ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Nov. 2010, p. 4744–4749 Vol. 54, No. 110066-4804/10/$12.00 doi:10.1128/AAC.00798-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Characterization of Two Newly Identified Genes, vgaD and vatG,Conferring Resistance to Streptogramin A in

Enterococcus faecium�

Young-Hee Jung, Eun Shim Shin, Okgene Kim, Jung Sik Yoo, Kyeong Min Lee, Jae Il Yoo,Gyung Tae Chung, and Yeong Seon Lee*

Division of Antimicrobial Resistance, Center for Infectious Disease Research, National Institute of Health, 194, Tongil-Lo,Eunpyung-Gu, Seoul 122-701, Republic of Korea

Received 16 June 2009/Returned for modification 23 November 2009/Accepted 2 July 2010

We characterized two new streptogramin A resistance genes from quinupristin-dalfopristin-resistant En-terococcus faecium JS79, which was selected from 79 E. faecium isolates lacking known genes encoding strep-togramin A acetyltransferase. A 5,650-bp fragment of HindIII-digested plasmid DNA from E. faecium JS79 wascloned and sequenced. The fragment contained two open reading frames carrying resistance genes related tostreptogramin A, namely, genes for an acetyltransferase and an ATP efflux pump. The first open reading framecomprised 648 bp encoding 216 amino acids with a predicted left-handed parallel �-helix domain structure;this new gene was designated vatG. The second open reading frame consisted of 1,575 bp encoding 525 aminoacids with two predicted ATPase binding cassette transporters comprised of Walker A, Walker B, and LSSGmotifs; this gene was designated vgaD. vgaD is located 65 bp upstream from vatG, was detected together withvatG in 12 of 179 quinupristin-dalfopristin-resistant E. faecium isolates, and was located on the same plasmid.Also, the 5.6-kb HindIII-digested fragment which was observed in JS79 was detected in nine vgaD- andvatG-containing E. faecium isolates by Southern hybridization. Therefore, it was expected that these two geneswere strongly correlated with each other and that they may be composed of a transposon. Importantly, vgaDis the first identified ABC transporter conferring resistance to streptogramin A in E. faecium. Pulsed-field gelelectrophoresis patterns and sequence types of vgaD- and vatG-containing E. faecium isolates differed forisolates from humans and nonhumans.

Quinupristin-dalfopristin (Q-D) (70:30), a mixture of strep-togramins A and B, has been used to treat patients infectedwith methicillin-resistant Staphylococcus aureus and vancomy-cin-resistant Enterococcus faecium since the U.S. Food andDrug Admission approved the drug in 1997. Virginiamycin,another streptogramin mixture, had been used as a feed addi-tive for livestock since the late 1970s in the United States,Europe, and Korea and has cross-resistance with Q-D.

Resistance to a synergistic mixture of streptogramins A andB was first identified in clinical S. aureus isolates in France in1975. The resistance marker vga, conferring resistance to strep-togramin A, was characterized in the early 1990s (7), andthereafter many new resistance mechanisms were discovered instaphylococci and E. faecium (3, 4, 6, 8. 25, 33), but resistanceto mixtures of streptogramins A and B has been reported to bemediated by streptogramin A alone, irrespective of resistanceto streptogramin B (8). Streptogramin A resistance is mediatedby vat genes, which encode a streptogramin A acetyltransferase(SAT) that acetylates streptogramin A, and by vga genes,which encode an ATPase binding cassette transporter (ABCtransporter).

Multiple alignment of nucleotide sequences of vatA, vatB,

and vatD identified four conserved motifs, namely, I, II, III,and IV, and a PCR primer was designed for motifs III and IV(3). Nucleotide sequences of 144 to 147 bp were found fromisolates containing vatA, vatB, vatC, vatD, and vatE (3, 6, 33).Most vat genes are located on plasmids and are distributed instaphylococci (vatA, vatB, and vatC) and E. faecium (vatD andvatE) (3, 6, 8, 25, 33), but vatF from Yersinia enterocolitica islocated in chromosomal DNA (27). The vga genes, includingvgaA, vgaAv, vgaB, and vgaC, encoding the ABC transporter,have been identified in Q-D-resistant staphylococci (4, 7, 14,22). Recently, both vgaB and vatB were detected in Enterococ-cus gallinarum (18), but a Q-D resistance mechanism for theABC transporter has yet to be identified in E. faecium.

E. faecium isolates from healthy humans, poultry, swine,retail meats, clinic patients, and wastewater have been shownto exhibit Q-D resistance and to carry the resistance genesvatD and/or vatE (2, 17, 20, 28, 32). Although the resistancegenes encoding SAT have been established in Q-D-resistant E.faecium, some Q-D-resistant isolates that do not carry knownresistance genes have been reported (9, 23, 24, 28). Therefore,to identify new determinants conferring resistance to strepto-gramin A, we selected a Q-D-resistant E. faecium isolate(JS79) lacking known streptogramin A resistance genes andcharacterized the genes responsible for the resistance.

MATERIALS AND METHODS

Bacterial strains. Fecal samples from poultry (obtained in 2000) and fromhealthy humans, poultry, and swine (obtained in 2003) and samples of retailmeats (obtained in 2003) were cultivated in 10 ml Enterococcosel broth (BD) for

* Corresponding author. Mailing address: Division of Antimicro-bial Resistance, Center for Infectious Disease Research, NationalInstitute of Health, 194, Tongil-Lo, Eunpyung-Gu, Seoul 122-701,Republic of Korea. Phone: 82-2-380-1479. Fax: 82-2-380-1550.E-mail: yslee07@nih.go.kr.

� Published ahead of print on 16 August 2010.

4744

on May 2, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 2, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

on May 2, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

48 h at 37°C, and one loop of the culture was streaked on Enterococcosel agarcontaining Q-D (MIC, 2 �g/ml) (Aventis, France) to isolate Q-D-resistant E.faecium. Q-D-resistant isolates were selected after antibiotic susceptibility wasdetermined by disk diffusion and Etest according to Clinical and LaboratoryStandards Institute guidelines. A total of 179 Q-D-resistant E. faecium isolates(MICs, �4 �g/ml) were used in this experiment (Table 1).

Determination of genotypes. The presence or absence of genes conferringresistance to vancomycin (vanA), macrolides (ermB and vgb), or streptogramin A(vatA, vatB, vatC, vatD, and vatE) in the 179 isolates was verified by PCRamplification using primers and PCR conditions as described previously (21, 28).To identify other streptogramin A resistance genes encoding SAT from Q-D-resistant E. faecium isolates lacking known vat genes, the strepto-M andstrepto-N primer set was used (28). This primer set was designed based onconserved sequences of vatA, vatB, and vatD (Table 2). Products of 144 to 147 bpwere obtained from vat gene-containing isolates with resistance to Q-D.

To determine whether Q-D-resistant E. faecium isolates carried vatG or vgaD(the two new streptogramin A resistance genes identified in this study), theprimer sets were designed based on sequences within vatG and vgaD (Fig. 1 andTable 2), and PCR amplification was performed (Table 2).

Transferability of Q-D and erythromycin resistance. Seven of 12 vatG-con-taining E. faecium isolates showed resistance to erythromycin and were used asdonors. E. faecium U201, which is susceptible to Q-D and erythromycin andresistant to ampicillin, was used as the recipient. The conjugation was performedusing broth mating. One hundred microliters of donor and recipient (1:1) cul-tured overnight in M17 broth (Oxoid, England) was added in 2 ml fresh M17broth and incubated at 37°C for 6 h. Transconjugants were selected on brainheart infusion (BHI) agar (BD) containing erythromycin (100 �g/ml) and am-picillin (100 �g/ml) after incubation at 37°C for 24 h.

Isolation of plasmid DNA and Southern hybridization. Plasmid DNAs wereextracted from Q-D-resistant E. faecium isolates using the modified alkaline lysismethod of Ehrenfeld and Clewell (10) and then digested using the restrictionenzymes BamHI, EcoRI, HindIII, PstI, SalI, and SphI (Takara, Japan). Southernhybridization was then performed using the ECL direct nucleic acid labeling anddetection system (Amersham, GE Healthcare Life Science). The PCR productsobtained from E. faecium JS79 using the strepto-M and strepto-N primers (144to 147 bp) to search a new vat gene and using the vatG primer set (200 bp) toidentify the vatG gene were used as probes, respectively.

PFGE and multilocus ST. Pulsed-field gel electrophoresis (PFGE) patternsfrom vatG-containing E. faecium isolates were obtained as described previously(21). The fragments containing total DNA were digested with SmaI (Takara),

and electrophoresis conditions were a constant 6 V/cm at 14°C and a pulse timeof 1 to 20 s for 24 h using the CHEF-Mapper system (Bio-Rad). Cluster analysisof PFGE patterns was carried out using GelCompar software version 4.0b (Ap-plied Maths, Belgium). The sequence type (ST) and allele number for vatG-containing E. faecium isolates were determined using the multilocus ST site,http://efaecium.mlst.net.

Determination of nucleotide sequences and analysis of the putative aminoacids. A 6-kb HindIII fragment of plasmid DNA from Q-D-resistant E. faeciumisolate was sequenced by Macrogen Service Center (Macrogen, Seoul, SouthKorea) and analyzed using DNAStar software version 5.0 to find open readingframes (ORFs). Clustal W 2.0 (http://www.ebi.ac.uk/Tools/clustalw2/) was usedto establish and analyze multiple alignments of the putative amino acid se-quences. Conserved Domains from the National Center for Biotechnology In-formation (http://www.ncbi.nlm.nih.gov/) and PROSITE (http://www.ca.expasy.org/prosite/) were used to search for motifs.

Nucleotide sequence accession number. The sequence data presented herewere submitted to GenBank under accession number GQ205627.

RESULTS

Cloning of a resistance gene encoding streptogramin Aacetyltransferase. A total of 179 Q-D-resistant E. faecium iso-lates (MIC, �4 �g/ml) were identified in samples from fecesfrom healthy humans, swine, and poultry in 2000 and 2003 andfrom chicken meats in 2003. vatD was detected in 26 of the 179isolates (14.5%), and vatE was detected in 74 of the 179 iso-lates (41.3%). PCR products were not obtained using primersets which were specific for known vat genes, including vatA,vatB, vatC, vatD, and vatE, in 79 Q-D-resistant strains (44.1%).In 28 of these 79 Q-D-resistant strains lacking known vat genesas well as in 100 isolates containing vatD and vatE, however,PCR products of 144 to 147 bp were obtained using thestrepto-M/strepto-N primer set. The PCR products from the28 Q-D-resistant isolates were expected to carry a new vat genesequence encoding SAT. To identify this new determinantconferring resistance to streptogramin A, we selected thehighly Q-D-resistant E. faecium strain JS79 (MIC, 32 �g/ml),which was isolated from the stool of a healthy human.

Plasmid DNA isolated from JS79 was digested with BamHI,EcoRI, HindIII, PstI, SalI, and SphI and subjected to 1%agarose gel electrophoresis followed by Southern blot analysisusing as a probe the 144- to 147-bp PCR amplification prod-uct which was obtained from JS79 using the strepto-M andstrepto-N primers. A 6-kb HindIII fragment carrying an acetyl-transferase gene was cloned into the HindIII site of pUC18.The nucleotide sequence of the cloned HindIII fragment wasdetermined and consisted of 5,650 bp with 36.6% GC content.The fragment contained three putative ORFs, as determinedusing DNAStar version 5.0 and the NCBI ORF finder pro-grams. Two ORFs were identified as genes conferring resis-tance to streptogramin A (encoding SAT and ABC transporter

TABLE 2. Primer sequences and PCR conditions

Primer Sequence Productsize (bp) PCR conditions

Strepto-M ATHATGAAYGGIAAYCAYMGIATG 144–147 Initial denaturing reaction at 95°C for 5 min; 35 cycles at 95°Cfor 30 s, 40°C for 2 min, and 72°C for 90 s; final extensionreaction at 40°C for 4 min and 72°C for 10 minStrpeto-N ICCDATCCAIACRTCRTTICC

vatG1 GTGGGAAAAGCATACACCT 200 Initial denaturing reaction at 94°C for 5 min; 30 cycles at 94°Cfor 30 s, 55°C for 30 s, and 72°C for 30 s; final extensionreaction at 72°C for 10 min

vatG2 TTGCAGGATTACCACCAACvgaD1 CAACTGGAGCGAGCTGTTA 201vgaD2 GACAGCCGGATAATCTTTTG

TABLE 1. Prevalence of Q-D-resistant E. faecium isolates fromswine, poultry, chicken meat, and healthy humans in

2000 and 2003

Source Isolation yr No. ofsamples

No. (%) of Q-Da-resistant

isolates

Q-D MICrange (�g/ml)

Swine 2003 255 13 (5.1) 8–32Poultry 2000 396 60 (15.2) 4–32

2003 431 82 (19.0)Chicken meat 2003 100 21 (21) 4–32Healthy humans 2003 328 3 (0.9) 4–32

Total 2000–2003 1,510 179 (11.9) 4–32

a Q-D, quinupristin-dalfopristin.

VOL. 54, 2010 CHARACTERIZATION OF STREPTOGRAMIN A RESISTANCE GENES 4745

on May 2, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

proteins), and the other ORF, containing a transposase inser-tion sequence, was partially sequenced (Fig. 1).

Characterization of two new ORFs conferring resistance tostreptogramin A. Of the three ORFs identified in the 5,650-bpHindIII fragment of E. faecium JS79 DNA, the first consistedof 1,575 bp (from nucleotide [nt] 1394 to 2968 relative to the 5�HindIII site) and encoded 525 amino acid residues; the GCcontent was 36.9%. The ORF contained two ABC transportertype 2 domains (residues 4 to 175 and 271 to 479) as deter-mined via PROSITE and Conserved Domains from the NCBIprograms (Fig. 2). Each of these domains contained the char-acteristic ATP binding cassette comprised of a highly con-served ATP binding cassette (ABC), a typical phosphate bind-ing loop (Walker A motif, P loop), a magnesium binding site(Walker B motif) (29), and a signature conserved motif (LSGGmotif, C loop) (Fig. 2). The Walker A motif sequence wasA/G-X2-G-X-G-K-S/T, the Walker B motif sequence washhhhD (h represents hydrophobic residues), and the signaturemotif sequence was LSGG (Fig. 2). This ORF was designatedvgaD. The calculated molecular mass of VgaD was 60.5 kDa,and the calculated isoelectric point was 7.58. In a multiplealignment of amino acid sequences related to ABC transport-ers, VgaD showed 47% identity with VgaA, 50% with VgaAv,54% with VgaB, 33% with MsrA, 31% with MsrC, 34% withMsrD, and 22% with Lsa.

The second ORF was located 65 bp downstream of the 3�end of vgaD. This ORF consisted of 648 bp (from nt 3037 to3684 relative to the 5� HindIII site) and encoded 216 residueswith a calculated molecular mass of 23.9 kDa; the GC contentwas 36.9%. This ORF contained the common trait of acyl- andacetyltransferases, namely, the L�H domain of hexapeptiderepeats containing the transferase signature motif L/I/V-G-X4

(residues 126 to 154 of the peptide sequences) (Fig. 1). ThisORF was designated vatG. In a multiple alignment of aminoacid sequences related to acetyltransferases, VatG showed61.7% identity with VatA, 54.7% with VatB, 68.4% with VatC,63.2% with VatD, 48.6% with VatE, and 55% with VatF.

Distribution of vatG and vgaD in Q-D-resistant E. faeciumisolates. To detect the presence of vatG and vgaD in the 179Q-D-resistant E. faecium isolates, PCR primer pairs were de-signed to amplify sequences within vatG and vgaD (Table 2).PCR amplification products of vatG and vgaD were detected in

6.7% (12/179) of the Q-D-resistant isolates from the stoolsamples of healthy humans, swine, poultry and from chickenmeat. All E. faecium isolates containing vatG also harboredvgaD, and Southern hybridization indicated that these geneswere located on HindIII fragments of identical size in differentplasmids from 10 isolates (Fig. 3).

Relationship of Q-D resistance and erythromycin resis-tance. In addition, the gene ermB was detected in 9 of the 12E. faecium isolates containing vatG and vgaD from stool sam-ples from healthy humans and poultry, and the gene vanA wasdetected in 4 of the 12 isolates from chicken feces in 2001 andfrom chicken meat in 2003 (Table 3). vgb was not detected inthese 12 isolates.

The transfer frequencies of streptogramin A resistance geneswere 10�6 to 10�8 per donor using broth mating conjugation.Although transconjugants were selected on BHI agar con-taining ampicillin and erythromycin as selection markers,erythromycin resistance of donor isolates was always trans-ferred together with Q-D resistance into the recipient strain,all transconjugants carried ermB and vatG genes on the sameplasmid, and MICs of erythromycin (256 �g/ml) and Q-D (8 to32 �g/ml) in transconjugants were the same as those in donorisolates (data not shown).

Molecular epidemiology of vgaD- and vatG-containing E. fae-cium isolates. Among the 12 vgaD- and vatG-containing E.faecium isolates, three isolates (CS98, CS103, and CS106) andtwo isolates (A15 and C19) from the same farm and two iso-lates (GAV04 and GAV12) from chickens purchased in thesame market were identical based on PFGE and ST analyses,respectively (Table 3). The STs of two isolates from healthyhumans, JS79 and KS46, were identical (ST17), and the PFGEpatterns and the STs differed in healthy humans and nonhu-mans (Table 3). Among them, the allele copy numbers of threeisolates (AS115, ES022, and KS46) were not determined.

DISCUSSION

In staphylococci and enterococci, Q-D resistance is con-ferred by the SAT and the ABC transporter molecules. In theearly 1990s, Q-D resistance genes were identified using ashotgun cloning method with the Q-D-susceptible strainEscherichia coli DB10 or S. aureus RN4220 as the host, and

FIG. 1. Schematic diagram depicting a restriction map of a 5.6-kb HindIII fragment of E. faecium JS79 DNA containing two streptogramin Aresistance genes and a transposase gene. Bold arrows reflect the orientations of vgaD and vatG and the transposase (IS); black boxes reflectfunctional domains within the resistance gene translation product. There are two ABC transporter 2 domains, the N-terminal ATP binding domainand the C-terminal ATP binding domain, in the ABC transporter encoded by vgaD and an L�H domain in the streptogramin A acetyltransferaseencoded by vatG. Filled arrows indicate primer sequences designed for the vgaD and vatG genes.

4746 JUNG ET AL. ANTIMICROB. AGENTS CHEMOTHER.

on May 2, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

Q-D-resistant transformants were directly selected on Q-D-containing selection media. Since then, however, new Q-Dresistance genes, vatC and vatE, were identified by Southernhybridization using the PCR product of 144 to 147 bp obtainedwith the primer set of strepto-M and strepto-N as a probe (28),and here we identified a new vat gene, vatG, from Q-D-resis-

tant E. faecium JS79 (which lacks known vat genes) using thisprimer set (28). Although the seven vat genes from Q-D-resistant staphylococci, E. faecium, and Y. enterocolitica share45 to 71% identity and the vatF gene is intrinsic, motifs I andII were conserved as shown by multiple-sequence alignment ofseven known vat genes. Therefore, new vat genes from Q-D-resistant isolates lacking known vat genes may be identified onan ongoing basis using nucleotide sequences of motifs II andIII as queries.

ABC transporters are widely distributed in humans as well asin other eukaryotes and prokaryotes. Many ABC transporterscontain two hydrophobic membrane-spanning domains andtwo hydrophilic ATP binding domains. VgaD, however, con-tains only two distinct ATP binding domains, as do MsrA andVgaB (4, 26). In a multiple sequence alignment of strepto-gramins A and B and macrolide ABC transporters, the strep-togramin A ABC transporters VgaA, VgaB, and VgaD exhibit44 to 50% identity with each other (not including VgaAv); 31to 37% identity with MsrA, MsrC, and MsrD; and 22 to 24%identity with Lsa (Fig. 2). We searched for the positions of theN-terminal ATP binding domains (N domains) and C-terminalATP binding domains (C domains) in the amino acid se-quences of MsrA, MsrC, MsrD, VgaA, VgaAv, VgaB, VgaD,and Lsa via PROSITE. In all the proteins except Lsa, the Ndomain was shorter than the C domain, whereas in Lsa the Cdomain was the shorter of the two (Fig. 2). Multiple alignmentsof those sequences excluding Lsa revealed 20 to 80% identityin all of the N domains and the C domains, but the sequenceidentity between the Msr and Vga C domains (31 to 80%) was,on average, higher than that between the N-domains (33 to51%). The identity between N domain and C domain in eachABC transporter besides VgaB was 20 to 26% and was lowerin different ABC transporters; therefore, ABC transporterssuch as Msr and Vga may be composed of two domains, the Ndomain and the C domain, with different ancestries.

FIG. 2. Multiple-sequence alignment of ABC transporters conferringresistance to streptogramin A/B or macrolides from staphylococci, entero-cocci, and streptococci. VgaA, accession no. AF186237, S. aureus; VgaAv,M90050, S. aureus; VgaB, U82085, S. aureus; VgaD, a new ABC trans-porter encoded by vgaD, GQ205627, E. faecium; MsrA, X52085, S. epi-dermidis; MsrC, AF313494, E. faecium; MsrD, AJ715499, Streptococcuspneumoniae; Lsa, AY225127, E. faecalis.

FIG. 3. Southern hybridization to identify vatG-containing E. fae-cium isolates from healthy humans, swine, poultry stool samples, andchicken meat. (A) Agarose gel electrophoresis of HindIII-digestedplasmid DNA from E. faecium isolates. (B) Southern hybridization ofthe samples shown in panel A using a vatG PCR product as probe. M,100-bp plus ladder. Isolates are as follows: lane 1, A15; lane 2, C19;lane 3, AS115; lane 4, CS098; lane 5, CS103; lane 6, CS106; lane 7,CS121; lane 8, GAV04; lane 9, GAV11 (negative control); lane 10,ES022; lane 11, JS79. ES, isolates from swine feces; A, C, AS, and CS,isolates from poultry feces; JS and KS, isolates from human feces;GAV, isolates from chicken meat.

VOL. 54, 2010 CHARACTERIZATION OF STREPTOGRAMIN A RESISTANCE GENES 4747

on May 2, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

Many transposons contain resistance genes with varioustransposases, which were found in plasmid DNA of staphylo-cocci. In previous reports such findings were observed. Forinstance, a vgaA variant streptogramin A resistance gene con-taining a transposon sequence (Tn5406) was previously iso-lated from S. aureus BM3327, and the structure of Tn5406 issimilar to that of Tn554 (13). In this study, such transposonstructure was also identified in the DNA plasmid of E. faeciumJS79. vgaD was detected in only 12 vatG-containing Q-D-re-sistant E. faecium isolates and was 65 bp apart from vatG onthe same plasmid. However, vgaD was not detected in theremaining Q-D-resistant E. faecium isolates. Nine E. faeciumisolates containing vgaD and vatG yielded HindIII fragmentsidentical to that of JS79 (Fig. 3), which included transposasesequences as well as vgaD and vatG (Fig. 1). Although furthersequencing for upstream of vgaD and downstream of the in-sertion sequence is required, such findings in this study suggestthat the fragment containing vgaD and vatG carries the struc-ture of the transposon.

Most vat genes isolated from staphylococci and E. faeciumare linked with other genes, such as vga-vatA-vgb, vgaB-vatB,and vgbB-vatC in staphylococci (4–6) and ermB-vatD and ermB-vatE in E. faecium (12, 19). It has been reported that transcrip-tional regulation of vat genes is not controlled by sequencesupstream of the start codon (6, 32) but that vat genes arecotranscribed and cotransferred to other strains along withother genes, such as vga, vgaB, vgb, vgbB, or ermB (17, 20, 28).A few researchers have speculated about the linkage betweenresistance genes in the coselection or persistence of antibioticresistance. Macrolide resistance is widely distributed in manyisolates, especially in vancomycin-resistant E. faecium. TheermB gene is closely linked together with vanA on the sameplasmid, and cotransfer of vanA and ermB to other strains anda high frequency of vancomycin-resistant enterococci (VRE)result from the link with macrolide resistance (1, 11). Linkagewith ermB and vatE using PCR and transference of the Q-Dresistance gene to other strains were also reported for Q-D-resistant E. faecium isolates (30, 31). We found that both ermBand vatG were transferred using broth mating conjugation, andermB and vatG were detected using PCR. Therefore, it wasexpected that vatG was more closely linked to ermB.

Many Q-D-resistant E. faecium isolates that do not containany known streptogramin A resistance genes have been iden-tified (14, 16, 23, 24, 32). In one study, no known streptograminA resistance genes were detected in 29% of the Q-D-resistantisolates (MIC, 4 to 16 �g/ml) (28), and a clinical study from

Korea reported that 10% of Q-D-resistant E. faecium isolatesdid not carry streptogramin A resistance genes (MIC, 4 �g/ml).Although vat-vgb and vgaB-vatB were isolated from E. faeciumand E. gallinarum, respectively (14, 18), vat genes from E.faecium have not been detected in staphylococci (14), and vatgenes from staphylococci are rarely found in enterococci (15).This suggests that genes encoding SAT are specific accordingto genus.

It has been reported that clonal complex 17 (CC17), includ-ing ST17, is widely disseminated in E. faecium isolates fromhospitals throughout the world and carries mostly virulencemarker esp genes. E. faecium JS79 was isolated from a healthyhuman and had ST17, but JS79 is susceptible to ampicillin anddoes not carry the esp gene (data not shown). The STs of twoisolates, AS115 and ES022, were not determined, and we ex-pect to find that the ST(s) of these two isolates is new.

ACKNOWLEDGMENTS

This work was supported by a research grant from the Korea Foodand Drug Administration of the Republic of Korea in 2006 (06042-ARM-127) and by the Korea National Institute of Health in 2007(2007-N00299-00).

REFERENCES

1. Aarestrup, F. M. 2000. Characterization of glycopeptides-resistant Entero-coccus faecium (GRE) from broilers and pigs in Denmark: genetic evidencethat persistence of GRE in pig herds is associated with coselection by resis-tance to macrolides. J. Clin. Microbiol. 38:2774–2777.

2. Aarestrup, F. M., Y. Agerso, P. Gerner-Smidt, M. Madsen, and L. B. Jensen.2000. Comparison of antimicrobial resistance phenotypes and resistancegenes in Enterococcus faecalis and Enterococcus faecium from humans in thecommunity, broilers, and pigs in Denmark. Diagn. Microbiol. Infect. Dis.37:127–137.

3. Allignet, J., and N. El Solh. 1995. Diversity among the gram-positive acetyl-transferases inactivating streptogramin A and structurally related com-pounds and characterization of a new staphylococcal determinant, vatB.Antimicrob. Agents Chemother. 39:2027–2036.

4. Allignet, J., and N. El Solh. 1997. Characterization of a new staphylococcalgene, vgaB, encoding a putative ABC transporter conferring resistance tostreptogramin A and related compounds. Gene 202:133–138.

5. Allignet, J., and N. El Solh. 1999. Comparative analysis of staphylococcalplasmids carrying three streptogramin-resistance genes:vat-vgb-vga. Plasmid42:134–138.

6. Allignet, J., N. Liassine, and N. El Sohl. 1998. Characterization of a staph-ylococcal plasmid related to pUB110 and carrying two novel genes, vatC andvgbB, encoding resistance to streptogramins A and B and similar antibiotics.Antimicrob. Agents Chemother. 42:1794–1798.

7. Allignet, J., V. Loncle, and N. El Sohl. 1992. Sequence of a staphylococcalplasmid gene, vga, encoding a putative ATP-binding protein involved inresistance to virginiamycin A-like antibiotics. Gene 117:45–51.

8. Allignet, J., V. Loncle, C. Simenel, M. Delepierre, and N. El Solh. 1993.Sequence of a staphylococcal gene, vat, encoding an acetyltransferase inac-tivating the A-type compounds of virginiamycin-like antibiotics. Gene 130:91–98.

9. Donabedian, S. M., M. B. Perri, D. Vager, E. Hershberger, P. Malani, S.

TABLE 3. Characterization of E. faecium isolates containing vgaD and vatGa

Isolate(s) Source Yr Resistancegene(s)

MIC (�g/ml)MLST profile ST

Q-D ERY VAN

JS79, KS46 Healthy humans 2003 ermB 32 256 �1 1-1-1-1-1-1-1 17ES022 Swine 2003 4 0.1 �1 5-2-22-3-1-1-5 NDA15, C19 Poultry 2000 ermB, vanA 8 256 256 9-2-1-6-1-1-1 26AS115 Poultry 2003 ermB 8 256 �1 9-2-6-32-1-7-1 NDCS098, CS103, CS106 Poultry 2003 ermB 8 256 �1 9-2-7-6-1-7-1 14CS121 Poultry 2003 ermB 32 256 �1 5-2-6-6-1-1-1 12GAV04, GAV12 Chicken meat 2003 vanA 4 �1 256 5-2-24-14-1-7-1 237

a Abbreviations: Q-D, quinupristin-dalfopristin; ERY, erythromycin; VAN, vancomycin; MLST, multilocus sequence type; ST, sequence type; ND, not determined;ES, isolates from swine feces; A, C, AS, and CS, isolates from poultry feces; JS and KS, isolates from human feces; GAV, isolates from chicken meat.

4748 JUNG ET AL. ANTIMICROB. AGENTS CHEMOTHER.

on May 2, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

Simjee, J. Chow, E. N. Vergis, R. R. Muder, K. Gay, F. J. Angulo, P. Bartlett,and M. J. Zervos. 2006. Quinupristin-dalfopristin resistance in Enterococcusfaecium isolates from humans, farm animals, and grocery store meat in theUnited States. J. Clin. Microbiol. 44:3361–3365.

10. Ehrenfeld, E. E., and D. B. Cleweell. 1987. Transfer functions of the Strep-tococcus faecalis plasmid pAD1 organization of plasmid DNA encodingresponse to sex pheromone. J. Bacteriol. 169:3473–3481.

11. Garcia-Migura, L., E. Liebana, and L. B. Jensen. 2007. Transposon charac-terization of vancomycin-resistant Enterococcus faecium (VREF) and dis-semination of resistance associated with transferable plasmids. J. Antimi-crob. Chemother. 60:263–268.

12. Hammerum, A. M., S. E. Flannagan, D. B. Clewell, and L. B. Jensen. 2001.Indication of transposition of a mobile DNA element containing the vatDand ermB genes in Enterococcus faecium. Antimicrob. Agents Chemother.45:3223–3225.

13. Haroche, J., J. Allignet, and N. El Solh. 2002. Tn5406, a new staphylococcaltransposon conferring resistance to streptogramin A and related compounds,including dalfopristin. Antimicrob. Agents Chemother. 46:2337–2343.

14. Haroche, J., J. Allignet, C. Buchrieser, and N. El Solh. 2000. Characteriza-tion of a variant of vgaA conferring resistance to streptogramin A and relatedcompounds. Antimicrob. Agents Chemother. 44:2271–2275.

15. Haroche, J., J. Allignet, S. Aubert, A. E. Van Den Bogaard, and N. El Solh.2000. satG, conferring resistance to streptogramin A, is widely distributed inEnterococcus faecium strains but not in staphylococci. Antimicrob. AgentsChemother. 44:190–191.

16. Hayes, J. R., D. D. Wagner, L. L. English, L. E. Carr, and S. W. Joseph. 2005.Distribution of streptogramin resistance determinants among Enterococcusfaecium from a poultry production environment of the U.S.A. J. Antimicrob.Chemother. 55:123–126.

17. Jackson, C. R., P. Fedorka-Cray, J. B. Barrett, L. M. Hiott, and T. A.Woodley. 2007. Prevalence of streptogramin resistance in enterococci fromanimals: identification of vatD from animal sources in the U.S.A. Int. J.Antimicrob. Agents 30:60–66.

18. Jackson, C. R., P. J. Fedorka-Cray, L. M. Hiott, and T. A. Woodley. 2008.First report of vatB and vgaB from Enterococcus gallinarum in the U.S.A. Int.J. Antimicrob. Agents 31:175–187.

19. Jensen, L. B., A. M. Hammerum, and F. M. Aarestup. 2000. Linkage of vatEand ermB in streptogramin-resistant Enterococcus faecium isolates from Eu-rope. Antimicrob. Agents Chemother. 44:2231–2232.

20. Jensen, L. B., A. M. Hammerum, F. Bager, and F. M. Aerestrup. 2002.Streptogramin resistance among Enterococcus faecium isolated from produc-tion animals in Denmark in 1997. Microb. Drug Resist. 8:369–374.

21. Jung, Y.-H., Y. S. Lee, J. O. Ahn, H. R. Lee, J. K. Lee, J. I. Yoo, H.-S. Kwak,and B. S. Kim. 2006. Prevalence and genetic relatedness of vancomycin-resistant enterococci isolated from livestock and humans after ban of avopar-cin in Korea. Infect. Chemother. 38:7–14.

22. Kadlec, K., and S. Schwarz. 2009. Novel ABC transporter gene, vagC, lo-cated on a multiresistance plasmid from a porcine methicillin-resistantStaphylococcus aureus ST398 strain. Antimicrob. Agents Chemother. 53:3589–3591.

23. McDermott, P. F., P. Cullen, S. K. Hubert, S. D. McDermott, M. Bar-tholomew, S. Simjee, and D. D. Wagner. 2005. Changes in antimicrobialsusceptibility of native Enterococcus faecium in chickens fed virginiamycin.Appl. Environ. Microbiol. 71:4986–4991.

24. Oh, W. S., K. S. Ko, J.-H. Song, M. Y. Lee, S. Perk, K. R. Peck, N. Y. Lee,C.-K. Kim, H. Lee, S.-W. Kim, J.-S. Yeom, H. K. Ki, and G.-J. Woo. 2005.High rate of resistance to quinupristin/dalfopristin in Enterococcus faeciumclinical isolates from Korea. Antimicrob. Agents Chemother. 49:5176–5178.

25. Rende-Fournier, R., R. Leclercq, M. Galimand, J. Duval, and P. Courvalin.1993. Identification of the satA gene encoding a streptogramin A acetyltrans-ferase in Enterococcus faecium BM4145. Antimicrob. Agents Chemother.37:2119–2125.

26. Ross, J. I., E. A. Eady, J. H. Cove, W. J. Cunliffe, S. Baumberg, and J. C.Wootton. 1990. Inducible erythromycin resistance in staphylococci is en-coded by a member of the ATP-binding transport super-gene family. Mol.Microbiol. 4:1207–1214.

27. Seoane, A., and J. M. García Lobo. 2000. Identification of a streptogramin Aacetyltransferase gene in the chromosome of Yersinia enterocolitica. Antimi-crob. Agents Chemother. 44:905–909.

28. Soltani, M., D. Beighton, J. Philpott-Howard, and N. Woodford. 2000. Mech-anisms of resistance to quinupristin-dalfopristin among isolates of Entero-coccus faecium from animals, raw meat, and hospital patients in WesternEurope. Antimicrob. Agents Chemother. 44:433–436.

29. Walker, J. E., M. Saraste, M. J. Runswick, and N. J. Gay. 1982. Distantlyrelated sequences in the �- and �-subunits of ATP synthase, myosin, kinases,and other ATP-requiring enzymes and a common nucleotide binding fold.EMBO J. 1:945–951.

30. Werner, G., B. Hildebrandt, I. Klare, and W. Witte. 2000. Linkage of deter-minants for streptogramin A, macrolide-lincosamide-streptogramin B, andchloramphenicol resistance on a conjugative plasmid in Enterococcus fae-cium and dissemination of this cluster among streptogramin-resistant en-terococci. Int. J. Med. Microbiol. 290:543–548.

31. Werner, G., I. Klare, and W. Witte. 2002. Molecular analysis of strepto-gramin resistance in enterococci. Int. J. Med. Microbiol. 292:81–94.

32. Werner, G., I. Klare, H. Heier, K.-H. Hinz, G. Bohme, M. Wendt, and W.Witte. 2000. Quinupristin/dalfopristin enterococci of the satA (vatD) andsatG (vatE) genotypes from different ecological origins in Germany. Microb.Drug Resist. 6:37–47.

33. Werner, W., and W. Witte. 1999. Characterization of a new enterococcalgene, satG, encoding a putative acetyltransferase conferring resistance tostreptogramin A compounds. Antimicrob. Agents Chemother. 43:1813–1814.

VOL. 54, 2010 CHARACTERIZATION OF STREPTOGRAMIN A RESISTANCE GENES 4749

on May 2, 2018 by guest

http://aac.asm.org/

Dow

nloaded from

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, July 2011, p. 3647 Vol. 55, No. 70066-4804/11/$12.00 doi:10.1128/AAC.00559-11Copyright © 2011, American Society for Microbiology. All Rights Reserved.

AUTHOR’S CORRECTION

Characterization of Two Newly Identified Genes, vgaD and vatG, ConferringResistance to Streptogramin A in Enterococcus faecium

Young-Hee Jung, Eun Shim Shin, Okgene Kim, Jung Sik Yoo, Kyeong Min Lee,Jae Il Yoo, Gyung Tae Chung, and Yeong Seon Lee

Division of Antimicrobial Resistance, Center for Infectious Disease Research, National Institute of Health, 194, Tongil-Lo,Eunpyung-Gu, Seoul 122-701, Republic of Korea

Volume 54, no. 11, p. 4744–4749, 2010. Throughout the paper, the gene designation vatG should be vatH.

3647