cholesterol regulates vegfr-1 (flt-1) expression and...

1 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Copyright © 2010 American Association for Cancer Research

Cholesterol Regulates VEGFR-1 (FLT-1) Expression and Signaling in Acute

Leukemia Cells.

Casalou C. 1,2,3, Costa, A.1,2,3 , Carvalho, T.1,2,3, Gomes, A.L.1,2,3, Zhu, Z.4, Wu, Y.4

and Dias, S.1,2,3£

1 Angiogenesis Group, Instituto Português de Oncologia Franscisco Gentil de

Lisboa, EPE (CIPM/IPOLFG)

2 Neoangiogenesis Group, Instituto Gulbenkian de Ciência, Oeiras

3 CEDOC, Faculdade de Ciências Médicas, Universidade Nova de Lisboa,

Portugal.

4 Imclone Systems, New York, USA.

£ Corresponding author

Running title: FLT-1 signaling is modulated by cellular cholesterol

on June 28, 2018. © 2011 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on January 5, 2011; DOI: 10.1158/1541-7786.MCR-10-0155

http://mcr.aacrjournals.org/



Abstract

Vascular endothelial growth factor receptors -1 (FLT-1) and -2 (KDR) are

expressed on subsets of acute myeloid (AML) and lymphoid (ALL) leukemia

cells, in which they induce cell survival, proliferation and migration. However, little

is known regarding possible co-factors that regulate VEGF receptors expression

and activation on leukemia cells. Here we show that cholesterol accumulates in

leukemia-rich sites within bone marrow of xenotransplanted SCID mice.

Therefore, we hypothesized that cholesterol-rich domains might regulate FLT-1

signaling and chemotaxis of acute leukemias. We then showed that (i) FLT-1

accumulates in discrete cholesterol-rich membrane domains where it associates

with caveolin-1; and that (ii) PlGF/VEGF stimulation promoted FLT-1 localization

in such cholesterol-rich domains. Accordingly, FLT-1 localization and its

phosphorylation were abrogated by -methyl-β-cyclodextrin (MβCD) which

removes cellular cholesterol and by Nystatin, an inhibitor of lipid raft endocytosis.

Mechanistically, cholesterol increased FLT-1 expression and promoted

PlGF/VEGF-induced leukemia cells viability and also induced VEGF production

by the leukemia cells in vitro. Taken together, we conclude that cholesterol

regulates VEGF:VEGFR-1 signaling on subsets of acute leukemias, modulating

cell migration and viability, which may be crucial for disease progression. Finally,

we provide evidence obtained from Human AML samples that primary leukemia

cells accumulate significantly more cholesterol than normal cells, and that

cholesterol accumulation correlates with disease aggressiveness.






Introduction

Acute leukemia cells have been previously shown to express VEGF

receptors, which can be stimulated in a paracrine or autocrine manner, resulting

in increased cell survival, proliferation and migration (1). VEGF signaling through

VEGFR-1 (FLT-1) on acute leukemias was shown to involve p38 and Erk1/2

activation, resulting in caveolae formation (2). Others have shown that VEGF

stimulation of subsets of leukemias results in the activation of a downstream

signaling pathway which mainly involves the activation of the Pi3 kinase pathway

(3).

Concerning the function of the different VEGF receptors on leukemia cells,

we have recently shown that FLT-1 mediates leukemia migration within the bone

marrow (BM) microenvironment, promoting leukemia expansion and ultimate exit,

to colonize extramedullary sites (4). These findings led us to hypothesize that

other signals within the BM microenvironment might cooperate or promote VEGF

signaling on leukemia cells, which in turn would contribute towards favoring

leukemia migration and invasion, worsening disease outcome.

Plasma membrane lipid raft domains, which contain high concentrations of

cholesterol and sphingolipids, are known to function as centers of signaling

complexes. The ability of lipid rafts to enhance receptor signaling, has led to the

concept of a signalosome, a region where proteins are localized together to

facilitate receptor signaling. A vast body of literature is available concerning the

localization of EGF receptors in lipid rafts, and the subsequent regulatory

pathway involving the intracellular transport of EGF receptor (5). Much less is

known about the involvement of membrane rich lipid domains and VEGF

signaling (6). Our recent data showed that inhibitors of lipid raft assembly,

including nystatin, blocked VEGF-induced leukemia migration (4), which strongly

suggested that cholesterol rich domains might in fact regulate VEGF signaling on

malignant cells such as acute leukemias.

In the present report we exploited the biochemical pathways involved in

VEGF signaling in AML cells, and demonstrate that FLT-1 is modulated by






cellular cholesterol. We show that FLT-1 co-localizes with membrane rich

cholesterol domains, whose assembly is essential for FLT-1 expression and

activation on leukemia cells. Moreover, cholesterol content of acute leukemia

patient samples correlates with disease aggressiveness. As such, our data reveal

novel possibilities of therapeutic intervention on subsets of acute leukemias.






Results

Acute leukemia cells localize in cholesterol-rich niches in the BM

microenvironment in vivo

We have previously observed that acute leukemia cells migrate in an FLT-1

dependent manner within the bone marrow (BM) microenvironment towards the

epiphysis, en route to colonize other organs (4). In the present study we detected

specific cholesterol accumulations in leukemia-rich BM sites in vivo. For this, we

stained smears of BM collected on days 10-12 after mice inoculation with

leukemia cells, with Nile red, to detect intracellular lipids (7, 8). We observed

major accumulations of lipids (neutral lipids, i.e. cholesterol esters and polar

lipids) around BM sinusoids, where leukemia cells also tend to accumulate (figure

1). These data suggests that leukemia cell migration within the BM

microenvironment results in their accumulation in cholesterol-rich areas.

Avidity for cholesterol of leukemia cells

We compared cholesterol content of mononucleated (MNC) cells isolated from

healthy donors with MNC obtained from AML patients (2A). Patient samples were

grouped into pediatric samples, adult samples I (AML patients with ages between

30-35 years old) and adult samples II (AML patients with ages between 64-79

years old). In peripheral blood AML patient samples (AML8 and 15) the levels of

intracellular cholesterol were increased by 2,4-3,4 fold in relation to healthy

donor’s samples. AML patients display increased intracellular cholesterol, in

particular older patients with 4 to 6 fold increase (Adult samples II). After clinical

bone marrow remission, intracellular cholesterol levels decreased to levels

compared to that obtained from healthy donors (AML3, 4 and 16-BM-R). Also,

MDS sample (patient with myelodysplasic syndrome) has lower levels of

cholesterol. Furthermore, pediatric AML samples present 3 to 4 fold increased

levels of cellular cholesterol. In figure 2B, AML cells (HEL and HL60 cell lines)

showed 2 to 4 fold significant increase of cellular cholesterol (control-1 and -2,

respectively), when compared with cells isolated from healthy donors. Next, we






disturbed cholesterol homeostasis of leukemia cells by exposure for 4 hours to

10μM methyl-β-cyclodextrin (MβCD), which depletes cholesterol from cellular

membranes, or by increasing its cellular cholesterol levels with the use of

cholesterol+MβCD complexes (0,4μM). Cholesterol+MβCD complex treatment

increased by 1,5-2,3 fold cellular cholesterol of leukemia cells when compared to

untreated cells. This increase was abolished by MβCD and by nystatin treatment,

which inhibits lipid raft endocytosis. Additionally, PlGF treatment also increased

intracellular cholesterol of AML cells, an effect that was reverted to control levels

(control-2; figure 2B) by the use of a neutralizing antibody against FLT-1 (6.12

Ab; p<0,02; Imclone, N.Y.). Acute leukaemia cells possess more intracellular

cholesterol when compared to normal cells. Furthermore, FLT-1 activation by

PlGF further potentiates this effect. Additionally, cellular cholesterol is highly

increased in AML patients, an effect that was reverted after clinical bone marrow

remission.

PlGF induces FLT-1 accumulation and co-localization with caveolin-1 in lipid rafts

We have previously reported that FLT-1 associates in vitro with caveolin-1, the

main component of a sub-type of lipid-rafts (caveolae), in AML cells (2). This

suggested that FLT-1 mediated signaling in acute leukemia cells might depend

on cholesterol-raft membrane domains. Therefore, in the present study we

determined a more precise membrane location of FLT-1 on leukemia cells and

asked whether it was affected by PlGF-stimulation and/or cholesterol

disturbance. We isolated lipid-rafts using sucrose-density gradients and this

analysis revealed that FLT-1 and caveolin-1 co-localize in 2 distinct regions of the

sucrose gradients; a caveolin-enriched membrane region (fractions 4 and 5; 6%-

30% sucrose) and a cytosolic region (fractions 10-11; 35% sucrose), as

assessed by caveolin-1 (a component of lipid-rafts) co-sedimentation (figure 3A).

Upon PlGF/VEGF stimulation, FLT-1 was localized preferentially into lipid-raft

fractions (fractions 4 and 5), an effect that was reverted in the presence of the

FLT-1 inhibitor IR1 (figure 3A). Also, inhibition of FLT-1 by IR1 treatment,






removes caveolin-1 from the lipid raft fractions. Using confocal microscopy we

observed that FLT-1 (in red) and caveolin-1 (in green) co-localized in lipid

raft/caveolin-1 rich structures (figure 3B). (FLT-1 antibody specificity is shown in

additional file 1). To determine whether FLT-1 distribution in lipid-rafts was

affected by cholesterol disturbance, sucrose gradient-generated lipid-raft

fractions 4 and 5 and cytosolic fractions 10 and 11 were concentrated and

analyzed by Western-blot as before. As shown in figure 3C, cholesterol

enrichment accumulated FLT-1 in lipid-raft fractions, while MβCD extracted FLT-

1 from lipid-raft fractions (see quantification in figure 3D). β-actin was used as a

loading control (figure 3C). As determined by confocal microscopy, after

cholesterol enrichment FLT-1 co-localized with caveolin-1, whereas cholesterol

extraction with MβCD reduced this co-localization (figure. 3E). These results

indicating the preferential localization of FLT-1 in lipid-rafts after intracellular

cholesterol enrichment, suggest that FLT-1-raft interactions may regulate

PlGF/VEGF mediated signaling.

Cholesterol enrichment of acute leukemia cells induces FLT-1 activation in lipid

rafts

In AML cells, FLT-1 is phosphorylated by PlGF/VEGF treatment for 30 minutes

(figure 4A), as assessed by co-immunoprecipitation of FLT-1 with pan phosphor-

tyrosine antibody. We determined the consequences of disturbing cholesterol

homeostasis for FLT-1 activation on AML cells. We observed that cholesterol

extraction abolishes FLT-1 phosphorylation induced by PlGF, in a dose

dependent manner. In contrast, cholesterol enrichment increased FLT-1

phosphorylation (activation) in the absence or presence of PlGF (figure 4B).

Inhibition of FLT-1 activation was achieved by the use of nystatin, an inhibitor of

lipid-raft formation and endocytosis, which impeded PlGF-induced FLT-1

phosphorylation (figure 4C). β-actin was always used as loading control. Taken

together, these data suggests that FLT-1 activation (phosphorylation) is affected






by cellular cholesterol levels, and in particular by agents that perturb the

formation of lipid rafts/cholesterol rich membrane domains.

Cholesterol enrichment modulates PlGF-induced AML cells properties

To evaluate the role of cholesterol in acute leukemia cells properties, we

assessed cell viability, migration and VEGF production on cholesterol enriched or

depleted cells, alone or in the presence of PlGF. Viability was assessed after 24-

48 hours by counting cell viability with trypan exclusion dye. As previously

reported, PlGF induced a modest increase in AML cells viability. However,

leukemia cells cholesterol enrichment increased cell viability after 24hours;

interestingly, co-treatment of cholesterol enrichment with PlGF, induced a further

increase in leukemia cell viability (figure 5A). In contrast, PlGF-induced cell

viability was significantly reduced by MβCD treatment. Cholesterol enrichment of

AML cells for 4-16 hours increased their chemotactic (migratory) response

towards PlGF (figure 5B), an effect that was reverted in the presence of FLT-1

neutralizing agents. In addition, cholesterol enrichment also increased VEGF

production by AML cells in vitro (see additional file 2). Taken together, these data

suggest that cholesterol cellular levels affect FLT-1 mediated increase in cell

viability, chemotaxis and VEGF production.

FLT-1 expression on AML cells increases upon cholesterol exposure

Besides its effects in the regulation of FLT-1 activation and sub-cellular

localization, next we asked whether cholesterol levels also affected FLT-1

expression. In fact, cholesterol enrichment up-regulates FLT-1 mRNA expression

in leukemia cells (figure 6A). PlGF further increased FLT-1 expression in

cholesterol enriched cells, an effect that was reverted by the FLT-1 inhibitors.

This effect on FLT-1 mRNA expression is characteristic of leukemia cells since

FLT-1 mRNA expression remains unaltered by cholesterol disturbances in Huvec






cells (figure 6B). It was previously reported that CREB/ATF element regulates the

basal transcription of FLT-1 expression (18). Moreover, we observed that

increasing intracellular cholesterol on AML cells further potentiates the binding of

CREB complexes to the FLT-1 promoter region, thereby regulating FLT-1

expression (see additional figure 3). In contrast, KDR mRNA expression was not

altered by increasing cellular cholesterol in leukemia cells (figure 6C).






Discussion

In this report we reveal novel molecular evidence by which cellular

cholesterol regulates the function of a receptor tyrosine kinase on malignant

leukemia cells. In detail, we show that cholesterol affects FLT-1 expression,

localization and activation, thereby modulating cellular phenotypes including

viability, chemotaxis/migration and VEGF production. The mechanisms by which

cholesterol interferes with FLT-1 signaling and cellular localization are still not

completely understood, but may involve the intracellular transport machinery and

the regulation/assembly of specific membrane domains, including vesicles and

lipid rafts. Other receptor tyrosine kinases, most notoriously EGF receptor, have

been shown to be transported intracellularly in vesicles, in and out of the cell onto

the cell nucleus where EGF receptor was shown to activate transcription (5).

Whether FLT-1 recycling involves a similar mechanism of intracellular transport is

still undisclosed. Nevertheless, the present report reveals that FLT-1 localizes

preferentially in specific lipid-enriched membrane domains. Detailed biochemical

analysis of cellular extracts, together with the use of biochemical inhibitors,

suggests these membrane domains may be considered lipid rafts. As such, our

data strongly suggests lipid rafts are essential for VEGF receptor signaling on

malignant leukemia cells.

We have previously shown that subsets of acute leukemias respond to

VEGF/PlGF gradients within the BM microenvironment, migrating towards the

epiphysis of long bones, from where the leukemia cells leave the BM onto the

peripheral blood, en route to other target organs (4). From these findings it

became clear that leukemia cells migrate towards specific “niches” within the BM

microenvironment. Recent studies have suggested leukemia cells “create”

specific niches within the BM microenvironment, where the malignant cells will

thrive and proliferate, eventually replacing the normal hematopoietic elements

(9). The signals/molecular cues involved in this “invasion” of the BM by malignant






cells are still largely undisclosed, but are believed to involve SDF-1:CXCR4 and

possibly integrin-mediated signaling (10-12).

Our present report suggests the BM cholesterol levels and the cholesterol

distribution throughout the BM may play an important part during leukemia

engraftment, expansion and perhaps also during leukemia spread. In detail, we

provide evidence that PlGF/VEGF signaling via FLT-1 is affected by cellular

cholesterol levels, and that specific cholesterol accumulations are seen in

leukemia-rich sites in the BM, in vivo. Interestingly, we have recently discovered

that systemic cholesterol levels also affect the levels of SDF-1 in the BM

microenvironment (13). This strongly suggests that cholesterol may affect

leukemia engraftment and expansion, by interfering with SDF-1:CXCR4 signaling

and VEGF:FLT-1 signaling respectively.

A link between cholesterol avidity and acute leukemias has been previously

suggested. In our present study AML patient samples show increased levels of

intracellular cholesterol compared to healthy donor’s samples. Moreover, the BM

cholesterol content correlates with disease aggressiveness (and stage); leukemia

patients undergoing clinical remission show a corresponding decrease in

intracellular cholesterol levels. Other studies have reported that cholesterol

uptake by leukemia cells promotes their survival and resistance to chemotherapy

(14,15). These studies led to the use of statins (cholesterol lowering agents) as

therapeutic targets for subsets of acute leukemias (16-17), with reported clinical

activity and efficacy. Nevertheless, to our knowledge, there have been no reports

explaining the importance of cholesterol in VEGF-mediated signaling on acute

leukemia cells. All together, the findings reported in the present manuscript have

implications for the understanding of the regulation of the BM microenvironment,

during the onset/engraftment and expansion/progression of acute leukemias. The

biochemical mechanisms described here, showing that lipid-enriched membrane

domains regulate VEGF receptor signaling, may be relevant also in the context of

other receptor tyrosine kinases and other tumor types.






Materials and Methods

Cell culture

HEL, HL60 and 697 cells were obtained from American Type Culture Collection.

Cells were maintained in RPMI 1640 medium supplemented with 10% fetal

bovine serum, L-glutamine 100mM and 1% penicillin-streptomycin (Invitrogen

Life Tecnologies). Huvec cells were maintained in endothelial cell growth medium

containing 5% FBS (EBM-2; Cambrex, Inc.) at 37ºC with humidified 95% air/5%

CO2.

Human samples

Sixteen patient samples (bone marrow-BM or peripheral blood-PB) were used

and grouped in 4 pediatric AML samples, 2 of them in clinical bone marrow

remission; 4 adult samples I, with ages between 30-35 years old; 7 adult samples

II, with ages between 74-79 years old, one in clinical bone marrow remission.

Also, one MDS sample was used (myelodysplasic syndrome) in the adult sample

II group. Mononuclear cells were collected from BM/PB and isolated using

Ficoll/Histopaque gradient. Dry pellets were processed for cholesterol

quantification according to Amplex red kit.

RNA extraction and RQ-PCR

Leukemia cells were analyzed for VEGF-1(FLT-1) by RQ-PCR (ABI PRISM 7700

Sequence Detection System and SYBR Green Master Mix Kit; Applied

Biosystems). Total cellular RNA was extracted using trizol protocol (Sigma-

Aldrich) and cDNA was synthesized following conventional protocols. The 18S

gene was used as a standard reference. The relative expression of FLT-1 and

KDR was obtained using comparative threshold cycle (CT) method. Primer

sequences: FLT-1 sense; 5’-CCTCGCCGGAAGTTGTAT-3’; FLT-1 anti-sense;

5’-GTCAAATAGCGAGCAGATTTCTCA-3’; KDR sense; 5’-

ATTCCTCCCCCGCATCA-3’; KDR anti-sense; 5’-GCTCGTTGGCGACTCTT-3’.






Whole-cell lysate preparation and Western blotting

Acute leukemia cells were stimulated for 30 minutes with recombinant VEGF165

(50ng/mL), PlGF (100ng/mL) and/or treated with for 2-4hours with MβCD (10mM

or 20mM), Cholesterol+MβCD (0,2mM or 0,4mM), Nystatin (50μg/mL). After

stimulation/treatment, total protein extracts were obtained by suspending cell

pellets in cold buffer A (50 mM Tris-HCl, pH 7,4; 1% (v/v) Triton X-100; 150mM

NaCl; 1mM EDTA; 0,1% (v/v) SDS), in the presence of protease and

phosphatase inhibitors, for 30 minutes on ice followed by centrifugation at 12 000

g, for 15 minutes at 4 ºC. Protein concentrations were determined using the Bio-

Rad Laboratories DC protein assay kit and equal amounts were separated by

SDS-PAGE gels, transferred onto nitrocellulose membranes and processed for

Western blotting. Primary antibodies: anti-FLT-1 (0,5μg/mL; Santa Cruz

Biotechnology, Inc.), anti-caveolin-1 (1:100; BD-Biosicences), anti-phospho-

tyrosine (1:50, 0,5μg/mL; Santa Cruz Biotechnology, Inc), anti-β-actin (1:2500,

Sigma-Aldrich). Secondary antibodies HRP (Horseradish peroxidase)-conjugated

were used at 1:2500 and the enhanced chemiluminescence (ECL) detection

system and Kodak films (Amersham Pharmacia Biotech, Piscataway, NJ) were

used to visualize the presence of proteins on the nitrocellulose blots. Bands were

quantified using Image J software (rsb.info.nih.gov/ij/).

Immunoprecipitation assay

HEL lysates (900μg) were pre-cleared (1hour) with Protein G-Sepharose beads

(Sigma Aldrich) and then incubated overnight at 4ºC with anti-FLT-1 (1μg/mL;

Santa Cruz) or with rabbit IgG as a negative control of the co-

immunoprecipitation procedure. Protein G-Sepharose beads were then added

and mixed for 2 hours at 4ºC. Beads were recovered by centrifugation, washed

with cold buffer A or with buffer A supplemented with high salt concentration

(500mM Nacl), and resuspended in (20μl) Laemmli buffer. After boiling at 95ºC






for 5 minutes, the immunoprecipitates were analyzed by 8% SDS-Page gels

followed by western-blotting with anti-phospho tyrosine and anti-FLT-1 antibodies

(1μg/mL; Santa Cruz).

Sucrose Density Centrifugation and Isolation of Lipid Raft Fractions

Acute leukemia cells (HEL; 1x108) stimulated for 30 minutes with PlGF

(100ng/mL) or treated 1 hour with IR1 inhibitor (2μM; Calbiochem.), MβCD

(10mM) and MβCD+cholesterol (0,2mM) were washed with PBS and cell pellets

were suspended in 1.0ml of 1% (v/v) Triton X-100 in TNEV buffer (100mM Tris-

HCL (pH 7.5), 150mM NaCl, 5mM EDTA, 1mM Na2VO3, 1mM PMSF, 1x

protease inhibitors (Roche)) on ice for 60 minutes. Cells were homogenized with

10 passages through a 22-gauge needle and nuclei were removed by

centrifugation at 800 g for 8 minutes at 4ºC. The supernatants were mixed 1:1 in

85% sucrose (v/v)/TNEV buffer. The mixture (2ml) was transferred to the bottom

of the ultra-centrifuge tube and 2 solutions with different sucrose concentrations

in TNEV buffer were added sequentially (6ml of 35% (v/v) sucrose and 3,5ml of

5% (v/v) sucrose). The discontinuous gradients were separated by centrifugation

in a swing-out rotor (SW41TI) at 38,000 g during 18 hours at 4ºC in a Beckman

XL-80 Ultracentrifuge. One-milliliter fractions were collected sequentially from the

top to the bottom of the tube and Western blot analysis were done with

antibodies against FLT-1, caveolin-1. After identification by Western-blot

fractions from sucrose gradients (lipid/raft: 4 and 5; cytosolic fractions: 10 and

11) were concentrated by centrifugation (4000 g for 20 minutes at 4ºC) using

Amicon Ultra-4 devices with 10kDa cut-off membranes (millipore).

Cell viability and migration assays

Cells (1x105/mL) were cultured in serum-free RPMI medium for 48 hours in the

presence of PlGF (100ng/mL), methyl-β-cyclodextrin (MβCD; 10mM) and

cholesterol+MβCD complexes (0,4mM). When applicable, cells where previously

treated for 2 hours with 2μM IR1 (tyrosine kinase inhibitor of FLT-1;






Calbiochem.), or with neutralizing antibodies directed to FLT-1 (1μg/mL 6.12

antibody, Imclone). Cell viability was determined at 24 hours and 48 hours by

trypan blue exclusion and cell counts (with the aid of a hemocytometer). Each

experiment was done in triplicate. Cell migration was assayed using a modified

version of a transwell migration technique described previously (Hamada et al,

1998). Serum starved cells (1x106 cell/mL) were treated for 4 hours or 18 hours

with cholesterol+MβCD. Cell aliquots (100μL) were added to 8μm-pore transwell

inserts of migration system (6.5μm in diameter, Costar) and let migrate for 4-6

hours towards PlGF in the absence/presence of neutralizing antibodies directed

to FLT-1. Cell counts were done in 7 distinct power-fields (20x magnification) with

Olympus CK2 microscope. Experiments were done in triplicate, and results are

shown as the number of migrating cells/mL.

Human VEGF Elisa and cholesterol measurement

VEGF production by leukemia cell lines used was determined by enzyme-linked

immunosorbent assay (ELISA). VEGF in serum free medium was quantified

using the human VEGF ELISA kit (Calbiochem). Cellular cholesterol was

detected using the Amplex Red Cholesterol Assay Kit according to

manufacturer´s instructions (Molecular Probes).

Immunofluorescence

Leukemia cells (5x106) were serum starved for 16 hours and further attached to

poly-L-lysine coated coverslips for 10 minutes at 37ºC. After a brief wash in PBS

cells were stimulated with PlGF (100ng/mL) for 30 minutes and/or treated with

MβCD (10mM) or MβCD+Cholesterol complexes (0,2mM cholesterol) for 2 hour-

4 hours. The cells were fixed in 2% (v/v) paraformaldehyde for 10 minutes at

room temperature, washed in PBS twice and permeabilized in 0,1% (v/v) triton

X-100 for 30 seconds. After blocking in PBS (Invitrogen Life technologies)

supplemented with 0,1% (w/v) BSA, 5%(v/v) complete goat serum, rabbit anti-

human FLT-1 (1,5 μg/mL; Santa Cruz Biotechnology, Inc), mouse anti-caveolin-1






(1:100; BD biosciences) were used overnight at 4ºC. The cells were washed and

incubated with Alexa fluor 594 or 488 secondary antibodies at 1:500 (Molecular

probes) for 90 minutes and washed with PBS. Samples were mounted in

Vectashield and analyzed by Confocal microscopy in a True Confocal Scanner

Leica TCS SP2; Leica Microsystems; objectives HCX PL APOCS 63 x 1.4 oil.

Sets of optical sections with 0.5-μm intervals along the z-axis were obtained from

the top to the bottom of cells. Z-projections of the acquired images were

obtained using ImageJ software (rsb.info.nih.gov/ij/).

Bone marrow smears and Nile red staining

Ten to twelve days after 697 and HL60 cells Xenotransplantation, mice were

sacrificed and bone marrow (BalbSCID mice) was removed in toto by flushing

one femoral cavity. Bone marrow smears were prepared by streaking the

exposed bone marrow onto a glass slide. Pressure while executing the smears

was adjusted to disperse cells in a monolayer without disrupting cells and

vascular structures integrity. Bone marrow smears were air dried, fixed in cold

acetone for 10 minutes and stained with Nile Red for 15 minutes. Images were

acquired on a Zeiss Axioplan microscope with a Zeiss Axioxcam MRm

(amplification: x200, x630). Nile Red solution (1:6 diluted in 75% (v/v) glycerol)

was prepared from a stock Nile Red solution (100μg/mL in ethanol; sigma-

N3013). Nile red stained with excitation wavelength of 450–500 nm neutral lipids

(yellow‐gold emission) and 515–560 nm polar lipids (red emission) (8).

Eletrophoretic mobility shift assay (EMSA)

Nuclear extraction and electrophoretic gel mobility shift assays were performed

following standard methodology as described elsewhere (19). Briefly,

oligonucleotide probe (sequence: ACCCCTTGAGTCACCAGAAGG) was labeled

with [γ32-P] ATP using T4 polynucleotide kinase (Promega) and purified in Micro-

spin G-50 columns (Bio-Rad). For the EMSA analysis, 10 μg of nuclear proteins

were pre-incubated with EMSA binding buffer (Promega) as well as 15 ng/μl






poly(dI)-poly(dC) at room temperature 10 minutes before the addition of the

radiolabeled oligonucleotide for an additional 25 minutes. For Supershift studies,

before addition of the radiolabeled probe, samples were incubated for 30 minutes

with 4 μg of CREB-1 antibody (H-74; Santa Cruz).

Statistical analysis

Results are expressed as mean plus or minus SD. Data were analyzed using the

unpaired 2-tailed Student t test. P values of less than 0.05 were considered

significant.






List of abbreviations used BM- bone marrow; PB- peripheral blood ALL- acute leukemia cells; AML- acute

myeloid leukemia; MβCD- methyl-β-cyclodextrin; HPF- high power fields

Acknowledgments This study was supported by GlaxoSmithkline. Cristina Casalou, Ana Costa, Ana

L. Gomes and Tânia Carvalho are recipients of FCT (Portuguese Government)

Fellowships. The authors would like to thank other members of the Angiogenesis

Lab. for useful discussions and for critically reading this manuscript.






References

1. Hicklin, DJ and Ellis, LM. Role of Vascular Endothelial Growth Factor Pathway

in Tumor Growth and Angiogenesis. Journal of Clinical Oncology 2005;23:1011-

1027.

2. Casalou C, Fragoso R, Nunes, JFM, Dias, S. VEGF/PLGF induces leukemia

cell migration via P38/ERK1/2 kinase pathway, resulting in Rho GTPases

activation and caveolae formation. Leukemia 2007;21:1590-94.

3. Fragoso R, Elias AP, Dias S. Autocrine VEGF loops, signaling pathways, and

acute leukemia regulation. Leukemia & Lymphoma 2007;48:481-8.

4. Fragoso R, Pereira T, Wu Y, Zhu Z, Cabeçadas J, Dias S. VEGFR-1 (FLT-1)

activation modulates acute lymphoblastic leukemia localization and survival

within the bone marrow, determining the onset of extramedullary disease. Blood

2006;107:1608-16.

5. Patra, SK. Dissecting lipid raft facilitated cell signaling pathways in cancer.

Biochem Biophys Acta 2008;1785 (2):182-206.

6. Labrecque, L, Royal, I, Surprenant, DS, Patterson, C, Gingras, D,Béliveau, R.

Regulation of vascular endothelial growth factor receptor-2 activity by caveolin-1

and plasma membrane cholesterol. Molecular Biology of the cell2003;14:334-

347.

7. Diaz, G, Melis, M., Batetta, B., Angius, F., Falchi, A.M. Hydrophobic

characterization of intracellular lipids in situ by Nile Red/Yellow emission ratio.

Micron 2008;39:819-824.

8. Greenspan P, Fowler, SD. Spectrofluorometric studies of the lipid probe, nile

red. Journal of Lipid Research 1985;26:781-89.

9. Colmone, A, Amorim, M, Pontier, AL, Wang, S, Jacblonski, E, Sipkins, DA.

Leukemic Cells Create Bone Marrow Niches That Disrupt the Behavior of Normal

Hematopoietic Progenitor Cells. Science 2008;322:1861-1865.

10. Peled, A, Kollet, O, Ponomaryov, T, et al. The chemokine SDF-1 activates

the integrins LFA-1, VLA-4, and VLA-5 on immature human CD34(+) cells: role in






transendothelial/stromal migration and engraftment of NOD/SCID mice. Blood

2000;95:3289–3296.

11. Kijowski, J, Baj-Krzyworzeka, M, Majka, M, et al. The SDF-1-CXCR4 axis

stimulates VEGF secretion and activates integrins but does not affect

proliferation and survival in lymphohematopoietic cells. Stem Cells 2001;19:453–

466.

12. Hidalgo A, Sanz-Rodriguez F, Rodriguez-Fernandez JL et al. Chemokine

stromal cell-derived factor-1alpha modulates VLA-4 integrin-dependent adhesion

to fibronectin and VCAM-1 on bone marrow hematopoietic progenitor cells.

Experimental Hematology 2001;29:345–355.

13. Gomes, A.L., Carvalho, T., Serpa, J., Torre, C., Dias, S.,

Hypercholesterolemia promotes bone marrow cell mobilization by perturbing the

SDF-1:CXCR4 axis. Blood 2010; [Epub ahead of print].

14. Li, HY, Appelbaum FR, Willman CL, Zager RA, Banker DE. Cholesterol-

modulating agents kill acute myeloid leukemia cells and sensitize them to

therapeutics by blocking adaptive cholesterol responses. Blood 2003;101: 3628-

34.

15. Banker, DE, Mayer, SJ, Li, HY, Willman, CL, Appelbaum, FR, Zager, RA.

Cholesterol synthesis and import contribute to protective cholesterol increments

in acute myeloid leukemia cells. Blood 2004;104:1816-24.

16. Sassano A, Katsoulidis E, Antico G, et al. Supressive effects of statins on

acute promyelocytic leukemia cells. Cancer Research 2007;67:4524-32.17.

17. Kornblau SM, Banker DE, Stirewalt D, et al. Blockade of adaptive defensive

changes in cholesterol uptake and synthesis in AML by the addition of

pravastatin to idarubicin + high-dose Ara-C: a phase 1 study. Blood

2007;109:2999-3006.

18. Morishita, K, Johnson, DE and Williams, LT. A novel promoter for Vascular

Endothelial Growth Factor Receptor (flt-1) that confers endothelial-specific gene

expression. The Journal of Biological Chemistry 1995;270:27948-53.






19. Santos, SC and Dias, S. Internal and external autocrine VEGF/KDR loops

regulate survival of subsets of acute leukemia through distinct signaling

pathways. Blood2004;103:3883-3889.

Figure Legends:

Figure 1: Evidence for co-localization of acute leukemia cells in cholesterol-rich

BM niches in vivo. Leukemia cells tend to gather around BM sinusoids, where

major lipid accumulation was detected (limited by the intermittent line); Nile Red

fluorescence arising from the dye–lipid interaction was selectively measured

using an excitation wavelength of 450–500 nm for neutral lipids (yellow‐gold

emission; B and F) and 515–560 nm for polar lipids (red emission; C and G).

These results were obtained from 3 independent experiments and are

representative of 4 recipients. Images were processed with Adobe Photoshop 7.0

Software.

Figure 2: Acute leukemia cells possess high avidity for cholesterol. (A) AML

primary cells display high levels of intracellular cholesterol as compared with

cholesterol content in cells obtained from healthy donors, as measured by the

Amplex Red cholesterol assay kit. Furthermore, intracellular cholesterol content

correlates with the aggressiveness of the disease. HD1/2- healthy donor sample;

AML- bone marrow acute myeloid leukemia samples; AML PB-peripheral blood

acute myeloid leukemia samples; AML BM-R- bone marrow acute myeloid

leukemia in clinical remission samples; MDS- myelodysplasic syndrome. (B)

Acute leukemia cells possess higher levels of intracellular cholesterol, an effect

potentiated by FLT-1 activation by PlGF. Leukemia cell lines (HEL and HL60)

where exposed to 0.2 μM cholesterol complex or to MβCD alone (10 μM) for 4

hours and cellular cholesterol was quantified using the Amplex red kit. Error bars

show the standard errors of two independent experiments.

Figure 3: Cholesterol enrichment of acute leukemia cells recruits FLT-1 to lipid-

raft/caveolin-1 rich domains. (A) Extracts from AML cells stimulated with PlGF,






control cells or cells treated with FLT-1 tyrosine kinase inhibitor (IR1) were

separated by sucrose gradient fractionation and analyzed by Western blot for

FLT-1 and caveolin-1 distribution. FLT-1 was mainly localized in caveolin-1

enriched fractions (4 and 5) upon PlGF stimulation; an effect reverted by FLT-1

tyrosine kinase inhibition. (B) Co-localization of FLT-1 with caveolin-1 was also

observed by confocal microscopy. (C) After AML exposure to cholesterol

disturbing agents, cell extracts were fractionated by sucrose gradients and

fractions enriched for lipid raft/caveolin-1 (fractions 4 and 5) and cytosolic

(fractions 10 and 11) were concentrated using Amicon ultra devices and

analysed by SDS-Page. Results are representative of three independent

experiments. (D) The bands obtained via western-blot for FLT-1 distribution upon

cholesterol disturbance (C) were quantified with ImageJ software based analysis

(http://rsb.info.nih.gov/ij/). (E) Extraction of FLT-1 from caveolin-1-enriched rafts

was observed after MβCD treatment the reverse effect of cholesterol+MβCD cell

treatment (see confocal microscopy analysis). Scale bars= 10μm.

Figure 4: Cholesterol enrichment promotes FLT-1 signaling in lipid rafts. FLT-1

receptor activation was tested by addition of PlGF, MβCD, Cholesterol+MβCD

and Nystatin as indicated. Total cell extracts were analyzed using anti-

phosphotyrosine, anti-FLT-1 and anti-β-actin antibodies. (A) Immunoprecipitation

of FLT-1 in AML lysates showed that PlGF/VEGF treatment for 30 minutes

activates FLT-1 receptor. (B) Leukemia cell treatment with MβCD abolishes FLT-

1 phosphorylation mediated by VEGF/PlGF. In contrast, AML intracellular

cholesterol increase activates FLT-1. (C) Inhibition of lipid-raft

formation/endocytosis by nystatin impedes FLT-1 activation. The

autoradiographs are representative of similar results obtained from three

independent experiments.

Figure 5: Cholesterol enrichment promotes PLGF/VEGF-induced leukemia cell

viability and migration. Viability of AML cells was assessed for 48 hours by trypan






blue exclusion dye. Cholesterol+MβCD acted synergistically with PlGF inducing

significantly (P=0,002) cell viability whereas cholesterol extraction by MβCD cell

treatment had the opposite effect (P=0,01). The chemotactic capacity of leukemia

cells towards PlGF was evaluated using a transwell migration system after their

treatment with Cholesterol+MβCD complexes (4-16 hours). A significant increase

in cell migration was obtained, an effect reverted by FLT-1-signaling blockage

(6.12 neutralizing antibody-P<0,01; tyrosine kinase inhibitor IR1-P=0,08). Results

are representative of 3 independent experiments. Error bars depict the standard

error of the mean.

Figure 6: Acute leukemia cell exposure to cholesterol up-regulates FLT-1

expression. (A) As determined by real-time PCR, FLT-1 expression after AML

cell treatment with cholesterol+MβCD complexes (4 hours) in the

presence/absence of PlGF is significantly up-regulated (without PlGF: P=0,048;

with PlGF: P<0,025). Inhibition of FLT-1 signaling (6.12 neutralizing antibody; IR1

chemical inhibitor) significantly abolishes the up-regulated FLT-1 expression

obtained after cholesterol cell exposure (P<0,03). In contrast, FLT-1 mRNA

expression was not affected by cellular cholesterol disturbance in Huvec cells

(B). KDR (also expressed in these cells) mRNA expression remains unaltered by

enriched cellular cholesterol (C). Experiments were done in triplicate and

represented the mean (n=3).

Additional files

Additional file 1- FLT-1 antibody specificity was assessed by confocal

microscopy using cells that express distinct FLT-1 amounts (HEL; 697). FLT-1

immunolocalization on HEL cells (A and C) is distinct when compared with FLT-1

staining obtained with the same antibody on 697 cells (E and F). B and D are DIC

images of A and C, obtained for HEL cells. As negative control HEL cells were

incubated only with secondary antibody (G, H).






Additional file 2- Acute leukemia cells produce significantly higher amounts of

VEGF after exposure to cholesterol, an effect FLT-1 dependent as observed by

FLT-1 blockage with 6.12 neutralizing antibody and with tyrosine kinase inhibitor

IR1. ELISA quantification of VEGF levels produced by acute leukemia cells after

treatment with Cholesterol+MβCD complexes for 4 hours.

Additional file 3- Cholesterol treatment (0,2μM cholesterol complex) increases

CREB complex formation at FLT-1 promoter. (A) Electrophoretic mobility shift

assay (EMSA) revealed the binding of CREB to the human FLT-1 proximal

promoter containing 2 putative FLT-1 binding sites. Nuclear extracts of untreated

(lane 2 and 3) and cholesterol+MβCD treated cells (lanes 4 and 5) were

incubated with labeled probe of wild-type FLT-1 binding site. Additionally, FLT-1

phosphorylation was induced by PlGF treatment for 30 minutes (lanes 3 and 5).

Excess of cold competitor (lane 1) inhibits CREB complex formation. In lane 6

untreated AML nuclear extracts (10μg) were incubated with 4 μg of anti-CREB-1

antibody for 1 hour at 4ºC before the addition of 32P-labeled probe. A- Band of

CREB complex; SS- Supershifted band with anti-CREB-1 antibody. (B)

Quantification of the bands obtained in A using ImageJ software based analysis

(http://rsb.info.nih.gov/ij/).




Published OnlineFirst January 5, 2011.Mol Cancer Res Cristina Casalou, Ana Costa, Tania Carvalho, et al. Signaling in Acute Leukemia Cells.Cholesterol Regulates VEGFR-1 (FLT-1) Expression and

Updated version

10.1158/1541-7786.MCR-10-0155doi:

Access the most recent version of this article at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/early/2011/01/05/1541-7786.MCR-10-0155To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-10-0155

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/early/2011/01/05/1541-7786.MCR-10-0155


cholesterol regulates vegfr-1 (flt-1) expression and...

Documents