, which he argues have a natural singsong nature.

After introducing the importance of Psalmody, Saulnier takes you through the ori-gins and liturgical signifi cance of each of the chants of the Divine Offi ce (i.e., the monastic liturgical units as defi ned by St. Benedict) and then the Mass Proper and Mass Ordinary. For the Divine Offi ce, the author discusses Antiphons and Responsories, among others. For the elements of the Mass, there are the more familiar pieces (to modern readers) including Introits, Alleluias, Graduals and Of-fertories. For each of these liturgical blocks, Saulnier discusses their textual origins and shows how the Roman service developed them into the forms we know today.

The Alleluia, for example, was originally intended only for Easter but was then ex-tended to all Sundays of the year except in Lent. He argues that the music of the Alleluia, because it is frequently more complex than other elements in the service, shows that the shift to having this chant every week came relatively late, probably some time after the adoption of the Roman chants by Gal-lican musicians (eighth and ninth centuries). Saulnier’s histories of individual chants are

fascinating and worth consulting, especially when programming chants in a recital or church service. Used in conjunction with Ron Jeffers’s Translations and Annotations of Choral Repertoire: Sacred Latin Texts, this book will offer plenty of information for service leafl ets and program notes.

Saulnier also offers a valuable history of the nineteenth-century monks at Solesmnes and the beginning of the modern restoration of the Gregorian repertoire. Music history textbooks usually gloss over the importance of these monastic musicologists, but Saulnier gives plenty of information about the monks themselves and the motivations behind their work. Being a priest at the Abbey of Saint Peter of Solemnes, the author is able to offer an insider’s perspective.

Because the author is himself a priest, the tone of the book occasionally shifts from “musicological” to “theological.” Saulnier’s history, for example, begins with the spread of the “Christian message” not “Christian-ity” (p. 1). His evaluations of individual chant forms are often peppered with theological side comments such as discussions about how cantillation can transport the listener to another world (p. 29) or references to the hymns often being used as vehicles for “disseminating heretical ideas” (p. 110). Because of these additions to the analyses,

one is sometimes unsure of what is historical fact and what is Saulnier’s theological take.

Fortunately, as an addition to the litera-ture on Gregorian Chant, this book holds up as both a musicological and theological work. Saulnier puts himself not at the cli-max of Chant study but in the middle of a continuum of scholars who are constantly uncovering new evidence on the historical performance practice of medieval music. The conclusion of his chapter on the history of Gregorian Chant emphasizes his central argument—that consideration of multiple sources is the key to understanding the repertoire:

The or igins of the Gregor ian reper tor y remain shrouded in mystery, making it impossible in our day to be certain that there exists a single manuscript archetype of this repertory, a unique and totally reliable source of all the documents that have come down to us.. .However, we now know which are the most important witnesses of the tradition: they are catalogued and studied; they are gradually revealing their secrets (p. 16).

Kevin ZakreskyChatham, Virginia

Scores to Settle: Stories of the Struggleto Create Great MusicGilliland, Norman Madison, Wisconsin: NEMO Productions 2009 395 pp. $21.95. ISBN: 978-0-9715093-3-7.

Radio personality Norman Gilliland’s latest offering, Scores to Settle: Stories of the Struggle to Create Great Music, a kind of se-quel to his popular Grace Notes for a Year, is a volume of musical anecdotes from classical music history very much like its predecessor. The book consists of 366 entries (one page for every day of the year), each delivering up some little-known fact regarding that par-ticular date in the history of classical music performance and composition. Gilliland takes

Highest Quality at Best Prices

2012 China International Chinese Choral Festival Performance Opportunity at China National Center for the Performing Arts

“Thank you for a world class tour! It exceeded our expectation in every aspect” - Dr. Donald Neuen, Director of Choral Activities, UCLA


the reader from January 1st to December 31st, sharing stories of the confl icts and turmoil which accompany the composition and production of music: from operas to symphonies, oratorios to piano recitals.

The title is, unfortunately, a bit mislead-ing. One expects each story to involve some sort of Beethoven-esque triumph such as the composition of Eroica or quo-tations from the Heiligenstadt Testament. (Beethoven’s rather serious fi gure in fact graces the cover of the book.) Instead, we are introduced to a cast of characters that includes many musicians on whom there is very little written: composers such as Karl Goldmark and violinist Leopold Auer. To be certain, the book is full of stories about the likes of Verdi and Mozart as well, though it is the inclusion of Gilliland’s “not-so-well-knowns” that makes the book particularly unique.

Scores to Settle is best read in random order. Because each new page offers another calendar date, there is no narrative progres-sion to the book and therefore no reason to start at the beginning. This book belongs on the coffee table, particularly in the waiting rooms of all music studios. It’s a chance to get a few bite-sized pieces of music history into your brain before your piano or cello lesson.

I must admit that, once I discovered the day-by-day structure of Scores to Settle, I im-mediately went straight to my own birthday. Once there, I learned about pianist Henri Herz, the man that Schumann deridingly called a “stenographer.” It was interesting to learn what tours to America looked like in the nineteenth century: concert offers from P. T. Barnum, recitals with gimmicks such as a stage illuminated by one thousand candles, and patriotic bandstand shows with sixteen pianos and fi ve orchestras. Though none of this information would likely appear on any music history exam, it is nonetheless fascinat-ing to read about the everyday existences of touring musicians in that era.

Next, I had to see whether the author was able to include February 29th in his list of anecdotes. In the place of this infrequent date, Gilliland offers a short biography of the Polish violinist George Augustus Polgreen Bridgetower, a personal friend of Beethoven who died on February 29th 1860. After that, I started fl ipping randomly, sometimes

stopping when I recognized a picture of Lorenzo da Ponte or Arnold Schoenberg. Gilliland certainly favors some composers with more entries than others. The Robert and Clara Schumann saga is played out over many entries and Verdi’s letters are quoted several times.

Gilliland has a habit of beginning many of the stories with some sort of hook, compel-ling the reader to keep going. For July 13th, the fi rst paragraph reads:

Malcolm Arnold’s music for David Lean’s 1957 fi lm The Bridge on the River Kwai earned him an Oscar, but he described composing it as one of the worst jobs he’d ever had (p. 195).

How can you stop there? It is diffi cult to skim through Scores to Settle when so

many of Gillilland’s stories begin with such a forceful opener.

Gilliland’s style is economical and informa-tive. His stories have a certain brevity and form to them that would lend them well to a radio broadcast. An index of composers and performers at the end is also very helpful if you are looking for an anecdote to comple-ment a paper or speech. I am sure that I will use the book as a reference for many of my own lectures and presentations in the future.

Kevin ZakreskyChatham, Virginia

Lynne Gackle currently is associate professor of music

and associate director of choral activities at Baylor University,

where she conducts the Baylor Women’s Choir and the Baylor

Concert Choir. Lynne is an active clinician, conductor, and

adjudicator for choral clinics, honor choirs, workshops, and

festivals throughout the United States and abroad.

Gackle has conducted all-state choirs in 26 states, several

division ACDA honor choirs, and two ACDA national honor choirs. Her choirs performed at

American Choral Directors Association state, division, and national conferences and the Music

Educators National Conference Biennial Convention. Internationally, she conducted the Australian

National Choral Association’s High School Women’s Choir in Brisbane, the Alberta Choral

Federation’s High School Honour Choir in Calgary, the DoDDS Europe Honors Music Festival

Mixed Choir, in Wiesbaden, Germany and the Haydn Youth Festival in Vienna, Austria.

Lynne has served as president of ACDA-Florida and the ACDA's Southern Division. The

Florida ACDA Chapter awarded her the Wayne Hugoboom Distinguished Service Award for

dedicated service, leadership, and excellence. Lynne has also served in various R&S roles within

ACDA, including National R&S Chair for Children’s Choirs. Currently, she serves on the editorial

board for the Choral Journal. She is the editor of Choral Artistry for the Singer with Walton Music

and the Lynne Gackle Choral Series for Colla Voce Music, Inc. She has written several articles for

the Choral Journal and contributed to the MENC publication, Music at the Middle Level: Building

Strong Programs. Lynne is the author of Finding Ophelia’s Voice, Opening Ophelia’s Heart: Nurturing

the Adolescent Female Voice, to be published by Lorenz Music Corporation in 2010. Additionally,

she currently serves on the repertoire task force and as a lead author with Glencoe/McGraw Hill.

She is a member of ACDA, MENC, the Texas Music Educators Association, the Texas

Choral Directors Association, ISME, and NATS. Gackle received her BME from Louisiana State

University and her MM and DME from the University of Miami in Coral Gables, Florida.

Women's Honor Choir instructions are available on the ACDA Web site at www.acda.org/conferences.

Women's Honor Choir Conductor


ssociation The draft was sent to charter success and subsequent growthAsAssosociciata iion. The draft was sent to c aharter me bmberrss foforr susuggggesestitiononss. H Hararryry R Roboberertt Wilson was thhe authhor fof thhe fifin lal ver ision

and dedicated to the purpose that the new organization would support the fi nest choral music and music-making, through word and deed. The fi rst annual ACDA convention, March 16–17, 1960, in Atlantic City, NJ, was held in conjunction with the MENC national convention and was planned by ACDA of-fi cers. It was led by its fi rst president, Archie Jones, who was Dean of the University of Kansas City’s Conservatory of Music. It included concerts, clinic demonstrations, panel discussions, reading sessions, and two general business sessions. Once again, the early leaders hit on a formula that continuestoday for convention planning. In addition, the early conventions provided a forum for appropriate business meetings that resulted in major constitutional changes such as a more formal election system, terms of offi ce, etc. The business meetings also provided an opportunity for “feedback” and suggestions from grass roots members.

The early presidents and offi cers were generous not only with their time, but also with their personal fi nancial support, since ACDA had only a small fi nancial base. Dues were set at $6 per active member. Imagine planning a convention with little money, no track record or reputation, where those in attendance would be paying their own way, since no one at that time received expense money. The founders recognized the need for high standards at the conventions, held critic sessions, and encouraged famous cho-ral conductors and scholars to participate. Roger Wagner was one of the fi rst to active-ly support ACDA and he appeared on sev-eral early convention programs stating loudly that “the joy of attending a choral convention was that he did not have to rub shoulders with band directors.” Later, Robert Shaw and Margaret Hillis gave of their talents and recommended that this new organization was worthy of serious support. Four other well-known and infl uential choral conductor/educators were also pro-active supportersof ACDA: Harry Robert Wilson, Teachers College of Columbia University, who wasalso a member of the Steering Commit-tee; Helen Hosmer, Crane School of Music, State University of Potsdam; Elaine Brown, Singing City; and, Howard Swan, Occidental College affectionately called the Dean of

hss o off ofoffifi cece t too bebe t takakenen n tthehe B Bibiblle; yet, one must iic deesisirre to serve fellow OOver the

teeered ththeaan notot, setoood oof theyy-fi vee natidd meentty off backoors oof unees, Immig, M,, Pricce, Googramms (H

mme wwere ceeckerr,, Hirt, Collins, T. Kirk, WWhittten, Haberlen, Price); sst in their early careers cc in tthe public schools, a rreerss (ten or more years) mmusicc programs (Leland,

iintennded to capture an aaccommplishments of AC-rresideents as they presided ees andd educational trends perffoormance. The reader

many oof ACDA’s goals and rrs to come to fruition un-oof connsecutive presidents, eees, aand national boards.

oof ACCDA presidents from oon inspired doctoral stu-rr collleagues to become hhe oorganization: Warner ssity oof Colorado (Collins,

Hirt at the University oornia (Saltzman, Whitten, kk at thhe Florida State Uni-ooom)); and Harold Decker f Illinoois (Mathis, Haberlen, ffeelstaadt). These pioneers ees off outstanding ACDA rrvice that their younger eents aand colleagues could

ssidennts who had skills be-aat weere considerable and

Wooodyy” Keister was an air-r, an eexercise fanatic; Hirt ddrovve a luxury Citroen;

tic direector/conductor/ac-meer off Broadway musicals

Mexxico; Collins was an CCaseey, a trout fl y fi sher-

maasterr magician who still rrms aat the Magic Castle nnd wwas the fi rst full-time ff the Dale Warland Sing-pprincipal timpanist in the and a “rock” drummer;

ett cheef; Price, an excellent GGroom an accomplished

ellemeent that bound this ttogo ethher was that they cono ducttororss tht rougghout

f th i th

babasesedd inin C Cololumumbubuss, O Ohihioo. M Mosostt chchororalal c conon-dductors hthat are successffull hhave d dev lelop ded tremendous organizational skills in addition

possessed strong collaborative personalities that resulted in achievements supported by the ACDA Executive Committee, elected offi cers at the division (National Board) and state levels, various committees, and the Repertoire & Standards appointees. All ACDA offi cers had sincere, honest, and dedicated attitudes that enabled them to succeed during their terms of offi ce.

Early Years

1959–73The initial suggestion for an organiza-

tion of choral directors was made in a letter dated December 2, 1957, by Robert Landers, conductor of the United States Air Force’s “Singing Sergeants.” Landers included a recommendation for the formation of a seven-member steering committee whose task was to solicit support for the idea of this new choral organization. The committee was successful in setting the course of the organization and arranging for its fi rst formal meeting. Four members of the Steering Committee later became national presidents (Jones, Hirt, Imig, and Keister),

On February 4, 1959, thirty-fi ve choral directors met in Kansas City, Missouri, for the specifi c purpose of possibly establishing a national organization of choral musicians. The meeting, held in conjunction with the national convention of The Music Teachers National Association, [not MENC] produced the new organization’s name and ideas for a constitution and bylaws and the basic struc-tural framework that would allow for the organization’s monumental growth. It was originally designated the American Choir-masters Association, but those attending the meeting approved and adopted Woody Keister’s proposal that the organization be named the American Choral Directors As-sociation. Unlike the organizations it was based on, application for membership was open to all choir directors. The American Choral Directors Association was to cover the needs of all choir directors, not just a small subset.

The fi rst fi ve presidents charted the beginnings of the young organization by overse ieing tthhe w irititing off ththe ACACDADA CCon-

success and subseqquent ggrowth.

bebersrs/E/Elelet decadecreate aew memKeister

w

… at this full valu

ar basis. h six huna visionar

well as a distinguished membeour profession.

By May 1963, the membership ifrom 600 to 1000 members, anlater to 1600 members. Namesmembers were printed in each issChoral Journal throughout much of tlACDA’s growth occurred despitethat until 1973, a choral director hrecommended for membership. Thattest to ACDA’s phenomenal gropopularity.

It took a number of years tostandard election procedures; elections were informal and in it seemed as no surprise that fouseven-member Steering Committelected president. At times, only owas submitted on a slate. Warnerscribed the process, “All those in attat a national meeting were handedTheir marked ballots were countedfi nal tally announced. It was fast, ecoand very relaxed.” Obviously, earlywere elected by the small number members who attended the conveinclude more members in the proBoard approved a motion in 1964future elections by mail with the retifi ed by an independent CPA. Thisin voting numbers that were propothe total number of members, whicMarch 1973, grown to over 4000 m

Candidates selected to run forpresident, from the beginning of ton were carefully chosen by a nocommittee and the nominees had eresumes of achievement and yearsous and proven effective service t(Table 1). Most nominees had serveand division presidents and had srunning state and division conveaddition, many national president nalso had served on national ADCAtees and/or as R&S Committee ch

An Emphasis on Choral RepertPerformance Practices

As universities and colleges begmusicologists such as Julius HerfoM d h h i li d

KeKeisisteteeeesvsvsvsvilililillleleee

atinn anananbb kk

Keiesviinn anan

which certain elements were utilized by the fl edgling choral group. The offi cially desig-nated charter members of ACDA launched what has become one of the world’s most signifi cant infl uences in choral music.

The early presidents were papapapapapapppppppp ssssssssssssssssssssioioioioioioioioioioioioioionanananananananananananananananattetetetetetetetetetetetetetete ananananannananannananananddddddddddddd dddeedeedededeededededededidididididididididididididiccacacacaccacacaccacacacattttetetetetetteteetetetetedddddddddddddddd tttttototototototototototo tttttttttttttthhhhhhhhhehehehehehehe ppppururpose that the new

kkgkgkgkgkgkgkgkgkggggkgkgkgrounds: some niiivvveveveveveveveveveveeveveversr ity music Mathhhisisissssisisisisis, , ThThTTTTTTTTTTTT orsen, room) or r lalalalalalalalalalalalalalalalargrgrgrgrgrgrgrgrgrgrgrgrgrgrgrge e eeeHirt, Decker, C. composers/edi-t Collins T Kirk

tasks. These skills, possessed by all the ACDA presidents, enabled them to establish practi-cal goals and objectives for the organization that were accomplished by hard work and dededededededededededededededed tetetetetetettetttt rmrr ination with the assistance of the nation llllal ooooffififfiffiffiffiffiffiffiffiffiffiffiffiffifficcccccccccccc ceeeeeeeeeeeeeee stststststststststststststststafafafafafafafafafafafafafafff.f.f.f.f.ff.f.T T T T TT Thehehe national presidents possessed strong collabora iititivee pppererrerersosoososososonanaaananananananalilililililiilliillilililili itititittititititititititieesseseeseseseseseseses

ACDA is in its infannnnnnnncccccycycycycycycycycycycycy …no one can gggggggggguauauauauauauauauauauaaaaaarrrrrrrrrrarararantee any meeeembmbmbmbmbmbmbmbmbmbmbmbmbmbmbbeeeeeeeererer on a dollmmmmemememememememememememememmbmbmbmbership along withothers, marks you as awell as a distinguished

state orgag nizations was also a model from which certain elements were utilized by the

nnnndddddddd dd women who kkkkkkkkkkkkkk d

and plp an tours in addition to manyy other tasks These skills possessed by all the ACDA

UnUniviverersisityty o off FlFlororidida,a, G Gaiainnnnnnneeeeenen

WiWiWiWiWiWiWiWiWilslslslslslslslslsononononononononon wwwwwwww w wasasasasasassasas tttttt t heheheheheheh aaa a autututhohor of the fi nal version of the new organization’s ten pupurprppprprpososososssososososososesesesseseseseseseseseseseses;;;;;;;;;;;;;; ; anananananananananananananandddddd dd ddto this day, these purposes, as adopted at that time, have remained largely unchanged with the exception of two purposes added in 1975. MENC’s fl owchart of division and

to serve fellow e e yeyearars, A ACDCDAA eir time selfl essly y yyyyyyyt aside pepepepepepeeeeersrsrsrsrsrsrsrsrsrsrsrsrsrsrssooooooooononononononal e orgrgrgrgrgrgrgrgrgrgggggggaaaaaaaanananananananananiiiization. oooonnnnnnnnnananananananan l presidents

tremendous organizational skills in n adadadaddididididitititittititionononononononn toto t theheirir m musususususussicicicicicicicicicicicccalaalalalalalalaalalalalalal ttttttttttttt t talalalalalaalalalaalalalalaleeeenenenenenenenenentttttttststststststs. AAAAAfAfAfAfAfAfAfttter all, conductors dededededededededededededededede isisisisisisisissisisisisisisiggggngngngngn warm-ups and musical objectives for rehearsals, select repertoire for programs, write notes for concert programs, recruit singers, promote their choral organizations,

ReRecrcruiuitmtmenentt ofof M MemembbThThThThThThThThhhhThThTheeeeeeeeeee ofofofofofofofofofofofofofofofo fififi fi fi fi fi fi fi fi cecec rs in the fi rst

70) also realiliiilizezezezeeeeeeeeeddddddddddddd d dd thtttt at to cbase, the recruitmennnnnttttttttttttttt t ofofoooooooooooo neessential In 1962 Woododododododddddddddddyyyyyyy

ststatatee ororgaganinizazatitiononss wawass alalsoso aa mmododelel ffrorommp

nndddddddddddd women hwho anandd plplanan ttouoursrs iinn adaddidititionon ttoo mamanyny ooththerer, yyyyyyyyyyyyy

UU ii iit ff FlFl idid GG iioooonnnnnnnann p es de ts g p g essential. In 1962, Woodddddddyyyyyyyyyp essential. In 1962, Woody

state organizations was also a model fromnd women who and plan tours in addition to many other University of Florida Gaine

The Choral Journal: The Choral Journal: An Index to Volume FiftyAn Index to Volume Fifty

by

Scott W. Dorsey

1. Choral Composition, Arranging, Editing and Publishing

“Copyright: Know the Law,” by Ken Thomas. 8/09:49.

“Choral Music in the Digital Age: Distributing Your Music Online,” by Bryson Mortensen. 5/10:63.

2. Composers and Their Choral Music

“Swedish Soul: Hugo Alfvén and His Folk-Song Arrangements,” by Nathan Leaf. 8/09:18. BIB.

“Haydn, a Prince and Beethoven’s Mass in C,” by Jeremiah W. Mc-Grann. 9/09:9.

“Haydn’s Musicians at the Esterházy Court, 1796–1802,” by Kathleen Lamkin. 9/09:24.

“A New View of Haydn: A Twenty-fi rst Century Reassessment of the Masses of Joseph Haydn,” by Robert W. Demaree and Don V. Moses. 9/09:38.

“Textual Presentation and Representation in Stravinsky’s Choral Works,” by Kevin Zakrekey. 10/09:9.

“Universalism and Particularism in Ernest Bloch’s Sacred Service,” by Joshua R. Jacobson. 11/09:20.

“Modernism and Byzantine Infl uence in Rautavaara’s Vidilia, Part One,” by Charles W. Kamm. 10/09:47.

“Modernism and Byzantine Infl uence in Rautavaara’s Vidilia, Part Two,” by Charles W. Kamm. 11/09:47.

“Roberto Sierra’s Missa Latina (Pro Pace),” by José Rivera. 3/10:6.

“Jeffrey Van’s A Procession Winding Around Me—Four Civil War Poems: A Wedding of Text and Music,” by John Warren. 4/10:6.

“A Historical and Pragmatic Approach to Lili Boulanger’s Psaume 130, Du fond de l’abîme, Part 1,” by John Perkins. 5/10:8.

“A Beginner’s Guide to Prophesy: Orlande de Lassus’s Prophetiae Sibyllarum,” by Jonathan Harvey. 6/10:8.

“New Solutions for Lili Boulanger’s Psaume 130, Du fond de l’abîme, Part 2,” by John Perkins. 6/10:18.

3. Choral Conducting and Choral Techniques: General

“Technology for the 21st-Century Choir,” by Philip Copeland. 12/09:22.

4. Choral Conducting and Choral Techniques: Auditioning and Adjudicating

“Preparing Recorded Auditions,” by Linda Cressman Busarow. 8/09:52.

“Tonal Memory in the Choral Audition,” by Tony Mowrer. 5/10:20.

5. Choral Conducting and Choral Techniques: Formations

“The Effects of Choral Formation on the Singing Voice,” by Debra S. Atkinson. 3/10:24.

6. Choral Conducting and Choral Techniques: Conducting Tech-nique

“Beyond Error Detection: A Cycle of Pedagogical Skills for Choral Conductors,” by Patrick K. Freer. 10/09:34.

“University Conducting Class: A New Solution for Capturing Digital Video,” by Craig Zamer. 12/09:49.

“Thoughtful Gestures: A Model of Conducting as Empathetic Com-munication,” by Amelia Nagoski. 4/10:18. BIB.

“Letter to the Editor,” by Tom Carter. 6/10:6.

“Letter to the Editor,” by Willem Blees. 6/10:7.

7. Choral Conducting and Choral Techniques: Rehearsal

“The Speechless Rehearsal,” by Alan J. Gumm. 2/10:16.

Subject Classifi cation

The classifi cation numbers used below correspond to subject headings in all ACDA monographs utilizing bibliographic format, particu-larly the Choral Journal: An Index to Volumes 1–18 (Monograph No. 3) by Gordon Paine, and the Choral Journal: An Index to Volumes 19–32 (Monograph No. 7) by Scott W. Dorsey. Subject classifi cations with no entries for this volume year have been omitted from the listing. “REP.” “BIB.” and “DISC.” are abbreviations for repertoire, bibliography, and discography.


the American Choral Directors Associa-n at the state, division, or national level.

th f ffi t b t k

tremendous organizational skills in addition to their musical talents. After all, conductors design warm-ups and musical objectives for

Association and the College Band Directors Association. The draft was sent to charter members for suggestions Harry Robert

Recruitment of The offi cers in t

70) l li d here are no ooatathshs o off office to be takenhh o onene’’s h handd on thhesssseess an aalt i ti doralal colleagues. Oveccers have volunteere

dd, more often than nobition for the good of the organization. ACDA’s twenty-fi ve national presidents re multi-talented men and women who

me from a variety of backgrounds: some re administrators of university musicpartments (Jones, Imig, Mathis, Thorsen, berlen, Whitten, Price, Groom) or large

MA/DM/PhD programs (Hirt, Decker, C. k, Hatcher); some were composers/edi-s/arrangers (Decker, Hirt, Collins, T. Kirk, ders, Hatcher, Whitten, Haberlen, Price);

d, although most in their early careersght choral music in the public schools, a

w had primary careers (ten or more years)public school music programs (Leland, ore, Holt). This article is intended to capture an

erview of the accomplishments of AC-A’s twenty-fi ve presidents as they presided er many initiatives and educational trends horal music and performance. The reader

ould note that many of ACDA’s goals and ectives take years to come to fruition un-r the guidance of consecutive presidents, ecutive committees, and national boards. A small group of ACDA presidents fromearly generation inspired doctoral stu-

nts and younger colleagues to become ve leaders in the organization: Warner g at the University of Colorado (Collins, hitten); Charles Hirt at the University Southern California (Saltzman, Whitten, ce); Colleen Kirk at the Florida State Uni-sity (Mathis, Groom); and Harold Decker he University of Illinois (Mathis, Haberlen, tzenberger, Apfelstadt). These pioneers sented examples of outstanding ACDA dership and service that their younger neration of students and colleagues could d did emulate. There were presidents who had skills be-

nd conducting that were considerable and ed: Elwood “Woody” Keister was an air-ne pilot; Decker, an exercise fanatic; Hirt oke French and drove a luxury Citroen; this was an artistic director/conductor/ac-mpanist performer of Broadway musicals Santa Fe, New Mexico; Collins was and bird watcher; Casey, a trout fl y fi sher-n; Thorson a master magician who still ches and performs at the Magic Castle Hollywood; Leland was the fi rst full-time neral manager of the Dale Warland Sing-

Haberlen was principal timpanist in the rida Symphony and a “rock” drummer; hitten, a gourmet chef; Price, an excellent nnis player; and Groom an accomplished oompm anist.The cocommm on element that bound this siddenentit al group together was that they

g p j

presidents, enabled them to establish practi-cal goals and objectives for the organizationthat were accomplished by hard work and determination with the assistance of the national offi ce staff. The national presidents possessed strong collaborative personalities that resulted in achievements supported by the ACDA Executive Committee, elected offi cers at the division (National Board)and state levels, various committees, and the Repertoire & Standards appointees. All ACDA offi cers had sincere, honest, and dedicated attitudes that enabled them to succeed during their terms of offi ce.

Early Years


tion of choral directors was made in a letter dated December 2, 1957, by Robert Landers, conductor of the United States Air Force’s “Singing Sergeants.” Landers included a recommendation for the formation of a seven-member steering committee whosetask was to solicit support for the idea of this new choral organization. The committeewas successful in setting the course of theorganization and arranging for its fi rst formal meeting. Four members of the SteeringCommittee later became national presidents (Jones, Hirt, Imig, and Keister),

On February 4, 1959, thirty-fi ve choral directors met in Kansas City, Missouri, for the specifi c purpose of possibly establishinga national organization of choral musicians. The meeting, held in conjunction with thenational convention of The Music TeachersNational Association, [not MENC] produced the new organization’s name and ideas for aconstitution and bylaws and the basic struc-tural framework that would allow for the organization’s monumental growth. It was originally designated the American Choir-masters Association, but those attending the meeting approved and adopted Woody Keister’s proposal that the organization benamed the American Choral Directors As-sociation. Unlike the organizations it wasbased on, application for membership was open to all choir directors. The American Choral Directors Association was to cover the needs of all choir directors, not just a small subset.

The fi rst fi ve presidents charted thebeginnings of the young organization by overseeing the writing of the ACDA Con-stitution and Bylaws, creating a vehicle for cocommunu iccatatioon (t(thee ChC oro ala J Jouournala ),), sstrt ucuc-t i hi di i i d l i th

members for suggestions Harryy Robert tthhe fi fi n lal ver ision n purposes; and, as adopted at rgely unchanged purposes added

in 1975. MENC’s fl owchart of division and state organizations was also a model fromwhich certain elements were utilized by thefl edgling choral group. The offi cially desig-nated charter members of ACDA launched what has become one of the world’s most signifi cant infl uences in choral music.

The early presidents were passionate and dedicated to the purpose that the neworganization would support the fi nest choral music and music-making, through word and deed. The fi rst annual ACDA convention, March 16–17, 1960, in Atlantic City, NJ, was held in conjunction with the MENC national convention and was planned by ACDA of-fi cers. It was led by its fi rst president, ArchieJones, who was Dean of the University of Kansas City’s Conservatory of Music. It included concerts, clinic demonstrations, panel discussions, reading sessions, and two general business sessions. Once again, the early leaders hit on a formula that continuestoday for convention planning. In addition, the early conventions provided a forum for appropriate business meetings that resulted in major constitutional changes such as amore formal election system, terms of offi ce, etc. The business meetings also provided anopportunity for “feedback” and suggestions from grass roots members.

The early presidents and offi cers were generous not only with their time, but also with their personal fi nancial support, since ACDA had only a small fi nancial base. Dues were set at $6 per active member. Imagineplanning a convention with little money, no track record or reputation, where those in attendance would be paying their own way, since no one at that time received expense money. The founders recognized the need for high standards at the conventions, held critic sessions, and encouraged famous cho-ral conductors and scholars to participate. Roger Wagner was one of the fi rst to active-ly support ACDA and he appeared on sev-eral early convention programs stating loudly that “the joy of attending a choral convention was that he did not have to rub shoulderswith band directors.” Later, Robert Shaw and Margaret Hillis gave of their talents and recommended that this new organization was worthy of serious support. Four other well-known and infl uential choral conductor/educators were also pro-active supportersof ACDA: Harry Robert Wilson, Teachers College of Columbia University, who wasalso a member of the Steering Commit-tee; Helen Hosmer, Crane School of Music, State University of Potsdam; Elaine Brown, Singing City; and Howard Swan Occidental

7070)) alalsoso r reaealilizezedd ththbabasese, ththee rerecrcruiuitmtmenen

i l I 19196262, WWUniversity of Florida

ACDA is in its inno one can guaany member onmembership aloothers, marks ywell as a distinour profession.

By May 1963, the from 600 to 1000later to 1600 memmembers were prinChoral Journal througlACDA’s growth octhat until 1973, a chrecommended for mattest to ACDA’s ppopularity.

It took a numbstandard election elections were infoit seemed as no suseven-member Steelected president. Awas submitted on ascribed the process,at a national meetinTheir marked ballotfi nal tally announcedand very relaxed.” Owere elected by themembers who atteninclude more memBoard approved a mfuture elections by mtifi ed by an indepenin voting numbers ththe total number of March 1973, grown

Candidates selecpresident, from the on were carefully ccommittee and the resumes of achievemous and proven effe(Table 1). Most nomand division presiderunning state and addition, many natioalso had served on ntees and/or as R&S

An Emphasis on CPerforma

As universities amusicologists such Mann, and others wmusic research, anrepep rtoire and scoimportant to practi


nn pupup rprppososeses;; anandd , aaasss dadadadopopopttetetedddd tatatat

esesessesesentntntiaiaialll. II In nUUUniiiver iisitty o

n purposes; and ti lp p essential.ltl rururuisisistititiccc dededeagueuess OOOveveltruistic deltl rruistic de

f ofo fi cece tto o bebe ttaka ene e B Bibiblle; ;; yeyeyeyeyeyeyeyeyeyeyeyy tttttt,t,t,t,t,t,t,t, ooooooooooo o onenenenenenenenenenene mmmm must

i eeeee to serve fellow eer r rr rrr r rr rrrr the years, ACDAed ththththhhhhhhhh iiieieieieieieieieieieieieirrrrrrrrrrrrrrr titititititititititititititt memememmmmmmmm s elfl essly ot, set aside personon lllllllllalalalalal

rerererererererererereehhehehehehehehehehehehearararararararararsasasasasasallllllllslslslsls,, seseselllllllllele ttttctct rrepeperertttotoiiiiiirire e ffffffofor r prprogogograrararamsmsmsmsmsms,, write notes for concert programs, recruit singers, promote their choral organizations, and plan tours in addition to many other tasks. These skills, possessed by all the ACDA pres ddididididenttttttts ennen bbbbbbbbbabbabababllllllllelleleleddddddddddddd hhththhththhthththhthththememememem ttttttttttooooo essesesesestttttttatatatatatablblblbblblbblblblblbliiiiiiissisisishhhhhhhhhhhhhh pprpraac itititittititi

members for suggggestions. WiW lson wwwasasasasasas ttttttttttt thehehehehehehehehehehehehe aaaaaaa aa a aa utututututuuuu hohor fof t tof the new organization’n’’’’’’’’n’n’n’n’ssssssssssss tetttto this day, these purposeeeeeeeeeeeesssssthat time, have reemamamamamamamaaaaaaaininininininininininininininnedededededededededededededed larwiwiwiwiwiwiwiwiwiwiwiwiwiwiwiththththththththththththththth tttttttttttttt thhhehehehehehehehehehehehehe eeeeeeee excxcxcxception of two p

sssss tetetetetettetttttttoseeeeeeessssssssssssss teeeesisisisisisisisisisisisiiirrrrrrrerererererere

eeeeeerrrrrrrrrrr teses An Index to Volume FiftyAn Index to Volume Fifty

8. Choral Conducting and Choral Techniques: Vocal Technique, Vocal Production, and Tone

“The Other Side of Sixty: The Choir and the Conductor,” by Sandra M. Willetts. 12/09:31.

“Support or Resistance? Examining Breathing Techniques in Choral Singing,” by Duane Cottrell. 4/10:53. BIB.

15. Choral Conducting and Choral Techniques: Repertoire Selec-tion

“The Choral Director as Voice Teacher: Suggestions for Selecting Solo Repertoire for Singers,” by C. Andrew Blosser. 6/10:37.

34. History of Choral Performance, Histories of Choral Organiza-tions, and Biographies of Conductors

“In Memoriam: Lee Kjelson (1926–2009).” 8/09:48.

“A Bicentennial Tribute to William Walker,” by Harry Eskew. 8/09:55.

“In Memoriam: Joyce Eilers Bacak (1941–2009).” 9/09:60.

“In Memoriam: Horace Clarence Boyer (1935–2009).” 10/09:19.

“In Memoriam: David R. Davidson (1947–2009).” 11/09:71.

“In Memoriam: Wesley Coffman (1927–2009).” 11/09:80.

“In Memoriam: Wesley Surber Coffman (1927–2009),” by John Dickson. 12/09:48.

“In Memoriam: Ron Shirey (1933–2009).” 1/10:65.

“In Memoriam: Walter Ehret (1918–2009),” 2/10:28.

“In Memoriam: Neil A. Kjos, Jr. (1931–2009).” 2/10:50.

“The Wayne Hugoboom Collection,” by Marvin E. Latimer, Jr. 2/10:51.

“In Memoriam: Gilbert B. Fisher (1940–2009).” 2/10:68.

“In Memoriam: Paul Manz (1919–2009).” 2/10:82.

“In Memoriam: Brent F. Miller (1940–2009).” 3/10:80.

“Helen Kemp: Nurturing the Whole Child through Music,” by Heather Potter. 4/10:63.

“In Memoriam: Nöel Goemanne (1926–2010).” 4/10:94.

“ACDA Founding Member Celebrates 90th Birthday.” 5/10:7.

43. Interviews

“On the History and Future of the Hymnody from the Mennonite Tradition: An Interview with Marlyn Houser Hamm,” by Ian Loep-pky. 8/09:8.

“Conducting American Choirs: Interviews with Foreign-born Choral Conductors,” by Eliezer Yanson, Jr. 5/10:28.

45. Literature on, and Music for Various Types of Choruses: Women’s Voices

“Women’s Choir Repertoire Performed at ACDA National Conven-tions in the Twenty-First Century,” by Deborah Spurgeon. 10/09:60.

“Mixing it Up: Voicing and Seating a Women’s Choir,” by Sandra Peter. 6/10:35.

46. Literature on, and Music for Various Types of Choruses: Men’s Voices

“Two-Part Repertoire for Male Choir : 50+ Selections for a Variety of Occasions and Ensembles,” by Frank S. Albinder. 4/10:64.

47. Literature on, and Music for Various Types of Choruses: Elementary School and Children

“Keep America’s Youth Singing,” by Robyn Lana. 10/09:57.

“A Model of Excellence for Children’s Music Education in the Church,” by Stephanie Mowery. 11/09:67.

“Some Thoughts on Arranging Music for the Children’s Choir,” by Clara Levy. 12/09:6.

“Letter to the Editor,” by Melissa Malvar-Keylock. 2/10:6.

“Leading the Impressionable Young Singer from the Piano: Perspec-tives froma Collaborative Artist,” by Tammy Miller. 5/10:49.

48. Literature on, and Music for Various Types of Choruses: Middle School, Junior High School, High School and Boychoir

“Letter to the Editor,” by Stephan P. Barnicle. 8/09:6.

“Repeating with Variety: Implementing Motor Learning Theory in the Middle School Choral Rehearsal,” by Joshua Bronfman. 8/09:61.

“Music for Men in the Middle,” by Lon Berry. 11/09:34.

“A Case for At-Risk Students in the Middle School/Junior High Choral Ensemble,” by Michael Murphy. 11/09:63.

“The Boy Singer,” by Julian Ackerley. 11/09:64.

“Foundation of the Boy’s Expanding Voice: A Response to Henry Leck,” by Patrick K. Freer. 2/10:29.

“Setting the Standard: Destination Excellence,” by Gretchen Har-rison. 5/10:46.

“Choral Evaluation Survival Techniques – C’est la vie,” by Bradley Olesen. 6/10:51.

49. Literature on, and Music for Various Types of Choruses: Junior College, College and University

“Choral Repertoire and Standards in the Two-Year College (Part One): The Most Frequently Asked Questions,” by Paul Laprade. 3/10:43.

outstanding choruses from Canada, East Germany, and Korea on Wednesday evening. Th i l i f i t ti l h i

Members/Electionsthe fi rst decade (1960–h fi i l

choral composition. Over the years, eleven ACDA presidents

h i f ith th i i

board meeting minutes and prodACDA policy manual for offi cers.h i dThThe e ininclclususioion n ofof i intnterernanatitiononalal c chohoirirs s wawas s

not laltogeg hther w lelcomedd;; some me bmbers cocompmplalainineded t theheyy ththououghghtt ouourr coconvnvenentitionon should be exclusively “American.” The major-ity, however, appreciated hearing choirs fromaround the world with their different tone colors and the exposure to a greater variety of indigenous choral repertoire.

Some presidents were involved in other projects independent of ACDA. Royce Saltzman founded the Oregon Bach Festival in 1970 that featured the famousGerman conductor Helmuth Rilling. David Thorsen was Rilling’s assistant for fi fteenyears at the Oregon festival and fi ve yearsat the Sommerakademie-Bach in Stuttgart, Germany. The Oregon Bach Festival hosted participants from thirty countries and eleveninternational choirs. The festival won a Grammy in 2001, and has become one of the premiere summer choral workshops inthe United States.

Saltzman and Walter Collins were lead-ers in discussions at the 1981 New Orleans convention concerning the creation of theInternational Federation of Choral Musicians [IFCM] that took place in 1982. ACDA was one of the fi ve founding members. Saltzman served eight years as its second president (1985–93), and a year as interim president (1998–99). Collins was the fi rst editor of theInternational Choral Bulletin. David Thorsen represented the United States by conductinghis “Fullerton State University Singers” choir at IFCM’s fi rst world choral symposium inVienna in 1987. Since the founding of IFCM, ACDA presidents, during their terms of offi ce, have automatically served on the IFCM board; most recently President Hillary Apfelstadt and President-Elect Jerry McCoy were in attendance at the 8th World Sympo-sium of Choral Music in July 2008 as ACDArepresentatives.

In August 1992, the Endowment Trust was formed with the purpose of securingACDA’s fi nancial future and funding theselect objectives and purposes of the Ameri-can Choral Directors Association. Presidents Hatcher and Casey served on the original board and Whitten, Stutzenberger, and C. Kirk served as subsequent board trustees.

Writers of Policy–CommunicationIn the 1970s, various pamphlets outlin-

ing the duties of offi cers (Presidency Guide, R&S Procedural Guide, Newsletter Editor’sGuide, and the Convention Planning Hand-book), were created by the National Board. More than any other president, Colleen Kirk identifi ed the need for better com-munication with state and division offi cers, and to that end, she wrote a newsletter, “Leadership Interchange,” for that purpose. In the 1980s, , Kirk continued to uppdate and

i ACDA itt t t d t

hhatat t too crcreaeatete a a fi fin nanancicialal nntt ofof n newew m memembebersrs w wasas

WoWoododyy KeKeisisteterr frfromom t thehe a, Gainesville wrote,

nfancy … at this time arantee full value to n a dollar basis. Your ong with six hundred you as a visionary asguished member of

membership increased 0 members, and a year mbers. Names of new nted in each issue of theghout much of the 1960s. ccurred despite the fact horal director had to be membership. These factsphenomenal growth and

er of years to develop procedures; the first

ormal and in hindsight urprise that four of theering Committee were

At times, only one name a slate. Warner Imig de-, “All those in attendanceng were handed a ballot. ts were counted and thed. It was fast, economical, Obviously, early offi cers e small number of voting nded the conventions. To bers in the process, the motion in 1964 to havemail with the results cer-ndent CPA. This resulted hat were proportional tof members, which had, by to over 4000 members.

cted to run for national beginning of the 1980s

chosen by a nominating nominees had extensive ment and years of previ-fective service to ACDA inees had served as state ents and had success in division conventions. In

onal president nominees national ADCA commit-Committee chairs.

Choral Repertoire and ance Practicesnd colleges began hiring as Julius Herford, Alfred

who specialized in choral n awareness of choral re studyy became more cing conductors ACDA

hahaveve g givivenen p pererfoformrmananceces s wiwithth t theheirir s siningegersrs at natiionall conven itions: C Chha lrles H Hiirt lledd hihis UnUniviverersisityty o off SoSoututhehernrn C Calalififororniniaa ChChamambeberr Singers, emphasizing the “styles and textures” of choral chamber music and Morris Hayes, known for his Renaissance performances, as a clincian gave a choral demonstration titled, “[T ]he development of stylistic Perfor-mance of Male Choral Literature” with the University of Illinois Men’s Glee Club, and a second concert in 1983 with the Singing Statesmen from the University of Wisconsin-Eau Claire. Milburn Price led the Furman University Concert Choir in “A Celebration of Love: An Exploration of Contemporary Media for Worship.” Other presidents also conducted choral ensembles at National Conventions [Decker (2), Mathis (3), Casey, Thorsen, Hatcher (3), Sanders (2), Moore, and Apfelstadt] illustrating their musical talents and their leadership traits. An expert accompanist, Mitzi Groom, was selected to accompany numerous “convention sings” and reading sessions.

Decker also formed an ad hoc Com-mittee on Choral Editing Standards with Walter Collins as chair ; their charge was to address the “low quality editing of most pre-twentieth-century choral music published in the United States”. Publishers became aware of the need for artistic/authentic editions that were selected for use at ACDA interest and reading sessions. ACDA also produced a “Copyright Policy” on June 27, 1974 that encouraged members to abide by the copy-right laws and not use photocopies of music for rehearsal or at any concert performance or ACDA sponsored event. Adherence to the policy, printed on membership forms, was to be signed by conductors when they became members of ACDA.

International ActivitiesHarold Decker was instrumental in es-

tablishing international contacts for ACDA as a promoter of The Vienna Symposium(1969–73). The symposia involved the participation of select American univer-sity choirs and many ACDA members including future presidents Mathis, Decker, Stutzenberger, and Haberlen. This thrust of international infl uence was apparent at the fi rst two independent ACDA national con-ventions in Kansas City; with special guests from Germany, Wilhelm Ehmann and Frauke Haasemann in 1971, and with two choirs, The Faculty of Music Singers of the Univer-sity of Western Ontario, Canada, and the Budapest University Choir, from Hungary, in 1973. Russell Mathis and Morris Hayes continued this global interest by leading two people-to-people tours to Southeast Asia. Mathis also was involved with additional trips with Friendship p Ambassadors to Romania

d P l d d h t t S th A i

ththee coconvnvenentitionon p prorogrgramam e expxpananddfofourur-ddayay e eveventnts,s, t theherere w wasas l lesesss titimemepoportrtanantt bubusisinenessss a andnd i intntererchchanangege b bstate and division offi cers. On theACDA’s third decade, communicaton new meaning with the receipt ofgrant of $17,000 in support of fi rst Leadership Conference in JunACDA leaders, state and division came to Lawton for two days of mtraining sessions, and an agenda senational president. At one of these Colleen Kirk introduced the structuCommittee on Repertoire and Stanthe attendees. The conferences, givimportance, were scheduled on a tcycle beginning in 1993 and varioushave been explored over the yevocacy/Mentorship/Strategic PlannThis past summer (July 9–13, 2008Apfelstadt led the four-day eighth Leadership Conference in Oklahowith an emphasis on articulating a guide the organization into the twecentury. Other agenda items discussthe establishment of a state presideto aide in communication, membetention, and new member campaig

ACDA enters the Technology Athe Late Eighties & Ninetie

Walter Collins was an early prof technology when he urged his to use e-mail as a means of correspoCollins was a founder of Choral transferred his enthusiasm to ACDADavid Thorsen also realized the impof technology when he recommenthe board approve a $50,000 purcomputers and equipment for the offi ce. That was a large expenditureThorsen also began a project of inteon video-tape select living past pr[1989 Louisville convention-KeistDecker interviewed by Saltzman; aPhoenix convention-Hayes, T. Kirkinterviewed by Collins] to create history of the organization.

Presidents in the 1990s suppoChoral Journal editors as they denew methods of setting magazine laTechnology Committee was estab1997 to outline technological needorganization. In the 2000s, musical ewere created by Sibelius software, and articles were e-mailed to the Crial board. Presidents Price, StutzeGroom, and Holt continued the teccal advance within the organization development of an informative w(See Philip Copeland, October CJ 62). More effective communicationpossible due to the establishment titiononalal A ACDCDAA dadatatababasese. ReRececentntlyly, AA

50. Literature on, and Music for Various Types of Choruses: Com-munity Choir

“A Place for Everyone in the Choir,” by Ron Sayer. 2/10:47.

51. Literature on, and Music for Various Types of Choruses: Church

“Contemplative Worship: A Case for Compline,” by Jeff Jones. 9/09:63.

“Music Literacy Among Adults in Church Choirs,” by Paul G. Hill. 12/09:12.

“Credo: The Incarnation of Giver and Gift,” by Alicia Walker. 3/10:53.

“Your Church Choir Can Sing Mendelssohn!” by Robert Chambers. 4/10:32.

55. Literature on, and Music for Various Types of Choruses: Folk, Pop, Jazz, and Rock

“A Defi nition of the Vocal Jazz Group: An Ensemble of Solo Singers, One-on-a-Mic,” by Diana Spradling. 8/09:50.

“Two Important Collections and a Bluegrass Mass,” by Sharon Davis Gratto. 3/10:50.

57. Educational Techniques and Philosophy

“Conferences 101: How to Listen, Absorb, and Process the Confer-ence Experience,” by Susan Davenport. 12/09:53.

“What do They Know? What Can They Do?” by William T. McCon-nell. 2/10:45.

“Encore! Advocating for the Arts in Education (an interview with Terry Taylor),” by Terre Johnson. 6/10:28.

63. Performance Practice, Style and Interpretation: Romantic

“The Infl uence of Znamenny Liturgical Chant in the Nineteenth-Century Russian Choral School: A Guide for Performance,” by Jeffery B. Wall. 10/09:20.

65. Performance Practice, Style and Interpretation: Folk, Pop, Jazz, and Rock

“A Template for the Comprehensive Learning of Vocal Jazz Reper-toire,” by Kirk Marcy. 2/10:57.

“Keeping the ‘Choir’ in Showchoir,” by Rosephanye Powell. 5/10:45.

66. ACDA Activities and Other Professional News

“Letter to the Editor,” by Howard Meharg. 9/09:6.

“Visioning Goals for ACDA in the Twenty-fi rst Century,” by Ron Sayer. 9/09:54.

“acda.for.you.,” by Philip L. Copeland. 9/09:57.

“Conventional Newsletter or Online Newsletter/Web Site?” by Howard Meharg. 12/09:45.

“Special Convention Issue.” 1/10.

“Meet the ACDA National Headquarters’ Staff,” by Timothy Sharp. 2/10:22.

67. Professional and Artistic Philosophy, Esthetics

“Choral Music, Faith, and a Pathway to Peace,” by Paul A. Aitken. 9/09:53.

“Plays Well With Others: Collegiality in Graduate Choral Programs,” by Jean-Marie Kent. 2/10:63.

68. Recording and Amplifi cation Techniques and Equipment

“Recording Your Choir : Technology for the Choral Director,” by C. Blair Bryant. 10/09:63.

“Miking your Choir,” by Diosan Borrego. 4/10:71.

69. Reference Materials: Bibliographies of Literature on Choral Music

“The Walter Stowe Collins II Collection,” by Marvin E. Latimer, Jr. 6/10:41.

“The Choral Journal: An Index to Volume Fifty,” by Scott W. Dorsey. 6/10:65.

70. Reference Materials: Bibliographies and Lists of Choral Music

“With Harp and Voice: An Annotated Bibliography of Harp/Choral Works,” by Emily John and James John. 8/09:30. BIB.

“Letter to the Editor,” by Emily John and James John. 11/09:7.

“An American Sampler: Choral Music at the Library of Congress,” by John Silantien. 2/10:8.

71. Book Reviews

John Stainer: A Life in Music, by Jeremy Dibble. Stephen Town, re-viewer. 8/09:65.

Foundations of Choral Conducting, by Kevin Fenton. David Holdhusen, reviewer. 8/09:67.

The Music of the Moravian Church in America, edited by Nola Knouse. Timothy Sharp, reviewer. 8/09:68. What Every Singer Needs to Know About the Body, by Melissa Malde, Maryjean Allen and Kurt-Alexander Zeiler. Donald Callen Freed, reviewer. 9/09:71.

Ivor Gurney and Marian Scott: Song of Pain and Beauty, by Pamela Blevins. Stephen Town, reviewer. 9/09:72.

Music, Thought, and Feeling: Understanding the Psychology of Music, by William Forde Thompson. Mark Sharpiro, reviewer. 9/09:75.

Tenor: History of a Voice, by John Potter. Donald Callen Freed, re-viewer. 10/09:67.

The Worlds of Johann Sebastian Bach, edited by Raymond Erickson. Gregory Pysh, reviewer. 10/09:68.

The Clock of the Years: A Gerald and Joy Finzi Anthology, edited by Rolf Jordan. Stephen Town, reviewer. 10/09:98.


hehe A Americaann ChChororalal D Dirirecectotorsrs A Assssocociaia-aatt tthe state, division, or national level.

rre are no oaths of offi ce to be taken one’s hand on the

sess an altruistic desral colleagers have volunteeredmore often than no

bition for the good of the organization. ACDA’s twenty-fi ve national presidents e multi-talented men and women who e from a variety of backgrounds: some e administrators of university music artments (Jones, Imig, Mathis, Thorsen, erlen, Whitten, Price, Groom) or large A/DM/PhD programs (Hirt, Decker, C. Hatcher); some were composers/edi-

/arrangers (Decker, Hirt, Collins, T. Kirk, ders, Hatcher, Whitten, Haberlen, Price);

although most in their early careers ht choral music in the public schools, a had primary careers (ten or more years) ublic school music programs (Leland,

ore, Holt). This article is intended to capture an rview of the accomplishments of AC-s twenty-fi ve presidents as they presided r many initiatives and educational trends horal music and performance. The reader uld note that many of ACDA’s goals and ectives take years to come to fruition un-the guidance of consecutive presidents, cutive committees, and national boards. A small group of ACDA presidents from early generation inspired doctoral stu-ts and younger colleagues to become ve leaders in the organization: Warner

at the University of Colorado (Collins, tten); Charles Hirt at the University outhern California (Saltzman, Whitten, e); Colleen Kirk at the Florida State Uni-ity (Mathis, Groom); and Harold Decker e University of Illinois (Mathis, Haberlen, zenberger, Apfelstadt). These pioneers ented examples of outstanding ACDA ership and service that their younger eration of students and colleagues could did emulate.

There were presidents who had skills be-d conducting that were considerable and ed: Elwood “Woody” Keister was an air-e pilot; Decker, an exercise fanatic; Hirt ke French and drove a luxury Citroen; his was an artistic director/conductor/ac-

mpanist performer of Broadway musicals anta Fe, New Mexico; Collins was an bird watcher; Casey, a trout fl y fi sher-; Thorson a master magician who still hes and performs at the Magic Castle ollywood; Leland was the fi rst full-time

eral manager of the Dale Warland Sing-Haberlen was principal timpanist in the da Symphony and a “rock” drummer; tten, a gourmet chef; Price, an excellent

nnisis player; and Groom an accomplished ompananisist.t.The cocommmmonon e elelemementnt t thahatt bobounundd ththisis

trtrememenendodousus o orgrgananizizatatioionanall skskilillsls i inn adaddidititiononto thheiir musiic lal t lalents. AfAfter lalll, condductorsdesign warm-ups and musical objectives for rehearsals select repertoire for programs

cal goals and objectives for the organizationthat were accomplished by hard work anddetermination with the assistance of thenational offi ce staff. The national presidentspossessed strong collaborative personalitiesthat resulted in achievements supported by the ACDA Executive Committee, electedoffi cers at the division (National Board)and state levels, various committees, andthe Repertoire & Standards appointees. All ACDA offi cers had sincere, honest, anddedicated attitudes that enabled them tosucceed during their terms of offi ce.

Early Years


tion of choral directors was made in aletter dated December 2, 1957, by RobertLanders, conductor of the United States Air Force’s “Singing Sergeants.” Landers includeda recommendation for the formation of aseven-member steering committee whosetask was to solicit support for the idea of this new choral organization. The committeewas successful in setting the course of theorganization and arranging for its fi rst formalmeeting. Four members of the SteeringCommittee later became national presidents(Jones, Hirt, Imig, and Keister),

On February 4, 1959, thirty-fi ve choraldirectors met in Kansas City, Missouri, for the specifi c purpose of possibly establishing a national organization of choral musicians. The meeting, held in conjunction with thenational convention of The Music TeachersNational Association, [not MENC] producedthe new organization’s name and ideas for aconstitution and bylaws and the basic struc-tural framework that would allow for theorganization’s monumental growth. It wasoriginally designated the American Choir-masters Association, but those attendingthe meeting approved and adopted Woody Keister’s proposal that the organization benamed the American Choral Directors As-sociation. Unlike the organizations it wasbased on, application for membership wasopen to all choir directors. The AmericanChoral Directors Association was to cover the needs of all choir directors, not just asmall subset.

The fi rst fi ve presidents charted thebeginnings of the young organization by overseeing the writing of the ACDA Con-ststititututioionn anandd ByBylalawsws,, crcreaeatitingng a a v vehehiciclele f foror cocommmmununicicatatioionn (t(thehe ChChororalal J Jouournrnalal)), s strtrucuc-

AsAssosociciatatioion anand d ththe e CoCollegege e BaBandnd Direcectotorsrs Association. The draft was sent to charter members for suggestions. Harry Robert

he fi nal version n purposes; and

gely unchanged urposes added

in 1975. MENCs fl owchart of division and state organizations was also a model from which certain elements were utilized by the fl edgling choral group. The offi cially desig-nated charter members of ACDA launched what has become one of the world’s most signifi cant infl uences in choral music.

The early presidents were passionate and dedicated to the purpose that the new organization would support the fi nest choral music and music-making, through word and deed. The fi rst annual ACDA convention, March 16–17, 1960, in Atlantic City, NJ, was held in conjunction with the MENC national convention and was planned by ACDA of-fi cers. It was led by its fi rst president, Archie Jones, who was Dean of the University of Kansas City’s Conservatory of Music. It included concerts, clinic demonstrations, panel discussions, reading sessions, and two general business sessions. Once again, the early leaders hit on a formula that continuestoday for convention planning. In addition, the early conventions provided a forum for appropriate business meetings that resulted in major constitutional changes such as a more formal election system, terms of offi ce, etc. The business meetings also provided an opportunity for “feedback” and suggestions from grass roots members.

The early presidents and offi cers were generous not only with their time, but also with their personal fi nancial support, since ACDA had only a small fi nancial base. Dues were set at $6 per active member. Imagine planning a convention with little money, no track record or reputation, where those in attendance would be paying their own way, since no one at that time received expense money. The founders recognized the need for high standards at the conventions, held critic sessions, and encouraged famous cho-ral conductors and scholars to participate. Roger Wagner was one of the fi rst to active-ly support ACDA and he appeared on sev-eral early convention programs stating loudly that “the joy of attending a choral convention was that he did not have to rub shoulderswith band directors.” Later, Robert Shaw and Margaret Hillis gave of their talents and recommended that this new organization was worthy of serious support. Four other well-known and infl uential choral conductor/educators were also pro-active supportersof ACDA: Harry Robert Wilson, Teachers College of Columbia University, who wasalso a member of the Steering Commit-tee; Helen Hosmer, Crane School of Music, StStatate e UnUniviverersisityty o of PoPotstsdadam;m; Elalaine e Browown,n, S C S O

ReRecrcruiuitmtmenentt ofof M MThe offi cers in th

70) also realized thabase, the recruitmenessential. In 1962, W

f Florida

ACDA is in its infno one can guaany member on membership alonothers, marks yowell as a distingour profession.

By May 1963, the mfrom 600 to 1000 later to 1600 memmembers were printChoral Journal throughlACDA’s growth occthat until 1973, a chorecommended for mattest to ACDA’s phpopularity.

It took a numbestandard election elections were infoit seemed as no suseven-member Steeelected president. Atwas submitted on a scribed the process, “at a national meetingTheir marked ballotsfi nal tally announcedand very relaxed.” Owere elected by the members who atteninclude more membBoard approved a mfuture elections by mtifi ed by an independin voting numbers thathe total number of mMarch 1973, grown t

Candidates selectpresident, from the on were carefully chcommittee and the nresumes of achievemous and proven effe(Table 1). Most nominand division presiderunning state and daddition, many nationalso had served on ntees and/or as R&S C

An Emphasis on CPerforman

As universities anmusicologists such aMann, and others whmusic research, , an rerepepertrtoioirere a andnd s scocorr


as ddadopptteddd tat l h d

UnUniviverersisitytyy o oofas adopted at U i itguuees.s. O OveverrO

Bible; yet, one mmmmmusususususususususususttttttttttt t sireee t t t t t t ttttttttoooooooooooooo o seseseseseseserve fellow

he years, ACDA d dd thththththththththththththththeieieieieeieeeeee r r time selfl essly ot, set asididddddddidididideeeeeeee pepepeeepepepepepepepepepepersrsrsrsrsrsrsrsrsrsrsrsrsrsrsonononononononononononono alalalalalala of the organization

rehearsasalslsls,, , ,,,, seseseseselelelelelelelectctctctctctcct rrrrr rr r r repepepeppepepepeppppppererererererereerertototototototototoiririririririririreeeeeeee e fofofofofofofofofoforrrrrrrr r prprprprprprpprprpppppp ogogogogogogogogggggggrarararraramsmsmsmsms,, , ,,,,wriite notes for concert programs, recruit singers, promote their choral organizations, and plan tours in addition to many other tasks. These skills, possessed by all the ACDA prprprprprprprprprprprprprprpresesesesesesesesesesesesesesesidididididididididididididideneneneneneneneneneneneentstststststststststst ,,,,, , ,,, enenenenenenene ababababableleleleddd thththemem t too esestataablblblisisishhh h prprprprprprpppppppp acacacacacacacctitititititittii--

WiWiWiWiWWiWiWiWWiWiWiWiWiWilslslslslslslslslslslslslslslsononononononononononononono wwww ww ww w w wasasasasaa t he author of thof the new organiiiiiiizizizatatattttttatatatatatatatioioioiooioioiooiooioioioion’nnnnnnnnnnnnn ss s s s ss ss tento this day, these purpothat time, have remainedddd l l llllllllaaaaararararararararararargwith the eexcxcxcxcxcxccepepepepepepepepepepepepepepptitititititititititittitititiooononononononononononononon ooooo offffffffffff ttwo piiiiiiiin 111119997975 MENC’s flowchart

sessss,s,s,s,sss, l

sesrr r r r rrrr ttth An Index to Volume FiftyAn Index to Volume Fifty

Way Over in Beulah Lan’: Understanding and Performing the Negro Spiritual, by André Thomas. Thomas Lloyd, reviewer. 11/09:71.

Bax: A Composer and His Times, by Lewis Woodbridge. Stephen Town, reviewer. 11/09:74.

The Innumerable Dance: The Life and Work of William Alwyn, by Adrian Wright. Stephen Town, reviewer. 11/09:77

Creating Artistry through Choral Excellence, by Henry Leck with Flossie Jordan. Robert Jones, reviewer. 2/10:69.

Wisdom, Wit and Will: Women Choral Conductors and Their Art, edited by Joan Catoni Conlon. Anna Hamre, reviewer. 2/10:70.

The Great Transformation of Musical Taste, by William Weber. Ian Loeppky, reviewer. 2/10:73.

Choral Conducting and the Construction of Meaning: Gesture, Voice, Identity, by Liz Garnett. Nancy Plum, reviewer. 3/10:59.

Maestro: A Surprising Story about Leading through Listening, by Roger Nierenberg. Daniel S. Clark, reviewer. 3/10:61.

Deepening Musical Performance through Movement, by Alexandra Pierce. Ian Loeppy, reviewer. 3/10:63.

Bach and the Meanings of Counterpoint, by David Yearsley. David Malfatti, reviewer. 3/10:63.

Crybantc Conversations: Imagined Encounters between Dalcroze, Kodály, Laban, Mason, Orff, Seashore, and Suzuki, by Edwin E. Gordon. Vincent C. Bates, reviewer. 3/10:68.

The Unaccompanied Choral Music of Pierre Villette: A Conductor’s Analysis, by Sean M. Burton. Donald Callen Freed, reviewer. 4/10:77.

Purcell: An Extraordinary Life, by Bruce Wood. Donald Callen Freed, reviewer. 4/10:77.

The Choral Challenge: Practical Paths to Solving Problems, by Michael Kemp. Vance D. Wolverton, reviewer. 4/10:78.

Young Choristers, 650–1700: Studies in Medieval and Renaissance Music 7, edited by Susan Boynton and Eric Rice. Kathleen Sewright, reviewer. 5/10:53.

From Serra to Sancho: Music and Pageantry in the California Missions, by Craig H. Russell. Louis Welcher, reviewer. 5/10:55.

Dialogues, Volume I (Morten Lauridsen, Paul Salamunovich and James Jordan): Musical Conversations between Composers and Conductors, by Morten Lauridsen and James Jordan. Ian Coleman, reviewer. 5/10:57.

The Finale Projects (The New Approach to Learning Finale), by Tom Carruth. Ian Coleman, reviewer. 6/10:59.

Gregorian Chant: A Guide to the History and Liturgy, by Don Daniel Saulnier and Mary Berry. Kevin Zakresky, reviewer. 6/10:60.

Scores to Settle: Stories of the Struggle to Create Great Music, by Nor-man Gilliland. Kevin Zakresky, reviewer. 6/10:62.

72. Recording Reviews

Anton Bruckner: Mass in F Minor. RIAS Kammerchor, Orchestre des Chammps-Elysees; Philippe Herreweghe, conductor. David Castle-berry, reviewer. 8/09:73.

First Day. Santa Fe Desert Chorale; Linda Mack, conductor. Natasia Sexton Cain, reviewer. 8/09:74.

Kenneth Leighton: The World’s Desire. Wells Cathedral Choir, Wells Ca-thedral School Chapel Choir ; Matthew Owens, conductor. Stephen Kingsbury, reviewer. 8/09:75.

C. P. E. Bach: Magnifi cat; Die Himmel erzählan, die Ehre Gottes. Basler Madrigalisten, L’arpe festanta; Fritz Näf, conductor. Vicenta Chavarria, reviewer. 8/09:76.

Ferdinando Paër: Missa Pienna D-Mol. Dresdener Kreuzchor, Staats-kapella Dresden; Roderich Kreile, conductor. Rich Brunner, reviewer. 8/09:77.

Haydn: Missa, Hob. XXII: 13. Gatti: Schöpfungsmesse in A Major. Dresdener Kreuzchor, Dresdener Philharmonie; Roderich Kreile, conductor. Frank DeWald, reviewer. 9/09:79.

Joseph Haydn: Missa Cellensis, Hob. XXII:5. Anima Eterna; Jos van Im-merseel, conductor. Amy Stuart Hunn, reviewer. 9/09:79.

Franz Josepf Haydn: Oratorios VokalEnsemble Köln, Capella Augustina; Andreas Spering, conductor. Gewandhaus Kammerchor, Leipzinger Kammerorchester; Morten Schuldt-Jensen, conductor. David A. Mc-Connell, reviewer. 9/09:80.

Joseph Haydn: Die Schöpfung. Saltzburger Bachchor; Ivor Bolton, conductor. Lawrence Schenbeck, reviewer. 9/09:82.

Joseph Haydn: Die Jahreszeiten. Saltzburger Bachchor; Ivor Bolton, conductor. Lawrence Schenbeck, reviewer. 9/09:82.

Lukas Foss: The Prairie. Providence Singers; Andrew Clark, conduc-tor. Sean Burton, reviewer. 10/09:73.

Toivo Tulev: Songs. Estonian Philharmonic Chamber Choir, Tallinn Chamber Orchestra; Paul Hillier, conductor. Rich Brunner, reviewer. 10/09:73.

Stella del nostro mar. Cantica Symphonia. Philip Barnes, reviewer. 10/09:74.

The Road Less Traveled. Phoenix Chamber Choir ; Ramona Luengen, conductor. Philip Barnes, reviewer. 10/09:75.

Hodie. Octarium. Matthew Smyth, reviewer. 10/09:77.

Tavener: Ex Maria Virgine. Choir of Clare College Cambridge; Timothy Brown, conductor. Stephan Kingsbury, reviewer. 11/09:81.

ggououtststatandndiningg chchororususeses f froromm CaCananadada, EaEastst Germany, and Korea on Wednesday evening. The inclusion of international choirs wasnot altogether welcomed; some memberscomplained they thought our convention should be exclusively “American.” The major-ity, however, appreciated hearing choirs from around the world with their different tone colors and the exposure to a greater variety of indigenous choral repertoire.

Some presidents were involved in other projects independent of ACDA. Royce Saltzman founded the Oregon Bach Festival in 1970 that featured the famousGerman conductor Helmuth Rilling. David Thorsen was Rilling’s assistant for fi fteen years at the Oregon festival and fi ve yearsat the Sommerakademie-Bach in Stuttgart, Germany. The Oregon Bach Festival hosted participants from thirty countries and eleven international choirs. The festival won a Grammy in 2001, and has become one of the premiere summer choral workshops in the United States.

Saltzman and Walter Collins were lead-ers in discussions at the 1981 New Orleans convention concerning the creation of the International Federation of Choral Musicians [IFCM] that took place in 1982. ACDA was one of the fi ve founding members. Saltzman served eight years as its second president (1985–93), and a year as interim president (1998–99). Collins was the fi rst editor of theInternational Choral Bulletin. David Thorsen represented the United States by conducting his “Fullerton State University Singers” choir at IFCM’s fi rst world choral symposium in Vienna in 1987. Since the founding of IFCM, ACDA presidents, during their terms of offi ce, have automatically served on the IFCM board; most recently President Hillary Apfelstadt and President-Elect Jerry McCoy were in attendance at the 8th World Sympo-sium of Choral Music in July 2008 as ACDA representatives.

In August 1992, the Endowment Trust was formed with the purpose of securing ACDA’s fi nancial future and funding the select objectives and purposes of the Ameri-can Choral Directors Association. Presidents Hatcher and Casey served on the original board and Whitten, Stutzenberger, and C. Kirk served as subsequent board trustees.

Writers of Policy–CommunicationIn the 1970s, various pamphlets outlin-

ing the duties of offi cers (Presidency Guide, R&S Procedural Guide, Newsletter Editor’sGuide, and the Convention Planning Hand-book), were created by the National Board. More than any other president, Colleen Kirk identifi ed the need for better com-munication with state and division offi cers, and to that end, she wrote a newsletter, “LLeaeadedersrshihipp InIntetercrchahangnge,e,” foforr ththatat p pururpoposese.. InIn t thehe 1 198980s0s, KiKirkrk c conontitinunueded t too upupdadatete a andnd

MMemembebersrs/E/Elelectctioionsnshe fi rst decade (1960–at to create a fi nancial t of new members was

Woody Keister from the , Gainesville wrote,

fancy … at this time rantee full value to a dollar basis. Your

ng with six hundred ou as a visionary as guished member of

membership increased members, and a year

mbers. Names of new ted in each issue of the hout much of the 1960s. curred despite the fact oral director had to be

membership. These facts henomenal growth and

er of years to develop procedures; the first

ormal and in hindsight rprise that four of the

ering Committee were t times, only one name slate. Warner Imig de-

“All those in attendance g were handed a ballot. s were counted and the . It was fast, economical,

Obviously, early offi cers small number of voting ded the conventions. To

bers in the process, the motion in 1964 to have mail with the results cer-dent CPA. This resulted at were proportional to members, which had, by to over 4000 members.ted to run for national beginning of the 1980s hosen by a nominating nominees had extensive ment and years of previ-ective service to ACDA nees had served as state nts and had success in division conventions. In nal president nominees ational ADCA commit-Committee chairs.

horal Repertoire andnce Practicesnd colleges began hiring as Julius Herford, Alfred ho specialized in choral

awareness of choral rere s stutudydy b bececamamee momorere

; , ppchchororalal c comompoposisititionon.

Over the years, eleven ACDA presidents have given performances with their singers at national conventions: Charles Hirt led hisUniversity of Southern California Chamber Singers, emphasizing the “styles and textures” of choral chamber music and Morris Hayes, known for his Renaissance performances, as a clincian gave a choral demonstration titled, “[T ]he development of stylistic Perfor-mance of Male Choral Literature” with the University of Illinois Men’s Glee Club, and a second concert in 1983 with the Singing Statesmen from the University of Wisconsin-Eau Claire. Milburn Price led the Furman University Concert Choir in “A Celebration of Love: An Exploration of Contemporary Media for Worship.” Other presidents also conducted choral ensembles at National Conventions [Decker (2), Mathis (3), Casey, Thorsen, Hatcher (3), Sanders (2), Moore, and Apfelstadt] illustrating their musical talents and their leadership traits. An expert accompanist, Mitzi Groom, was selected to accompany numerous “convention sings” and reading sessions.

Decker also formed an ad hoc Com-mittee on Choral Editing Standards with Walter Collins as chair ; their charge was to address the “low quality editing of most pre-twentieth-century choral music published in the United States”. Publishers became aware of the need for artistic/authentic editionsthat were selected for use at ACDA interest and reading sessions. ACDA also produced a “Copyright Policy” on June 27, 1974 that encouraged members to abide by the copy-right laws and not use photocopies of music for rehearsal or at any concert performance or ACDA sponsored event. Adherence to the policy, printed on membership forms, was to be signed by conductors when they became members of ACDA.

International ActivitiesHarold Decker was instrumental in es-

tablishing international contacts for ACDA as a promoter of The Vienna Symposium(1969–73). The symposia involved the participation of select American univer-sity choirs and many ACDA membersincluding future presidents Mathis, Decker, Stutzenberger, and Haberlen. This thrust of international infl uence was apparent at the fi rst two independent ACDA national con-ventions in Kansas City; with special guests from Germany, Wilhelm Ehmann and Frauke Haasemann in 1971, and with two choirs, The Faculty of Music Singers of the Univer-sity of Western Ontario, Canada, and the Budapest University Choir, from Hungary, in 1973. Russell Mathis and Morris Hayes continued this global interest by leading two people-to-people tours to Southeast Asia. MaMaththisis a alslsoo wawass ininvovolvlveded w witithh adaddidititiononalal t triripsps wiwithth F Fririenendsdshihipp AmAmbabassssadadororss toto R Romomananiaia

and culled information from pap st nboboarardd memeetetiningg miminunutetess anandd prprododuuACDA policy manual for offi cers. the convention program expandefour-day events, there was less timeportant business and interchange bstate and division offi cers. On the ACDA’s third decade, communicatioon new meaning with the receipt of agrant of $17,000 in support of Afi rst Leadership Conference in JunACDA leaders, state and division came to Lawton for two days of mtraining sessions, and an agenda setnational president. At one of these sColleen Kirk introduced the structurCommittee on Repertoire and Standthe attendees. The conferences, giveimportance, were scheduled on a twcycle beginning in 1993 and various have been explored over the yeavocacy/Mentorship/Strategic PlanninThis past summer (July 9–13, 2008)Apfelstadt led the four-day eighth NLeadership Conference in Oklahomwith an emphasis on articulating a vguide the organization into the twecentury. Other agenda items discussethe establishment of a state presidento aide in communication, membertention, and new member campaign

ACDA enters the Technology Athe Late Eighties & Ninetie

Walter Collins was an early proof technology when he urged his sto use e-mail as a means of correspoCollins was a founder of Choral Ltransferred his enthusiasm to ACDA David Thorsen also realized the impoof technology when he recommendthe board approve a $50,000 purccomputers and equipment for the noffi ce. That was a large expenditure iThorsen also began a project of interon video-tape select living past pre[1989 Louisville convention-KeisteDecker interviewed by Saltzman; anPhoenix convention-Hayes, T. Kirk, interviewed by Collins] to create history of the organization.

Presidents in the 1990s supporChoral Journal editors as they devnew methods of setting magazine layTechnology Committee was establi1997 to outline technological needsorganization. In the 2000s, musical exwere created by Sibelius software, pand articles were e-mailed to the CJrial board. Presidents Price, StutzenGroom, and Holt continued the techcal advance within the organization wdevelopment of an informative we(See Philip Copeland, October CJ 262). More effective communication popossssibiblele d dueue t too ththee esestatablblisishmhmenentt ootition lal A ACDCDAA ddattabbase. RRece tntlly, AAp

John Rutter: A Christmas Festival. Cambridge Singers, Farnham Youth Choir ; John Rutter, conductor. Karen Lecky-Springer, reviewer. 11/09:82.

Be Merry! Celebrate Advent and Christmas with Gloriæ De Cantores. Gloriæ De Cantores; Elizabeth C. Patterson, conductor. Karen Lecky-Springer, reviewer. 11/09:83.

Eclipse: The Voice of Jean Lanlais. Gloriæ De Cantores, Schola Canto-rum; Elizabeth C. Patterson, conductor. Steven R. Gibson, reviewer. 11/09:83.

Reinhard Keiser: Dialogus von der Geburt Christi. Rastatter Hofkapelle; Jürgen Ochs, conductor. Robert Chambers, reviewer. 11/09:84.

Song of Songs. Stile Antico. Lawrence Schenbeck, reviewer. 11/09:86.

Christmas Joy in Latvia. Youth Choir Balsis, New York Lutheran Concert Choir ; Andrejs Jansons, conductor. Vance D. Wolverton, reviewer. 12/09:59.

Flaming Heart. I Fagiolini; Robert Hollingsworth, conductor. Bryson Mortensen, reviewer. 12/09:60.

Fire and Ashes. I Fagiolini; Robert Hollingsworth, conductor. Bryson Mortensen, reviewer. 12/09:60.

Making Waves. The Sirens; Bob Chilicott, conductor. Natasia Sexton Cain, reviewer. 12/09:61.

You Shall Have a Song: The Music of Stephen Palus. Calvin College Alumni Choir ; Pearl Shangkuan, conductor. Tobin Sparfeld, reviewer. 12/09:61.

While You Were Alive. Cantus. Steven R. Gibson, reviewer. 12/09:63.

David Lang: The Little Match Girl Passion. Theatre of Voices, Nova Co-penhagen; Paul Hillier, conductor. Thomas Lloyd, reviewer. 2/10:75.

Phil Kline: John the Revalator. Lionhart, Ethel. Thomas Lloyd, reviewer. 2/10:75.

Kile Smith: Vespers. Piffaro, The Crossing; Donald Nally, conductor. Thomas Lloyd, reviewer. 2/10:75.

Handel: Messiah. Polyphony; Stephen Layton, conductor. Lawrence Schenbeck, reviewer. 2/10:77.

Handel: Chandos Anthems. Choir of Trinity College, Cambridge; Ste-phen Layton, conductor. Bob Chambers, reviewer. 2/10:78.

Georg Philipp Telemann: Brockes-Passion. RIAS Kammerchor; René Jacobs, conductor. David McConnell, reviewer. 2/10:79.

Heinrich Schütz: Lukas-Passion. Nova Copenhagen; Paul Hillier, con-ductor. Matthew Smyth, reviewer. 2/10:80.

Bernstein: Mass: A Theatre Piece for Singers, Players, and Dancers. Com-pany of MusicTölzer Knabenchor, Chorus Sine Nomine, Absolute Ensemble; Kristjan Järvi, conductor. Roger Miller, reviewer. 2/10:80.

Cornerstone Works of Sacred Music. Various performers. Lawrence Schenbeck, reviewer. 2/10:81.

Sierra: Missa Latina “Pro Pace”. Milwaukee Symphony Orchestra and Chorus; Andreas Delfs, conductor. Frank DeWald, reviewer. 3/10:71.

William Byrd: Hodie Simon Petrus. The Cardinal’s Musick; Andrew Carwood, conductor. Sean Burton, reviewer. 3/10:72.

The Complete Haydn Masses (and Stabat Mater). Trinity Choir ; J, Owen Burdick and Jane Glover, conductors. Lawrence Schenbeck, reviewer. 3/10:73.

Haydn: Die Schöpfung. RIAS Kammerchor; René Jacobs, conductor. Lawrence Schenbeck, reviewer. 3/10:73.

Pawel Lukaszewski: Via Crucis. Polyphony; Stephen Layton, conductor. Cameron F. LaBarr, reviewer. 3/10:75.

Handel: Alexander’s Feast, HWV 75; Ode for St. Cecilia’s Day HWV 76. Kölner Kammerchor, Collegium Cartusianum; Peter Neumann, conductor. Frank DeWald, reviewer. 3/10:75.

A Company of Voices: Conspirare in Concert. Conspirare; Craig Hella Johnson, conductor. Vicente Chavarria, reviewer. 3/10:76.

Come Thou Fount of Every Blessing: American Folk Hymns and Spiritu-als. Mormon Tabernacle Choir ; Mack Wilberg, conductor. Steven Gibson, reviewer. 3/10:77.

Ralph Vaughan Williams: A Cappella Choral Works. Laudibus; Mike Brewer, conductor. Allen Clements, reviewer. 4/10:85.

Richard Toensing: Kontakion on the Nativity of Christ with New Orthodox Christmas Carols. Cappella Romana; Alexander Lingas, conductor. Rich Brunner, reviewer. 4/10:85.

And Glory Shone Around. The Rose Ensemble; Jordan Sramek, conduc-tor. Frank DeWald, reviewer. 4/10:86.

Frohlocke nun! Berliner Weihnachtsmusiken zwischen Barock und Ro-mantik. Staats- und Domchor Berlin, Laurren Compagney; Kai-Uwe Jirka, conductor. Robert Chambers, reviewer. 4/10:87.

Handel: Messiah. The Sixteen; Harry Christophers, conductor. Rich Brunner, reviewer. 4/10:89.

Philippe de Monte: Missa Ultimi miei sospiri. Cinquecento. Michael Lister, reviewer. 4/10:90.

David Lang: A Little Match Girl Passion. Theatre of Voices, Ars Nova Copenhagen; Paul Hillier, conductor. Jean-Marie Kent and Jeremiah Cawley, reviewers. 4/10:90.

74. Choral Activities in the USA and Abroad

“The American International Festival: A New Festival Concept in Partnership Between ACDA and Interkultur,” by Christian Ljunggren. 5/10:6.

75. Texts

“Her Lyric Poetry Still Inspires Lovely Music,” by Natasia Sexton Cain. 11/09:8.


ithth one’s hand on the Bible; yet, one must osssess an altruistic desire to serve fellow hooral colleagues. Over the years, ACDA ffifi cers have volunteered their time ndd, more often than not, set aside pmmbition for the good of the organ

ACDA’s twenty-fi ve national preere multi-talented men and womamme from a variety of backgrounds: some eere administrators of university music eepartments (Jones, Imig, Mathis, Thorsen, aaberlen, Whitten, Price, Groom) or large MMA/DM/PhD programs (Hirt, Decker, C. rrk, Hatcher); some were composers/edi-rrs/arrangers (Decker, Hirt, Collins, T. Kirk,

anders, Hatcher, Whitten, Haberlen, Price); nd, although most in their early careers uught choral music in the public schools, a ww had primary careers (ten or more years) public school music programs (Leland,

ooore, Holt). This article is intended to capture an

vverview of the accomplishments of AC-AA’s twenty-fi ve presidents as they presided vver many initiatives and educational trends cchoral music and performance. The reader oould note that many of ACDA’s goals and

bbjectives take years to come to fruition un-eer the guidance of consecutive presidents, xxecutive committees, and national boards.

A small group of ACDA presidents from ee early generation inspired doctoral stu-

eents and younger colleagues to become ttive leaders in the organization: Warner

mig at the University of Colorado (Collins, WWhitten); Charles Hirt at the University f Southern California (Saltzman, Whitten, rice); Colleen Kirk at the Florida State Uni-ersity (Mathis, Groom); and Harold Decker tthe University of Illinois (Mathis, Haberlen, uutzenberger, Apfelstadt). These pioneers reesented examples of outstanding ACDA aadership and service that their younger eneration of students and colleagues could nd did emulate.

There were presidents who had skills be-ond conducting that were considerable and arried: Elwood “Woody” Keister was an air-aane pilot; Decker, an exercise fanatic; Hirt

pooke French and drove a luxury Citroen; aathis was an artistic director/conductor/ac-

ompanist performer of Broadway musicals Santa Fe, New Mexico; Collins was an

viid bird watcher; Casey, a trout fl y fi sher-aan; Thorson a master magician who still aaches and performs at the Magic Castle Hollywood; Leland was the fi rst full-time

eneral manager of the Dale Warland Sing-rss; Haberlen was principal timpanist in the oorida Symphony and a “rock” drummer;

WWhitten, a gourmet chef; Price, an excellent nnnis player; and Groom an accomplished ccompanist.The common element that bound this

ressidential group together was that they eree a ctive choral conductors throughout e e prp immararyy poportrtioionn ofof t theheirir c carareeeersrs:: ththeyey eere diirectotorsrs ooff chchororalal pprorogrgramamss atat tthehe

rehearsals, select repertoire for programs, write notes for concert programs, recruitsingers, promote their choral organizations, and plan tours in addition to many other

determination with the assistance of the national offi ce staff. The national presidents possessed strong collaborative personalities that resulted in achievements supported by the ACDA Executive Committee, elected offi cers at the division (National Board)and state levels, various committees, and the Repertoire & Standards appointees. All ACDA offi cers had sincere, honest, and dedicated attitudes that enabled them to succeed during their terms of offi ce.

Early Years


tion of choral directors was made in a letter dated December 2, 1957, by Robert Landers, conductor of the United States Air Force’s “Singing Sergeants.” Landers included a recommendation for the formation of aseven-member steering committee whosetask was to solicit support for the idea of this new choral organization. The committeewas successful in setting the course of theorganization and arranging for its fi rst formal meeting. Four members of the SteeringCommittee later became national presidents (Jones, Hirt, Imig, and Keister),

On February 4, 1959, thirty-fi ve choral directors met in Kansas City, Missouri, for the specifi c purpose of possibly establishing a national organization of choral musicians. The meeting, held in conjunction with thenational convention of The Music TeachersNational Association, [not MENC] produced the new organization’s name and ideas for aconstitution and bylaws and the basic struc-tural framework that would allow for the organization’s monumental growth. It was originally designated the American Choir-masters Association, but those attending the meeting approved and adopted Woody Keister’s proposal that the organization benamed the American Choral Directors As-sociation. Unlike the organizations it wasbased on, application for membership was open to all choir directors. The American Choral Directors Association was to cover the needs of all choir directors, not just a small subset.

The fi rst fi ve presidents charted thebeginnings of the young organization by overseeing the writing of the ACDA Con-stitution and Bylaws, creating a vehicle for communication (the Choral Journal), struc-turing geographic divisions, and planning thefi rst annual convention. The new leaders of ACACDADA d didid n notot “ rereininveventnt t thehe w wheheelel”;; P Preresisi--dd tt AA hihi JJ ll ll iiblbl

Wilson was the author of the fi nal version of the new organization’s ten purposes; and to this day, these purposes, as adopted at that time, have remained largely unchanged

rposes added f division and model fromtilized by the

fl edgling choral group. The offi cially desig-nated charter members of ACDA launched what has become one of the world’s mostsignifi cant infl uences in choral music.

The early presidents were passionate and dedicated to the purpose that the neworganization would support the fi nest choral music and music-making, through word and deed. The fi rst annual ACDA convention, March 16–17, 1960, in Atlantic City, NJ, was held in conjunction with the MENC national convention and was planned by ACDA of-fi cers. It was led by its fi rst president, ArchieJones, who was Dean of the University of Kansas City’s Conservatory of Music. It included concerts, clinic demonstrations, panel discussions, reading sessions, and two general business sessions. Once again, the early leaders hit on a formula that continuestoday for convention planning. In addition, the early conventions provided a forum for appropriate business meetings that resulted in major constitutional changes such as amore formal election system, terms of offi ce, etc. The business meetings also provided anopportunity for “feedback” and suggestions from grass roots members.

The early presidents and offi cers were generous not only with their time, but also with their personal fi nancial support, since ACDA had only a small fi nancial base. Dues were set at $6 per active member. Imagineplanning a convention with little money, no track record or reputation, where those in attendance would be paying their own way, since no one at that time received expense money. The founders recognized the need for high standards at the conventions, held critic sessions, and encouraged famous cho-ral conductors and scholars to participate. Roger Wagner was one of the fi rst to active-ly support ACDA and he appeared on sev-eral early convention programs stating loudly that “the joy of attending a choral convention was that he did not have to rub shoulderswith band directors.” Later, Robert Shaw and Margaret Hillis gave of their talents and recommended that this new organization was worthy of serious support. Four other well-known and infl uential choral conductor/educators were also pro-active supportersof ACDA: Harry Robert Wilson, Teachers College of Columbia University, who wasalso a member of the Steering Commit-tee; Helen Hosmer, Crane School of Music, State University of Potsdam; Elaine Brown, Singing City; and, Howard Swan, Occidental College, affectionately called the Dean of choral conductors. The many y contributionsofof tthehesese mmususiciciaiansns tthrhrououghghououtt ththeieirr cacarereererss

base, the recruitmmeessential. In 19622, University of Floriid

ACDA is in itss no one can ggany member omembership aaothers, marks well as a disttiour professionn

By May 1963, thefrom 600 to 1000later to 1600 mmemembers were prrChoral Journal throulACDA’s growth oothat until 1973, a crecommended forrattest to ACDA’s popularity.

It took a nummstandard electionelections were innit seemed as no seven-member Sttelected president.. was submitted onnscribed the processat a national meettTheir marked balloofi nal tally announcceand very relaxed.”were elected by thhmembers who attteinclude more memmBoard approved aafuture elections byytifi ed by an indepeein voting numbers tthe total number ooMarch 1973, groww

Candidates sellepresident, from thhon were carefullyy committee and theresumes of achievveous and proven eef(Table 1). Most nommand division presidrunning state anddaddition, many nattalso had served onntees and/or as R&&S

An Emphasis on Performm

As universities musicologists suchhMann, and others music research, arepertoire and sccimportant to praacwas committeedd ththrorougughh arartiticles i inn ThThee 19196666 nationall

f di i i dth d f th f division and no or the good of the organ

- A -Ackerley, Julian, 11/09:64Aitken, Paul A., 9/09:53Albinder, Frank S., 4/10:64Atkinson, Debra S., 3/10:24

- B -Barnes, Philip, 10/09:74, 10/09:75Barnicle, Stephan P., 8/09:6Bates, Vincent C., 3/10:68Berry, Lon, 11/09:34Blees, Williem, 6/10:7Blosser, C. Andrew, 6/10:37Borrego, Diosan, 4/10:71Bronfman, Joshua, 8/09:61Brunner, Rich, 8/09:77, 10/09:73, 4/10:85, 4/10:89Bryant, C. Blair, 10/09:63Burton, Sean, 10/09:73, 3/10:72Busarow, Linda Cressman, 8/09:52

- C -Cain, Natasia Sexton, 8/09:74, 11/09:8, 12/09:61Carter, Tom, 6/10:6Castleberry, David, 8/09:73Cawley, Jeremiah, 4/10:90Chambers, Robert, 11/09:84, 2/10:78, 4/10:32, 4/10:87Chavarria, Vicenta, 8/09:76, 3/10:76Clark, Daniel S., 3/10:61Clements, Allen, 4/10:85Coleman, Ian, 5/10:57, 6/10:60Copeland, Philip L., 9/09:57, 12/09:22Cottrell, Duane, 4/10:53

- D -Davenport, Susan, 12/09:53Demaree, Robert W., 9/09:38DeWald, Frank, 9/09:79, 3/10:71, 3/10:75, 4/10:86Dickson, John, 12/09:48Dorsey, Scott W., 6/10:??

- E, F, G -Eskew, Harry, 8/09:55Freed, Donald Callen, 9/09:71, 10/09:67, 4/10:77, 4/10:77Freer, Patrick K., 10/09:34, 2/10:29

Gibson, Steven R., 11/09:83, 12/09:63, 3/10:77Gratto, Sharon Davis, 3/10:50Gumm, Alan J., 2/10:16

- H -Hamre, Anna, 2/10:70Harrison, Gretchen, 5/10:46Harvey, Jonathan, 6/10:8Hill, Paul G., 12/09:12Holdhusen, David, 8/09:67Hunn, Amy Stuart, 9/09:79

- J -Jacobson, Joshua R., 11/09:20John, Emily, 8/09:30, 11/09:7John, James, 8/09:30, 11/09:7Johnson, Terre, 6/10:28Jones, Jeff, 9/09:63Jones, Robert, 2/10:69

- K -Kamm, Charles W., 10/09:47, 11/09:47Kent, Jean-Marie, 2/10:63, 4/10:90Kingsbury, Stephen, 8/09:75, 11/09:81

- L -LaBarr, Cameron F., 3/10:75Lamkin, Kathleen, 9/09:24Lana, Robyn, 10/09:57Laprade, Paul, 3/10:43Latimer, Marvin E., 2/10:51, 6/10:41Lecky-Springer, Karen, 11/09:82, 11/09:83Leaf, Nathan, 8/09:18Levy, Clara, 12/09:6Ljunggren, Christian, 5/10:6Lister, Michael, 4/10:90Lloyd, Thomas, 11/09:71, 2/10:75, 2/10:75, 2/10:75Loeppky, Ian, 8/09:8, 2/10:73, 3/10:63

- M -Malfatti, David, 3/10:63Malvar-Keylock, Melissa, 2/10:6Marcy, Kirk, 2/10:57McConnell, David A., 9/09:80, 2/10:79McConnell, William T., 2/10:45McGrann, Jeremiah W., 9/09:9

Meharg, Howard, 9/09:6, 12/09:45Miller, Roger, 2/10:80Miller, Tammy, 5/10:49Mortensen, Bryson, 12/09:60, 12/09:60, 5/10:63Moses, Don V., 9/09:38Mowery, Stephanie, 11/09:67Mowrer, Tony, 5/10:20Murphy, Michael, 11/09:63

- N, O, P -Nagoski, Amelia, 4/10:18Olesen, Bradley, 6/10:51Perkins, John, 5/10:8, 6/10:18Peter, Sandra, 6/10:35Plum, Nancy, 3/10:59Potter, Heather, 4/10:63Powell, Rosephanye, 5/10:45Pysh, Gregory, 10/09:68

- R, S, T -Rivera, José, 3/10:6Sayer, Ron, 9/09:54, 2/10:47Schenbeck, Lawrence, 9/09:82, 9/09:82, 11/09:86, 2/10:77, 2/10:81, 3/10:73, 3/10:73Sewright, Kathleen, 5/10:53Sharp, Timothy, 8/09:68, 2/10:22Sharpiro, Mark, 9/09:75Silantien, John, 2/10:8Smyth, Matthew, 10/09:77, 2/10:80Sparfeld, Tobin, 12/09:61Spradling, Diana, 8/09:50Spurgeon, Deborah, 10/09:60Thomas, Ken, 8/09:49Town, Stephen, 8/09:65, 9/09:72, 10/09:98, 11/09:74, 11/09:77,

- W, Y, Z -Walker, Alicia, 3/10:53Wall, Jeffery B., 10/09:20Warren, John, 4/10:6Welcher, Louis, 5/10:55Willetts, Sandra M., 12/09:31Wolverton, Vance D., 12/09:59, 4/10:78Yanson, Eliezer Jr., 5/10:28 Zakrekey, Kevin, 10/09:9, 6/10:60, 6/10:62Zamer, Craig, 12/09:49

iiizzzzzzzzation. resssssssssididididididididididididididideneneneneneeeeeee tst

men who d

cal goals and objectives for the organizationthththtt at were accomplished by hard work and determiiiiiiiin tttttttatatatiiiiiiiiioioioioionnnnnnn iiiwiwwiwiwwiwiwiwwiwiwiththththththththththththththth ttttttttttttttthhehehehehehehehehehehehehehe aaaaaaaaaaaaaaasssssssssssssssssssssssssssisisisisisisisisisisisisisistatatattatatatatatatatatatancncncncncncncncncncncncnceeeeeeeeeeeee ofofofofofofofofofofoofofof ttttttttttttttthheheheheeheheheehehehehehe

in 1975. MENCs fl owchart oooofffffffffff state organizations was alalallsososososososososososooooo aaa a whicch h cecececececertrtrtrtrtrtrtrtttaiaiaiaiaiaaiaiaaiaiaa nnnnnnnnnnn nn eleleleleleleeleleleeleleleleememememememememememememememeeeenenenenenenttttttsts were ufl d li h l Th ffi

iizizizzzzzzzzzzzzationp , p in 1975 MENC’s flowchart ooooofofofofoffffofofof

selfl essly persrsrsrsrsrssssssononononononononononononononon lllalalalalalalalalalalalal i i

and plan tours in addition tto o maanyyyyyyyyy other tatatatatatatatatatatatatatataskskskskskskskskskskskskskskskssssssssssss.TTTTTTTTTTTTTT Thhhhhhhhhehehehehehesese skikikikikilllllls, possessed by all the ACDA presidents, enabled them to establish practi-

thththththththththththththththatatatatatatatatatatatatatatat ttttttttttt t t timimimimimimmimimimimimee,e,e,e,e,e,e,e,e,e,,,, hh h h avavavave remained largelwith the exception oooofffffffffffffff twtwtwtwtwtwtwtwtwtwtwtwtwtwtwooooo oo o o ooooo puppppppppp ri 1975 MENC’ fl h t ffi ti

p es de ts, e ab ed t e to estab s p act i 1975 MENC’ fl h t fization l l d bj i f h i iin 1975. MENCs flowchart ofAuthor IndexAuthor Index


Submission InformationArticles submitted for publication in the Choral Journal should meet established specifi cations. Although the length of articles varies considerably, submissions generally consist of ten to twenty typed, double-spaced pages. Referenced material should be indicated by superscript and end notes. Any artwork and a one- to two-sentence professional identifi cation of the author should also be included. Com-plete writer’s guidelines can be found on the ACDA Web site at <www.acda.org/choral_journal/writer%27s_guide-lines>. Articles submitted via e-mail attachment should be sent to <[email protected]>.

Book and Music Publishers and Compact Disc DistributorsSend books, octavos, and discs for review to:

Choral Journal545 Couch Drive,Okla. City, Oklahoma 73101Telephone: 405/232-8161

Choral ReviewersACDA members wishing to review choral music should contact:

Lyn SchenbeckTelephone 770/683-6837, E-mail <[email protected]>

Book ReviewersACDA members wishing to review books about choral music should contact:

Stephen TownTelephone: 660/562-1795, <[email protected]>

Compact Disc ReviewersACDA members wishing to review compact discs should contact:

Lawrence SchenbeckTelephone: 404/270-5482 E-mail <[email protected]>

Advertisers’ IndexACFEA Tour Consultants 58All Things Musical 56American Federation Pueri Cantores 63Appalachian Children's Chorus 55 Argentina Concert Tours 60Arts Bureau for the Continents 14 Classical Movements IBC Concept Tours 26 Cultural Tour Consultants 17DCINY 36 Ellison Travel & Tours 20 Friendship Ambassadors Foundation 11 George Fox University 22Hal Leonard Publishing Corp. 24Hawaii Music Festivals 12Herff Jones 10Interkultur (World Choir Games) 27, 61 Kingsway International IFC

Korea Tourism Organization 50 Lyric Choir Gown Company 59Musica Mundi, Inc. 35New Orleans Children's Chorus 37 Pacifi c Rim Music Resources 52 Part Predominant Recordings 46 Regency Cap & Gown Company 53 Small World MUSICFOLDER.com 16 SolidColorNeckTies.com 42Southeastern Performance Apparel BC Texas Choral Directors Association 32 The InterCulture Tours 62 Tour Resource Consultants 54University Music Service 31Valiant Music Supply 15Witte Travel & Tours 33Young Voices of Colorado 30


American Choral Directors Association545 Couch DriveOklahoma City, Oklahoma 73102<www.acda.org>

choral journal • june/july 2010 - acda 한국 연락 ... · pdf file2 h. royce saltzman...

Documents