chemical and molecular characterization of marigold ( tagetes...
TRANSCRIPT
Chemical and Molecular Characterization of
Marigold (Tagetes Species) Found in Pakistan
By
Irum Shahzadi
CIIT/SP05-R07-005/ATD
PhD Thesis
In
Environmental Sciences
COMSATS Institute of Information Technology Abbottabad - Pakistan
Fall, 2012
ii
COMSATS Institute of Information Technology
Chemical and Molecular Characterization of Marigold (Tagetes Species) Found in Pakistan
A Thesis Presented to
COMSATS Institute of Information Technology, Abbottabad
In partial fulfillment
of the requirements for the degree of
PhD
(Environmental Sciences)
By
Irum Shahzadi
CIIT/SP05-R07-005/ATD
Fall, 2012
iii
Chemical and Molecular Characterization of Marigold (Tagetes Species) Found in Pakistan
A Post Graduate Thesis submitted to the Department of Environmental Sciences
as partial fulfillment of the requirements for the award of Degree of PhD.
Name Registration Number
Irum Shahzadi CIIT/SP05-R07-005/ATD
Supervisor
Dr. Mohammad Maroof Shah Professor Department of Environmental Sciences COMSATS Institute of Information Technology (CIIT) Abbottabad
November, 2012
iv
Final Approval
This thesis titled
Chemical and Molecular Characterization of Marigold (Tagetes Species) Found in Pakistan
By
Irum Shahzadi
CIIT/SP05-R07-005/ATD
Has been approved
For the COMSATS Institute of Information Technology, Abbottabad
External Examiners: 1. ______________________________________________
Prof. Dr. Zahoor Ahmed Swati Director, Institute of Biotechnology and Genetic Engineering, KPK, Agricultural University, Peshawar
2. ______________________________________________
Dr. Uzaira Rafique Assoc. Prof. Department of Environmental Sciences Fatima Jinnah Women University, Rawalpindi
Supervisor: ______________________________________________ Prof. Dr. Mohammad Maroof Shah Department of Environmental Sciences, CIIT, Abbottabad
Head of Department: ______________________________________________ Prof. Dr. Arshid Pervez Department of Environmental Sciences, CIIT, Abbottabad
Dean, Faculty of Sciences: ______________________________________________ Prof. Dr. Arshad Saleem Bhatti, CIIT, Islamabad
v
Declaration
I, Irum Shahzadi, CIIT/SP05-R07-005/ATD hereby declare that I have produced the work presented in this thesis, during the scheduled period of study. I also declare that I have not taken any material from any source except referred to wherever due, and that the amount of plagiarism is within acceptable range. If a violation of rules on research has occurred in this thesis, I shall be liable to punishable action under the plagiarism rules of the HEC. Signature of the student: Date: ______________ ________________________
Irum Shahzadi CIIT/SP05-R07-005/ATD
vi
Certificate
It is certified that Miss Irum Shahzadi, CIIT/SP05-R07-005/ATD has carried out all the work related to this thesis under my supervision at the Department of Environmental Sciences, COMSATS Institute of Informational Technology, Abbottabad and the work fulfills the requirements for award of PhD degree. Date: ______________________
Supervisor: _________________________________ Prof. Dr. Mohammad Maroof Shah Department of Environmental Sciences CIIT, Abbottabad
Head of Department: ________________________________ Prof. Dr. Arshid Pervez Department of Environmental Sciences CIIT, Abbottabad
vii
DEDICATION
To
My most respected parents for their love, deep care and
encouragement that was a great strength to achieve this
remarkable objective of my life
viii
ACKNOWLEDGEMENTS
I am grateful to Almighty Allah (SWT) who helped me to complete this thesis and gave me courage and determination as well as true guidance in conducting my research work despite all difficulties. I need His help at every turn and every moment of my life.
First of all I am thankful to my supervisor Dr. Mohammad Maroof Shah, Professor, Department of Environmental Sciences, CIIT-Abbottabad for his excellent supervision, and guidance throughout my research and academic career. He always pushed me forward and encouraged to have firm belief in myself. I extend my gratitude to Professor Øyvind M. Andersen, Department of Chemistry, University of Bergen, Norway for his guidance in the identification and analyses of important chemical compounds in Tagetes. I acknowledge the Higher Education Commission of Pakistan (HEC) for providing me an opportunity to travel to the University of Bergen under International Research Support Initiative Program (IRSIP) where I completed a major objective of my study.
I express my gratitude to my supervisory committee including Dr. Raza Ahmad, Dr. Amjad Hassan, and Dr. Robina Farooq, for their help in my research work at CIIT Abbottabad. Particularly, I want to thank Dr. Raza Ahmad, for extending his expertise and auspicious efforts in carrying out molecular aspects of my research work and Dr. Amjad Hassan for assistance in thesis revisions. I also express my deepest thanks to Dr. Iftikhar A. Raja, Professor, Department of Environmental Sciences, for his help and continuous encouragement. Thanks are also extended to Dr. Arshid Pervez for support in research facilitation and to all faculty members of the Department of Environmental Sciences for long-lasting and unbendable support throughout the course of my studies and research work. Thanks to Dr. Manzoor Hussain, Professor and Taxonomist, Department of Botany, Post-Graduate College, Abbottabad, for species identification.
I also express my sincere thanks to lab staff especially Mr. Muhammad Amjad, Mr. Muhammad Jamshaid and Mr. Aurangzeb at CIIT, Abbottabad and the staff at the University of Bergen for their assistance in experiments. I am grateful to my friends for their support especially Maryam Mustafa, Ummara Waheed Khan and Maria Saddique who made my days joyous at and outside the department. I am highly obliged to my brothers Raja Yaser Ayaz, Raja Ihtsham, Raja Usman Akbar and sisters Noreen Ayaz and Aisha Ayaz who supported me throughout my life and academic career. My deepest gratitude goes to my parents who taught me the importance of having dreams, setting goals, achieving the targets and the art of hard work.
Irum Shahzadi
ix
ABSTRACT
Chemical and Molecular Characterization of Marigold (Tagetes
Species) Found in Pakistan Irum Shahzadi
Tagetes, a genus of flowering marigold is a medicinal plant grown over a wide range of climatic conditions. Molecular and chemical characterization of this important plant species may lead to identify novel compounds of high medicinal value. Major goal of the current research project was to characterize Tagetes species on chemical and molecular bases. The specific objectives of the study were to optimize extraction protocols for DNA and chemical compounds, molecular based genetic diversity of Tagetes plants, develop and characterize gene based markers, identify and characterize new/novel compounds present in the species. Fifteen genotypes of Tagetes including hybrids from different parts of Pakistan were collected and used. The plants of all Tagetes were grown in pots and field at CIIT Abbottabad for molecular analyses where as bulk amount of Tagetes minuta was collected and used for chemical analyses. The DNA from all genotypes was isolated using fresh, dried leaf tissues and seeds. Specific primers were developed for limonene synthase gene using sequence analyses and bioinformatic tools. Twenty-five random (RAPD) and 5 specific (degenerate-STS) primers were used for genetic diversity analysis. Chemical compounds were extracted using standard solvent extraction techniques and the crude fractions were tested for biological activities. The fractions were further purified and analyzed by chromatographic (TLC and HPLC) and spectroscopic (LCMS and NMR) techniques for compound identification and structural elucidation. The DNA isolated from fresh leaves and seeds of Tagetes was of good quantity and quality for PCR analyses. Significant variations were observed among all the genotypes of Tagetes species using PCR based markers. Twenty RAPD primers out of 25 and 3 degenerate-STS primers out of 5 revealed high polymorphism rate of 95.21% and 96.55% respectively. The phenograms generated using both marker systems grouped 15 Tagetes genotypes into 4 distinct groups, while T. minuta was placed genetically as most distantly related and unique species. PCR analysis with limonene synthase gene specific degenerate primers amplified candidate gene for limonene synthase in T. minuta. Bioactive extracts from flower parts of Tagetes exhibited antimalarial, phytotoxic, insecticidal and antibacterial activity. The HPLC profile revealed that butanol fraction contained good quality and quantity of flavonoids (17 flavonols) as compared to ethyl acetate (2 falvonols) and chloroform (mixture of other compounds). A total of 19 falvaonols were identified, of which 8 were structurally elucidated. Four new flavonols viz; 6-hydroxy quercetin 7-O-β-(6''-galloylglucopyranoside) (2), 6-hydroxy quercetin 7-O-β-(6''- caffeoylglucopyranoside) (9), 6-hydroxy kaempferol 7-O-β-glucopyranoside (5), 6-hydroxy kaempferol 7-O-β-(6''-galloylglucopyranoside) (7) were identified using butanol fraction. Four known flavonols, viz; 6-hydroxyquercetin 7-O-β-glucopyranoside (1), 6-methoxy quercetin 7-O-β-glucopyranoside (6), 6-methoxyquercetin (19), and 6-hydroxyquercetin (18) were also identified using butanol (1, 7) and ethyl acetate (18, 19) fractions. The combined molecular and biochemical information obtained will lead us to improve Tagetes for highly valuable compounds which may generate foreign exchange by exporting this important medicinal plant to other parts of the world.
x
TABLE OF CONTENTS
1 Introduction……………………………………………...................... 1
1.1 Genus Tagetes…...………………………………………………. 2
1.2 Tagetes species…………………………………………………… 2
1.2.1 Tagetes minuta L…………………………………………. 3
1.3 Molecular Characterization of Plant…………………................... 3
1.4 Chemical Characterization of Tagetes…………………………… 6
1.4.1 Essential Oils………………………………………............ 6
1.4.1.1 Terpenes...……………………………………..... 6
1.4.2 Flovonoids.………………………………………………... 7
1.4.2.1 Flavonols.………………………………………. 8
1.4.2.2 Structures of Flavonols.………………………… 8
1.4.2.3 Functions in Plant.……………………………… 12
1.4.2.4 Potential Health Effects………………………… 12
1.5 Uses of Tagetes Species.………………………………………..... 12
1.6 Objectives.………………………………………………………... 15
2 Materials and Methods..………………………………………………. 16
PART-I
Molecular Analysis..…………………………………………………….
17
2.1 Plant Material…………………..………………………………… 17
2.1.1 Plants Identification and Labeling..………………………. 17
2.1.2 Reagents, Chemicals and Buffer Solutions used in DNA
Analyses …………………………………………………..
18
2.2 DNA Isolation……………...…………………………………….. 19
2.2.1 DNA Extraction and Purification...…….…………………. 20
2.2.2 DNA Quantification……...……………………………….. 21
2.3 PCR Amplification and RAPD Analysis...……………………….. 21
2.3.1 STS Analysis..…………………………………………….. 22
xi
2.3.2 Data Analysis …………………………………………….. 23
2.4 Generation of Gene Specific Primers ……………………………. 25
2.4.1 Homology Search and Clustering………………………… 25
2.4.2 Degenerate Primers ………………………………………. 25
2.4.3 PCR and Nested-PCR Analysis .………………………….. 27
2.4.4 PCR Product Purification ………………………………… 27
2.4.5 DNA Sequencing and Data Analysis …………………….. 28
PART-II
Chemical Analysis..……………………………………………………..
29
2.5 Plant Material for Chemical Analysis …………………………… 29
2.6 Extraction and Fractionation …………………….......................... 29
2.7 Biological Assays.………………………………………………... 29
2.7.1 Antimalarial Bioassay .…………………………………… 30
2.7.2 Phytotoxicity Assay……………………………………..... 30
2.7.3 Insecticidal Activity Assay……………………………….. 31
2.7.4 Antibacterial Activity…………………………………...... 32
2.8 Isolation and Purification of Flavonoids ………………………… 33
2.8.1 Preparative HPLC ………………………….…………….. 33
2.9 Characterization and Structure Determination…………………… 34
2.9.1 Thin Layer Chromatography (TLC) ……………………… 34
2.9.2 Reversed Phase Analytical HPLC – DAD ……………….. 34
2.9.3 UV-Spectroscopy (UV)…………………………………… 35
2.9.4 NMR Spectroscopy……………………………………….. 36
2.9.4.1 1D 1H NMR ……………………………………. 36
2.9.4.2 1D 13C NMR …………………………………… 36
2.9.4.3 2D 1H 1H gradient selected, Double Quantum
Filter Correlation SpectroscopY (gs-DQF-
COSY)…………………………………………..
37
xii
2.9.4.4 2D 1H 1H TOtal Correlation SpectroscopY (2D
TOCSY)…………………………………………
37
2.9.4.5 2D 1H 1H Nuclear Overhauser and Exchange
Effect SpectroscopY(2D NOESY)………………
37
2.9.4.6 2D 1H 13C gradient- selected Heteronuclear
Single Quantum Coherence (gs-HSQC)…………
38
2.9.4.7 2D 1H 13C gradient-selected heteronuclear
Multiple bond Correlation (gs-HMBC)………….
38
2.9.5 LC-MS…………………………………………………….. 38
3 Results and Discussion……………………………………................... 39
PART- I
Molecular Analysis……………………………………………………..
40
3.1 Optimization of DNA Extraction……………………………….... 40
3.1.1 DNA Quantification……………………………………..... 44
3.1.2 DNA Amplification……………………………………...... 46
3.2 Analysis of Genetic Diversity in Tagetes……………………….... 49
3.3 Identification of Gene Specific Markers and their Relationship
With Biochemical Compounds……………………………………
68
PART- II
Chemical Analysis………………………………………………………
71
3.4 Biological Assays..……………………………………………..… 71
3.4.1 Antimalarial Activity………………..……………………. 71
3.4.2 Phytotoxicity .…………………………………………….. 72
3.4.3 Insecticidal Activity ……………………………………… 73
3.4.4 Antibacterial Activity .…………………………………..... 74
3.5 Isolation and Purification of Flavonoids (Flavonols)…………….. 76
3.5.1 NMR Elucidation of Flavonols...…………………………. 78
3.5.1.1 Structure Elucidation of Flovonols (1, 2, 9 and
xiii
18)……………………………………………….. 78
3.5.1.2 Structure Elucidation of Flavonols (5 and 7)……. 85
3.5.1.3 Structure elucidation of Flavonols (6 and 19)…... 85
3.6 Conclusions………………………………………………………. 87
4 References ……………………………………………………………... 89
Appendix A ……………………………………………………………. 104
Appendix B ……………………………………………………………. 116
Appendix C ……………………………………………………………. 129
xiv
LIST OF FIGURES
Fig. 1.1
Basic structure of flavonoid………………………………………. 7
Fig. 1.2 Structures of most common favonols occurring in nature ...……… 9
Fig. 1.3
Structures of monosaccharides found in flavonol structures……… 10
Fig. 1.4 Structures of aliphatic and aromatic acyl substitutions found in flavonols……………………………………………………………
11
Fig. 3.1 Genomic DNA of four Tagetes minuta from Haripur (a) before and (b) after treatment with RNaseA………………………………
41
Fig. 3.2 Genomic DNA of four Tagetes minuta from Abbottabad (a) before and (b) after treatment with RNaseA………………………………
41
Fig. 3.3 Genomic DNA of four Tagetes minuta from Manshera (a) before and (b) after treatment with RNaseA………………………………
42
Fig. 3.4 Genomic DNA of fourteen Tagetes genotypes (a) before and (b) after treatment with RNaseA……………………………………….
43
Fig. 3.5 Genomic DNA isolation from fresh leaf tissue of the three samples (lane 1, 2 and 3).……………………………………………………
45
Fig. 3.6 Genomic DNA isolation from dried seed powder of the three samples (lane 1, 2 and 3).…………………………………………..
46
Fig. 3.7 PCR amplification products of DNA isolated from fresh-leaf and seeds of 6 samples of T. minuta using random primer GL A-03…..
47
Fig. 3.8 PCR amplification products of DNA isolated from fresh-leaf and seeds of 6 samples of T. minuta using random primer GL A-08…..
47
Fig. 3.9 PCR amplification products of DNA isolated from fresh-leaf and seeds of 6 samples of T. minuta using random primer GL A-09…..
48
Fig. 3.10 PCR amplification products of fifteen Tagetes species with RAPD primer GL A-07. …....……………………………………...............
61
Fig. 3.11 PCR amplification of fifteen Tagetes species with primer GL A-09.………………………………………………………………….
61
Fig. 3.12 PCR amplification products of fifteen Tagetes species with primer GL A-13. .……………………………………................................
62
xv
Fig. 3.13 PCR amplification products of fifteen Tagetes species with primer GL A-16……………………………………....................................
62
Fig. 3.14 PCR amplification products of fifteen Tagetes species with primer GL A-18……………………………………....................................
63
Fig. 3.15 PCR amplification products of fifteen Tagetes species with STS primer LSTIII …………………..…………………………….........
63
Fig. 3.16 A dendrogram of fifteen (15) Tagetes genotypes generated using 20 RAPD primers and genetic distance estimates from UPGMA…
66
Fig. 3.17 A dendrogram of fifteen (15) Tagetes genotypes generated using 3 STS primers and genetic distance estimates from UPGMA……….
67
Fig. 3.18 Amino Acid Sequence of Several Limonene Synthases…………...
69
Fig. 3.19 Agarose gel analysis of PCR products using degenerate STS primers LSTI, LSTII, LSTIII, LSTIV and LSTV………………….
70
Fig. 3.20 Agarose gel analysis of PCR products using degenerate STS primers LSTI, LSTII, LSTIII, LSTIV and LSTV …………………
70
Fig. 3.21 Structures of the flavonols identified in the examined T. minuta …
77
Fig. 3.22 HPLC profiles showing the flavonols content of T. minuta extract (A) in butanol and (B) ethyl acetate……………………….………
78
Fig. 3.23 UV spectra of 2, 9 and 15 recorded on-line during HPLC analysis……………………………………………………………..
80
xvi
LIST OF TABLES
Table 2.1
Sample code, flower color, collection site and putative species of Tagetes genotypes………………………………………………….
18
Table 2.2 Tissue types used for DNA extraction from 03 Tagetes species (T.
minuta, T. ecrecta and T. patula)…………………………………..
20
Table 2.3 Detailed information of RAPD and STS primers used in characterizing Tagetes genotypes…………………………………..
24
Table 2.4 Detail of primer sequences based on conserved DNA regions……. 26
Table 2.5 Composition of medium preparation for phytotoxic bioassay ……. 31
Table 3.1 Yield and quality of total DNA determined by spectrophotometer.…........................................................................
45
Table 3.2 Primer name, total bands, amplification products and homology of Tagetes genotypes (%) for the RAPD primers …………………….
50
Table 3.3 Primer, no of band fragments, band average and genetic distance of Tagetes genotypes for RAPD primers…………………………..
56
Table 3.4 Average genetic distances among 15 Tagetes genotype using RAPD primers…………………………………………...................
64
Table 3.5 Polymorphism parameters and homology of genotypes using STS primers……………………………………………………………...
64
Table 3.6 Primer, no of band fragments, band average and genetic distance of Tagetes genotypes using STS primers…………………………..
64
Table 3.7 Average genetic distances among 15 Tagetes genotype using STS primers...............................................................................................
65
Table 3.8 Anti-malarial activity of Tagetes minuta oil in the n-Hexane and Ether soluble fraction………………………………………………
72
Table 3.9 Phytotoxic bioassay of n-Hexane soluble fraction of T. minuta oil..
72
Table 3.10 Phytotoxic bioassay of Ether soluble fraction of T. minuta oil……
73
Table 3.11 Insecticidal activity of T. minuta oil in the n-Hexane and Ether soluble fractions……………………………………………………
74
xvii
Table 3.12 Antibacterial activity of fraction extracts (Ether soluble, n-Hexane soluble, Chloroform soluble, Ethyl acetate soluble and Butanol soluble) and isolated compounds of T. minuta……………………..
75
Table 3.13a Relative amounts and on-line HPLC and high-resolution electrospray ionization mass spectral data recorded for flavonoids (1, 2, 4-9, 15-17) isolated from T. minuta (Butanol fraction)..
81
Table 3.13b Relative amounts and on-line HPLC and high-resolution electrospray ionization mass spectral data recorded for flavonoids (18-19) isolated from T. minuta (Ethyl acetate fraction)…………
82
Table 3.14 1H NMR spectral data for flavonoids (1, 2, 5-7, 9, 18, 19) isolated from T. minuta recorded in CD3OD at 25 °C……………………..
83
Table 3.15 13C NMR spectral data for flavonols (1, 2, 5-7, 9, 18, 19) isolated from T. minuta recorded in CD3OD at 25 °C……………………...
84
xviii
LIST OF APPENDICES
Fig. A-1 Tagetes patula and their hybrids (A), Tagetes minuta (B) ……….
105
Fig. A-2 View of Tagetes minuta in its natural habitat……………………...
105
Fig. A-3 Tagetes erecta and their hybrids species…………………………...
106
Fig. A-4 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-03. …...……………………………………………….
107
Fig. A-5 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-04. …………………………………………………....
107
Fig. A-6 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-05. …………………………………………................
108
Fig. A-7 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-06. …...………………………………….....................
108
Fig. A-8 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-11. …………………………………………................
109
Fig. A-9 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-12. …………………………………....……………....
109
Fig. A-10 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-14. …………………………………………................
110
Fig. A-11 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-15. …...……………………….……………................
110
Fig. A-12 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-17. …………………………………………................
111
Fig. A-13 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-19. …………………………………………................
111
Fig. A-14 PCR amplification products of fifteen Tagetes species with RAPD primer GLA-20. …..……………………………………………….
112
Fig. A-15 PCR amplification products of fifteen Tagetes species with RAPD primer GLB-01. …………………………………………................
112
Fig. A-16 PCR amplification products of fifteen Tagetes species with RAPD primer GLB-02. …...……………………………………………….
113
xix
Fig. A-17 PCR amplification products of fifteen Tagetes species with RAPD primer GLB-03. …...……………………………………………….
113
Fig. A-18 PCR amplification products of fifteen Tagetes species with RAPD primer GLB-04. ……………………………………………………
114
Fig. A-19 PCR amplification products of fifteen Tagetes species with STS primer LSTI. …….…………………………………………………
114
Fig. A-20 PCR amplification products of fifteen Tagetes species with STS primer LSTII. …..…………………………………….....................
115
Table B-1 Genetic distances among 15 Tagetes genotype using RAPD primer GLA03...............................................................................................
117
Table B-2 Genetic distances among 15 Tagetes genotype using RAPD primer GLA04...............................................................................................
117
Table B-3 Genetic distances among 15 Tagetes genotype using RAPD primer GLA05...............................................................................................
118
Table B-4 Genetic distances among 15 Tagetes genotype using RAPD primer GLA06...............................................................................................
118
Table B-5 Genetic distances among 15 Tagetes genotype using RAPD primer GLA07...............................................................................................
119
Table B-6 Genetic distances among 15 Tagetes genotype using RAPD primer GLA09...............................................................................................
119
Table B-7 Genetic distances among 15 Tagetes genotype using RAPD primer GLA11...............................................................................................
120
Table B-8 Genetic distances among 15 Tagetes genotype using RAPD primer GLA12……………………………………………………………...
120
Table B-9 Genetic distances among 15 Tagetes genotype using RAPD primer GLA13……………………………………………………………...
121
Table B-10 Genetic distances among 15 Tagetes genotype using RAPD primer GLA14……………………………………………………………...
121
Table B-11 Genetic distances among 15 Tagetes genotype using RAPD primer GLA15……………………………………………………………...
122
xx
Table B-12 Genetic distances among 15 Tagetes genotype using RAPD primer GLA16……………………………………………………………...
122
Table B-13 Genetic distances among 15 Tagetes genotype using RAPD primer GLA17……………………………………………………………...
123
Table B-14 Genetic distances among 15 Tagetes genotype using RAPD primer GLA18……………………………………………………………...
123
Table B-15 Genetic distances among 15 Tagetes genotype using RAPD primer GLA19……………………………………………………………...
124
Table B-16 Genetic distances among 15 Tagetes genotype using RAPD primer GLA20……………………………………………………………...
124
Table B-17 Genetic distances among 15 Tagetes genotype using RAPD primer GLB01……………………………………………………………...
125
Table B-18 Genetic distances among 15 Tagetes genotype using RAPD primer GLB02……………………………………………………………...
125
Table B-19 Genetic distances among 15 Tagetes genotype using RAPD primer GLB03……………………………………………………………...
126
Table B-20 Genetic distances among 15 Tagetes genotype using RAPD primer GLB04……………………………………………………………...
126
Table B-21 Genetic distances among 15 Tagetes genotype using STS primer LSTI…..............................................................................................
127
Table B-22 Genetic distances among 15 Tagetes genotype using STS primer LSTII……………………………………………………………….
127
Table B-23 Genetic distances among 15 Tagetes genotype using STS primer LSTIII………………………………………………………………
128
xxi
LIST OF ABBREVIATIONS
α Alpha AFLP Amplified Fragment Length Polymorphism
β Beta CTAB Cetyltrimethylammonium Bromide 1D One Dimensional 2D Two Dimensional DMSO Dimethyl Sulfoxide g Gram
HPLC High Performance Liquid Chromatography λ Lambda
MS Mass Spectrometry mg Miligram
µg Microgram
µl Microliter
µm Micrometer mL Milli liter mM Milli molar M Molar ng Nano gram nm Nano meter nt Nucleotide
NMR Nuclear Magnetic Resonance PCR Polymerase Chain Reaction RAPD Random Amplified Polymorphic DNA RFLP Restriction Fragment Length Polymorphism STS Sequence Tagged Site δ Sigma SDS Sodium Dodecyl Sulfate
TLC Thin Layer Chromatography TFA Trifluoroacetic Acid UV Ultra Violet
1
Chapter 1
Introduction
2
Medicinal plants are natural factories of medicines. Approximately 50% of
today’s prescribed drugs are derived either from a plant source or man made imitations of
plant compounds. The herbs have continuously been used to cure a number of illnesses
from ancient times. Today, research continues to prove that most of our present
medicines are the product of research on medicinal plants. Medicinal plants are under
investigations all over the world, yet a significant portion is still unexplored.
Asteraceae is the largest family of Angiosperm consisting of more than 1600
genera and 23000 species worldwide (Barkley et al., 2006; Panero and Funk, 2008) that
further distributed in 2 subfamilies (Asteroideae or Tubuliflorae and Cichorioideae or
Liguliflorae) and 17 tribes (Panero and Funk, 2002). Asteraceae is also considered as a
largest plant family in Pakistan with more than 650 identified species (Qaiser and Abid,
2002).
1.1. Genus Tagetes
Genus Tagetes (marigold) belongs to subfamily Asteroideae (or Tubuliflorae) of
family Asteraceae (Evans, 2002; Panero and Funk, 2002). Tageteae is a tribe of the plant
family Asteraceae (Loockerman, et al., 2003) consisting of 28 genera and approximately
216 species including genus Tagetes (Barkley et al., 2006). Tagetes contains cultivated
and wild marigolds having an offensive odor. Genus Tagetes is a flowering plant
represented by 56 species, of which 27 are annual and 29 are perennial species
throughout the world (Soule, 1993a; Soule, 1993b). Tagetes is indigenous to North and
South America (Soule, 1993a; Soule, 1993b) and have competetive nature and can grow
well in almost every type of soil. In Pakistan, three species of genus Tagetes namely: T.
erecta, T. minuta and T. patula are widely distributed throughout northern regions of the
country (Ghafoor, 2002).
1.2. Tagetes Species
The Tagetes (marigold) species grown all over the world, the plants of which are
stout and branched with height varying from 0.01-2.2 m. The leaves are segmented,
pinnate and fern like which are dark green in color and are strongly scented. Flowers are
3
varying in color from yellow and golden to orange, red and mahogany (Fig. A-1 and A-
3). Four annual species T. patula, T. lunulata, T. erecta and T. tenuifolia are commonly
cultivated throughout the world for ornamental purposes (Vasudevan et al., 1997). The
taller and large flowered T. erecta is known as African marigold while the smaller T.
patula is called French marigold. A number of hybrid varieties have been developed
from these two species. T. erecta, T. minuta, T. tenuifolia and T. patula are the most
common species while there are other species which are region specific.
1.2.1. Tagetes minuta L.
Tagetes minuta L. (Wild marigold) locally known as ‘Gul-e-Sad Barga’ is
an annual plant of the Asteraceae (Compositeae) family, probably originated from South
America and was later introduced to Central America, Europe, Australia and Eastern and
Southern Africa. The Tagetes species are grown widely all over the world for various
uses including ornamental, medicinal, cultural and therapeutic. This plant is growing
under a broad spectrum of climatic conditions starting from extreme temperate to tropical
regions of the world.
T. minuta is distinct being a very large plant with tiny pale yellow flowers
(Thomas, 1982). The plant grows to a height of 50-150 cm with a single and highly
branched stem at the top (Fig. A-2). It is generally grown in organic gardens due to its
useful properties on the soil, as roots give off chemicals which remove grasses (weeds)
and eelworms (Batish et al., 2007).
1.3. Molecular Characterization of the Plant
The information regarding molecular characterization of Tagetes species are
limited in general. The most reliable and powerful method to carry out molecular
characterization is through the DNA analyses, though it includes targeting living
organism at RNA and protein level. DNA analyses are an essential component for un-
derstanding organisms at molecular level. The quick, reliable and inexpensive protocols
for DNA isolation are always desirable at the initial stage of molecular analyses. DNA
extracted from Tagetes species is usually degraded or contaminated by essential oils,
4
polyphenols and tagetones and thus not useful in polymerase chain reaction (PCR) or
restriction products upon amplification or digestions (Hills and Van Staden, 2002). In
general, it is difficult to isolate high-quality DNA from medicinal plants because of the
presence of large quantities of secondary metabolites such as alkaloids, polyphenols,
polysaccharides and proteins. These compounds interfer by precipitating along with the
DNA, thus degrading its quality and reducing yield (Katterman and Shattuck, 1983;
Sarwat et al., 2006). An array of DNA isolation protocols have been optimized and were
used in various combinations to isolate quality DNA from plants for analyses (Dellaporta
et al., 1983; Doyle and Doyle, 1990; Suman et al., 1999; Shah et al, 2000; Warude et al.,
2003; Sarwat et al., 2006; Deshmukh et al., 2007). Liquid nitrogen has been extensively
used for DNA extraction from fresh leaf and or other tissues (Doyle and Doyle, 1990)
which is assumed to be a key factor of obtaining high quality DNA. However, it is not
always easily available or convenient to use especially in developing parts of the world.
Wide molecular biological techniques have developed highly informative and
useful DNA markers that are primarily used to determine the level of genetic
polymorphism followed by genetic fingerprinting, mapping and gene tagging. The
genetic based markers have been employed on phenotypic based experiments since
nineteenth century. These marker techniques such as Randomly Amplified
Polymorphic DNA (RAPD), Simple Sequence Repeats (SSR), Amplified Fragment
Length Polymorphism (AFLP) and Restriction Fragment Length Polymorphism (RFLP)
are useful to phonological and morphological character analysis and genetic study.
These are also independent of environmental effects and can be used for the
identification of cultivars in their early stage of development (Agarwal et al., 2008).
Highly related individuals from different propagation sources can also be catagorized
by molecular markers thus facilitating the understanding of crop species (White and
Doebley, 1998; Metais et al., 2000; Lombard et al., 2000; Sun et al., 2001).
Random Amplified Polymorphic DNA (RAPD) markers are capable to
investigate the genetically distinct individuals, although not necessarily in a
reproducible way (Sreekumar and Renuka, 2006). The RAPD method is relatively
5
quick and easy to use and does not require any sequence information and can generate
large number of loci which can complement traditional morphological marker systems
(Fevzi, 2001). Generally short, single and arbitrary decamer of unlimited number of
oligonucleotide primer could be tested. Thus this method provides a valuable new
resource for phylogenic studies. The RAPD technique revealed the intra-specific
variation for screening the degree of inbreeding in animals and commercial plant
species. The polymorphic site is based on the presence and absence of same size of
RAPD fragment profile (Williams et al., 1990). RAPD molecular markers can be used
as good early selection techniques and their association with agronomic traits in crop
plants. RAPD technique has wide range of applications in molecular evolutionary
genetics, gene mapping and plant and animal breeding.
The usefulness of a particular category of molecular or biochemical markers is
limited by several attributes including level of polymorphism, environmental stability,
geographic distribution of chemotypes, the number of loci, molecular basis of the
polymorphism and the ease and cost of analysis (Grass et al., 2006). At DNA level
molecular markers reveal polymorphism and are considered a powerful tool to estimate
the genetic diversity for characterization of genotypes. Similarly, the parental selection
based on genetic diversity is better than pedigree method (Tinker et al., 1993).
Advances in molecular biology have developed new approaches and techniques
such as polymerase chain reaction (PCR) to facilitate the novel genomic DNA
sequencing and identification of target gene in genomic DNA. The known genomic
sequence of target DNA can be amplified by using specific oligonucleotide primers based
on those sequences. Degenerate primers can be used and designed from highly conserved
regions of amino acid sequence of target gene among several plants (Pytela et al., 1994;
Maruyama et al., 2002). This method is useful for identifying new members of a gene
family from different organisms where genomic information is not available (Lang and
Orqoqozo, 2011). PCR products can be sequenced directly in order to generate
information quickly and accurately (Slatko, 1996).
6
1.4. Chemical Characterization of Tagetes
Major compounds reported to be present in Tagetes are essential oil and
flavonoids. Majority of the studies regarding chemical composition of Tagetes focused
on the yield and distribution of essential oils (Singh et al., 1992; Chalchat et al., 1995;
Bansal et al., 1999; Gil et al., 2000). The main constituents of Tagetes oil are ocimene
(monoterpenes), limonene, dihydrotagetone and tagetenone (Kaul et al., 2005;
Upadhyaya et al., 2010).
1.4.1. Essential oils
Essential oils are secondary metabolites of plants. They are volatile in nature and
are complex mixtures of organic compounds. Essential oils are important to medicine,
pharmaceutical industry, agriculture, and biotechnology. Essential oils are composed of
different chemical groups of terpenic hydrocarbons and their oxidized derivatives.
Similarly terpenes are related with essential oils and are distributed throughout the plant
kingdom. These are also found in the species grown under unfavourable conditions.
1.4.1.1. Terpenes
Terpenes are natural products based on the five carbon framework arrangement
units. Terpenes represent a large group of natural compounds that do not contribute
much to flavour, fragrance or odour of the oil. Very often the hydrocarbon terpenes
represent a large percentage of the components of essential oils of plants and can be
found in a remarkable variety of closely related structures. Oils from thousands of plant
species have been extracted and are commercially available (Adams, 1995; Culp et al.,
1977). Oxygen-containing terpenic compounds (terpenoids) are also present in essential
oils. Terpenoids are the most abundant and widely distributed group of secondary
metabolites. The terpenoids structure is range in size from volatile oils of molecular
formula C10H16 to larger molecular structures such as rubber that contains about 4000
isoprene units (Martinez, et al., 1988). Terpenoids composition and components varies
within the species of Tagetes (Hethelyi, et al., 1986; 1987).
7
Essential oils contain monoterpenes. The general constituents of essential oils
and resins are monoterpenes (C10). Several hundred naturally occurring monoterpenes are
known in herbs and citrus fruits (Etherton et al., 2002). Limonene is cylic monoterpene.
Phytochemical investigations of Tagetes species indicate variation in the yield of
limonene (Kaul et al., 2005; Upadhyaya et al., 2010). The limonene and perillyl alcohol
are monoterpenes and have shown efficacy in both cancer prevention and therapy (Elson
and Qureshi, 1995; Gould, 1995; Crowell, 1999).
1.4.2. Flavonoids
The word flavonoid is derived from the Latin word flavus meaning yellow.
Flavonoids are polyphenolic compounds produced in plants, and more than 8150
different flavonoids have been reported (Andersen and Markham, 2006). The basic
flavonoid structure consists of a C15 skeleton as shown for flavone (Fig. 1.1), having two
benzene rings (A, B) joined together by a three-carbon link, with the latter forming a
pyrone ring (C ring). Flavonoids are classified on the basis of oxidation level and
substitution pattern of the C ring, while individual compounds within a class differ in the
substitution pattern on the A and B rings.
O
O
B
A C
2
3
4
10
5
6
7
8
9 1`
4`
5`
6`
3`
2`
Fig. 1.1: Basic structure of flavonoid
Flavonoids are reported to have potential antioxidant, antimicrobial, antiallergic,
antiviral, anti-inflammatory and possess vasodilating properties.
8
1.4.2.1. Flavonols
Flavonols are a family of polyphenols which constitute a particular class of flavonoids.
The important role of flavonols is ultra violet protection and copigmentation in fruits and
flowers of plant (Flint et al., 1985; Smith and Markham, 1998). The copigmentation of
flavonols and anthocynins also increase the red wine color (Baranac et al., 1997; Boulton,
2001). Flavones and flavonols and their derivatives are widely distributed in the
angiosperms, gymnosperms, mosses, liverworts and ferns. More than 1331 flavonol O-
glycosides have been reported in plants (Williams, 2006) and over 393 flavonols have
been identified with complete structure elucidation (Vetschera and Wollenweber, 2006).
The main flavonoids previously detected in the genus Tagetes belong to the
flavonols class. Patuletin, quercetin, quercetagetin and isorhamnetin and some of their
glycosides have previously been tentatively identified in T. minuta (Abdala and
Seeligmann, 1983; 1995).
1.4.2.2. Structure of Flavonols
Flavonols consist of an aglycone, and may contain sugar, acyl and sulfate groups.
The aglycone part possess two benzene rings joined by a linear three carbon chain (C2,
C3, C4), represented as the C6–C3–C6 system. The most important flavonols in the
genus Tagetes have been reported to be patuletin, quercetin, quercetagetin, kaempferol,
myricetin, isorhamnetin and some of their glycoside derivatives (Abdala and Seeligmann
1995; Parejo et al., 2004). These flavonol aglycones differ by the hydroxylation and
methoxylation pattern on their A and B-rings (Fig. 1.2).
9
Fig. 1.2: Structures of most common favonols occurring in nature
Highly methoxylated flavonols are found in the Rutaceae but a hexamethoxylated
flavonol is also isolated from Distemonanthus benthamianus and Fiscus altissima
(Malan, 1993; Sharaf et al., 2000). Similarly polymethoxylated derivatives are also
found in species of Asteraceae. Flavonols from the Asteraceae have a tendency towards
6-methoxylation rather than towards 8-methoxylation because of 5- and 7-hydroxylation
pattern (Halbwirth et al., 2004; Vetschera and Wollenweber, 2006).
O
O
OH
OH
OH
HO
HO
OH
O
O
OH
OH
HO
OH
O
O
OH
OH
OH
HO
OH
OH
O
O
OH
OH
OH
HO
OCH3
O
O
OH
OH
OH
O
HO
OH
O
O
OH
OH
OH
HO
OH
Patuletin
Quercetagetin
Quercetin
Kaempferol
Myricetin Isorhamnetin
10
The sugar derivatives of flavonols are named as flavonol-O-glycosides. Various
types of sugar moieties are attached to the aglycone through O- or C-bindings. Flavonol-
glycosides are mono-, di-, tri- and tetra-glycosylated mainly at the 7- and 3-hydroxyl
positions, but can also be glycosylated at 2`, 4`, 6, 5, and 8. (Strack et al., 1989; Arisawa
et al., 1993; Fuchino et al., 1997; D’Agostino et al., 1997). In the genus Tagetes most of
the aglycones are mono-glycosylated at the 7- and 3-hydroxyl, and very few are di-
glycosylated (Parejo et al., 2004).
O
HO
HO
OH
OH
OH
O
HO
HO
OH
OH
OH
β-D-galactopyranose β-D-glucopyranose
O
HO
HO
OH
OH
O
OH
H3C
HO
HO
OH
α-L-arabinopyranose α-L-rhamnopyranose
Fig. 1.3: Structures of monosaccharides found in flavonol
The monosaccharides most commonly found in O-combination with flavonols are
glucose, galactose and rhamnose, and less frequently xylose, arabinose and glucuronic
acid, etc. (Fig.1.3) (Williams, 2006).
The diversity of flavonols is also related with the nature, number and linkage
position of acyl groups, including both aromatic and aliphatic acyl groups (Williams,
2006) (Fig. 1.4). These are linked to the hydroxyl groups of the sugar units. The
aliphatic acylation moieties include acetic, malonic, succinic, butyric, butanoic, lactic,
11
glutaric, tiglic, isovaleric and quinic acids. The aromatic acyl groups include coumaric,
gallic, cinnamic, caffeic, ferulic, benzoic and sinapic acids.
HO CH3
O
HO OH
OO
HO
O
OH
O
OH
O
OH
O
HO
O
OH
O
OH
Acetic acid Malonic acid Succinic acid Butyric acid Lactic acid Glutaric acid
OH
OO
OHH3CO
HO
O
OHHO
HO
HO
O
OHHO
OCH3
Cinnamic acid Sinapic acid Gallic acid p-hydroxybenzoic acid
O
OHHO
HO
O
OHH3CO
HO
O
OH
HO
p-coumaric acid Caffeic acid Ferulic acid
Fig. 1.4: Structures of aliphatic and aromatic acyl substitutions found in flavonols
The majority of the flavonoids reported to occur in genus Tagetes have been
characterized by chromatographic methods or by low-resolution LC-MS (Abdala and
Seeligmann 1995; Tereschuk et al., 2004; Parejo et al., 2004). One study dealt with
NMR characterization of flavonoid-O-glycoside isolated from T. maxima (Parejo et al.,
2005).
12
1.4.2.3. Functions in Plants
Flavonoids are involved in the plant reproduction, in which especially
anthocyanins make the most obvious contribution to flower color and other flavonoids
also assist in pigmentation. Various flavonols and flavones act as copigments with
anthocyanins leading to an intensification of flower color. Yellow color is produced by
flavonols following methylation, certain type of glycosylation, or certain A-ring
hydroxylation patterns (Forkmann, 1991). The main emphasis is on the flavonoids
function as antioxidant and as UV light protectant. There is increasing evidence that
flavonols and flavones accumulate in the epidermal cells in response to wounding,
pathogenic infection, nutrient deficiency, temperature changes, ozone (UV radiation) and
for protecting photosynthetic tissues (Koes et al., 1994; Shirley, 1996; Smith and
Markham, 1998; Simmonds, 2003).
1.4.2.4. Potential Health Effects
Flavonoids have attracted much interest during last fifteen years related to
potential beneficial health effects on humans. This is mainly because of their possible
antioxidant properties. They have potential therapeutic role in the resistance of tumour
diseases (Ickes, et al., 1973; Vasudevan et al., 1997; Kviecinski, et al., 2008; Mertens-
Talcott and Percival, 2005; Boots et al., 2008) and in the treatment of cancer (Kamei et
al., 1995; Andersen et al., 1997; Cecchini et al., 2005; Linda et al., 2006). Flavonoids
also have vital role in the prevention of neurological and cardiovascular diseases (Hertog
et al., 1993; Knekt et al., 2002; Ruiz et al., 2006; Lopez-Sanchez et al., 2007).
1.5. Uses of Tagetes Species
In tropics, especially in Brazil and adjoining regions it is grown for essential oil
production (Lawrence, 1985), which has numerous applications for the benefit of human
society. The oils are good insect repellents and are used in the treatment of certain
illnesses, such as smallpox, earache, and colds and to reduce fevers. In addition, it has
been recognized to possess hypotensive, spasmolytic, antimicrobial, antifungal and
nematicidal properties (Tereschuk et al., 1997; Mangena and Muyima, 1999). Tagetes
13
oil, which can be extracted with hexane (Wiese et al., 1992), is an established product of
flavor and a raw material for perfume production (Soule, 1993a).
The traditional use of insect repellent is widely spread among the communities
and cultures of East Africa, West Africa, China, northern Tanzania, Gambia and Kenya.
Like the other weeds T. minuta (55%) is also used in direct burning of plants which is
the most common application of plant (Seyoum et al., 2002). The ethnobotanical
survey of taditional use of medicinal plants also suggested the repellency of plants
against the malaria vector Anopheles gambiae (Seyoum et al., 2002). T. minuta has a
competitive nature towards light and space. It creates dense monotypic stands and
displaces other weeds and plants and is resistant to natural enemies. Due to the presence
of monotrepenes especially ocimenones it inhibit the germination of cohabitant species
and thus cause their delayed germination (Lopez et al., 2009). Now it is also cultivated
as crop for agrochemical and pharmaceutical products. It is used as natural herbicide to
manage the rice weeds (Tomova et al., 2005; Batish et al., 2007).
Almost any stored material, whether of plant or of animal origin, is prove to
attack by insects, especially common stored grain by Coleopetra species. Among the
products that are frequently damaged are grains and their derivatives. Stored grain pests
are a major problem in various countries. Similarly, in developing world weeds are a
major factor responcible for poor agriculture productivity. Synthetic weedicides
(herbicides) are often expensive, toxic and non specific. Weedicides from natural sources
having improved characteristic could, therefore, have promising future. In this regard
allelopathic plants can be used for managing the weeds (Singh et al., 2003). The search
for new weedicides/herbicides requires an assay, which can predict the general
phytotoxic effects of the tested samples. The specificity for certain weeds can be
determined at large stages. The Lemna minor hypotoxicity is a useful primary screen for
weedicides search. This bioassay has advantage to predict the growth stimulating effect
of the test sample.
14
The carotenoids are also important constituent of marigold flowers espacially
from T. patula and T. erecta (Vargas et al., 2000). The yellow carotenoid pigments are
used as source for food colouring and as a source of gum emulsification (Henken, 1992).
Lutein as carotenoids may help to reduce the risk of some age-related eye disorders such
as cataracts, photosensitivity disorders and cancer (Vargas and Lopez, 1996).
The medicinal plants have such type of chemical and biochemical compounds and
their derivatives which can be used as pharmaceutical medicines, perfumery products,
cosmetics, flavors and food colorant. In recent years, remarkable interest in plant based
drugs has developed and there is also a trend to adopt herbal medicines being safe for
humans (Giberti, 1983; Abbasi et al., 2010; Awodele et al., 2012). Moreover, regular
use of antibiotics has adverse effects and also develops low resistance in the host.
Wetlands and forests are important and main source of natural products and plant based
material. There are very few crops cultivated for the plant based drug material and
natural sources, thus there is a need to introduce the commercial cultivation of herbal
plants as crops into the cropping system. They will not only maintain the quality and
quantity of biochemical composition but will also meet the demands of industry. The
Tagetes minuta is wildly grown in Pakistan especially in northern hilly areas. Until now
the molecular and chemical characterization of Tagetes species in Pakistan has not been
performed comprehensively. It is, therefore, necessary and useful to study Tagetes
species found in Pakistan for their genetic and chemical analyses using advannced DNA
and biochemical techniques.
15
1.6. Objectives
Major goal of the current research was to characterize Tagetes species in terms of
plant’s DNA and chemical constituents, for the exploitation of its medicinal value in the
benefit of human society. The specific objectives were to:
1. Optimize extraction and purification protocols for DNA and chemical compounds
in the Tagetes
2. Investigate molecular marker based genetic diversity present in the Tagetes
3. Develop and characterize gene based specific markers controlling chemical
compounds in the Tagetes
4. Investigate biological activities of the crude and purified chemical compounds
isolated from the Tagetes
5. Isolate and characterize important chemical compounds such as flavonoids
present in the Tagetes
16
Chapter 2
Materials & Methods
17
Part-I
MOLECULAR ANALYSIS
2.1. Plant Material
A total of 27 sample plants (genotypes) of Tagetes species and their hybrids were
collected in the months of September and October (2007) at flowering stage from
different regions of Pakistan. The plant material was shipped as fresh and was preserved
in the lab after preliminary identification of the species.
2.1.1. Plant Identification and Labeling
The collected plants were identified by a qualified Taxonomist (Dr. Manzoor
Ahmed) of the Department of Botany, Post-Graduate College, Abbottabad, Pakistan.
Voucher specimens were deposited at the herbarium of the Botany Department of Post-
Graduate College, Abbottabad, Pakistan. The putative identification based on
morphologically distinct characteristics of plant especially of flower color and type
narrowed all 27 plants into 15 genotypes from 3 species (Table 2.1, Fig. A-2 and
A-3). Further genetic analyses were carried out on 15 genotypes of the 3 Tagetes
species, whereas chemical analyses were conducted only on Tagetes minuta.
18
Table 2.1: Sample code, flower color, collection site and putative species of Tagetes genotypes
Sample
code
Flower Color Collection site Species
T1 Light yellow flower (Sarai Saleh ) Haripur T. erecta
T2 Light orange flower (Sarai Saleh) Haripur T. erecta
T3 Dark yellow flower COMSATS Nursery Abbottabad T. erecta
T4 Dark orange flower COMSATS Nursery Abbottabad T. erecta
T5 Yellow flower (hybrid) (Sarai Saleh) Haripur T. patula
T6 Orange flower (hybrid) (Sarai Saleh) Haripur T. patula
T7 Dark orange to red (hybrid) COMSATS Nursery Abbottabad T. patula
T8 Yellow to red (hybrid) COMSATS Nursery Abbottabad T. patula
T9 Wild species *BZU, Multan T. patula
T10 Orange and yellow COMSATS Nursery Abbottabad T. patula
T11 Red flower COMSATS Nursery Abbottabad T. patula
T12 Yellow flower (hybrid) Kohat T. erecta
T13 Orange flower (hybrid) Mardan T. erecta
T14 Orange flower (hybrid) COMSATS Nursery Abbottabad T. erecta
T15 Pale yellow Composite sample from different localities of Abbottabad and Mansehra
T. minuta
* Baha-ud-din Zakariya University
2.1.2. Reagents, Chemicals and Buffer Solutions used in DNA Analyses
• Absolute Ethanol (Merck, Germany)
• 70% Ethanol (Merck, Germany)
• Absolute isopropanol (Sigma-Aldrich, Germany)
• EDTA (Merck, Germany)
• NaCl (Merck, Germany)
• CH3COONa (Merck, Germany)
• Chloroform (Merck, Germany)
• β-mercaptoethanol (Calbiochem, Merck, Germany)
19
• Tris-Cl (Merck, Germany)
• CTAB (Merck, Germany)
• SDS (Merck, Germany)
• Boric acid (Merck, Germany)
• Agarose gel (Fermentas Inc.)
• Ethidium bromide (10 mg/ml) (Merck, Germany)
• Enzyme: Taq DNA Polymerase (Fermentas Inc.), Rnase A (Fermentas Inc.)
• Buffer: Taq DNA Polymerase buffer (Fermentas Inc.)
• Nucleotides: dNTPs (G, A, T, C) (Fermentas Inc.)
• RAPD primers (Gene Link USA)
• 1.0 M Tris-Cl (pH 8.0, 9.5); 0.5 M EDTA (pH 8.0); 5.0 M NaCl; 3.0 M sodium
acetate (pH 5.2); CTAB (20%); chloroform:isoamyl alcohol (24:1, v/v); β-
mercaptoethanol
• CTAB extraction buffer: 0.1 M Tris-Cl (pH 9.5), 20 mM EDTA (pH 8.0), 1.4 M
NaCl, CTAB (2%, w/v) (mixture was autoclaved for 20 min at 121°C) and β-
mercaptoethanol (1%, v/v) (added to the buffer just before use)
• SDS extraction buffer: 0.1 M Tris-Cl (pH 8.0), 50 mM EDTA (pH 8.0), 0.5 M
NaCl, SDS (10%, w/v) (mixture was autoclaved for 20 min at 121°C)
• TE buffer: 10 mM Tris-Cl buffer (pH 8.0), 1 mM EDTA (pH 8.0)
• TBE 5X: 54 g Tris, 27.5 g boric acid, 20 mL 0.5 M EDTA
2.2. DNA Isolation
Fresh and dried leaves and seeds were used to isolate the DNA from Tagetes
species (Table 2.2) to compare the efficiency of each tissue type. Plants of each species
were grown at research farm of the COMSATS Institute of Information Technology in
Abbottabad using seeds collected from the plains and hilly areas of Hazara division, Paki-
stan. Leaf tissues were collected upon 6-8 leaved stage. The young leaf tissues were
taken to the laboratory in an icebox and were used directly to isolate DNA by crushing in
the CTAB extraction buffer. A portion of the leaves were subjected to sun-drying by
placing on clean mesh under sun in the farm. For shade drying the samples were brought
to the labs or store houses and were shade-dried by placing on the tables. Seeds of
20
Tagetes were collected from the farm grown plants and also from other parts and were
stored in plastic bags in the laboratory. Three major protocols, viz; chloroform:
isoamylalcohol (24:1, v/v), cetyltrimethylammonium bromide (CTAB) (Doyle and
Doyle, 1990; Warude et al., 2003; Sarwat et al., 2006), and sodium dodecyl sulfate (SDS)
(Aljanabi et al., 1999; Deshmukh et al., 2007) were used with modifications to isolate
and analyze DNA from the plant using different tissue types. A modified CTAB buffer
method (Kim and Hamada, 2005) was employed to post-extraction analyses of DNA
from seed and leaf tissues.
Table 2.2: Tissue types used for DNA extraction from 03 Tagetes species (T. minuta, T.
erecta and T. patula)
Tissue type Weight (g)
Seeds 0.1
Sun-dried leaf 0.1
Shade-dried leaf 0.1
Fresh leaf 0.2
2.2.1. DNA Extraction and Purification
Fresh leaf tissue (0.2 g) was ground in a 1.5mL Eppendorf tube with a micropestle
while seeds, sun-dried and shade-dried leaf samples (0.1 g) were ground to fine powder
with a pestle and mortar and transferred to a 1.5 mL eppendorf tube and 800 µL CTAB
extraction buffer was added. These eppendorf tubes were incubated at 65° C for 35-45
min, with inversion during incubation. An equal volume of chloroform: isoamyl alcohol
(24:1, v/v) was added and the tubes were inverted 8-10 times. The tubes were
centrifuged at 13,000 rpm for 15 min. The supernatant was placed in a new eppendorf
tube. If there was visible cellular debris, the steps of chloroform: isoamyl alcohol (24:1,
v/v) purifications were repeated until the removal of visible contaminants. An equal
volume of absolute ice-cold isopropanol was added. The tubes were centrifuged at
13,000 rpm for 10 min. The supernatant was discarded and the pellet was washed with
70% (v/v) ethanol. The pellet was air-dried for 1 h at room temperature and then
21
dissolved in 100 µL TE buffer. RNase A [2 µL (1 µg/µL)] was added and the tubes were
incubated at 37° C for 1 h.
For further purification, extraction with an equal volume of chloroform: isoamyl
alcohol (24:1, v/v) was performed. DNA was precipitated by adding 1/10th volume of
3M sodium acetate (pH 5.2) and 2.5 mL of ice-cold ethanol; the tube was inverted gently
and this mixture was maintained for 30 min at -20 ° C. It was then centrifuged at 13,000
rpm for 10 min. The supernatant was discarded and the pellet was washed with 70%
(v/v) ethanol. The pellet was dried and dissolved in 100 µL TE buffer. DNA
concentrations were measured by running aliquots on 0.8% agarose gel and by reading
absorbance at 260 nm and 280 nm (Kim and Hamada, 2005) using a UV-Vis
spectrophotometer (IRMECO GmbH, Model U2020, Geesthacht/Germany). The DNA
samples were stored at -20° C until further use.
2.2.2. DNA Quantification
DNA concentration was measured in a UV-Vis spectrophotometer (IRMECO
GmbH, Model U2020, Geesthacht/Germany), and purity of the DNA samples was
confirmed by absorbance (A260/A280) ratio (Kim and Hamada, 2005) to check DNA
quality and quantity for further PCR analysis. Total DNA obtained was run on 0.8%
agarose gel in 1X TAE or 1X TBE buffer containing ethidium bromide (0.01 mg/µl).
Initially same ratio of loading dye and DNA was used (2 µ L each). The samples were
loaded at 100 volt for suitable time (20 to 30 min). The gel was visualized under UV
light and the gels were photographed using the UVi-tec gel documentation system
(Cambridge, UK). The amount of DNA per µ L was judged from the visibility of the
band or ladder (λ DNA digested with restriction enzymes). When the bands for a sample
were not clear or showing total degradation the whole procedure was repeated for that
sample.
2.3. PCR Amplification and RAPD Analysis
PCR-based amplification of the purified DNA was carried out in a 20-µL reaction
mixture. The reaction mixture contained 25 ng template DNA, 0.125 U Taq DNA
22
polymerase, 1.6 mM dNTPs, 3.75 mM MgCl2, 1X Taq DNA polymerase buffer (Shah et
al., 2000), 2 mM primer and dilution up to the volume of 20 µ L was completed by
double distilled autoclaved water. Amplification of the DNA was done using a Perkin
Elmer 9700 Thermocycler (ABI, Foster City, CA, USA) with the following parameters:
initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 ° C for
30 s, primer annealing at 50 ° C for 1 min, and extension at 72 ° C for 1 min, with a final
extension at 72 ° C for 7 min. The reaction was stored at 4 °C, until it was loaded onto
the gel. Twenty five (25) decanucleotide primers were used for PCR amplification
products. Twenty (20) primers generated amplified of products by producing detectable
band patterns. Sequence information of twenty (20) RAPD primers randomly selected
for study is presented in Table 2.3. PCR products were fractionated on 0.8% agarose gel
using 1X TBE buffer containing 10 mg/mL ethidium bromide and were visualized under
UV light and the gels were photographed using the UVi-tec gel documentation and
analysis system (Cambridge, UK).
2.3.1. STS Analysis
Based on the highly conserved amino acid sequence among several plant
limonene synthases, the degenerate primers (15) were designed by reverse translating the
conserved regions using their corresponding genomic codons. The detailed decription is
given in section 2.4. Out of these fifteen (15) primers three (3) sequence-tagged-site
(STS) primers were used for amplification of products. These primers were 18-
nucleotide long for each forward and reverse fragment (Table 2.3). PCR reaction was
carried out in a 20-µL volume. The reaction mixture contained 25 ng to 30 ng template
DNA, 1x Taq DNA polymerase buffer with (NH4)2SO4, 0.8 µL of dNTPs (10 mM), 3 µL
of MgCl2 (25mM), 0.125-U Taq DNA polymerase, 4 µL of each STS forward and
reverse primer (Fermentas Inc.) and dilution up to the volume of 20 µ L was completed
by double distilled autoclaved water. PCR reactions were carried out in a Perkin Elmer
9700 thermocycler (ABI, Foster City, CA, USA) with the following parameters: initial
denaturation at 94 ° C for 5 min, followed by 30 cycles of denaturation at 94 ° C for 30
s, primer annealing at 54 ° C to 56 ° C for 1 min, and extension at 72 ° C for 1 min, with
a final extension at 72 ° C for 7 min (Shah et al., 2000; Maruyama et al., 2001). PCR
23
products were fractionated on 0.8% agarose gel using 1X TBE buffer containing 10
mg/mL ethidium bromide and were visualized under UV light and the gels were
photographed using the UVi-tec gel documentation and analysis system (Cambridge,
UK).
2.3.2. Data Analysis
Only the visible band fragments were considered for data scoring. In all the
genetic analysis each single band fragment was considered as a single locus. In case of
RAPDs 15 Tagetes genotypes for PCR analysis were included. The amplified product
bands were scored in binary formula with the presence (1) and absence (0) in every
genotype for each primer. For assessing genetic diversity to prepare a dendogram,
Bivariate (1-0) data matrix was used on the basis of the number of shared amplification
products for estimating dissimilarity and similarity (Nei and Li, 1979). The distance
matrix and similarity matrix were obtained by computing binary data. These distance
matrices were used for cluster analysis. The dendrogram was generated by using
UPGMA (un-weighted pair-group method with arithmetic average) method of cluster
analysis of SAHN command on NTSYS-pc version 2.2 as follows:
GDxy=1 - 2Nxy
Nx + Ny
Where GDXY is genetic distance, Nxy is number of common bands (loci) in two
genotypes, Nx is number of loci in genotype 1, Ny is number of loci in genotype 2 (Nei
and Li, 1979).
24
Table 2.3: Detailed information of RAPD and STS primers used in characterizing Tagetes genotypes
Primer Sequence 5`-3` Size (nt) Melting
Temp (ºC)
Molecular
weight (amu)
GL A03 AGTCAGCCAC 10 29.5 2,997
GL A04 AATCGGGCTG 10 29.5 3,088
GL A05 AGGGGTCTTG 10 29.5 3,098
GL A06 CAAACGGGTG 10 29.5 3,004
GL A07 GGGTAACGCC 10 29.5 3,117
GL A09 GTGATCGCAG 10 29.5 3,053
GL A11 CAATCGCCGT 10 29.5 2,988
GL A12 TCGGCGATAG 10 29.5 3,068
GL A13 CAGCACCCAC 10 33.6 2,942
GL A14 TCTGTGCTGG 10 29.5 3,050
GL A15 TTCCGAACCC 10 29.5 2,984
GL A16 AGCCAGCGAA 10 29.5 3,046
GL A17 GACCGCTTGT 10 29.5 3,019
GL A18 AGGTGACCGT 10 29.5 3,068
GL A19 CAAACGTCGG 10 29.5 3,037
GL A20 GTTGCGATCC 10 29.5 3,019
GL B01 GTTTCGCTCC 10 29.5 2,970
GL B02 TGATCCCTGG 10 29.5 3,019
GL B03 CATCCCCCTG 10 33.6 2,924
GL B04 GGACTGGAGT 10 29.5 3,108
LSTI-F CAGCTTGAGTTGATCGAC 18 54.3 5,515
LSTI-R GCCATACACGTCGTAGAT 18 54.3 5,484
LSTII-F ATCTACGACGTGTATGGC 18 54.3 5,515
LSTII-R AGACTTTGGGACGTCACC 18 55.3 5,500
LSTIII-F CTGCAGCTGTATGAAGCT 18 54.3 5,515
LSTIII-R GCCATACACGTCGTAGAT 18 54.3 5,484
25
2.4. Generation of Gene Specific Primers
2.4.1. Homology Search and Clustering
The known genomic sequence of limonene synthase gene (accession numbers
AY055214, D49368, AF282875, L13459 and AB110637) were used for clustering. All
sequences producing significant alignments were downloaded from the NCBI Gen Bank
(http://www.ncbi.nlm.nih.gov/) for clustering. ClustalW sequence alignments program
(http://www.ebi.ac.uk/clustalw/) was used to obtain the conserved regions. Sequences
were scanned for short conserved amino acid regions with low permutations of possible
codons. Similarly sequences were also scanned directly for short conserved nucleotide
regions. Single primer contained up to three degenerate nucleotides. The resulting
groups were realigned with ClustalW to search conserved regions.
2.4.2. Degenerate Primers
Based on the highly conserved amino acid sequence among several plant
limonene synthases, the fifteen degenerate primers were designed and conserved regions
were reverse translated by using their corresponding genomic codons. The degenerate
primers were designed by reverse translating the conserved regions using their
corresponding genomic codons. Usually the degenerate primers were required to have a
certain length range and degeneracy. The designing criteria of primers were to have 18-
21 nt in length, 40-60% GC contents and Tm 50-65 ° C (optimum 60 ° C) (Rozen and
Skaletsky, 2000). The primer pairs having melting temperature difference within 4° C of
each other were selected to increase the consistency of results (Table 2.4). These
degenerate primer pairs were synthesized commercially from e-oligos Gene Link,
Hawthorne, USA. Detail of primer sequence, length, product size and degeneracy is
given in table 2.4.
26
Table 2.4: Detail of primer sequences based on conserved DNA regions
Primer name
Primer sequence (5′ to 3′) Length
Product
size (bp)
Degene
racy
GC
(%)
Tm
(ºC)
LSTI-F CAGCTTGAGTTGATCGAC 18 864 50 53.4
LSTI-R GCCATACACGTCGTAGAT 18
750
384 50 53.4
LSTII-F ATCTACGACGTGTATGGC 18 384 50 53.4
LSTII-R AGACTTTGGGACGTCACC 18
440
1536 56 55.4
LSTIII-F CTGCAGCTGTATGAAGCT 18 1152 50 53.4
LSTIII-R GCCATACACGTCGTAGAT 18
525
384 50 53.4
LSTIV-F ATCTACGACGTGTATGGC 18 384 50 53.4
LSTIV-R AGTTCCCAAGTCATCAGC 18
380
1536 50 53.4
LSTV-F TACATGCAGCTGTGCTTG 18 96 50 53.4
LSTV-R AGTTCCCAAGTCATCAGC 18
309
1536 50 53.4
LSTmI-F TACGATGTCTATGGTACC 18 44 49.8
LSTmI-R CCTCTTCTTCCGAACCAT 18
539
50 52.1
LSTmIII-F TTCAAGAACGAGGAGGGT 18 50 52.1
LSTmIII-R CATTCATCTTCTTCCACA 18
1063 39 47.5
LSTmIV-F TCCTCGCAACTCCCTACTATC 21 52 57.8
LSTmIV-R TGTTTTCGCCTTCCTTGAACA 21
475 43 53.9
LSTmVI-F GACGATCCGGAAACTACA 18 50 52.1
LSTmVI-R TACAGTTGCAACAATCCT 18
405 39 47.5
LSTmIX-F TTCAAGAACGAGGAGGGTGAG 21 52 57.8
LSTmIX-R CAACACTACTGGATTCATGTC 21
285 43 53.9
LSTmX-F TACGATGTCTATGGTACC 18 44 49.8
LSTmX-R CTCTTCTTCCGAAGCATT 18
522 44 49.8
27
2.4.3. PCR and Nested-PCR Analysis
Eleven degenerate primers were used for amplification of products with well-
marked fragments. These primers were 18 and 21-nucleotides in length for each of
forward and reverse primer sequence (Table 2.4). PCR reaction was carried out in a 20-
µL volume. The reaction mixture contained 25 ng to 30 ng template DNA, 1x Taq DNA
polymerase buffer with (NH4)2SO4, 0.125 U Taq DNA polymerase (Fermentas Inc), 0.8
µL of dNTPs (10 mM), 3 µL of MgCl2 (25mM), 4 µL of each STS forward and reverse
primer (e-oligos Gene Link, Hawthorne, USA) and dilution up to the volume of 20 µL by
double distilled autoclaved water. For nested-PCR all the ingredients of reaction mixture
were same except the template DNA, which was already PCR product. PCR reactions
were carried out in a Perkin Elmer 9700 Thermocycler (ABI, Foster City, CA, USA) with
the following parameters: initial denaturation at 94 ° C for 5 min, followed by 30 cycles
of denaturation at 94 ° C for 30 s, primer annealing at 54 ° C to 56 ° C for 1 min, and
extension at 72 ° C for 1 min, with a final extension at 72 ° C for 7 min (Maruyama et al.,
2001; Shah et al., 2000). PCR products were fractioned on 0.8% agarose gel using 1X
TBE buffer containing 10 mg/mL ethidium bromide and were visualized under UV light
and the gels were photographed using the UVi-tec gel documentation system.
2.4.4. PCR Product Purification
PCR products of degenerate primers were purified at specific size by using silica
beads DNA gel extraction kit (Thermo Fisher Scientific, USA). The procedure was same
as described in kit.
Agarose gel slice containing the DNA fragment was cut by sterile scalpel. Pre-
weighed 1.5 mL eppendorf tube was used to place for gel slice and again weighed to
obtain the weight of the gel slice. 3:1 (v: w) volume of binding buffer was added to the
gel slice. The gel mixture was incubated at 55 °C for five to seven min until the gel slice
was completely dissolved. During incubation the eppendorf tube was mixed by inversion
with intervals and 4.5 volumes of binding buffer and half volume of TBE conversion
buffer were added to a known volume of agarose gel. Then the silica powder suspension
(2 µL/µg) was added to the DNA/binding buffer mixture. The gel mixture was again
28
incubated for 5 min at 55 ° C for binding the DNA to silica matrix followed by vortexing
every few minutes to keep the silica powder in suspension. The mixture of DNA/silica
powder was spinned for 5 to 10 s to form a pellet. Supernatant was removed carefully
and discarded. An additional 300 µL of binding buffer was added in the pelleted silica
powder containing DNA to dissolve any residual agarose. The suspension was placed in
a water bath at 55 ° C for a few minutes to proceed for the next step. 500 µL of ice cold
washing buffer was added (diluted with ethanol) to wash the pellet. After resuspension
of pellet mixture was spun for 5 to 10 s and supernatant was discarded. The same
procedure was repeated for three times. The pellet was air-dried for 10-15 min until the
complete removal of residual ethanol. The pellet was resuspended in appropriate volume
of TE and again tubes were incubated for 5 min at 55 ° C. Tubes were spun again and
supernatant was removed while avoiding the pellet. The recovered supernatant
containing this specific sized PCR product was placed into a fresh tube and procedure
was repeated with another but with the same volume of TE.
2.4.5. DNA Sequencing and Data Analysis
The specific sized PCR products were shipped to Macrogen Inc. Seoul, Korea
for sequence analysis. The resulting sequence alignments were confirmed by the BLAST
program on the NCBI (http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi).
29
Part-II
CHEMICAL ANALYSIS
2.5. Plant Material for Chemical Analysis
Tagetes minuta L. was collected as whole plant in fresh form in the months of
September to October 2008 for the chemical analysis from Abbottabad, a district of
Khyber Pakhtunkhwa Province of Pakistan. These plants were separated into three
different parts and were air dried in the shadow. During shade drying the plants were
protected from fungus by proper aeration. The three different parts; A) flowers and fruit
(5.2 kg), B) roots (3.5 kg) and C) stem and leaves (10 kg) were thereafter crushed to fine
powder.
2.6. Extraction and Fractionation
The T. minuta parts (A–C) were separately extracted with methanol (5L) in three
intervals at room temperature for altogether 21 days. After extraction the extracts were
filtered, and methanol was removed by evaporation under reduced pressure at 30ºC to get
dark brownish masses: 356 g (A), 106.4 g (B) and 461 g (C).
The various dried extracts were suspended in dist. H2O and sequentially
partitioned with ether, hexane, chloroform, ethyl acetate and butanol yielding ether-
soluble: 178 g (A,B and C), n-hexane soluble: 105 g (A), 10.72 g (B), 146.42 g (C),
chloroform-soluble: 39.28 g (A), 3.80 g (B), 118.61 g (C), ethyl acetate-soluble: 21.36 g
(A), 1.33 g (B), 16.91 g (C), and n-butanol-soluble: 53.64 g (A), 17.88 g (B) fractions.
Twelve fractions with different polarity were thus obtained.
2.7. Biological Assays
Crude extracts of three different parts (A-C) and their fraction extracts
were analysed for following biological assays.
30
2.7.1. Antimalarial Bioassay
Plant extracts were analyzed for antiplasmodial activity by lactate dehydrogenase
method in vitro (human blood) (Makler et al., 1993). A drop of blood infected with
malarial parasite was taken and at least 500 erythrocytes were counted, making a note of
the number that contains parasites. The culture medium contained RPMI 1640 buffered
with 0.2% sodium bicarbonate, 25 mM HEPES (Gibco, Life Technologies) and 10%
human serum (Chan et al., 2004). The culture was diluted to final parasitemia of 2.0%
and grown at 37 ºC in the presence of 5% CO2 for 72 h. 100µ l aliquots were distributed
in to sterile 96 well microtiter plate and 10 µ l containing various concentrations of the
crude extracts (solublised in 0.5% Dimethyl sulfoxide (Merck) and culture was placed in
humidified CO2 (5%) incubator at 37 º C. Negative control was administered 10 µ l PBS
in place of the drug while positive control contained standard drug chloroquine
diphosphate. Thin blood films of the culture were prepared after 24, 36 and 72 h. The
slides were stained with Giemsa stains and the number of parasites per 1000 erythrocytes
was determined by microscopic examination. Total parasitemia was calculated and
plated as percentage control against concentration and IC50 was determined.
2.7.2. Phytotoxicity Assay
Phytotoxic bioassay was carried out for plant extracts of T. minuta against Lemna
minor (Tinny plant containing leaves with 1 - 8 mm long and 0.6 - 5 mm wide). The
medium was prepared containing various inorganic components in 1000 ml distilled
water and pH was adjusted approximately 5.5 - 6.0 by adding KOH pellets (Table 2.5).
The medium was autoclaved at 121º C for 15 minutes. 30 mg of each crude and fraction
extracts of T. minuta were dissolved in 1.5 ml organic solvent (methanol) serving as
stock solutions. Three sterilized flasks were inoculated with 1000 µ g, 100µ g, 10 µ g of
solutions from the stock solution for 500, 50, 5 ppm. The solvent was allowed to
evaporate overnight in sterilized conditions. 20 ml of medium was added to each flask
containing the plant extract under investigation. Ten plants of L. minor each containing
a rosette of three fronds were added to each flask. Other three flasks serving as control
were also supplemented with ten plants of L. minor in 20 ml of medium each. The flasks
31
were kept in the growth cabinet for seven days. Plants were observed during incubation.
Number of fronds per flasks were counted and recorded on the seven day (Atta-ur-
Rehman, 1991). Results were analyzed as growth regulation in percentage, calculated
with reference to the negative control.
Table 2.5: Composition of medium preparation for phytotoxic bioassay
Constituents mg/L
Potassium dihydrogen phosphate (KH2PO4) 680
Maganous chloride (MnCl2) 3.62
Magnesium sulphate (MgSO4 with 7H2O) 492
Potassium nitrate (KNO3) 1515
Boric acid (H3BO3) 2.86
Calcium nitrate tetrahydrate (Ca(NO3)2) 1180
Ferric chloride (FeCl3 with 6H2O) 5.40
Zinc sulphate (ZnSO4 with 7H2O) 0.22
Ethylene diamino tetraacetic acid (EDTA) 11.2
Sodium molybdate (Na2MoO4 with 2H2O) 0.12
Copper Sulphate (CuSO4 with 5H2O) 0.08
2.7.3. Insecticidal Activity Assay
Plant extracts of T. minuta were subjected to insecticidal bioassay to determine
the insecticidal activities of this plant extract and fractions. Three different insects
Tribolium castaneum (Red flour beetle), Rhyzopertha dominica (Lasser grain borer) and
Callosobruchus analis (Pulse beetle) were used to test insecticidal activity of the T.
minuta extracts. The insects were reared in the laboratory under controlled conditions (at
30 º C temperature and 50-60 % humidity), in 9.0 cm diameter plastic bottles containing
250 mg of sterile breeding media. The media was sterilized at 60 º C for one hour. The
uniform size and age of insects were used for bioassay test.
For fractions 100 mg each was taken and was dissolved in methanol. Insecticidal
studies were carried out by contact method using filter paper. The fractions of T. minuta
32
prepared by dissolving in 3-4 ml of methanol were used for the determination of solvent
effect using filter paper absorption method. One filter paper was absorbed by the
methanol only used to dissolve the samples to be used as check for determination of
solvent effect and by placing it overnight for evaporation. Next day 10 adults of the same
size and age were placed in Petri dishes containing samples. The controlled batch of
reference insecticide (Coopex) in the same quantity was used. All the insects were kept
for 24 h at 27 º C. Results were calculated as mortality (%) mean.
2.7.4. Antibactrial Activity Assay
Crude and fraction extracts of T. minuta were analyzed at 3 mg/ml in dimethyl
sulfoxide (DMSO) (Merck, Germany). Nutrient broth medium (Oxoid, England) was
used for bacterial growth to perform antibacterial assay. It composition was starch (1
g/L), peptone (5 g/L), sodium chloride (5 g/L) and agar (10 g/L). Nutrient agar media
(Britanialab) composition was plury peptone (5 g/L), sodium chloride (8 g/L), beef
extract (3 g/L) and agar (15 g/L). Both media were prepared according to manufacturer’s
instructions in distilled water and sterized by autoclave at 121 º C for 15 min.
The antibacterial activity was determined both in gram negative and gram positive
bacteria. Gram positive bacteria used in the experiment were Bacillus subtilis,
Staphylococcus aureus, Micrococcus luteus and gram negative bacteria were
Pseudomonas piket, Salmonella setubal.
To compare the turbidity of bacterial culture McFarland (0.5 BaSO4) solution was
used. The standard was prepared by adding 0.5 ml of 1 % solution (w/v) of anhydrous
barium chloride (BaCl2) to 99.5 ml of 1 % solution (v/v) of sulphuric acid (H2SO4).
Barium sulphate turbidity (4 to 6 ml) was taken in screw capped test tube and was used to
compare the turbidity of bacteria.
The agar well diffusion method (Carron et al., 1987; Naqvi et al., 1987) was used
to analyze the samples for antibacterial assay. The samples were prepared by dissolving
3 mg of crude samples of T. minuta in 1 ml of DMSO. The autoclaved nutrient agar
media was cooled at 45 º C and poured 25 mL in each petri plate in front of flame. These
33
Petri plates were incubated overnight at 37 º C in incubator to avoid contamination. The
wells were made by 6 mm sterile metallic borer at 24 mm distance from each other. Each
well was filled with 20 µ L of plant extract and labeled at the back of petri dishes.
Solvent was used as negative control. Ampicillin (Sigma Aldrich) was used as standard
antibiotic drug, at the range of 50 µ g/mL. The incubation of sample plates was at 37 º C
in incubator for 24 h. Next day the results were noted in term of zone of inhibition from
one side to other side of circule and the well diameter was excluded.
2.8. Isolation and Purification of Flavonoids
The isolation, purification and structure identification of pure compounds
(flavonoids) is a time consuming process. Typical procedures for isolation and
characterization of flavonoids consist of several steps: i) extraction of plant material
followed by preliminary purification, ii) fractionation of the mixtures followed by the
isolation of pure pigments and finally iii) characterization and identification of pure
flavonoids (Strack and Wary, 1989; Marston and Hostettmann, 2006).
2.8.1. Preparative HPLC
This is a technique with high resolution. Preparative HPLC isolate the maximum
amount of a certain product at a desired purity in a minimum of time. The requirements
for a preparative HPLC system differ from analytical systems regarding sensitivity and
flow rates. The main difference however, is the fraction collection control for quality of
the product.
Various samples of the chloroform, ethyl acetate and butanol fractions were
examined by HPLC. Before injection to HPLC, samples were filtered by using 0.45 µ m
(Millipore membrane) filter.
The ethyl acetate fractions of A: seed flower, B: root part and similarly the
butanol fractions of A: seed flower, B: root part were subjected to preparative HPLC
using a Gilson 305/306 pump equipped with C18 reversed phase column (ODS-Hypersil
column (25 x 2.2 cm, 5 µ m)) coupled to a multidiode array detector (HP-1040 A)
(Supelco, Bellefonte, USA) for isolation of flavonoids 1-19. Compounds 18, 19 in the
34
ethyl acetate fraction, and compounds 1-17 in the butanol fraction were isolated by using
the solvents (A) H2O-TFA (0.5%) and (B) Acetonitrile-TFA (0.5%). The rate of flow
was 15 mL/min and aliquots of 500 µ L were injected. The initial profile of elution was
based on linear gradient from 10% to 100% of B for 40 min, after that with isocratic
elution of 100% B for 3 min and followed by final linear gradient from 100% to 10% B
for 5 min.
2.9. Characterization and Structure Determination
Chromatographic and spectroscopic techniques were used for characterization and
structure determination of purified compounds. TLC, HPLC and UV-Vis spectroscopy
may give a lot of characteristic information about the type of flavonoids, MS provides the
molecular mass of the compound, the application of powerful NMR instrument is usually
required for complete structure identification of compounds. Structure elucidation of
flavonoids comprises i) aglycone, ii) sugar units, and iii) acyl groups, as well as iv)
determination of linkage positions between the different sub-groups.
2.9.1. Thin Layer Chromatography (TLC)
TLC is considered to be one of the simplest of chromatographic techniques. TLC
facilitates short acquired time and is relatively inexpensive procedure. TLC silica plates
(0.1 mm) of cellulose F (Merck, Germany) was carried out on 0.1 mm cellulose F
(Merck, Germany) plates as a stationary phase with a mobile phase of polar solvent
(Formic acid: Hydrochloric acid: water; 25:24:51, v/v) system.
2.9.2. Reversed Phase Analytical HPLC - DAD
HPLC is the method of choice for accurate determination of both the composition
and concentration of flavonoids in a given sample (Andersen and Francis 2004). The
Agilent 1100 HPLC was operational with a HP 1050 diode-array detector and a 200 x 4.6
mm, 5 µ m ODS Hypersil column (Bellefonte, USA). The elution system was binary,
with (A) H2O-TFA (0.5%) and (B) Acetonitrile-TFA (0.5%) solvents. The rate of flow
was 1.0 mL/min. Samples of 20 µ L were injected with micro autosampler. The initial
profile of elution was based on linear gradient under conditions with 10% B and 90% of
35
A. Subsequently with 20% B for 18 min followed by linear gradient conditions for 18-26
min (to 23% B), 26-30 min (to 28% B), 30- 40 min (to 100% B), isocratic elution 40-43
min (100% B), and the final elution with linear gradient for 43-48 min (to 10% B).
During HPLC analysis online UV absorption spectrum was recorded under wavelength
range of 280-360 nm in steps of 2 nm.
The main chromatographical separation principle involved in reversed-phase
HPLC is the partition of solutes between mobile (polar) and stationary (non-polar) phase.
The overall polarity and stereochemistry of the flavonoids are the key factors for
separation (Strack and wray, 1989, 1994; Andersen and Francis, 2004). Elution of
flavonoids in reversed phase HPLC columns depends on the pattern of
hydroxylation/methoxylation of aglycone, the degree of glycosylation and acyl
subtitution as well as on the mobile phase composition and solvent gradient steepness.
The flavonoids glycosides eluted before aglycones with C18 phases and flavonoides
possessing more hydroxyl groups were eluted before the less substituted analogs.
Flavones C-glycosides generally elute with shorter retention times than the corresponding
O-glycosides. Flavanones elute before their corresponding flavones due to the
unsaturation effect between positions 2 and 3. The presences of aromatic or aliphatic
acylation increases retension times compared to the corresponding non-acylated
derivatives.
2.9.3. UV-Spectroscopy (UV)
Ultra Violet (UV) spectra of the compounds discussed in this work were obtained
online during various analytical HPLC analyses. Chromatograms can be recorded online
at different wavelengths by LC-UV with DAD (Diode Array Detection). Flavones and
flavonols can be found at 270 and 330 to 365 nm (Parejo et al., 2005), flavanones at 290
nm, isoflavones at 236 or 260 nm (Grayer and Veitch, 2006), chalcones at 340 to 360 nm,
dihydrochalcones at 280 nm (Veitch and Grayer, 2006),, anthocynins at 502 to 520 nm
(Andersen and Fossen, 2003; Andersen and Francis, 2004) and catechins at 210 or 280
nm (Merken and Beecher, 2000).
36
2.9.4. NMR Spectroscopy
Compensated attached proton test (CAPT), 2-D homonuclear correlation
experiment (1H-1H DQF-COSY), 2-D heteronuclear single quantum coherence (1H-13C
HSQC) and heteronuclear multiple bond correlation (1H-13C HMBC) were recorded on a
Bruker Biospin Ultrashield Plus AV-600 MHz instrument (Fallanden, Switzerland)
equipped with a cryogenic probe at 298 K at frequencies of 600.13 MHz and 150.90
MHz for 1H and 13C. The deuteriomethyl 13C signal and 1H residual signal of the
CD3OD solvent were used as secondary references (δ 49.0 and δ 3.40 from TMS,
respectively).
2.9.4.1. 1D 1H NMR
The 1D proton spectra of flavonoids provide quantitative information about
proton chemical shifts and their coupling constants (JHH) and give quantitative
information by integrated baseline-separated signals or selected spectral regions. The
information regarding the nature of aglycone, number and type of sugar unit and acyl
substituents can also be provided. The chemical shifts values also indicate linkage
positions between different sub-units of flavonoid.
2.9.4.2. 1D
13C NMR
Spin Echo Fourior Transform (SEFT) and compensated Attached Proton Test
(CAPT) was used along with different 2D techniques to obtain the accurate carbon
chemical shifts. The SEFT sequence suffers from the use of a 90º -excitation pulse,
which requires long repetition times. This feature has been significantly improved with
CAPT.
Due to low abundance (1.1%) and the lesser favorable magnetogyric ratio of 13C
compared to 1H, the 13C-spectra have lower signals to noise level than the corresponding
1H-spectra. In addition, with the 13C signal normally decrease in intensity because of the
JCH-couplings, which will split the signals into multiplets. But the last problem is
eliminated with proton decoupling where multiplets collapse into singlets. The signals
37
(C, CH, CH2, CH3) are differentiated with the aims of different delays in the pulse
program. The C and CH2 signals will be distinguished from the CH and CH3 signals by
having opposite phases.
2.9.4.3. 2D 1H-
1H gradient selected, Double Quantum Filter Correlation
Spectroscopy (gs - DQF- COSY)
This technique is used to assign the different proton signals based on the
couplings through bonds (J-coupling). COSY is 2D homo-nuclear technique where the
diagonal peaks represent the actual proton spectrum and the cross peaks show which
protons are J-coupled to each other.
2.9.4.4. 2D 1H-
1H Total Correlation Spectroscopy (2D TOCSY)
This is two dimensional homo nuclear NMR technique which has diagonal peaks,
and identical proton chemical shift axes as the COSY technique. The TOCSY is used to
find the proton shifts for all protons which belong to the same spin system, even if the
protons are not directly J-coupled. Thus, TOCSY is very useful for determination of
individual 1H shifts of the various sugar units linked to the flavonoid. This is particularly
relevant when the flavonoid contains more than one sugar unit.
2.9.4.5. 2D 1H-1H Nuclear Overhauser and Exchange Effect Spectroscopy (2D
NOESY)
This is 2D homo-nuclear technique which is based on coupling through space.
The method can provide information about the molecular geometry, confirmation and
linkage between flavonoid sun-units. Exchange cross peaks between analogous protons
of species that are in equilibrium with each other may be observed in NOESY spectra,
which will result in positive cross peaks. Across peak due to NOE correlation will be
negative (Santos et al., 1993; Jordheim et al., 2006).
38
2.9.4.6. 2D 1H-
13C gradient- selected Heteronuclear Single Quantum Coherence (gs-
HSQC)
The inverse-detected 2D-heteronuclear experiments correlate 1H and 13C
chemical shifts through single-bond heteronuclear couplings 1JCH. The HSQC spectrum
shows only protons that are directly attached to a carbon atom and vice versa.
2.9.4.7. 2D 1H-
13C gradient-selected Heteronuclear Multiple Bond Correlation (gs-
HMBC)
The HMBC correlates 1H and 13C chemical shifts through multiple-bond
heteronuclear couplings. The most important ones 2JCH and 3JCH, for which the strongest
cross peaks are observed. In addition, 1JCH correlations and some long distance
correlations may be observed. In the spectra recorded for the flavonoids the 1JCH large
doublet may be observed in the HMBC spectra because of incomplete suppression. In
the hetronuclear multiple-bond correlation spectra, most quaternary carbon resonances
may be assigned.
2.9.5. LC-MS
Mass Spectrometry in the present work was applied to measure the molecular
mass for verification of various structure determinations. The spectra of compounds 1-19
were obtained by high resolution LC electrospray mass spectrometry (ESI+/TOF). The
instrument JEOL AccuTOF JMS-T100LC in combination with an Agilent 1200 HPLC
system was used for recording of spectra. A Zorbax SB-C18 (50 mm x 2.1 mm (length x
i.d.), 1.8 µ m) column was used for combination, and separation of solvents A, H2O-TFA
(0.5%) (v/v) and B, Acetonitrile-TFA (0.5%) (v/v) were used for elution. The initial
solvent elution profile was based on linear gradient for 0 - 1.25 min with 10 to 22% B,
1.25 - 5 min with 22 to 30% B (linear gradient), followed by isocratic elution for 5 - 7
min with 30% B, 7 - 8 min with 30 to 40% B (linear gradient), 8 - 14 min 40% B
(isocratic) and finally linear gradient for 14 -15 min with 40 to 10% B. During this flow
rate was 0.4 mL/min.
39
Chapter 3
Results & Discussions
40
Part- I
MOLECULAR ANALYSIS
3.1. Optimization of DNA Extraction
The isolation of genomic DNA of T. minuta, T. patula, T. ertecta and their
hybrids was checked by means of agarose gel electrophoresis. Different tissue types
(fresh, sun-dried, shade-dried leaf tissues, and seeds) were used to isolate the DNA.
DNA obtained after application of DNA isolation protocol and RNase A treatment is
presented in Fig. 3.1, 3.2, 3.3 and 3.4. The quantity of the isolated DNA was optimum.
The DNA of T. minuta collected from four different areas of Haripur is presented
in Fig. 3.1. Seeds were used to isolate DNA from these genotypes of T minuta. The Fig.
3.1 (a) and (b) shows DNA before and after the treatment of RNase A respectively. The
bands of DNA are crispy and in good quality.
Fig. 3.2 shows the DNA of T. minuta taken from four different areas of
Abbottabad. Fig. 3.2 (a) and (b) shows DNA before and after the treatment of RNase A.
Fig. 3.3 shows the DNA of T. minuta taken from four different areas of Mansehra. The
sample TM12 shows excess amount of RNA in Fig. 3.3 (a) and similarly Fig. 3.1 (b)
shows DNA after the treatment of RNase A.
Fig. 3.4 shows the DNA of T. erecta T. patula and their hybrids collected from
the plains and hilly areas of Pakistan (Table 2.1). Seeds were used to isolate DNA from
fourteen genotypes of Tagetes species. Fig. 3.4 (a) and (b) shows DNA in good quantity
and before and after the treatment of RNase A.
41
(a) (b)
Fig. 3.1: Genomic DNA of four Tagetes minuta from Haripur (a) before and (b) after treatment with RNaseA TM1: Tagetes minuta collected from (Khanpur) Haripur.
TM2: Tagetes minuta collected from (Hattar) Haripur
TM3: Tagetes minuta collected from (Sarai Saleh) Haripur
TM4: Tagetes minuta collected from (Kotnagibullah) Haripur
(a) (b)
Fig. 3.2: Genomic DNA of four Tagetes minuta from Abbottabad (a) before and (b) after treatment with RNaseA
TM5: Tagetes minuta collected from (Havelian) Abbottabad
TM6: Tagetes minuta collected from (Habibullaha Colony) Abbottabad
TM7: Tagetes minuta collected from (Aspadar) Abbottabad
TM8: Tagetes minuta collected from (Qalanderabad) Abbottabad
42
(a) (b)
Fig. 3.3: Genomic DNA of four Tagetes minuta from Manshera (a) before and (b) after treatment with RNaseA
TM9: Tagetes minuta collected from (Daata) Mansehra
TM10: Tagetes minuta collected from (Chitta Bata) Mansehra
TM11: Tagetes minuta collected from (Rehar) Mansehra
TM12: Tagetes minuta collected from (Ghari Habibullah) Mansehra
(a)
T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14
43
(b)
Fig. 3.4: Genomic DNA of fourteen Tagetes genotypes (a) before and (b) after treatment with RNaseA T1: Tagetes erecta collected from (Sarai Saleh) Haripur
T2: Tagete erecta collected from (Sarai Saleh) Haripur
T3: Tagetes erecta collected from COMSATS Nursery Abbottabad
T4: Tagetes erecta collected from COMSATS Nursery Abbottabad
T5: Tagetes patula collected from (Sarai Saleh) Haripur
T6: Tagetes patula collected from (Sarai Saleh) Haripur
T7: Tagetes patula collected from COMSATS Nursery Abbottabad
T8: Tagetes patula collected from COMSATS Nursery Abbottabad
T9: Tagetes patula collected from (Baha-ud-din Zakariya) Multan
T10: Tagetes patula collected from COMSATS Nursery Abbottabad
T11: Tagetes patula collected from COMSATS Nursery Abbottabad
T12: Tagetes erecta collected from (Kohat) Peshawar
T13: Tagetes erecta collected from (Mardan) Peshawar
T14: Tagetes erecta collected from COMSATS Nursery Abbottabad
44
In the past various protocols and their modifications were developed and
employed to isolate quality DNA from different plant species (Murray and Thompson,
1980; Dellaporta et al., 1983; Saghai-Maroof et al., 1984; Rogers and Bendich, 1985;
Doyle and Doyle, 1990; Suman et al., 1999; Warude et al., 2003; Sarwat et al., 2006;
Deshmukh et al., 2007). Three of the reported protocols (isoamylalcohol, CTAB, and
SDS) were particularly used (with modifications) to isolate and analyze DNA from T.
minuta using different tissue types. Major aim was to optimize a protocol that may be
rapid and inexpensive with high quality and throughput. T. minuta is one of those
medicinal plant species that contain higher levels of secondary metabolites such as
polysaccharides, polyphenols, flavonoids, and essential oils, which may get co-
precipitated with DNA during its preparation, thus interfering with enzymatic analysis.
Removal of such compounds is key to obtain good-quality DNA. DNA isolated using
various extraction protocols was compared from preparation to PCR analysis in terms of
quantity and quality. DNA obtained was not of enough quantity and the quality was very
poor especially in case of dried (sun and shade) leaf tissues in all the tested protocols.
Preparations (including DNA) in the test tubes were highly viscous and dirty brown in
color which showed no or very faint bands (or smears of the bands) upon gel
electrophoresis while there were no amplification products after PCR analysis. However,
the results from the modified CTAB buffer method were encouraging and were far better
than the rest of the tested protocols especially in case of fresh leaf tissues without liquid
nitrogen and the seed samples. At that point, we stopped further testing for the protocols
except CTAB procedure. The modified CTAB buffer method of genomic DNA
extraction from different tissues of T. minuta was further tested and refined to compare
its efficiency in terms of quantity and quality of the DNA for various tissue types.
3.1.1. DNA Quantification
Successful DNA extraction was obtained from fresh, sun-dried, shade-dried leaf
tissues, and powdered (paste) seeds. DNA obtained from sun- and shade-dried leaves
was not of adequate quality for PCR analyses. DNA concentration was measured in a
spectrophotometer (UV/VIS) and an absorbance, i.e., A260/A280 ratio of 1.3, was obtained
45
that indicated high levels of contaminated proteins and polysaccharides (Dehestani and
Tabar, 2007).
Table 3.1: Yield and quality of total DNA determined by spectrophotometer
Absorbance Ratio Tissue type
OD 260/280
Yield (µg/0.1g)
Seed 1.84 ± 0.04a 83.9 ±10.6
Fresh leaf 1.89 90.6
Dry leaf 1.80 65.5
aValues are means ± SD (n = 6).
Total DNA isolated from fresh leaves and dried-seed powder of T. minuta was
checked by agarose gel electrophoresis. High-molecular weight DNA of larger quantities
and of good quality was obtained from fresh leaves without using liquid nitrogen and
dried seed samples (Fig. 3.5 and 3.6). The purity of the DNA samples was confirmed by
absorbance (A260/A280) ratio, which was 1.8 (Table 3.1). The modified protocol thus
yielded DNA of high purity, free from essential oils, polyphenols, flavonoides, and
polysaccharides from fresh leaf samples and seed tissues. However, an increase in the
amount of tissues used did not increase DNA yield from either types of plant tissues.
Fig. 3.5: Genomic DNA isolation from fresh leaf tissue of the three samples (lane 1, 2 and 3)
46
Fig. 3.6: Genomic DNA isolation from dried seed powder of the three samples (lane 1, 2 and 3).
3.1.2. DNA Amplification
The DNA obtained was suitable for enzymatic manipulations such as PCR and
showed high intensity amplification with arbitrary RAPD primers (Fig. 3.7, 3.8 and 3.9).
PCR amplification also indicated that the DNA was of good quality, free from interfering
compounds and it would be suitable for other DNA analyses such as restriction, Southern
transfer and hybridization when performing restriction fragment length polymorphism
(RFLP).
47
Fig. 3.7: PCR amplification products of DNA isolated from fresh-leaf and seeds of 6 samples of T. minuta using random primer GL A-03. M: 100-bp DNA ladder; lanes 1, 2, and 3: fresh leaf; lanes 4, 5, and 6: seed tissue
Fig. 3.8: PCR amplification products of DNA isolated from fresh-leaf and seeds of 6 samples of T. minuta using random primer GL A-08. M: 100-bp DNA ladder; lanes 1, 2, and 3: fresh leaf; lanes 4, 5, and 6: seed tissue
48
Fig. 3.9: PCR amplification products of DNA isolated from fresh-leaf and seeds of 6 samples of T. minuta using random primer GL A-09. M: 100-bp DNA ladder; lanes 1, 2, and 3: fresh leaf; lanes 4, 5, and 6: seed tissue
DNA isolation is a primary and critical step for molecular analysis of any plant
species. This process becomes even more difficult when the plant species contain high
amounts of secondary metabolites and essential oils. These compounds, particularly in
medicinal plants, are considered to be as contaminants that cause DNA degradation
during preparation. T. minuta is one of such plant species and therefore the extraction of
genomic DNA from this plant is difficult. Polyvinylpyrrolidone (PVP), a compound
known to suppress polyphenolic oxidation, has been used frequently in CTAB extraction
protocols (Doyle and Doyle, 1990). The modified CTAB buffer containing PVP was also
employed to extract DNA from T. minuta using liquid nitrogen (Hills and Van Staden,
2002). However, it was reported elsewhere that this compound did not significantly
increase the yield or prevent contamination of the DNA (Schneerman et al., 2002). SDS-
based extraction buffer is being used to break open the cells and isolate DNA. But the
quality of DNA obtained is questioned due to precipitation of polysaccharides and
proteins. In addition, the SDS might not bind with the proteins in the purification step,
thus degrading the extracted DNA (Aljanabi et al., 1999; Deshmukh et al., 2007). Since
SDS and isoamylalcohol methods did not give significant results in either type of leaf
tissues or seeds that we tested in the case of T. minuta are therefore, hard to make any
49
conclusive comments on their efficacy or effectiveness. However, the use of PVP in
CTAB buffer did not improve the yield or quality rather we obtained significantly better
results without PVP use in our experiment of DNA extraction.
3.2. Analysis of Genetic Diversity in Tagetes
Following the protocol, the DNA concentrations obtained from plant seeds are
83.9± 10.6 µ g/0.1g and the absorbance ratio of A260/A280 was 1.84± 0.04 (Table 3.1).
The total DNA from seeds tissue was analysed on 0.8% agarose gels electrophoresis and
high molecular weight DNA was obtained.
Twenty RAPD primers were used to estimate the genetic dissimilarity in fifteen
Tagetes genotypes for the genetic polymorphism. These primers indicated 167 loci of
amplification products with total 757 detectable fragment bands scored against 15
genotypes of Tagetes found in Northern areas of Pakistan. Of 167 amplification
products 159 (95.21%) were polymorphic, while 8 (4.79%) were obtained monomorphic
(Table 3.2). Number of amplification products from 7 to 11, while 8.35 was average of
amplified product per RAPD primer. Average 53.18% homology was observed in 15
genotypes (Table 3.2).
50
Table 3.2: Primer name, total bands, amplification products and homology of Tagetes
genotypes (%) for the RAPD primers
Amplification products profile primers
Total loci Monomorphic Polymorphic
Homology of
genotypes (%)
GL A03 7 1 6 3.80
GL A04 8 0 8 62.85
GL A05 7 0 7 90.47
GL A06 9 0 9 89.52
GL A07 7 1 6 41.90
GL A09 10 1 9 5.71
GL A11 8 0 8 52.38
GL A12 7 0 7 54.28
GL A13 8 1 7 32.28
GL A14 9 0 9 78.09
GL A15 8 1 7 59.04
GL A16 7 1 6 37.14
GL A17 10 0 10 74.28
GL A18 8 0 8 35.23
GL A19 11 0 11 37.14
GL A20 7 1 6 80
GL B01 8 0 8 17.14
GL B02 9 0 9 68.57
GL B03 10 0 10 76.19
GL B04 9 1 8 67.61
Total mean 167 8 159 53.18
Different levels of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLA03 primer. PCR amplification of this primer produced 57 band
fragments while band average per genotype was 3.8 (Table 3.3). The range of genetic
distance was observed from 0-100% in the genetic dissimilarity matrix. Only 5
combinations of Tagetes genotypes (for detail see Appendix Table B-1) showed
51
maximum genetic distance (100%). While 5 comparisons (T1-T2, T6-T7, T10-T11, T5-
T12 and T13-T15) showed 100% homology (GD = 0%) at DNA level when RAPAD
primer GLA03 was used.
Different levels of genetic polymorphism were also observed in all Tagetes
genotypes by using Genelink GLA04 primer. PCR amplification of this primer produced
29 band fragments while band average per genotype was 1.93. The range of genetic
distance was observed from 0-100% in the genetic dissimilarity matrix. Only 8
combinations of Tagetes genotypes (for detail see Appendix Table B-2) showed
maximum genetic distance (100%). While 67 comparisons showed 100% homozygosis
at DNA level in respect to primer GLA04.
PCR amplification by using Genelink GLA05 primer in all Tagetes genotypes
produced 16 band fragments while band average per genotype was 1.06 (Table 3.3). The
range of genetic distance was observed from 0-100% in the genetic dissimilarity matrix.
Only 2 combinations (T3-T15, T6-T15) of Tagetes genotypes (for detail see Appendix
Table B-3) showed maximum genetic distance (100%). While 95 comparisons showed
100% homozygosis at DNA level while using Genelink primer GLA05.
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLA06 primer. PCR amplification of this primer produced 18 band
fragments while band average per genotype was 1.2. The range of genetic distance was
observed from 0-100% in the genetic dissimilarity matrix. Only 1 (T8-T15) comparison
of Tagetes genotypes showed maximum genetic distance (100%). While 97% genetic
distance was observed in 3 comparisons and 94 comparisons (for detail see Table B-4)
showed no polymorphism at molecular level using GLA06 primer.
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLA07 primer (Fig. 3.10). PCR amplification of this primer produced
27 band fragments while band average per genotype was 1.8. The range of genetic
distance was observed from 0-100% in the genetic dissimilarity matrix. Only 8
52
comparisons of Tagetes genotypes (for detail see Table B-5) showed maximum genetic
distance (100%). While 44 comparisons showed no polymorphism at DNA level in
respect to primer GLA07.
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLA09 primer (Fig. 3.11). PCR amplification of this primer produced
54 band fragments while band average per genotype was 3.6 (Table 3.3). The range of
genetic distance was observed from 0-100% in the genetic dissimilarity matrix. 28
comparisons of Tagetes genotypes (for detail see Table B-6) showed maximum genetic
distance (100%). On the other hand 7 comparisons showed no polymorphism at DNA
level.
Similarly different level of genetic polymorphism was observed in all Tagetes
genotypes by using Genelink GLA11 primer. PCR amplification of this primer produced
49 band fragments while band average per genotype was 3.26 (Table 3.3). The range of
genetic distance was observed from 0-97% in the genetic dissimilarity matrix. Only one
(T8-T13) comparison of Tagetes genotypes (for detail see Appendix Table B-7) showed
maximum genetic distance (97%), while 55 comparisons showed 100% homozygosis at
DNA.
PCR amplification of GLA12 primer produced 39 band fragments while band
average per genotype was 2.6 (Table 3.3). The range of genetic distance was observed
from 0-100% in the genetic dissimilarity matrix. Eight (T3-T6, T3-T7, T3-T8, T3-T15,
T4-T6, T4-T7, T4-T8 and T4-T15) comparisons of Tagetes genotypes (for detail see
Appendix Table B-8) showed maximum genetic distance (100%). While 57 comparisons
showed 100% homozygosis at DNA level while using Genelink primer GLA12.
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLA13 primer (Fig. 3.12). PCR amplification of this primer produced
64 band fragments while band average per genotype was 4.26 (Table 3.3). The range of
genetic distance was observed from 0-100% in the genetic dissimilarity matrix. Eight
53
comparisons of Tagetes genotypes (for detail see Table B-9) showed maximum genetic
distance (100%), while 34 comparisons showed 100% homozygosis at DNA level.
Similarly different level of genetic polymorphism was observed in all Tagetes
genotypes by using Genelink GLA14 primer. PCR amplification of this primer produced
23 band fragments while band average per genotype was 1.53 (Table 3.3). The range of
genetic distance was observed from 0-100% in the genetic dissimilarity matrix. Six
comparisons of Tagetes genotypes (for detail see Table B-10) showed maximum genetic
distance (100%), while 82 comparisons showed 100% homozygosis at DNA level.
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLA15 primer. PCR amplification of this primer produced 41 band
fragments while band average per genotype was 2.73. The range of genetic distance was
observed from 0-100% in the genetic dissimilarity matrix. Six comparisons of Tagetes
genotypes (for detail see Table B-11) showed maximum genetic distance (100%). While
62 comparisons showed no polymorphism at DNA level, while using Genelink primer
GLA15.
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLA16 primer (Fig. 3.13). PCR amplification of this primer produced
53 band fragments while band average per genotype was 3.53 (Table 3.3). The range of
genetic distance was observed from 0-80% in the genetic dissimilarity matrix. Four
comparisons (T1-T6, T1-T7, T1-T8 and T1-T12) of Tagetes genotypes (for detail see
Appendix Table B-12) showed maximum genetic distance (80%). While 39 comparisons
showed no polymorphism at DNA level, while using Genelink primer GLA16.
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLA17 primer. PCR amplification of this primer produced 35 band
fragments while band average per genotype was 2.33. The range of genetic distance was
observed from 0-100% in the genetic dissimilarity matrix. Nine comparisons of Tagetes
genotypes (for detail see Table B-13) showed maximum genetic distance (100%). While
54
78 comparisons showed no polymorphism at DNA level, while using Genelink primer
GLA17.
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLA18 primer (Fig. 3.14). PCR amplification of this primer produced
40 band fragments while band average per genotype was 2.66. The range of genetic
distance was observed from 0-100% in the genetic dissimilarity matrix. Ten comparisons
of Tagetes genotypes (for detail see Table B-14) showed maximum genetic distance
(100%). While 37 comparisons showed no polymorphism at DNA level, while using
Genelink primer GLA18.
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLA19 primer. PCR amplification of this primer produced 44 band
fragments while band average per genotype was 2.93 (Table 3.3). The range of genetic
distance was observed from 0-100% in the genetic dissimilarity matrix. 21 comparisons
of Tagetes genotypes (for detail see Table B-15) showed maximum genetic distance
(100%). While 39 comparisons showed no polymorphism at DNA level, while using
Genelink primer GLA19.
Similarly different level of genetic polymorphism was observed in all Tagetes
genotypes by using Genelink GLA20 primer. PCR amplification of this primer produced
22 band fragments while band average per genotype was 1.46. The range of genetic
distance was observed from 0-100% in the genetic dissimilarity matrix. Three
combinations (T5-T6, T5-T15 and T9-T15) of Tagetes genotypes (for detail see Table B-
16) showed maximum genetic distance (100%). While 84 comparisons showed no
polymorphism at DNA level, while using Genelink primer GLA20.
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLB01 primer. PCR amplification of this primer produced 56 band
fragments while band average per genotype was 3.73 (Table 3.3). The range of genetic
distance was observed from 0-100% in the genetic dissimilarity matrix. 17 combinations
of Tagetes genotypes (for detail see Table B-17) showed maximum genetic distance
55
(100%). While 18 comparisons showed no polymorphism at DNA level, while using
Genelink primer GLB01.
Similarly different level of genetic polymorphism was observed in all Tagetes
genotypes by using Genelink GLB02 primer. PCR amplification of this primer produced
32 band fragments while band average per genotype was 2.13 (Table 3.3). The range of
genetic distance was observed from 0-100% in the genetic dissimilarity matrix. 11
combinations of Tagetes genotypes (for detail see Table B-18) showed maximum genetic
distance (100%). While 72 comparisons showed no polymorphism at DNA level, while
using Genelink primer GLB02.
56
Table 3.3: Primer, no of band fragments, band average and genetic distance of Tagetes genotypes for RAPD primers
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using Genelink GLB03 primer. PCR amplification of this primer produced 27 band
fragments while band average per genotype was 1.8 (Table 3.3). The range of genetic
distance was observed from 0-100% in the genetic dissimilarity matrix. 12 combinations
of Tagetes genotypes (for detail see Table B-19) showed maximum genetic distance
Primer No of band
fragments
Band
average
GD (100%) GD (0%)
Homogeneity
GL A03 57 3.8 5 5
GL A04 29 1.93 8 67
GL A05 16 1.06 2 95
GL A06 18 1.2 1 94
GL A07 27 1.8 8 44
GL A09 54 3.6 28 7
GL A11 49 3.26 1 (97%) 55
GL A12 39 2.6 8 57
GL A13 64 4.26 8 34
GL A14 23 1.53 6 82
GL A15 41 2.73 6 62
GL A16 53 3.53 4 (80%) 39
GL A17 35 2.33 9 78
GL A18 40 2.66 10 37
GL A19 44 2.93 21 39
GL A20 22 1.46 3 84
GL B01 56 3.73 17 18
GL B02 32 2.13 11 72
GL B03 27 1.8 12 80
GL B04 41 2.73 1 (75%) 71
57
(100%). While 80 comparisons showed no polymorphism at DNA level, while using
Genelink primer GLB03.
Similarly different level of genetic polymorphism was observed in all Tagetes
genotypes by using Genelink GLB03 primer. PCR amplification of this primer produced
41 band fragments while band average per genotype was 2.73 (Table 3.3). The range of
genetic distance was observed from 0-75% in the genetic dissimilarity matrix. Only one
combination (T1-T3) of Tagetes genotypes (for detail see Table B-20) showed maximum
genetic distance (75%). While 71 comparisons showed no polymorphism at DNA level,
while using Genelink primer GLB04.
The average genetic distance in terms of genetic dissimilarity by using the set of
twenty RAPD primers in fifteen Tagetes genotypes is presented in Table 3.4. The range
of genetic distance was observed from 22-100% in the genetic dissimilarity matrix (Table
3.4). Maximum genetic distances (100%) were estimated in three comparisons (T3-T13,
T6-T14 and T7-T14) while the minimum genetic distance was observed for one
comparison T9-T10 (22%) closely followed by T10-T11 (23%), T13-T14 (25%) and T3-
T4 (26%). The remaining genotypes showed insignificant differences.
The dissimilarity coefficient matrix (Nei and Li, 1979) data of 20 RAPD primers
for 15 genotypes of Tagetes species was used to make a dendogram by UPGMA method
for cluster analysis (Fig. 3.16). In general the dendogram agreed with the average
dissimilarity matrix presented in Table 3.4. Fifteen genotypes were grouped into four
groups (A, B, C and D) in the phenogram which were putatively identified by
taxonomist. The group A comprised of five (T1, T2, T13, T14 and T12) genotypes of T.
erecta hybrids, in which T12 out-grouped as it a diverse genotype. T13 and T14 were
similar genotypes in this group. Group B comprised seven (T5, T9, T10, T11, T6, T8 and
T7) genotypes of T. patula hybrid. T9 and T10 genotypes were most similar, while T5
and T7 were out-grouped from the rest of this group. Group C comprised two (T3 and
T4) genotypes of Tagetes species. T15 genotype of T. minuta was the genetically most
distinct from the other genotypes and did not match with the any other genotype, which
58
indicated the high level of genetic diversity with other genotypes. On the other hand,
twelve T. minuta plants collected from different areas did not show any genetic diversity
because they presented 100% similarity with no polymorphic band.
Three STS primers were used for the genetic polymorphism and species selection
for essential oils. These primers indicated 29 loci of amplification products with total
139 detectable fragment bands scored against 15 genotypes of Tagetes found in northern
areas of Pakistan. Of 29 amplification products 28 (96.55%) were found to be
polymorphic and 1 (3.45%) was monomorphic (Table 3.5). The number of amplification
products from 7 to 12, while 9.67 was average of amplified products per STS primer.
Average 51.11% homology was observed in 15 genotypes (Table 3.5).
Different level of genetic polymorphism was observed in all Tagetes genotypes
by using STS primer LSTI. PCR amplification of this primer produced 50 band
fragments while band average per genotype was 3.33 (Table 3.6). The range of genetic
distance was observed from 0-100% in the genetic dissimilarity matrix. 12 combinations
of Tagetes genotypes (for detail see Table B-21) showed maximum genetic distance
(100%). While 53 comparisons showed no polymorphism at DNA level, while using
LSTI primer.
Similarly different level of genetic polymorphism was observed in all Tagetes
genotypes by using STS primer LSTII. PCR amplification of this primer produced 35
band fragments while band average per genotype was 2.33 (Table 3.6). The range of
genetic distance was observed from 0-66% in the genetic dissimilarity matrix. Three
combinations (T2-T3, T2-T4 and T2-T15) of Tagetes genotypes (for detail see Table B-
22) showed maximum genetic distance (66%). While 52 comparisons showed no
polymorphism at DNA level, while using LSTII primer.
Similarly different level of genetic polymorphism was observed in all Tagetes
genotypes by using STS primer LSTIII (Fig. 3.15). PCR amplification of this primer
produced 54 band fragments while band average per genotype was 3.6 (Table 3.6). The
59
range of genetic distance was observed from 0-100% in the genetic dissimilarity matrix.
20 combinations of Tagetes genotypes (for detail see Table B-23) showed maximum
genetic distance (100%). While 56 comparisons showed no polymorphism at DNA level,
while using LSTIII primer.
Genotype T1, T2, T13, and T14 showed no significant amplification products to
these STS primers that also proved in the Nei’s genetic diversity findings. UPGMA
dendrogram of STS primers illustrate the genetic distance between studies genotypes
(Fig. 3.17). The average genetic distance in terms of genetic dissimilarity by using the
set of three STS primers in fifteen Tagetes genotypes is presented in Table 3.7. The
range of genetic distance was observed from 9-100% in the genetic dissimilarity matrix
(Table 3.7). Maximum genetic distances (100%) were estimated in three comparisons
(T2-T15, T3-T7, T4-T7 and T4-T9) while the minimum genetic distance was observed
for one comparison T10-T11 (9%) closely followed by T3-T4 (10%) and T9-T10 (14%).
The remaining genotypes showed insignificant differences.
RAPD is a technique used widely for the analysis of genetic variability and
collection of germplasm identification as well as the identification of phylogenetic
relationship, cultivars, breeding programs and investigation of lines (Caetano-Anolles,
1996; Virk et al., 1995; Powell et al., 1996; Singh et al., 2009; Besse et al., 2004; Liu et
al., 2008; Przyborowski and Sulima, 2010). Tagetes is a genus of medicinal importance
(Soule, 1993b; Tereschuk, et al., 1997; Parejo, et al., 2005; Romagnoli, et al., 2005). So
many chemical compounds have been isolated from this genus but not enough data is
present on molecular analysis. Generally, molecular marker techniques have been
employed in the cereal crops such as wheat, maize and rice but less emphasis was laid on
such medicinal important species (Leach et al., 1992; Adhikari et al., 1999; Shah et al.,
2000; Jun et al., 2007; Selvi et al., 2003). It is highly significant to test the genetic
diversity and genetic polymorphism present in the Tagetes species to improve this
medicinal crop of commercial importance. Only one reference is reported on the genetic
diversity of Tagetes species in scientific literature. Darokar et al., (2000) found 90 bands
with 70% polymorphism in six accessions of T. patula. While in present study 757 bands
60
and 159 loci with 95.21% polymorphisim was observed in fifteen genotypes of Tagetes.
The increase number of polymorphic products also increases the effectiveness of
molecular markers, so that high number of primers should be used. The increased
number of polymorphic amplification products in present study proved the usefulness and
effectiveness of RAPD markers in determination of genetic diversity of Tagetes, while
STS markers in the current study were used for the first time for genetic polymorphism in
Tagetes genotypes.
One of the important aims of current study was to identify and measure the
genetic polymorphism in a set of Tagetes genotypes collected from the plain and hilly
areas of Pakistan. Significantly high percentage and degree of genetic diversity was
observed in the species of genus Tagetes for selection of species if they were similar or
dissimilar.
61
Fig. 3.10: PCR amplification products of fifteen Tagetes species with RAPD primer GL A-07. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
Fig. 3.11: PCR amplification of fifteen Tagetes species with primer GL A-09. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
62
Fig. 3.12: PCR amplification products of fifteen Tagetes species with primer GL A-13. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
Fig. 3.13: PCR amplification products of fifteen Tagetes species with primer GL A-16. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
63
Fig. 3.14: PCR amplification products of fifteen Tagetes species with primer GL A-18. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
Fig. 3.15: PCR amplification products of fifteen Tagetes species with STS primer LSTIII. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
64
Table 3.4: Average genetic distances among 15 Tagetes genotype using RAPD primers
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.37 - T3 0.67 0.42 - T4 0.76 0.56 0.26 - T5 0.94 0.58 0.84 0.77 - T6 0.81 0.50 0.73 0.82 0.39 - T7 0.64 0.43 0.78 0.76 0.50 0.33 - T8 0.58 0.38 0.67 0.68 0.44 0.29 0.36 - T9 0.89 0.61 0.89 0.83 0.32 0.41 0.58 0.31 - T10 0.67 0.44 0.67 0.68 0.40 0.38 0.46 0.27 0.22 - T11 0.66 0.46 0.70 0.63 0.36 0.42 0.38 0.36 0.29 0.23 - T12 0.66 0.58 0.84 0.98 0.67 0.53 0.45 0.65 0.80 0.86 0.76 - T13 0.66 0.53 1.00 0.98 0.74 0.58 0.64 0.58 0.56 0.49 0.62 0.54 - T14 0.46 0.62 0.83 0.80 0.85 1.00 1.00 0.62 0.60 0.62 0.75 0.78 0.25 - T15 0.69 0.53 0.61 0.78 0.73 0.70 0.75 0.69 0.70 0.51 0.69 0.83 0.69 0.82 -
Table 3.5: Polymorphism parameters and homology of genotypes using STS primers
Table 3.6: Primer, no of band fragments, band average and genetic distance of Tagetes genotypes using STS primers
Parameters Values
Amplification products 29 Polymorphic (%) 96.55 Monomorphic (%) 3.45 Average amplification product per primer 9.67 Homology of genotypes (%) 51.11
Primer No of band fragments Band average GD (100%) GD (0%) Homogeneity
LST I 50 3.33 12 53 LST II 35 2.33 3 (60%) 52 LST III 54 3.6 20 56
65
Table 3.7: Average genetic distances among 15 Tagetes genotype using STS primers
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.98 - T4 0.00 0.95 0.10 - T5 0.00 0.75 0.93 0.90 - T6 0.00 0.84 0.84 0.99 0.45 - T7 0.00 0.79 1.00 1.00 0.40 0.24 - T8 0.00 0.51 0.98 0.94 0.40 0.50 0.20 - T9 0.00 0.51 0.98 1.00 0.40 0.65 0.45 0.20 - T10 0.00 0.55 0.84 0.99 0.31 0.69 0.50 0.24 0.14 - T11 0.00 0.46 0.93 0.90 0.22 0.60 0.40 0.27 0.27 0.09 - T12 0.00 0.88 0.88 0.69 0.35 0.73 0.40 0.40 0.69 0.45 0.35 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 1.00 0.63 0.48 0.68 0.77 0.91 0.73 0.57 0.77 0.86 0.66 0.00 0.00 -
T1: Tagetes erecta collected from (Sarai Saleh) Haripur
T2: Tagetes erecta collected from (Sarai Saleh) Haripur
T3: Tagetes erecta collected from COMSATS Nursery Abbottabad
T4: Tagetes erecta collected from COMSATS Nursery Abbottabad
T5: Tagetes patula collected from (Sarai Saleh) Haripur
T6: Tagetes patula collected from (Sarai Saleh) Haripur
T7: Tagetes patula collected from COMSATS Nursery Abbottabad
T8: Tagetes patula collected from COMSATS Nursery Abbottabad
T9: Tagetes patula collected from (Baha-ud-din Zakariya) Multan
T10: Tagetes patula collected from COMSATS Nursery Abbottabad
T11: Tagetes patula collected from COMSATS Nursery Abbottabad
T12: Tagetes erecta collected from Kohat
T13: Tagetes erecta collected from Mardan
T14: Tagetes erecta collected from COMSATS Nursery Abbottabad
T15: Tagetes minuta (Composite sample from different localities of Abbottabad and Mansehra)
66
Fig. 3.16: A dendrogram of fifteen (15) Tagetes genotypes generated using 20 RAPD primers and genetic distance estimates from UPGMA
67
Fig. 3.17: A dendrogram of fifteen (15) Tagetes genotypes generated using 3 STS primers and genetic distance estimates from UPGMA
68
3.3. Identification of Gene Specific Markers and their Relationship with
Biochemical Compounds
T. minuta is reported to contain monoterpenes as essential oil component such as
d and l-limonene. Degenerate primers were designed for limonene synthase gene for T.
minuta by using ClustalW sequence alignments. The ClustalW sequence alignment
search showed conserved DNA and protein (amino acid) regions. The resulting
consensus sequence of amino acids at each branch was a potential primer. To assess the
performance of primers their maximum number was considered and selected from larger
multiple sequence alignments. The regions of the alignment with high conservation of
amino acids were used in designing of primers (Fig. 3.18). Several highly conserved
motifs were observed and used to design the degenerate primers of Limonen Synthase of
Tagetes (LST). Motifs QLELID, LQLYEA, IYDVYG, YMQLCF, ADDLGT and
GDVPKS consisting of 122, 217, 368, 404, 514 and 527 amino acid residues
respectively were used as forward and reverse primers with their specific product size.
The PCR with degenerate primers designed with reference to the conserved amino
acid sequences among several plant terpene synthases (Rozen and Skaletsky, 2000;
Bertomeu, et al., 2008) and following sequence analysis, by using the DNA isolated from
the fresh leaf tissue of T. minuta as a template produced clear bands. The degenerate
primer LSTI showed the product size of 750-bp (Fig. 3.20) at annealing temperature of
54° C while showed no results at 56° C of annealing temperature. Similarly LSTII
showed the clear band pattern at product size of 440-bp, LSTIII primer has clear band
pattern at 525-bp product size and LSTV primer showed clear band pattern at product
size of 309-bp with annealing temperature of 56° C (Fig. 3.19). While the LSTIV primer
did not show any band at annealing temperatures ranging from 52°C, 54° C, 56° C and
even at 58° C. The primer dimmers appeared at the lower ends of all degenerate primers.
69
Fig. 3.18: Amino Acid Sequence of Several Limonene Synthases AY055214, AF282875, L13459 are Limonene synthase from Agastache rugosa, Schizonepeta, tenuifolia, Mentha spicata and D49368 limonene cyclase from Perilla
frutescens respectively. Stars indicate highly conserved amino acid residues and arrows show forward and reverse primers.
70
These bands of interest were recovered at their specific sizes and were sequenced. The resulting nucleotide sequences were BLAST that showed variation in sequence producing significant alignments.
Fig. 3.19: Agarose gel analysis of PCR of T. minuta products using degenerate STS primers LSTI, LSTII, LSTIII, LSTIV and LSTV. M, 100-bp DNA ladder. The degenerate primer has annealing temperature of 56°C.
Fig. 3.20: Agarose gel analysis of PCR products of T. minuta using degenerate primers LSTI, LSTII, LSTIII, LSTIV, LSTV. M, 100-bp DNA ladder. The degenerate primer has annealing temperature of 54°C.
71
Part- II
CHEMICAL ANALYSIS
3.4. Biological Assays
Crude extracts of three different plant parts; A) seed flower, B) roots, C)
stem and leaves and their fraction extracts were analysed for biological assays. Crude
extract of part-A showed good results of biological assays. Therefore, fraction extracts of
part-A were further analysed for different biological assays.
3.4.1. Antimalarial Activity
The anti-malarial results of T. minuta are presented in Table 3.8. The n-hexane
fraction showed better anti-malarial activity at 2.78 µ g/ml than did ether fraction at
25µ g/ml which was inactive against Plasmodium falciparum 3D7 strain (Table 3.8). The
chloroquine diphosphate was used as standard drug with 0.025 µ g/ml. The ratio of n-
hexane fraction and chloroquine diphosphate showed that it was moderately active.
Biological activities are commonly applied to analyze the phytochemicals of medicinal
plants. Like most other developing countries of the world the practice of herbal treatment
is well established in Pakistan. Few studies have been made to investigate phytotoxic
and insecticidal activities but no report on anti-malarial activity of T. minuta extracts was
seen. In the present study malaricidal, phytotoxic and insecticidal activities of T. minuta
seeds extracts were evaluated.
In the previous study it was found that the direct burning and thermal expulsion of
plant as mosquito-repellent was the most common method of application for T. minuta
(54.8 and 56.0%) (Seyoum et al., 2002). The results of present study proved the
importance and usefulness of T. minuta extract in determination of anti-malarial activity
against Plasmodium falciparum 3D7 strain.
72
Table 3.8: Anti-malarial activity of Tagetes minuta oil in the n-Hexane and Ether soluble fraction
Test Samples lC50(µg/ml)
Test organism
Standard Drug lC50(µg/ml) n-Hexane fraction Ether fraction
Plasmodium
falciparum
3D7
Chloroquine
diphosphate
0.025
2.78
>25
3.4.2. Phytotoxicity
Phytotoxic effect of T. minuta oil on Lemna minor at different concentrations
(1000, 100, 10 µ g/ml) was significantly lower in n-hexane soluble and ether soluble
fractions (Table 3.9 and 3.10). Paraquat was used as standard drug and incubation
condition was 28± 1 º C. It was observed that n-hexane fraction extract showed high
activity as compared to ether soluble extract. The n-hexane fraction showed 11.11,
16.66, 22.22% growth inhibition at 10, 100, 1000 µ g/ml, respectively (Table 3.9). As
the concentration of sample fraction increased the inhibition effect also increased
proportionately. The ether fraction extract showed low inhibition activity 11.11% at
1000 µ g/ml (Table 3.10).
Table 3.9: Phytotoxic Bioassay of n-Hexane soluble fraction of T. minuta oil
No. of Fronds Name of plant
Conc. of
compound
(µg/mL) Sample Control
%Growth
Regulation
Conc. of
Std. Drug
(µg/mL)
1000 14 22.22
100 15 16.66
Lemna minor
10 16
18
11.11
0.015
Std. Drug Paraquat
73
Table 3.10: Phytotoxic Bioassay of Ether soluble fraction of T. minuta oil
No. of Fronds Name of plant
Conc. of
compound
(µg/mL) Sample Control
%Growth
Regulation
Conc. of
Std. Drug
(µg/mL)
1000 16 11.11
100 17 5.5
Lemna minor
10 18
18
0
0.015
Std. Drug Paraquat
It has been found that secondary metabolites including terpenes especially
monotrepenes like tagetones and ocimenones are abundant in essential oil of T. minuta.
These secondary metabolites of plant inhibit the germination of cohabitant species and
thus cause their delayed germination (Zygadlo et al., 1993; Simon et al., 2002; Lopez et
al., 2009). Further more, phytotoxicity of the plant inhibit or reduced the growth of
weeds rather then causing any negative effect on growth of crop (Batish et al., 2007).
3.4.3. Insecticidal Activity
The insecticidal activity of crude and fraction extracts of the T. minuta were also
tested against three species of common grain pests namely Tribolium castaneum (Red
flour beetle), Rhyzopertha dominica (Lasser grain borer), Callosobruchus analis (Pulse
beetle) (Table 3.11). In treated samples 70% mortality was considered as significant and
active effect of the extract. The n-hexane fraction proved highly active and caused 70-
80% growth inhibition of C. analis and R. dominica, respectively. While the same
hexane fraction presented nearly 20% inhibitions against T. castaneum proving virtually
ineffective.
Ether soluble fraction was significantly effective against R. dominica with 70%
mortility, and showed non-significant mortility of 40% against T. castaneum and was
inactive against C. analis.
74
Table 3.11: Insecticidal activity of T. minuta oil in the n-Hexane and Ether soluble fractions
Mortality (%)
Insect used n-Hexane
soluble
fraction
Ether
soluble
fraction
Control Coopex
Tribolium castaneum 20 40 0 100
Rhyzopertha dominica 70 70 0 100
Callosobruchus analis 80 0 0 100
Previous studies on T. minuta extract showed weak repellant effect against C.
maculatus (Boeke, 2004). Krishna et al., (2005) found that essential oil of T. minuta
was also toxic against beetle species like S. oryzae (Linnaeus) and C. maculatus
(Fabricius). The composition of essential oil varies with plant parts. A fine powder of
leaves of T. minuta were moderately toxic against A. obtectus and Z. subfasciatus as
compared to whole leaves for the management of stored beans (Paul et al., 2009).
3.4.4. Antibacterial Activity
The antibacterial activity of crude and fraction extracts (Ether, n-Hexane,
Chloroform, Ethyl acetate and butanol) of the T. minuta were tested against gram
positive (M. leteus, S. aureus, B. subtilis) and gram negative (P. piket, E. coli, S.
setubal) bacteria (Table 3.12). All the samples showed significant antibacterial activity
while these samples were inactive against E. coli and S. setubal. The crude fractions
were also highly significant against B. subtilis and S. aureus as gram positive bacteia
and as well also againt P. piket (gram negative). This study indicated that fraction
extracts and isolated flavonols of T. minuta have a broad spectrum of antibacterial
activity.
75
Table 3.12: Antibacterial activity of fraction extracts (Ether soluble, n-Hexane soluble, Chloroform soluble, Ethyl acetate soluble and Butanol soluble) and isolated compounds of T. minuta
Zone of Inhibition of sample (mm) Samples
M. luteus S. aureus B. subtilis P. piket
Crude extract -- 6 9 5
Ether fration -- -- -- --
Hexane fraction -- 5 -- 4
Chloroform fraction 4 3 8 2
Ethly acetate fraction 3 3 21 6
Butanol fraction -- 1 8 5
Control (DMSO) 0 0 0 0
Standard (Ampicillin) 14 16 8 8
-- shows no activity
The results of the present study provided convincing evidence that bioactive
extracts of wild T. minuta that grows as weed is potentially valuable plant containing
economically important compounds effective against human disease and insect pests.
These results showed that there is a need to evaluate this plant for further investigation of
bactericidal and insecticidal compounds. These results also justified the traditional use of
T. minuta as insecticide. The study paved the way for further exploration of the
compounds in the plant that still are mystery.
76
3.5. Isolation and Purification of Flavonoids (flavonols)
HPLC/DAD analysis of the chloroform, ethyl acetate and butanol fractions of T.
minuta were detected in the UV spectral region. The HPLC profiles revealed that the
butanol fractions contained relative high quantities of flavonols as compared to the ethyl
acetate fractions, while the chloroform fractions contained other compounds than
flavonoids, and these latter fractions were not used for further spectroscopic analysis.
The HPLC profiles of the butanol fractions (A: seed flower, B: root part) showed
seventeen flavonols, while the ethyl acetate fractions (A: seed flower, B: root part)
showed two flavonols as major compounds (Fig. 3.22). The absorbtion maxima in the
UV spectra of respective compounds obtained online during HPLC analysis in the 320–
360 nm region indicated flavonol 7-O-glycosides based on quercetagetin, 6-hydroxy
kaempferol quercetin and patuletin aglycones.
The flavonols were separated by preparative HPLC. The spectroscopic analysis
of 1, 2, 4-9, 15-19 by UV, high resolution LC/MS (Table 3.13a and 3.13b), and 1D and
2D NMR (Table 3.14 and 3.15) established that 2, 4, 5, 7, 9 and 15-17 (Fig. 3.21) have
not been reported before in T. minuta. This is the first complete identification of
compound 7, which has previously been tentatively identified in T. maxima (Parejo et
al., 2004). Compounds 3, 10-14 were not separated and analysed by spectroscopic
analysis because of having very low concnration. Compounds 1, 6, 8, 18 and 19 have
previously been reported to occur in T. minuta (Abdala and Seeligmann, 1995), however,
this is the first NMR characterization of 1, 6, 18 and 19 isolated from this plant.
77
Fig. 3.21: Structures of the flavonols identified in the examined T. minuta 1: 6OH Qc 7-glc, 4, 5: 6OH Kf 7-glc, 6, 8: 6MeO Qc 7-glc, 2: 6OH Qc 7Gao Glc, 7: 6OH Kf 7Gao Glc, 9: 6OH Qc 7Caf Glc, 15: 6OH Qc 7Cum Glc, 16: 6MeO Qc 7Caf Glc, 17: 6MeO Qc 7Caf Glc with a OH on aglycone. Qc = quercetin; Kf = kaempferol; Glc = glucoside; Gao = galloyl; Caf = caffeoyl; Cum = coumaroyl
78
Fig. 3.22: HPLC profiles showing the flavonols content of T. minuta extract (A) in butanol and (B) ethyl acetate. The HPLC chromatograms were recorded at 320 ± 20 nm.
3.5.1. NMR Elucidation of Flavonols
3.5.1.1. Structure Elucidation of Flavonols (1, 2, 9 and 18)
The 1D 1H NMR spectrum of 1 and 18 confirmed a 3H ABX system at 7.76 ppm
(1: dd 2.0 Hz, 8.0 Hz; H-6'), 7.72 ppm (18: dd 3.6 Hz, 7.2 Hz; H-6'), 7.86 ppm (1: d 2.0
79
Hz; H-2'), 7.82 ppm (18: d 3.6 Hz; H-2'), 6.98 ppm (1: d 8.4 Hz; H-5') and 6.97 ppm (18:
d 7.8 Hz; H-5'), and an unresolved singlet at 7.03 ppm (1: H-8) and 6.58 ppm (18: H-8).
In the HMBC spectrum of 1 the aromatic proton at 7.03 ppm showed correlations to the
aromatic carbons at 106.2 ppm (C-10), 130.3 ppm (C-6), 150.0 ppm (C-9), 152.5 ppm
(C-7), as well as to the carbonyl function at 177.1 ppm (C-4), revealing the aglycone to
be 6-hydroxyquercetin. The molecular mass at m/z 319.0435 of 1 and 319.0433 of 18 in
their ESI high-resolution MS spectra were in accordance with 6-hydroxyquercetin
(C15H10O8 + H+; calc: 319.0454).
1D 1H NMR spectrum of the sugar region of 1 presented the existence of one
sugar unit by the single anomeric proton signal at 5.14 ppm (J = 7.4 Hz). In the COSY
spectrum of this proton the observed crosspeak at 5.14/3.71 and the following crosspeaks
were in accordance with 7 sugar protons, which indicated that this sugar unit was a
hexosyl. The corresponding crosspeaks in the HSQC spectrum allowed the assignment
of H-2'', H-3'', H-4'', H-5'', H-6A'' and H-6B'', and the coupling constants and chemical
shifts values of 1 were in agreement with β-glucopyranosyl. Similarly in the HMBC
spectrum a cross peak at δ 5.14/152.5 (H-1''/C-7) varified the connection point of the
sugar unit to be in the 7-position of the aglycone. The molecular mass at m/z 481.0963 in
the ESI mass spectrum of 1 was in agreement with 6-hydroxyquercetin 7-O-β-
glucopyranoside (C21H20O13 + H+; calc: 418.0982).
The 1H NMR spectrum of compound 2 shared many resemblance with the
corresponding resonances of 1 (Table 3.7). The chemical shift values of H-6A'' (4.78
ppm), H-6B'' (4.55 ppm), H-5'' (3.94 ppm) and C-6'' (64.2 ppm) of the sugar, indicated
the presence of acylation at the 6''-hydroxyl. The two-proton singlet at 7.13 ppm of H-2'''
and H-6''' in the 1D 1H NMR spectrum of 2 was in accordance with a galloyl unit. The
crosspeaks at δ 4.78/168.3 (H-6A''/C=O galloyl) and δ 4.55/168.3 (H-6B''/C=O gallyol)
confirmed the linkage between the 7-glucosyl and the galloyl moiety to be at the 6''-
hydroxyl. Fig. 3.23 shows the UV spectra of the three compounds, 2 with UVmax at 365
nm, 9 with UVmax at 359 nm and 15 with UVmax at 339 nm respectively. The molecular
mass at m/z 633.1066 (C28H24O17 + H+; calc: 633.1092) of 2 was similar with 6-
80
hydroxyquercetin 7-O-β-(6''-galloylglucopyranoside) as obtained in the high-resolution
mass spectrum.
The 1H and 13C resonances of the aglycone and monosaccharide of 9 were
assigned by a combination of 1D 1H NMR, DQF-COSY, HSQC and HMBC experiments
(Tables 3.7 and 3.8) to be 6-hydroxyquercetin 7-O-β-glucopyranoside. The HMBC
spectra presented the crosspeak at δ 5.18/151.7 (H-1''/C-7) confirmed the aglycone and
sugar unit linkage to be at the 7-hydroxyl. The doublets at δ 6.83 (1.5 Hz; H-2'''), δ 6.62
(8.1Hz; H-5'''), δ 7.53 (15.8 Hz; H-α) and δ 6.27 (15.8 Hz; H-β), and the double doublet
at δ 6.66 (dd, 7.8Hz, 1.8Hz; H-6''') in the 1D 1H NMR spectrum of 9 where in accordance
with a caffeoyl unit. The HMBC spectra showed crosspeaks at δ 4.74/168.9 (H-6A''/C=O
caffeoyl) and δ 4.42/168.9 (H-6B''/C=O caffeoyl) confirmed that an acyl group was
linked to be at the 6''-hydroxyl, and the molecular mass at m/z 643.1272 (C30H26O16 + H+;
calc: 643.1299) of 9 was similar to 6-hydroxyquercetin 7-O-β-(6''-
caffeoylglucopyranoside) as obtainedin the high resolution MS spectra.
Fig. 3.23: UV spectra of 2, 9 and 15 recorded on-line during HPLC analysis
8
1
Ta
ble
3.1
3a
: R
elat
ive
amo
unts
an
d o
n-l
ine
HP
LC
an
d h
igh-r
eso
luti
on
ele
ctro
spra
y i
oniz
atio
n m
ass
spec
tral
dat
a re
cord
ed f
or
flav
ono
ids
(1,
2,
4-9
, 1
5-1
7)
iso
late
d f
rom
T.
min
uta
(B
uta
nol
frac
tio
n)
Co
mp
ou
nd
R
ela
tiv
e a
mo
un
ts
(%)
UV
ma
x
(nm
)
t R (
min
) [F
+H
]+ m
/z
ob
serv
ed
[F+
H]+
m/z
calc
ula
ted
[M+
H]+
m/z
ob
serv
ed
[M+
H]+
m/z
calc
ula
ted
Mo
lecu
lar
form
ula
1
68.0
7
359
1
4.9
0
319
.04
35
3
19
.04
54
4
81
.09
63
4
81
.09
82
C
21H
20O
13
+
2
30.1
8
365
1
6.2
7
319
.04
45
3
19
.04
54
6
33
.10
66
6
33
.10
92
C
28H
24O
17
+
4
6.6
5
369
1
9.1
8
303
.04
93
3
03
.05
05
4
65
.10
15
4
65
.10
33
C
21H
20O
12
+
5
24.0
6
345
1
9.9
8
303
.04
80
3
03
.05
05
4
65
.10
09
4
65
.10
33
C
21H
20O
12
+
6
33.8
0
369
2
0.4
9
333
.05
97
3
33
.06
10
4
95
.11
37
4
95
.11
39
C
22H
22O
13
+
7
19.3
4
349
2
1.3
8
303
.04
85
3
03
.05
05
6
17
.11
37
6
17
.11
43
C
28H
24O
16
+
8
40.0
7
343
2
2.6
5
333
.05
95
3
33
.06
10
4
95
.11
40
4
95
.11
39
C
22H
22O
13
+
9
29.3
6
359
2
3.1
0
319
.04
43
3
19
.04
54
6
43
.12
72
6
43
.12
99
C
30H
26O
16
+
15
14.5
0
339
2
7.6
9
319
.04
58
3
19
.04
54
6
27
.13
48
6
27
.13
50
C
30H
26O
15
+
16
37.4
2
337
2
8.3
2
333
.06
13
3
33
.06
10
6
57
.14
50
6
57
.14
56
C
31H
28O
16
+
17
10.1
9
320
2
9.4
0
673
. 13
87
673
.14
05
C
31H
28O
17
+
8
2
Ta
ble
3.1
3b
: R
elat
ive
amo
unts
an
d o
n-l
ine
HP
LC
and
hig
h-r
eso
luti
on
ele
ctro
spra
y i
on
izat
ion
mas
s sp
ectr
al d
ata
reco
rded
fo
r fl
avo
no
ids
(18
-19
) is
ola
ted f
rom
T.
min
uta
(E
thyl
acet
ate
frac
tio
n)
Co
mp
ou
nd
R
ela
tiv
e a
mo
un
ts
(%)
UV
ma
x
(nm
)
t R (
min
) [F
+H
]+ m
/z
ob
serv
ed
[F+
H]+
m/z
calc
ula
ted
[M+
H]+
m/z
ob
serv
ed
[M+
H]+
m/z
calc
ula
ted
Mo
lecu
lar
form
ula
18
89.5
4
359
2
5.7
8
319
.04
33
3
19
.04
09
C
15H
10O
8+
19
72.3
6
371
3
5.4
2
333
.06
11
3
33
.05
66
C
16H
12O
8+
8
3
Ta
ble
3.1
4:
1H
NM
R s
pec
tral
dat
a fo
r fl
avo
noid
s (1
, 2
, 5
-7,
9,
18,
19)
iso
late
d f
rom
T.
min
uta
rec
ord
ed i
n C
D3O
D a
t 2
5 °
C
1
2
5
6
7
9
1
8
19
Agly
con
e
6
3.9
8 s
(O
CH
3)*
3.9
7 s
(O
CH
3)
8
7.0
3 s
6
.97 s
B
7.0
3 s
6
.91 s
6
.96 s
6
.92 s
6
.58 s
6
.58
s
2'
7.8
6 d
2.0
7
.85 d
2.0
8
.21 d
8.8
7
.82 d
2.0
7
.9 d
8.8
7
.82 d
5.2
7
.82 d
3.6
7
.82
d 1
.9
3'
6.9
9 d
8.9
6.9
2 d
8.9
5'
6.9
8 d
8.4
6
.97 d
8.4
B
6.9
9 d
8.9
6
.90 d
8.6
6
.92 d
8.9
6
.92 d
5.0
6
.97 d
7.8
6
.97
d 8
.2
6'
7.7
6
dd
2.0
, 8
.0
7.7
5 d
d 2
.0,
8.5
8
.21 d
8.8
7
.52 d
d 2
.0,
8.5
7
.9 d
8.8
7
.70 d
d 3
.3,
7.5
7
.72 d
d 3
.6,
7.2
7
.72
dd 1
.9,
8.0
7
-O-β
-glu
cop
yran
osy
l
1''
5.1
4 d
7.4
5
.20 d
7.4
5
.14 d
7.5
5
.19 d
7.6
5.1
8 d
7.4
2
'' 3
.71 m
C
3.7
1 d
d 7
.7,
9.4
3
.68 m
B,C
3
.65 m
B,C
3.7
2 m
C
3''
3.6
5 m
C
3.6
7 m
B
3.6
1 m
B,C
3
.60 m
B,C
3.6
6 m
C
4''
3.5
3 m
3
.68 m
B,C
3
.509
t 9
.3B
3
.510
t 9
.3B
3.5
5 t
9.3
5''
3.6
6 m
B,C
3
.94 m
3
.66 m
B,C
3
.66 m
B,C
3.9
6 m
C
6(A
)''
4.0
3
dd
2.0
, 1
2.0
B
4.7
8 d
d 1
.9,
12.0
4
.04 d
d 2
.0,
12.0
B
4.0
4 d
d 2
.0,
12.0
B
4
.74 d
d 1
.9,
11.9
6(B
)''
3.9
dd 6
.2,
12.2
B
4.5
5 d
d 5
.0,
12.0
3
.81 d
d 6
.2,
12.2
B
3.8
1 d
d 6
.2,
12.2
B
4
.42 d
d 1
2.0
, 7
.2
6''-
O-a
cyl
6
''-O
- g
all
oyl
6
''-O
- g
all
oyl
6
''-O
-caff
eoyl
1
'''
2'''
7.1
3 s
B
7.1
5 s
6
.83 d
1.5
3
'''
4'''
5
'''
6
.62 t
8.1
6
'''
7
.13 s
B
7.1
5 s
6
.66 d
d 7
.8,
1.8
Α
7
.53 d
15
.8
Β
6
.27 d
15
.8
BO
ver
lapp
ed b
y o
ther
sig
nal
. CF
rom
CO
SY
. s
(sin
gle
t),
d (
do
uble
t), d
d (
do
ub
le d
oub
let)
and
m (
mult
iple
t)
84
Table 3.15: 13C NMR spectral data for flavonols (1, 2, 5-7, 9, 18, 19) isolated from T.
minuta recorded in CD3OD at 25 °C
$These values are ranked from lowest to highest shift-values from HSQC. Exact shift-values were then determined from CAPT.
1 2 5 6 7 9 18 19
Aglycone 2 146.3 147.0B 149.0 149.3B 148.8B 148.8 148.8 3 137.1 137.4 137.1 137.1 137.1 136.9 137 4 177.1 177.6 177.5 177.5 177.5 177.6 177.3 177.5 5 147.0 153.15 146.8 147.0 147.0 146.8 147.5 6 130.3 133.3 130.9 130.9 130.7 129.7 132.1 6 (OCH3) 61.5 61.0 7 152.5 157.6 152.7 152.7 151.7 154.6 158.2 8 95.4 95.4 95.4 95.1 94.9 94.0 94.7 9 150.0 152.9 150.4 150.4 146.5 151.1 153.7 10 106.2 106.67 106.67 106.74 106.8 104.8 105.0 1' 123.9 123.9 123.7 124.1 123.9 124.4 124.1 2' 116.2 116.18$ 130.9 116.4 133 116.2 116.0 116.0 3' 145.9 146.2 116.30$ 146.0 146.1 146.2 146.1 4' 148.5 148.8 160.7 149.0 149.3B 148.7 148.7 5' 116.1 116.23$ 116.30$ 116.25$ 122 116.2 116.2 116.2 6' 121.8 121.9 130.9 121.7 133 121.9 121.7 121.7 Glycosyl 1'' 102.8 102.0 102.6 102.4 102.1 2'' 74.4 74.6 74.7 74.8 74.5 3'' 78 77.2 77.5 77.9 77.4 4'' 71.1 71.3 71.3 71.3 72.0 5'' 77.9 75.8 78.5 78.5 75.7 6'' 62.7 64.2 62.50 62.55 64.6 6''-O-acyl 6''-O-
galloyl 6''-O-
galloyl 6''-O-
caffeoyl
1''' 121.3 127.2 2''' 110.1 110.1 115.6 3''' 146.4 146.4 4''' 139.8 149.2
5''' 146.4 116.4
6''' 110.1 110.1 122.2 Α 147.5
Β 114.4 C=O 168.3 168.9
85
3.5.1.2. Structure Elucidation of Flavonols (5 and 7)
The UV spectra of 5 and 7 showed UVmax at 345 nm and 349 nm, respectively.
The 1H NMR spectrum of 5 presented a singlet at 7.03 ppm (H-8) and a 4H ABXY
system of two doublets at 8.21 ppm (d, 8.8 Hz; H-2'' and H-6'') and 6.99 ppm (d 8.9
Hz; H-3'' and H-5'') in accordance with the flavonol, 6-hydroxykaempferol. The
signals recorded on the basis of 1D 1H NMR, 1H-1H COSY, 1H-13C HSQC 1H-1H
TOCSY and 1H-13C HMBC spectra, the chemical shifts values (1H and 13C) of 5 were
in agreement 6-hydroxykaempferol linked to one β-glucopyranose unit. The
crosspeak at 5.14/152.7 ppm (H-1''/C-7) in HMBC spectra were in agreement with
linkage between the aglycone and the sugar unit to be at the 7-hydroxyl. The
molecular mass at m/z 465.1009 in the ESI-MS spectrum of 5 was in accordance with
6-hydroxykaempferol 7-O-β-glucopyranoside (C21H20O12 + H+; calc: 465.1033).
The chemical shift values in 1D 1H NMR spectrum of 7 were similar to those of
5. It showed a singlet at 6.96 ppm (H-8) and a 4H ABXY system of two doublets at
7.9 ppm (d, 8.8 Hz; H-2'' and H-6'') and 6.92 ppm (d 8.9 Hz; H-3'' and H-5'') in
accordance with the flavonol, 6-hydroxykaempferol (Table 3.14). The ESI-MS spectra
showed the fragment ion due to cleavage of the glycosidic bond, which suggested the
presence of 6-hydroxykaempferol (m/z 303.0485). Some of the NMR signals are
missing or were very weak, but the singlet at 7.15 ppm of H-2''' and H-6''' in the 1D 1H
NMR spectrum of 7 was in accordance with a galloyl unit. The molecular mass at m/z
617.1137 in the high-resolution ESI-MS spectrum were in accordance with 6-
hydroxykaempferol 7-O-β-(6''-galloylglucopyranoside) (C28H24O16 + H+; calc:
617.1143).
3.5.1.3. Structure elucidation of Flavonols (6 and 19)
The 1D 1H NMR spectra of 6 and 19 revealed the presence of 6-
methoxyquercetin aglycone. Each of their 1H NMR spectra showed four aromatic
proton resonances, a singlet at 6.91 ppm (6: H-8), 6.58 ppm (19: H-8) 7.52 ppm (6: dd
2.0 Hz, 8.5 Hz; H-6'), 7.72 ppm (19: dd 1.9 Hz, 8.0 Hz; H-6'), 7.82 ppm (6: d 2.0 Hz;
H-2'), 7.82 ppm (19: d 1.9 Hz; H-2'), 6.90 ppm (6: d 8.6 Hz; H-5') and 6.97 ppm (19: d
86
8.2 Hz; H-5') along with a methoxy group at 3.98 ppm (6) and 3.97 ppm (19). The
molecular mass at m/z 333.0597 of 6 and 333.0611 of 19 in the ESI high-resolution MS
spectra were in accordance with 6-methoxyquercetin (C16H12O8 + H+; calc: 333.0610).
1H and 13C resonances of the monosaccharide of 6 were assigned by a combination of
1D 1H, DQF-COSY, TOCSY and experiments, in accordance with β-glucopyranosyl.
The molecular mass at m/z 495.1137 in the ESI-MS spectrum of 6 was in accordance
with 6-methoxy quercetin 7-O-β-glucopyranoside (C22H22O13 + H+; calc: 495.1139).
In the scientific literature, only a few papers dealing with compounds isolated
from Tagetes species have addressed full structure elucidation of individual flavonoids
including NMR assignments. Particularly in T. minuta no reference has been found
with respect to NMR investigations of flavonoids. In T. minuta Abdala and
Seeligmann (1995) and Tereschuk et al., (2004) have reported the occurrence of the
flavonols quercetagetin, patuletin, isorhamentin and quercetin as aglycones with
glycosides linkages without acylations. In this study we have also identified 6-
hydroxy- and 6-methoxyquercetin glycosides with acylation in T. minuta. 6-
hydroxykaempferol as found in 5 (6-hydroxykaempferol 7-O-β-glucopyranoside) and 7
(6-hydroxykaempferol 7-O-β-(6'' galloylglucopyranoside)) has previously not been
identified in T. minuta. The compounds 2 (6-hydroxyquercetin 7-O-β-(6''-
galloylglucopyranoside)) and 9 (6-hydroxyquercetin 7-O-β-(6''-
caffeoylglucopyranoside)) have previously in nature been identified only in extracts of
Tagetes maxima (Parejo et al., 2005), and this is the first complete identification of
compound 7, which has previously been tentatively identified in T. maxima (Parejo et
al., 2004).
87
3.6. Conclusions
• Modified Cetyltrimethylammonium Bromide (CTAB) extraction protocol was
found to be highly suitable for extracting high-molecular weight DNA from T.
minuta and other species including T. erecta, T. patula and their hybrids con-
taining large amounts of secondary metabolites and essential oils.
• PCR-based primers such as RAPD and STS may successfully be employed to
estimate genetic diversity in different Tagetes genotypes which may further be
used for the species assortment of parents for breeding and mapping purposes.
• Gene based specific primers were successfully developed as DNA markers
(STS) to distinguish genotypes for limonene synthase gene in Tagetes.
• Tagetes extracts showed promising results against pathogenic bacteria, malaria
and insect pests.
• Findings of the bioassays showed that Tagetes minuta contains valuable
compounds which can be effective against other human diseases and pests.
• Of the three solvents used Butanol may be used as an effective solvent for
extracting new flavonols in T. minuta.
• Seven (07) new flavonols were identified via spectroscopic analyses among
which the structure of 04 was elucidated where as 03 are yet to be characterized
which may turned to be the noval flavonols.
• The structure of additional 4 known flavonols was also elucidated via NMR
which was putatively reported earlier by LC/MS.
88
Future Prospects
• More molecular studies may be carried out to explore in-depth diversity and
structure of Tagetes genome including cytogenetics and chromosome mapping.
• The identified biochemical compounds (flavonols) and the gene responsible for
these can further be characterized with more specific DNA and biochemical
markers in medicinal plants other than Tagetes.
• Efficacy analyses of the identified compounds (flavonols) for therapeutic uses
may further be expanded.
• Identification and complete profiling of additional compounds useful in
pharmaceutics and agriculture may be targeted.
89
Chapter 4
References
90
Abbasi, A.M., Khan, M.A., Ahmad, M., Zafar, M., Jahan, S. and Sultana, S. (2010).
Ethnopharmacological application of medicinal plants to cure skin diseases and in
folk cosmetics among the tribal communities of North-West Frontier Province,
Pakistan. J. Ethnopharmacol. 128, 322-335.
Abdala, L.R.A. and Seeligmann, P. (1983). Distribution of flavonoids from leaves of
three species of Tagetes Compositae and their chemosystematics significance (In
Spanish). Lilloa. 36, 5-14.
Abdala, L.R. and Seeligmann, P. (1995). Natural distribution of flavonoids in Tagetes
minuta. Biochem. Syst. Ecol. 23, 567-568.
Adams, R.P. (1995). Identification of Essential Oil Components by Gas
Chromatography /Mass Spectroscopy. Allured Publishing Corporation, Carlo
Stream, IL. USA.
Adhikari, T.B., Mew, T.W. and Leach, J.E. (1999). Genotypic and pathotypic
diversity in Xanthomonas oryzae pv. oryzae in Nepal. Phytopathology. 89, 687-
694.
Agarwal, M., Shrivastava, N. and Padh, H. (2008). Advances in molecular marker
techniques and their application in plant sciences. Plant Cell Rep. 27, 617-631.
Aljanabi, S.M., Forget, L. and Dookun, A. (1999). An improved and rapid protocol
for the isolation of polysaccharide- and polyphenol-free sugarcane DNA. Plant
Mol. Biol. Rep. 17, 1-8.
Andersen, O.M., Helland, D.E. and Andersen, K.J. (1997). Anthocyanidin and
anthocyanidin derivatives, and their isolation, for the treatment of cancer,
diseases caused by lesions in connective tissues, and diseases caused by virus.
PCT Int. Appl. 121.
Andersen, O.M. and Fossen, T. (2003). Characterization of anthocynins by NMR,
Unit F.1.4. In: “Current Protocols in Analytical Chemistry”. R Wrolstad, eds.
John Wiley. NY., pp 1-24.
Andersen, O.M. and Francis, G.W. (2004). Techniques of Pigment Identification. In:
“Plant Pigments and their manipulation”. K. Davies, eds. Blackwell publishing.
London., pp 293-341.
91
Andersen, O.M. and Markham, K.R. (2006). Flavonoids: Chemistry, Biochemistry
and Applications. CRC Press. Boca Raton.
Arisawa, M., Bai, H., Shiojima, M., Hayashi, T., Tezuka, Y., Taga, T., Miwa, Y., Ito,
Y., Kikuchi, T. and Morita, N. (1993). Novel flavonoids from Chrysosplenium
grayanum Maxim. (Saxifragaceae). Chem. Pharm. Bull. 41, 571.
Atta-ur-Rehman (1991). Studies on natural products chemistry; Netherland, Elsevier
Science Publishers, B.V. 383-409.
Awodele, O., Agbaje, E.O., Abiola, O.O., Awodele, D.F. and Dolapo, D.C. (2012).
Doctors’ attitudes towards the use of herbal medicine in Lagos, Nigeria. J. Herb.
Med. 2, 16-22.
Bansal, R.P., Bahl, J.R., Garg, S.N., Naqvi, A.A., Sharma, S., Ram, M. and Kumar, S.
(1999). Variation in quality of essential oil distilled from vegetative and
reproductive stages of Tagetes minuta crop grown in North Indian plains. J.
Essent. Oil Res. 11, 747-752.
Baranac, J.M., Petranovic, N.A. and Dimitric-Markovic, J.M. (1997).
Spectrophotometric study of anthocyan copigmentation reactions 2. Malvin and
the nonglycosidized flavone quercetin. J. Agric. Food Chem. 45, 1694-1697.
Barkley, T.M., Brouillet, L. and Strother, J.L. (2006). Flora of North America,
Asteraceae, part 1. Oxford University Press, New Yark.
Batish, D.R., Aroraa, K., Singh, H.P. and Kohli, K.R. (2007). Potential utilization of
dried powder of Tagetes minuta as a natural herbicide for managing rice weeds.
Crop Prot. 26, 566-571.
Bertomeu, J.M., Ros, R., Arrillaga, I. and Segura, J. (2008). Expression of spermint
limonene synthase in transgenic spike lavender results in an monoterpene
composition in developing leaves. Metab. Eng. 10, 166-177.
Besse, P., Silva, D.D., Bory, S., Grisoni, M., Bellec, F.L. and Duval, M.F. (2004).
RAPD genetic diversity in cultivated vanilla: Vanilla planifolia, and relationships
with V. tahitensis and V. pompona. Plant Sci. 167, 379-385.
Boeke, S.J. (2004). Efficacy of plant extract against the cowpea beetle,
Callosobruchus maculatus. Int. J. Pest Manage. 50, 251-258.
92
Boots, A.W., Wilms, L.C., Swennen, E.L.R., Kleinjans, J.C.S., Bast, A. and Haenen,
G.R.M.M. (2008). In vitro and ex vivo anti-inflammatory activity of quercetin in
healthy volunteers. Nutrition. 24, 703-710.
Boulton, R. (2001). The copigmentation of anthocyanins and its role in the colour of
red wine: a critical review. Am. J. Enol. Viticult. 52, 67-87.
Caetano-Anolles, G. (1996). Scanning of nucleic acids by in vitro amplification: new
developments and applications. Nat. Biotechnol. 14, 1668-1674.
Carron, R.A., Maran, J. M., Montero, L., Fernand ozalgo, A. and Dominguez A.
(1987). Plantes Medicinales et. Phytotherapic. 21, 195-202.
Cecchini, C., Silvi, S., Orpianesi, C. and Cresci, A. (2005). Red wine polyphenols
influence carcinogenesis, intestinal microflora, oxidative damage and gene
expressive profiles of colonic mucosa in F344 rats. Mutat. Res. 591. 237-264.
Chalchat, L.C., Garry, R.P. and Muhayimana, A. (1995). Essential oil of Tagetes
minuta from Rwanda and France: chemical composition according to harvesting
location, growth stage and part of plant extracted. J. Essent. Oil Res. 7, 375-
386.
Chan, K.L., Choo, C.Y., Abdullah, N.R. and Ismail, Z. (2004). Antiplasmodial
studies of Eurycoma longifolia Jack using the lactate dehydrogenase assay of
Plasmodium falciparum. J. Ethnopharmacol. 92, 223-227.
Crowell, P.L. (1999). Prevention and therapy of cancer by dietary monoterpenes. J.
Nutr. 129, 775S-778S.
Culp, R.A., Legato, J.M. and Ortero, E. (1977). In Flavour Analysis: Developments
in Isolation and Characterisation, C.J. Mussinan, M.J. Morello (Eds.) American
Chemical Society, Washington D.C., pp 260-267.
D’Agostino, M., De Simone, F., Piacente, S., Pizza, C. and Senatore, F. (1997).
Quercetagetin 6-O-β- D- glucopyranoside from Tagetes mandonii.
Phytochemistry. 45, 201.
Darokar, M.P., Khan, M. S., Shasany, A.K., Krishna, A. and Khanuja, S.P.S. (2000).
Molecular diversity analysis in the germplasm collection of Tagetes species. J.
Med. Aromat. Plant Sci. 22, 536-539.
93
Dehestani, A. and Tabar, S.K.K. (2007). A rapid efficient method for DNA isolation
from plants with high levels of secondary metabolites. Asian J. Plant sci. 6,
977-981.
Dellaporta, S.L., Wood, J. and Hicks, J.B. (1983). A plant DNA minipreparation:
Version II. Plant Mol. Biol. Rep. 1, 19-21.
Deshmukh, V.P., Thakare, P.V., Chaudhari, U.S. and Gawande, P.A. (2007). A
simple method for isolation of genomic DNA from fresh and dry leaves of
Terminalia arjuna (Roxb.) Wight and Argot. Electron. J. Biotechnol. 10, 468-
472.
Doyle, J.J. and Doyle, J.L. (1990). Isolation of plant DNA from fresh tissue. Focus.
12: 13-15.
Elson, C.E. and Qureshi, A.A. (1995). Coupling the cholesterol- and tumor-
suppressive actions of palm oil to the impact of its minor constituents on 3-
hydroxy-3-methylglutaryl coenzyme A reductase activity. PLEFA. 52, 205-207.
Etherton, K.P.M., Binkoski, A.E., Zhao, G., Coval, S.M., Clemmer, K.F., Hecker,
K.D., Jacques, H. and Etherton, T.D. (2002). Bioactive compounds in foods:
their role in the prevention of cardiovascular disease and cancer. Am. J. Med.
113, 71-88.
Evans, W.C. (2002). Pharmacognocy. In: “Plant Nomenclature and Taxonomy”.
Horocourt Publishers Limited.
Fevzi, B. (2001). Random Amplified Polymorphic DNA (RAPD) Markers. Turk J.
Biol. 25, 185-196.
Flint, S.D., Jordan, P.W. and Caldwell, M.M. (1985). Plant protective response to
enhanced UV-B radiation under field conditions: leaf optical properties and
photosynthesis. Photochem. Photobiol. 41, 95-99.
Forkmann, G. (1991). Flavonoids as flower pigments: the formation of natural
spectrum and its extension by genetic engineering. Plant Breeding. 106, 1-26.
Fuchino, H., Nakamura, H., Wada, H., Hakamatsuka, T. and Tanaka, N. (1997). 5-O-
Glucosylated kaempferols from the fern Drypteris dickinsii. Nat. Med. (Tokyo).
51, 537-538.
94
Ghafoor, A. (2002). Flora of Pakistan, Asteraceae (I). Missouri Botanical Garden
Press, U.S.A.
Giberti, G.C. (1983). Herbal folk medicine in northwestern Argentina: Compositae.
J. Ethnopharmacol. 7, 321-341.
Gil, A., Ghersa, C.M. and Leicach, S. (2000). Essential oil yield and composition of
Tagetes minuta accessions from Argentina. Biochem. Syst. Ecol. 28, 261-274.
Gould, M.N. (1995). Prevention and therapy of mammary cancer by monoterpenes.
J. Cell Biochem. Suppl. 22, 139-144.
Grass, S., Zidorn, C., Blattner, F.R. and Stuppner, H. (2006). Comparative molecular
and phytochemical investigation of Leontodon autumnalis (Asteraceae,
Lactuceae) populations from Central Europe. Phytochem. 67, 122-131.
Grayer, R.J. and Veitch, N.C. (2006). Flavanones and Dihydroflavonols. In
“Flavonoid: Chemistry Biochemistry and Applications”. O.M. Andersen and
K.R. Markham, eds. CRC Press. CRC press. Boca Raton, pp 917- 1002.
Halbwirth, H., Forkmann, G. and Stich, K. (2004). The A-ring specific
hydroxylation of flavonols in position 6 in Tagetes sp. is catalyzed by a
cytochrome P450 dependent monooxygenase. Plant Science. 167, 129-135.
Hills, P.N. and Van Staden, J. (2002). An improved DNA extraction procedure for
plant tissues with a high phenolic content. S. Afr. J. Bot. 68, 549-550.
Hethelyi, E., Danos, B., Tetenyi, P. and Koczka, I. (1986). GC/MS analysis of the
essential oils of some Tagetes species, In: Progress in Essential Oil Research.
Edit., E.S. Brunke, Walter de Gruyter & Co., Berlin; 131-137.
Hethelyi, E., Danos, B., Tetenyi, P. and Juhasz, G. (1987). Phytochemical studies on
Tagetes species; infraspecific differences of the essential oil in T. minuta and T.
Tenuifolia. Herba. Hung. 26, 145-158.
Henken, H. (1992). Chemical and physiological behavior of feed carotenoids and
their effect on pigmentation. Poultry Sci. 71, 711-717.
Hertog, M.G.L., Feskens, E.J.M., Hollman, P.C.H., Katan, M.B. and Kromhout, M.G.
(1993). Dietary antioxidant flavonoids and risk of coronary heart disease: the
Zutphen Elderly Study. Lancet. 342, 1007-1011.
95
Ickes, J.R., Fong, H.H.S., Schiff, P.l., Perdue, R.E. and Farnworth, N.R. (1973).
Antitumer activity and preliminary phytochemical examination of T. minuta
(Compositae). J. Pharm. Pharm. Sci. 62, 1009- 1011.
Jordheim, M., Fossen, T. and Andersen O.M. (2006). Characterization of hemiacetal
forms of anthocyanidin-3-O-β-glycopyranosides. J. Agric. Food Chem. 54,
9340-9346.
Jun, H., Yan, Z., Wei, Q. and Chaozu, H. (2007). Avirulence gene and insertion
element-based RFLP as well as RAPD markers reveal high levels of genomic
polymorphism in the rice pathogen Xanthomonas oryzae pv. oryzae. Syst. Appl.
Microbiol. 30, 587-600.
Kamei, H., Kojima, T., Hasegawa, M., Koide, T., Umeda, T., Yukawa, T. and Terabe,
K. (1995). Suppression of tumor cell growth by anthocyanins in vitro. Cancer
Invest. 13, 590-594.
Katterman, F.R. and Shattuck, V.I. (1983). An effective method of DNA isolation
from the mature leaves of Gossypium species that contain large amounts of
phenolic terpenoids and tannins. Prep. Biochem. 13, 347-359.
Kaul, P.N., Bhattacharya, A.K., Rao, B.R.R., Syamasundar, K.V. and Ramesh, S.
(2005). Essential oil composition of Tagetes minuta L. fruits. J. Essent. Oil
Res. 17, 184-185.
Kim, S.H. and Hamada, T. (2005). Rapid and reliable method of extracting DNA and
RNA from sweetpotato, Ipomoea batatas (L). Lam. Biotechnol. Lett. 27, 1841-
1845.
Knekt, P., Kumpulainen, J., Jarvinen, R., Rissanen, H., Heliovaara, M., Reunanen, A.,
Hakulinen, T. and Aromaa, A. (2002). Flavonoid intake and risk of chronic
diseases. Am. J. Clin. Nutr. 76, 560-568.
Krishna, A., Prajapati, V., Bhasney, S. and Tripathi, A.K. (2005). Potential toxicity
of new genotypes of Tagetes (Asteraceae) species against stored grain insect
pests. Int. J. Trop. Insect Sci. 25, 122-128.
Koes, R.E., Quattrocchio, F. and Mol, J.M.N. (1994). The flavonoid biosynthetic
pathway in plants: function and evaluation. Bio. Essay. 16, 123.
96
Kviecinski, M.R., Felipe, K.B., Schoenfelder, T., Wiese, L.P.L., Rossi, M.H.,
Goncalez, E., Felicio, J.D., Filho, D.W. and Pedrosa, R.C. (2008). Study of the
antitumor potential of Bidens pilosa (Asteraceae) used in Brazilian folk medicine.
J. Ethnophrmacol. 117, 69-75.
Lang, M. and Orqoqozo, V. (2011). Identification of homologous gene sequences by
PCR with degenerate primers. Methods Mol. Biol. 772, 245-256.
Lawrence, B.M. (1985). A review of the world production of essential oils - 1984.
Perfum. Flavorist. 10, 1-16.
Leach, J.E., Rhoads, M.L., White, F.F., Mew, T.W. and Leung, H. (1992).
Assessment of genetic diversity and population structure of Xanthomonas oryzae
pv. oryzae with a repetitive DNA element. Appl. Environ. Microbiol. 58,
2188-2195.
Linda, S.M.O, Wang, H., Zhendan, H. and Vincent, E.C.O. (2006). Antiviral
activities of purified compounds from Youngia japonica (Asteraceae,
Compositae). J. Ethnopharmacol. 106, 187-191.
Liu, L.W., Zhao, L.P., Gong, Y.Q., Wang, M.X., Chen, L.M., Yang J.L., Wang, Y.,
Yu, F.M. and Wang, L.Z. (2008). DNA fingerprinting and genetic diversity
analysis of late-bolting radish cultivars with RAPD, ISSR and SRAP markers.
Sci. Hort. 116, 240-247.
Lombard, V., Baril, C.P., Dubreuil, P., Blouet, F. and Zhang, D. (2000). Genetic
relationships and fingerprinting of rapeseed cultivars by AFLP: consequences for
varietal registration. Crop Sci. 40, 1417-1425.
Loockerman, D.J., Turner, B.L. and Jansen, R.K. (2003). Phylogenetic relationships
within the Tageteae (Asteraceae) based on nuclear ribosomal ITS and chloroplast
ndhF gene sequences. Syst. Bot. 28, 191-207.
Lopez, L.M., Bonzani, E.N. and Zygadlo, J.A. (2009). Allelopathic potential of
Tagetes minuta terpenes by a chemical, anatomical and phytotoxic approach.
Biochem. Syst. Ecol. 36, 882-890.
Lopez-Sanchez, C., Martin-Romero, F.J., Sun, F., Luis, L., Samhan-Arias, A.K.,
Garcia-Martinez, V. and Gutierrez-Merino, C. (2007). Blood micromolar
97
concentrations of kaempferol afford protection against ischemia/reperfusion-
induced damage in rat brain. Brain Res. 1182, 123-213.
Makler, M.T., Ries, J.M., Williams, J.A. and Bancroft, J.E. (1993). Parasite lactate
dehydrogenase as an assay for Plasmodium falciparum drug sensitivity. Am. J.
Trop. Med. Hyg. 48, 739-741.
Malan, E. (1993). A flavonol with a tetrasubstituted B-ring from Distemonsnthus
benthamianus. Phytochemistry. 32, 1631.
Mangena, T. and Muyima, N.Y. (1999). Comparative evaluation of the antimicrobial
activities of essential oils of Artemisia afra, Pteronia incana and Rosmarinus
officinalis on selected bacteria and yeast strains. Lett. Appl. Microbiol. 28, 291-
296.
Marston, A. and Hostettmann, K. (2006). Separation and Quantification of
Flavonoids. In “Flavonoid: Chemistry Biochemistry and Applications”. O.M.
Andersen and K.R. Markham, eds. CRC Press. CRC press. Boca Raton, pp 1-
36.
Martinez, M., Munoz-Zamora, A. and Joseph-Nathan, P. (1988). Conformational
analysis of achillin and leukodin. J. Nat. Prod. 51, 221-228.
Maruyama, T., Ito, M., Kiuchi, F. and Honda, G. (2001). Molecular cloning,
functional expression and characterization of d-Limonene synthase from
Schizonepeta tenuifolia. Biol. Pharm. Bull. 24, 373-377.
Maruyama, T., Saeki, D., Ito, M. and Honda, G. (2002). Molecular cloning,
functional expression and characterization of d-Limonene synthase from
Agastache rugosa. Biol. Pharm. Bull. 25, 661-665.
Merken, H.M. and Beecher, G.R. (2000). Measurement of food flavonoids by high-
performance liquid chromatography: a review. J. Agric. Food Chem. 48, 577.
Mertens-Talcott, S.U. and Percival, S.S. (2005). Ellagic acid and quercetin interact
synergistically with resveratrol in the induction of apoptosis and cause transient
cell cycle arrest in human leukemia cells. Cancer Lett. 218, 141-151.
Metais, I., Aubry, C., Hamon, B., Jalouzot, R. and Peltier, D. (2000). Description and
analysis of genetic diversity between commercial bean lines (Phaseolus vulgaris
L.). Theor. Appl. Genet. 101, 1207-1214.
98
Murray, M.G. and Thompson, W.F. (1980). Rapid isolation of high molecular weight
plant DNA. Nucleic Acids Res. 8, 4321-4325.
Naqvi S.B.S, Sheikh, D. and Sheikh, M.R. (1987). Screening of Pakistan plants for
antibacterial activity. J. Sci. Ind, Res. 30, 24-28.
Nei, M. and Li, W.H. (1997). Mathematical model for studying genetic variation in
terms of restriction endonucleases. Proc. Natl. Acad. Sci. USA. 76, 5269-
5273.
Panero, J.L. and Funk, V.A. (2002). Toward a phylogenetic subfamilial classification
for the Compositae (Asteraceae). Proc. Biol. Soc. Wash. 115, 909-922.
Panero, J.L. and Funk, V.A. (2008). The value of sampling anomalous taxa in
phylogenetic studies: major clades of the Asteraceae revealed. Mol. Phylogene
Evol. 47, 757-782.
Parejo, I., Jauregui, O., Viladomat, F., Bastida, J. and Codina, C. (2004).
Characterization of acylated flavonoids-O-glycosides and methoxylated
flavonoids from Tagetes maxima by liquid chromatography coupled to
electrospray ionization tandem mass spectroscopy. J. Mass Spectrom. 18, 2801-
2810.
Parejo, I., Bastida, J., Viladomat, F. and Codina, C. (2005). Acylated quercetagetin
glycosides with antioxidant activity from Tagetes maxima. Phytochemistry. 66,
2356-2362.
Paul, U.V., Lossini, J.S., Edwards, P.J. and Hilbeck, A. (2009). Effectiveness of
products from four locally grown plants for the management of Acanthoscelides
obtectus (Say) and Zabrotes subfasciatus (Boheman) (both Coleoptera:
Bruchidae) in stored beans under laboratory and farm conditions in Northern
Tanzania. J. Sorted Prod. Res. 45, 97-107.
Powell, W., Morgante, M., Andre, C. and Hanafey, M. (1996). The comparison of
RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis.
Mol. Breed. 2, 225-238.
Przyborowski, J.A. and Sulima, P. (2010). The analysis of genetic diversity of Salix
viminalis genotypes as a potential source of biomass by RAPD markers. Ind.
Crops Prod. 31,395-400.
99
Qaiser, M. and Abid, R. (2002). Contribution to Asteraceae from Pakistan and
adjoining areas- some new taxa, combination and new records. Pak. J. Bot. 34,
367-373.
Rogers, S.O. and Bendich, A.J. (1985). Extraction of DNA from milligram amounts
of fresh, herbarium and mummified plant tissues. Plant Mol. Biol. 5, 69-76.
Romagnoli, C., Bruni, R., Andreotti, E., Rai, M.k., Vicentini, C.B. and Mares, D.
(2005). Chemical characterization and antifungal activity of essential oil capitula
from wild Indian Tagetes patula L. Protoplasma. 225, 57-65.
Pytela, R., Suzuki, S., Breuss, J., Erle, D.J. and Sheppard, D. (1994). Polymerase
chain reaction cloning with degenerate primers: homology-based identification of
adhesion molecules. Methods Enzymol. 245, 420-451.
Rozen, S. and Skaletsky, H.J. (2000). Bioinformatics Methods and Protocols:
Methods in Molecular Biology, S. Krawetz and S. Misener, eds. Humana Press,
Totowa, NJ, pp 365-386.
Ruiz, E., Padilla, E., Redondo, S., Gordillo-Moscoso, A. and Tejerina, T. (2006).
Kaempferol inhibits apoptosis in vascular smooth muscle induced by a
component of oxidized LDL. Eur. J. Pharmacol. 529, 79-83.
Saghai-Maroof, M.A., Soliman, K.M., Jorgensen, R.A. and Allard, R.W. (1984).
Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance,
chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. USA.
81, 8014-8018.
Santos, H., Turner, D.L., Lima, L.C., Figueiredo, P., Pina, F.S. and Macanita, A.L.
(1993). Elucidation of the multiple equilibria of malvin in aqueous solution by
one- and two-dimentional NMR. Phytochemistry. 33, 1227-1232.
Sarwat, M., Negi, M.S., Lakshmikumaran, M., Tyagi, A.K., Das, S. and Srivastava,
P.S. (2006). A standardized protocol for genomic DNA isolation from
Terminalia arjuna for genetic diversity analysis. Electron. J. Biotechnol. 9, 86-
91.
Schneerman, M.C., Mwangi, J., Hobart, B., Arbuckle, J., Vaske, D.A., Register, J.C.
and Weber, D.F. (2002). The dried corncob as a source of DNA for PCR
analysis. Plant Mol. Biol. Rep. 20, 59-65.
100
Selvi, A., Nair, N.V., Balasundaram, N. and Mohapatra, T. (2003). Evaluation of
maize microsatellite markers for genetic diversity analysis and fingerprinting in
sugar cane. Genome. 46, 394-403.
Seyoum, A., Palsson, K., Kung’a, S., Kabiru, E.W., Lwande, W., Killeen, G.F.,
Hassanali, A. and Knols, B.G.J. (2002). Traditional use of mosquito-repellent
plants in western Kenya and their evaluation in semi-field experimental huts
against Anopheles gambiae: ethnobotanical studies and application by
thermal expulsion and direct burning. T. Roy. Soc. Trop. Med. H. 96, 225-
231.
Shah, M.M., Yen, Y., Gill, K.S. and Baenziger, P.S. (2000). Comparisons of RFLP
and PCR-based markers to detect polymorphism between wheat cultivars.
Euphytica. 114, 135-142.
Sharaf, M., Abu-Gabal, N.S. and EI-Ausari, M.A. (2000). Exudate flavonoids from
Ficus altissima. Biochem. Syst. Ecol. 28, 291.
Shirley, BW. (1996). Flavonoids biosynthesis: “new” functions for an “old” pathway.
Trends plant Sci. 1, 377.
Simmonds, M.S.J. (2003). Flavonoids-insect interactions: Recent advances in our
knowledge. Phytochemistry. 64, 21-23.
Simon, P.M., Katinas, L. and Arambarri, A.M. (2002). Secretory structures in
Tagetes minuta (Asteraceae, Heleniae). Bol. Soc. Argent. Bot. 37, 181-191.
Singh, B., Sood, R.P. and Singh, V. (1992). Chemical composition of Tagetes minuta
L. oil from Himalachal Pradesh (India). J. Essent. Oil Res. 4, 525-526.
Singh, H.P., Batish, D.R. and Kohli, R.K. (2003). Allelopathic interactions and
allelochemicals : New possibalities for sustainable weed management. Crit. Rev.
Plant Sci. 22, 239-311.
Singh, N., Lal, R.K. and Shasany, A.K. (2009). Phenotypic and RAPD diversity
among 80 germplasm accession of medicinal plant isabgol (Plantago ovata,
Plantaginaceae). Genet. Mol. Res. 8, 1273-1284.
Slatko, B.E. (1996). Thermal cycle dideoxy DNA sequencing. Mol. Biotechnol. 6,
311-322.
101
Smith, J.G. and Markham, R.K. (1998). Tautomerism of flavonol glucosides
relevance to plant UV protection and flower colour. J. Photoch and Photobio.
A. 118, 99-105.
Soule, J.A. (1993a). Tagetes minuta: Potential New Herbs from South America. In:
New Crops J. Janick and J,E. Simon, eds. Wiley, New York., pp 649-654.
Soule, J.A. (1993b). Medicinal and beverage uses of Tagetes (Tageteae: Compositae).
Am. J. Bot. 80, 177.
Sreekumar, V.B. and Renuka, C. (2006). Assessment of genetic diversity in Calamus
thwaitesii BECC. (Arecaceae) using RAPD markers. Biochem. Syst. Ecol. 34,
397-405.
Strack, D., Heilemann, J., Wray, V. and Dirks, H. (1989). Structures and
accumulation patterns of soluble and insoluble phenolics from Norway spruce
needles. Phytochemistry. 28, 2071.
Strack, D. and Wray, V. (1989). Methods in Plant Biotechnology. In: “Plant
Phenolics”. J.B. Harborneb, eds. Academic Press., pp 325-356.
Strack, D. and Wray, V. (1994). The Anthocynins. In: “The Flavonoids: Advances in
Research since 1986”. Harborneb, eds. Chapman and Hall. London., chap 1.
Suman, P.S.K., Ajit, K.S., Darokar, M.P. and Kumar, S. (1999). Rapid isolation of
DNA from dry and fresh samples of plants producing large amounts of secondary
metabolites and essential oils. Plant Mol. Biol. Rep. 17, 1-7.
Sun, G.L., William, M., Liu, J., Kasha, K.J. and Pauls, K.P. (2001). Microsatellite
and RAPD polymorphisms in Ontario corn hybrids are related to the commercial
sources and maturity ratings. Mol. Breed. 7, 13-24.
Tereschuk, M.L., Riera, M.V., Castro, G.R. and Abdala, L.R. (1997). Antimicrobial
activity of flavonoids from leaves of Tagetes minuta. J. Ethnopharm. 56, 227-
232.
Tereschuk, M.L., Baigori, M.D., Figueroa, L.I.C. and Abdala L.R. (2004).
Flavonoids From Argentine Tagetes (Asteraceae) With Antimicrobial Activity.
Methods Mol. Biol. 268, 317-330.
Thomas, H.E. (1982). The New York Botanical Garden illustrated encyclopedia of
horticulture. Taylor and Francis. 3290. ISBN 9780824072407.
102
Tinker, N.A., Fortin, M.G. and Mather, D.E. (1993). Random amplified polymorphic
DNA and pedigree relationships in spring barley. Theor. Appl. Genet. 85, 976-
984.
Tomova, B.S., Waterhouse, J.S. and Doberski, J. (2005). The effect of fractionated
Tagetes oil volatiles on aphid reproduction. Entomol. Exp. Appl. 115, 153-159.
Upadhyaya, K., Chanotiya, C.S., Padalia, R., Bhatt, Z.A. and Bahuguna, Y.M. (2010).
Comparative phytochemistry and pharmacological evaluation of Tagetes minuta.
J. Pharm. Res. 3, 1434-1437.
Vargas, D.F. and Lopez, P.O. (1996). Correlation of HPLC and AOAC methods to
assess the all-trans-lutein content in marigold flowers. J. Sci. Food Agric. 72,
283-290.
Vargas, D.F., Jimenez, A.R. and Lopez, P.O. (2000). Natural pigments: carotenoids,
anthocyanins and betalains. Characteristics, biosynthesis, processing and stability.
Crit. Rev. Food Sci. Nutr. 40, 173-289.
Vasudevan, P., Kashyp, S. and Sharma, S. (1997). Tagetes: A multipurpose plant.
Bioresource Technolo. 62, 29-35.
Veitch, N.C. and Grayer, R.J. (2006). Chalcones, Dihydrochalcones, and Aurones. In
“Flavonoid: Chemistry Biochemistry and Applications”. O.M. Andersen and
K.R. Markham, eds. CRC Press. CRC press. Boca Raton, pp 1003-1100.
Vetschera, V.K.M. and Wollenweber, E. (2006). Flavones and Flavonols. In
“Flavonoid: Chemistry Biochemistry and Applications”. O.M. Andersen and
K.R. Markham, eds. CRC Press. Boca Raton, pp 617- 748.
Virk, P.S., Ford, B.V., Jackon, M.T. and Newbury, H.J. (1995). Use of RAPD for the
study of diversity within plant germplasm collections. Heredity. 74, 170-179.
Warude, D., Chavan, P., Joshi, K. and Patwardhan, B. (2003). DNA isolation from
fresh, dry plant samples with highly acidic tissue extracts. Plant Mol. Biol. Rep.
21, 467.
White, S. and Doebley, J. (1998). Study of genes, genomes and the origin of maize.
Trends Genet. 14, 327-332.
Wiese, B., Quiroga, O.E., Vigo, M.S. and Nolasco, S.M. (1992). Seeds of Tagetes
minuta L. chemical composition of seed oil and residual seed meal. [Semilla de
103
Tagete minuta L. composicion quimica del aceite seminal y de la harina residual
de extraccion]. An. Asoc. Quim. Argent. 80, 487-491.
Williams, C.A. (2006). Flavones and Flavonols O-Glycosides. In “Flavonoid:
Chemistry Biochemistry and Applications”. O.M. Andersen and K.R.
Markham, eds. CRC Press. CRC press. Boca Raton, pp 749- 856.
Williams, J.G.K., Kubelic, A.R., Livak, K.J., Rafalski, J.A. and Tingey, S.V. (1990).
DNA polymorphisms amplified by arbitrary primers are useful as genetic
markers. Nucl. Acid Res. 18, 6531-6653.
Zygadlo, J.A., Lamarque, A.L., Maestri, D.M. and Guzman, C.A. (1993).
Composition of the inflorescences oils of some Tagetes species from Argentina.
J. Essent. Oil. Res. 5, 679-681.
104
APPENDEX-A
105
Fig. A-1: (A) Tagetes patula and their hybrids, (B) Tagetes minuta
Fig. A-2: A view of Tagetes minuta in its natural habitat
106
Fig. A-3: Tagetes erecta and their hybrids species
107
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
Fig. A-4: PCR amplification products of fifteen Tagetes species with RAPD primer GL A-03. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
Fig. A-5: PCR amplification products of fifteen Tagetes species with RAPD primer GLA-04. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
108
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
Fig. A-7: PCR amplification products of fifteen Tagetes species with RAPD primer GL A-06. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
Fig. A-6: PCR amplification products of fifteen Tagetes species with RAPD primer GL A-05. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
109
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
Fig. A-8: PCR amplification products of fifteen Tagetes species with RAPD primer GL A-11. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
Fig. A-9 PCR amplification products of fifteen Tagetes species with RAPD primer GL A-12. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
110
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
Fig. A-10: PCR amplification products of fifteen Tagetes species with RAPD primer GL A-14. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
Fig. A-11: PCR amplification products of fifteen Tagetes species with RAPD primer GL A-15. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
111
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
Fig. A-12: PCR amplification products of fifteen Tagetes species with RAPD primer GL A-17. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
Fig. A-13: PCR amplification products of fifteen Tagetes species with RAPD primer GL A-19. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
112
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
Fig. A-14: PCR amplification products of fifteen Tagetes species with RAPD primer GL A-20. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
Fig. A-15: PCR amplification products of fifteen Tagetes species with RAPD primer GL B-01. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
113
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
Fig. A-16: PCR amplification products of fifteen Tagetes species with RAPD primer GL B-02. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
Fig. A-17: PCR amplification products of fifteen Tagetes species with RAPD primer GL B-03. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
114
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
Fig. A-18: PCR amplification products of fifteen Tagetes species with RAPD primer GL B-04. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
Fig. A-19: PCR amplification products of fifteen Tagetes species with STS primer LSTI. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
115
M T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
Fig. A-20: PCR amplification products of fifteen Tagetes species with STS primer LSTII. Lanes 1 M: 100-bp DNA ladder; lanes 2-16 contains T1 to T15.
116
APPENDEX-B
117
Table B-1: Genetic distances among 15 Tagetes genotype using RAPD primer GLA03
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.22 0.22 - T4 0.40 0.40 0.11 T5 0.46 0.46 0.46 0.35 - T6 0.66 0.66 0.26 0.14 0.20 - T7 0.66 0.66 0.26 0.14 0.20 0.00 - T8 0.09 0.09 0.31 0.49 0.55 0.75 0.75 - T9 0.40 0.40 0.40 0.69 0.35 0.55 0.55 0.20 - T10 0.31 0.31 0.31 0.20 0.55 0.35 0.35 0.18 0.49 - T11 0.31 0.31 0.31 0.20 0.55 0.35 0.35 0.18 0.49 0.00 - T12 0.46 0.46 0.46 0.35 0.00 0.20 0.20 0.55 0.35 0.55 0.55 - T13 0.66 0.66 0.66 0.55 0.90 0.41 0.41 0.75 1.24 0.35 0.35 0.90 - T14 0.46 0.46 1.15 1.00 0.69 0.90 0.90 0.55 1.04 0.55 0.55 0.69 0.20 - T15 0.66 0.66 0.66 0.55 0.90 0.41 0.41 0.75 1.24 0.35 0.35 0.90 0.00 0.20 -
Table B-2: Genetic distances among 15 Tagetes genotype using RAPD primer GLA04
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.00 - T4 0.00 0.00 0.35 - T5 0.00 0.00 0.00 0.00 - T6 0.00 0.00 0.00 0.00 0.00 - T7 0.00 0.00 0.00 1.04 0.00 0.00 - T8 0.00 0.00 1.15 0.40 0.00 0.00 0.46 - T9 0.00 0.00 1.04 0.69 0.00 0.00 1.04 0.40 - T10 0.00 0.00 0.90 0.55 0.00 0.00 0.90 0.26 0.14 - T11 0.00 0.00 0.69 0.35 0.00 0.00 0.69 0.46 0.35 0.20 - T12 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T13 0.00 0.00 0.69 1.04 0.00 0.00 0.00 0.46 0.35 0.20 0.69 0.00 - T14 0.00 0.00 0.69 1.04 0.00 0.00 0.00 0.46 0.35 0.20 0.69 0.00 0.00 - T15 0.00 0.00 0.00 0.55 0.00 0.00 0.90 0.66 1.24 1.10 0.90 0.00 0.00 0.00 -
118
Table B-3: Genetic distances among 15 Tagetes genotype using RAPD primer GLA05
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.00 - T4 0.00 0.00 0.69 - T5 0.00 0.00 0.00 0.00 - T6 0.00 0.00 0.69 0.69 0.69 - T7 0.00 0.00 0.00 0.00 0.00 0.00 - T8 0.00 0.00 0.55 0.55 0.55 0.14 0.00 - T9 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T10 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T11 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T12 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.00 1.24 0.00 0.00 1.24 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -
Table B-4: Genetic distances among 15 Tagetes genotype using RAPD primer GLA06
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.00 - T4 0.00 0.00 0.00 - T5 0.00 0.00 0.00 0.00 - T6 0.00 0.00 0.00 0.00 0.00 - T7 0.00 0.00 0.55 0.00 0.00 0.00 - T8 0.00 0.00 0.90 0.00 0.00 0.00 0.35 - T9 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T10 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T11 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T12 0.00 0.00 0.55 0.00 0.00 0.00 0.69 0.35 0.00 0.00 0.00 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.00 0.42 0.00 0.97 0.00 0.97 1.32 0.00 0.00 0.00 0.97 0.00 0.00 -
119
Table B-5: Genetic distances among 15 Tagetes genotype using RAPD primer GLA07
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.35 0.35 - T4 0.35 0.35 0.00 - T5 0.35 0.35 0.69 0.69 - T6 0.35 0.35 0.69 0.69 0.00 - T7 0.35 0.35 0.69 0.69 0.00 0.00 - T8 0.55 0.55 0.90 0.90 0.20 0.20 0.20 - T9 0.35 0.35 0.69 0.69 0.00 0.00 0.00 0.20 - T10 0.35 0.35 0.69 0.69 0.00 0.00 0.00 0.20 0.00 - T11 0.35 0.35 0.69 0.69 0.00 0.00 0.00 0.20 0.00 0.00 - T12 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T13 0.00 0.00 0.35 0.35 0.35 0.35 0.35 0.55 0.35 0.35 0.35 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.80 0.80 1.15 1.15 1.15 1.15 1.15 0.66 1.15 1.15 1.15 0.00 0.80 0.00 -
Table B-6: Genetic distances among 15 Tagetes genotype using RAPD primer GLA09
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.35 - T3 1.04 0.69 - T4 0.90 1.24 0.55 - T5 1.04 0.29 0.69 1.24 - T6 0.46 0.40 0.80 1.35 0.40 - T7 0.00 0.35 1.04 0.90 1.04 0.46 - T8 0.20 0.14 0.55 1.10 0.55 0.26 0.20 - T9 1.04 0.29 0.69 1.24 0.00 0.40 1.04 0.55 - T10 0.69 0.35 0.63 0.90 0.35 0.46 0.69 0.49 0.35 - T11 1.04 0.29 0.69 1.24 0.29 0.80 1.04 0.55 0.29 0.35 - T12 0.00 0.35 1.04 0.90 1.04 0.46 0.00 0.20 1.04 0.69 1.04 - T13 0.00 0.35 1.04 0.90 1.04 0.46 0.00 0.20 1.04 0.69 1.04 0.00 - T14 0.35 0.69 0.69 0.55 0.69 0.80 0.35 0.55 0.69 1.04 0.69 0.35 0.35 - T15 1.24 0.49 0.49 1.45 0.20 0.60 1.24 0.75 0.20 0.14 0.20 1.24 1.24 0.90 -
120
Table B-7: Genetic distances among 15 Tagetes genotype using RAPD primer GLA11
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.00 - T4 0.00 0.00 0.26 - T5 0.00 0.00 0.26 0.22 - T6 0.00 0.00 0.41 0.66 0.66 - T7 0.00 0.00 0.55 0.40 0.40 0.14 - T8 0.00 0.00 0.42 0.17 0.17 0.42 0.28 - T9 0.00 0.00 0.66 0.22 0.22 0.66 0.40 0.17 - T10 0.00 0.00 0.35 0.09 0.09 0.75 0.49 0.08 0.09 - T11 0.00 0.00 0.55 0.40 0.11 0.55 0.29 0.28 0.11 0.20 - T12 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T13 0.00 0.00 0.00 0.80 0.00 0.00 0.00 0.97 0.80 0.90 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.00 0.75 0.60 0.60 0.35 0.49 0.26 0.31 0.41 0.49 0.00 0.90 0.00 -
Table B-8: Genetic distances among 15 Tagetes genotype using RAPD primer GLA12
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.29 - T4 0.00 0.55 0.14 - T5 0.00 0.00 0.00 0.00 - T6 0.00 0.69 1.39 1.24 0.35 - T7 0.00 0.69 1.39 1.24 0.35 0.00 - T8 0.00 0.69 1.39 1.24 0.35 0.00 0.00 - T9 0.00 0.00 0.00 0.00 0.00 0.35 0.35 0.35 - T10 0.00 0.00 0.00 0.00 0.35 0.69 0.69 0.69 0.35 - T11 0.00 0.00 0.00 0.00 0.00 0.35 0.35 0.35 0.00 0.35 - T12 0.00 0.20 0.49 0.75 0.55 0.20 0.20 0.20 0.55 0.90 0.55 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.55 1.24 1.10 0.90 0.55 0.55 0.55 0.90 0.55 0.90 0.35 0.00 0.00 -
121
Table B-9: Genetic distances among 15 Tagetes genotype using RAPD primer GLA13
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.55 - T3 0.55 0.18 - T4 0.46 0.31 0.09 - T5 1.24 0.18 0.41 0.60 - T6 1.04 0.20 0.49 0.80 0.20 - T7 1.04 0.20 0.49 0.80 0.20 0.00 - T8 1.04 0.20 0.49 0.80 0.20 0.00 0.00 - T9 1.04 0.20 0.49 0.80 0.20 0.00 0.00 0.00 - T10 1.04 0.20 0.49 0.80 0.20 0.00 0.00 0.00 0.00 - T11 1.04 0.20 0.49 0.80 0.20 0.00 0.00 0.00 0.00 0.00 - T12 0.46 0.31 0.09 0.22 0.60 0.40 0.40 0.40 0.40 0.40 0.40 - T13 1.04 0.20 0.49 0.80 0.20 0.00 0.00 0.00 0.00 0.00 0.00 0.40 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.55 0.18 0.18 0.31 0.18 0.49 0.49 0.49 0.49 0.49 0.49 0.31 0.49 0.00 -
Table B-10: Genetic distances among 15 Tagetes genotype using RAPD primer GLA14
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.46 - T4 0.00 0.00 0.00 - T5 0.00 1.15 0.00 0.00 - T6 0.00 0.66 0.90 0.00 0.20 - T7 0.00 0.00 0.00 0.00 0.00 0.00 - T8 0.00 0.51 1.15 0.00 0.46 0.26 0.00 - T9 0.00 0.80 0.00 0.00 0.35 0.55 0.00 0.80 - T10 0.00 0.80 0.00 0.00 0.35 0.55 0.00 0.80 0.00 - T11 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T12 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 1.50 0.00 0.00 1.04 1.24 0.00 0.80 0.69 0.69 0.00 0.00 0.00 0.00 -
122
Table B-11: Genetic distances among 15 Tagetes genotype using RAPD primer GLA15
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.00 - T4 0.00 0.00 0.00 - T5 0.00 0.00 0.00 0.00 - T6 0.00 0.00 0.00 0.00 0.55 - T7 0.00 0.00 0.00 0.00 0.69 0.55 - T8 0.00 0.00 0.00 0.00 1.32 0.26 0.63 - T9 0.00 0.00 0.00 0.00 1.24 0.41 0.55 0.08 - T10 0.00 0.00 0.00 0.00 1.15 0.31 0.46 0.17 0.09 - T11 0.00 0.00 0.00 0.00 1.15 0.31 0.46 0.17 0.09 0.00 - T12 0.00 0.00 0.00 0.00 0.69 0.55 0.69 0.63 0.55 0.46 0.46 - T13 0.00 0.00 0.00 0.00 0.69 0.55 0.69 0.63 0.55 0.46 0.46 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.00 0.00 0.00 1.04 0.20 1.04 0.28 0.49 0.40 0.40 0.35 0.35 0.00 -
Table B-12: Genetic distances among 15 Tagetes genotype using RAPD primer GLA16
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.55 - T3 0.55 0.00 - T4 0.55 0.00 0.00 - T5 0.55 0.00 0.00 0.00 - T6 0.80 0.26 0.26 0.26 0.26 - T7 0.80 0.26 0.26 0.26 0.26 0.00 - T8 0.80 0.26 0.26 0.26 0.26 0.00 0.00 - T9 0.69 0.14 0.14 0.14 0.14 0.11 0.11 0.11 - T10 0.69 0.14 0.14 0.14 0.14 0.11 0.11 0.11 0.00 - T11 0.69 0.14 0.14 0.14 0.14 0.11 0.11 0.11 0.00 0.00 - T12 0.80 0.66 0.66 0.66 0.66 0.22 0.22 0.22 0.40 0.40 0.40 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.11 0.26 0.26 0.26 0.26 0.51 0.51 0.51 0.40 0.40 0.40 0.51 0.00 0.00 -
123
Table B-13: Genetic distances among 15 Tagetes genotype using RAPD primer GLA17
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.00 - T4 0.00 0.00 0.28 - T5 0.00 0.00 0.83 1.24 - T6 0.00 0.00 1.32 0.00 0.20 - T7 0.00 0.00 0.00 0.00 0.00 0.00 - T8 0.00 0.00 0.34 0.57 1.52 1.32 0.00 - T9 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T10 0.00 0.00 0.28 0.69 1.24 1.04 0.00 0.28 0.00 - T11 0.00 0.00 0.63 1.04 0.90 0.69 0.00 0.63 0.00 0.35 - T12 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.00 0.08 0.49 0.75 1.24 0.00 0.48 0.00 0.49 1.24 0.00 0.00 0.00 -
Table B-14: Genetic distances among 15 Tagetes genotype using RAPD primer GLA18
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.00 - T4 0.00 0.00 0.00 - T5 0.00 0.00 0.00 0.55 - T6 0.00 0.00 1.04 0.69 0.14 - T7 0.00 0.00 0.00 0.55 0.00 0.14 - T8 0.00 0.00 0.00 0.55 0.00 0.14 0.00 - T9 0.00 0.00 0.90 0.55 0.41 0.14 0.41 0.41 - T10 0.00 0.00 0.90 0.55 0.41 0.14 0.41 0.41 0.00 - T11 0.00 0.00 0.00 0.35 0.90 1.04 0.90 0.90 0.90 0.90 - T12 0.00 0.00 1.24 0.90 0.35 0.20 0.35 0.35 0.35 0.35 1.24 - T13 0.00 0.00 0.00 0.55 0.41 0.55 0.41 0.41 0.41 0.41 0.90 0.35 - T14 0.00 0.00 0.90 0.55 1.10 0.55 1.10 1.10 0.41 0.41 0.90 0.35 0.41 - T15 0.00 0.00 0.35 0.00 1.24 0.69 1.24 1.24 0.55 0.55 0.00 0.49 0.55 0.55 -
124
Table B-15: Genetic distances among 15 Tagetes genotype using RAPD primer GLA19
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.90 - T4 0.00 0.90 0.00 - T5 0.00 1.15 1.35 1.35 - T6 0.00 1.24 0.75 0.75 0.31 - T7 0.00 0.69 0.90 0.90 0.46 0.55 - T8 0.00 1.15 1.35 1.35 0.22 0.31 0.46 - T9 0.00 0.00 0.00 0.00 0.80 0.90 0.00 0.80 - T10 0.00 1.04 1.24 1.24 0.80 0.49 1.04 0.40 0.69 - T11 0.00 0.90 1.10 1.10 0.26 0.35 0.20 0.26 0.55 0.55 - T12 0.80 1.15 1.35 1.35 0.22 0.31 0.46 0.22 0.80 0.80 0.26 - T13 0.00 0.00 0.00 0.00 0.80 0.90 0.00 0.80 0.00 0.69 0.55 0.80 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.00 0.41 0.41 1.35 0.75 0.00 1.35 0.55 1.24 1.10 1.35 0.55 0.00 -
Table B-16: Genetic distances among 15 Tagetes genotype using RAPD primer GLA20
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.00 - T4 0.00 0.00 0.00 - T5 0.00 0.00 0.00 0.00 - T6 0.00 0.00 0.00 0.00 1.04 - T7 0.00 0.00 0.00 0.00 0.69 0.35 - T8 0.00 0.00 0.00 0.00 0.35 0.29 0.35 - T9 0.00 0.00 0.00 0.00 0.20 0.55 0.90 0.14 - T10 0.00 0.00 0.00 0.00 0.20 0.55 0.20 0.14 0.41 - T11 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T12 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.00 0.00 0.00 1.04 0.69 0.35 0.69 1.24 0.55 0.00 0.00 0.00 0.00 -
125
Table B-17: Genetic distances among 15 Tagetes genotype using RAPD primer GLB01
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.55 - T3 0.55 0.29 - T4 1.10 0.55 0.14 - T5 0.55 0.29 0.29 0.55 - T6 0.66 0.40 0.40 0.66 0.11 - T7 0.66 0.11 0.40 0.66 0.40 0.51 - T8 0.75 0.49 0.49 0.75 0.20 0.09 0.31 - T9 1.24 0.69 0.69 1.24 0.29 0.11 0.80 0.20 - T10 0.66 0.40 0.40 0.66 0.11 0.00 0.51 0.09 0.11 - T11 0.66 0.11 0.11 0.26 0.11 0.22 0.22 0.31 0.40 0.22 - T12 0.41 0.55 0.55 0.41 1.24 1.35 0.66 1.45 0.00 1.35 0.66 - T13 0.90 1.04 0.00 0.00 1.04 1.15 1.15 1.24 1.04 1.15 1.15 0.90 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 1.10 0.14 0.55 0.41 0.55 0.66 0.26 0.75 1.24 0.66 0.26 0.41 0.90 0.00 -
Table B-18: Genetic distances among 15 Tagetes genotype using RAPD primer GLB02
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.35 - T3 0.90 1.24 - T4 0.90 1.24 0.00 - T5 0.00 0.00 1.24 1.24 - T6 0.00 1.04 0.90 0.90 1.04 - T7 0.00 0.00 0.00 0.00 0.00 0.00 - T8 0.80 0.46 0.60 0.60 0.46 0.40 0.00 - T9 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T10 0.00 0.69 1.24 1.24 0.69 1.04 0.00 0.46 0.00 - T11 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T12 0.00 0.00 0.00 0.00 0.69 1.04 0.00 1.15 0.00 0.00 0.00 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.35 0.69 0.55 0.55 0.69 0.00 0.00 0.46 0.00 0.69 0.00 0.00 0.00 - T15 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 -
126
Table B-19: Genetic distances among 15 Tagetes genotype using RAPD primer GLB03
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.00 - T4 0.00 0.00 0.42 - T5 0.00 0.00 0.00 0.00 - T6 0.00 0.00 0.83 1.10 0.00 - T7 0.00 0.00 0.00 0.00 0.00 0.00 - T8 0.00 0.00 0.63 0.00 0.00 0.90 0.00 - T9 0.00 0.00 1.32 0.00 0.00 0.90 0.00 0.69 - T10 0.00 0.00 1.32 0.00 0.00 0.90 0.00 0.69 0.00 - T11 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T12 0.00 0.00 0.57 1.24 0.00 1.24 0.00 1.04 1.04 1.04 0.00 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.00 0.97 1.24 0.00 1.24 0.00 1.04 0.35 0.35 0.00 1.39 0.00 0.00 -
Table B-20: Genetic distances among 15 Tagetes genotype using RAPD primer GLB04
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.14 - T3 0.75 0.49 - T4 0.00 0.00 0.00 - T5 0.00 0.00 0.00 0.00 - T6 0.26 0.11 0.60 0.00 0.00 - T7 0.35 0.20 0.41 0.00 0.00 0.09 - T8 0.26 0.11 0.60 0.00 0.00 0.00 0.09 - T9 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T10 0.14 0.00 0.49 0.00 0.00 0.11 0.20 0.11 0.00 - T11 0.20 0.35 0.55 0.00 0.00 0.46 0.55 0.46 0.00 0.35 - T12 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.35 0.20 0.41 0.00 0.00 0.31 0.18 0.31 0.00 0.20 0.55 0.00 0.00 0.00 -
127
Table B-21: Genetic distances among 15 Tagetes genotype using STS primer LSTI
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.90 - T4 0.00 0.69 0.20 - T5 0.00 0.00 0.00 0.00 - T6 0.00 0.00 1.24 0.00 0.35 - T7 0.00 0.00 0.00 0.00 0.00 0.35 - T8 0.00 0.55 0.75 1.24 0.55 0.90 0.55 - T9 0.00 0.80 1.01 1.50 0.80 1.15 0.80 0.26 - T10 0.00 0.69 0.90 1.39 0.69 1.04 0.69 0.14 0.11 - T11 0.00 0.35 1.24 1.04 0.35 0.69 0.35 0.20 0.46 0.35 - T12 0.00 0.00 0.00 0.00 0.00 0.35 0.00 0.55 0.80 0.69 0.35 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.80 1.70 1.50 0.80 1.15 0.80 0.66 0.22 0.40 0.46 0.80 0.00 0.00 -
Table B-22: Genetic distances among 15 Tagetes genotype using STS primer LSTII.
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.66 - T4 0.00 0.66 0.00 - T5 0.00 0.26 0.22 0.22 - T6 0.00 0.35 0.31 0.31 0.09 - T7 0.00 0.26 0.51 0.51 0.22 0.09 - T8 0.00 0.14 0.40 0.40 0.11 0.20 0.11 - T9 0.00 0.14 0.40 0.40 0.11 0.20 0.11 0.00 - T10 0.00 0.14 0.40 0.40 0.11 0.20 0.11 0.00 0.00 - T11 0.00 0.14 0.40 0.40 0.11 0.20 0.11 0.00 0.00 0.00 - T12 0.00 0.14 0.40 0.40 0.11 0.20 0.11 0.00 0.00 0.00 0.00 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.66 0.00 0.00 0.22 0.31 0.51 0.40 0.40 0.40 0.40 0.40 0.00 0.00 -
128
Table B-23: Genetic distances among 15 Tagetes genotype using STS primer LSTIII
Genotype T1 T2 T3 T4 T5 T6 T7 T8 T9 T10 T11 T12 T13 T14 T15
T1 - T2 0.00 - T3 0.00 0.00 - T4 0.00 0.00 0.09 - T5 0.00 0.00 1.50 1.59 - T6 0.00 0.00 1.50 1.59 1.39 - T7 0.00 0.00 0.00 1.70 0.80 0.40 - T8 0.00 0.00 0.00 1.59 0.69 0.69 0.11 - T9 0.00 0.00 0.00 0.00 0.35 1.04 0.46 0.35 - T10 0.00 0.00 1.50 1.59 0.29 1.39 0.80 0.69 0.35 - T11 0.00 0.00 1.50 1.59 0.29 1.39 0.80 0.69 0.35 0.00 - T12 0.00 0.00 0.75 0.55 0.63 1.73 0.75 0.63 1.39 0.63 0.63 - T13 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T14 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 - T15 0.00 0.00 0.80 0.49 1.39 1.39 1.50 1.39 0.00 0.00 0.00 0.63 0.00 0.00 -
129
APPENDEX-C
130
List of Publications
I. Shahzadi, R. Ahmed, A. Hassan and M.M. Shah. (2010). Optimization of DNA extraction from seeds and fresh leaf tissues of wild marigold (Tagetes
minuta) for polymerase chain reaction analysis. Genet. Mol. Res. 9: 386-393. I. Shahzadi, A. Hassan, U. W. Khan and M. M. Shah. (2010). Evaluating biological activities of the seed extracts from Tagetes minuta L. found in Northern Pakistan. JMPR Vol. 4: 2108-2112. I. Shahzadi, R. Ahmad, M. M. Shah. (2012). Genetic diversity analysis of Tagetes species using PCR based molecular markers. Scientia Horticulturae [Submitted] I. Shahzadi, O. M. Andersen, I. Skaar, M. Jordheim, M. M. Shah. (2012). Flavonoid compounds from Tagetes minuta characterized by high-resolution LC-MS. Phytochemistry [Submitted]