characterization of the saccharomyces castellii telomeric protein cdc13
DESCRIPTION
Degree project carried out at the Department of Cell and Organism Biology of Lund University, Sweden.Project supervisor: Dr Marita CohnCharacterization of the Saccharomyces castellii telomeric protein Cdc13TRANSCRIPT
![Page 1: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/1.jpg)
1
Report of Applied work for Exchange Student
Characterization of the Saccharomyces castellii telomeric protein Cdc13 Mario D. Siqueira Molecular Genetics 2006
![Page 2: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/2.jpg)
2
Applied work carried out during the Socrates-Erasmus Exchange Programme at
The Molecular genetics of telomeres and telomerase Group from
Lund University’s Faculty of Science Department of Cell and Organism Biology, Lund, Sweden
Institutionen för cell- och organismbiologi,
Lunds universitet, Sölvegatan 35, 223 62 Lund
Supervisor at Lund University
Professor Marita Cohn
Supervisor at Faculdade de Ciências e Tecnologia/UNL
Professor Isabel Spencer-Martins
Spring Term, 2006
![Page 3: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/3.jpg)
3
Contents
Abstract................................................................................................................................ 4
Introduction ........................................................................................................................ 5
Materials and Methods ....................................................................................................... 8
Electrophoresis of Plasmid cleavage products ............................................................... 8
Expression and Purification of scasCdc13p amplicons .................................................. 8
SDS-PAGE of different purified fractions ...................................................................... 9
5’-end labelling of oligonucleotides .............................................................................. 10
Electrophoretic Mobility Shift Assay (EMSA) .............................................................. 10
Results and Discussion ....................................................................................................... 11
References ......................................................................................................................... 15
Appendix............................................................................................................................ 16
![Page 4: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/4.jpg)
4
Abstract
he primary function of Saccharomyces cerevisiae Cdc13p (scerCdc13p) is to
recruit protein complexes for telomeric protection and replication.
Saccharomyces castellii Cdc13p (scasCdc13p) is similar in amino acid (aa)
sequence and nucleotide sequence to the S. cerevisiae counterpart. Partial scasCDC13
constructs encompassing different regions of the gene were expressed in E. coli, affinity
purified and analysed for its binding by Electrophoretic Mobility Shift Assay. The
scerCdc13p DNA Binding Domain is known and its binding features have been studied
before. Here we showed that the truncated protein scasCdc13p-(402-824) behaves
similarly to full-length scasCdc13 protein and has the ability to bind strongly to the 5’-
GTGTCTGG-3’ telomeric sequence. In contrast, scasCdc13p-(402-659), which is shorter
in its C-terminal sequence, displays a lower ability to bind this sequence. Constructs
lacking the N-terminal failed to produce any shift.
T
![Page 5: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/5.jpg)
Introduction
5
Introduction and Objectives
he terminal regions of eukaryotic chromosomes (telomeres) have major role in
maintaining the chromosomal integrity. During nuclear division the cell needs
to replicate the exact sequence of its helix DNA for its daughter cells and the
DNA polymerase do this replication.
One problem arises in the end of this process when the last RNA primer of the
lagging strand is removed and the absence of a free 3’ terminus prevents the association
of the DNA polymerase to fill the gap left. If the cell didn’t have any mechanism to
circumvent this problem, this erosion of the chromosomes would lead to degradation of
functional genes, to instability of the whole chromosome and eventually to apoptosis in
response to critical DNA degradation.
In human it has been observed that telomere instability is frequently associated
with either cellular aging or cancer.
Telomeres maintain the integrity of the linear chromosome in various ways. The
telomeric nucleo-protein complex and conformation protects the DNA from exonuclease
degradation while also making it distinguishable from a gap in the DNA chain – the cell
responds to DNA gaps triggering its DNA damage pathways that can lead to cell cycle
arrest or ultimately to apoptosis. Also, without this protective cap, chromosome ends
could fuse with each other leading to chromosomal aberrations.
Among other proteins that associate with telomeres we have, in Saccharomyces
cerevisiae, the Cdc13p. Cdc13p is a telomere terminus factor and it has a role not only in
the maintenance of the structural integrity of the telomere but also in recruiting
telomerase. This factor binds to the G-rich, single strand DNA.1
In telomeres we can usually find repeated units of 8-26 bp each and in some
species – like in humans – there is high homogeneity between units while in others –
like in S. cerevisiae – there is high variability in each unit.
The importance for human health of studying the Saccharomyces castellii
Cdc13p (scasCdc13p) is the fact that it is very similar to scerCdc13p which in turn is a
T
![Page 6: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/6.jpg)
Introduction
6
functional homolog of another single-stranded binding factor in humans – the POT1.2; 3
Also, if S. cerevisiae telomeres are characterized by having irregular repeats,4 the S.
castellii telomeres are composed by homogenous repeats of 5’-TCTGGGTG-3’ units.1 So,
using S. castellii as model for telomere research might yield information more relevant
to human telomere maintenance mechanisms.
S. castellii CDC13 (scasCDC13) was identified using a BLAST of its total genomic
DNA sequence against S. cerevisiae CDC13 (scerCDC13) and displayed similar structure
with a internal DNA binding domain (DBD).5; 6 The results showed a 28% of identity for
the full-length protein and 38% for the DBD while similarity goes as high as 45% and
59%, for respective sequences.1 The scerCdc13p-DBD in complex with its DNA target has
been analysed by NMR and it has been determined to form an OB-fold
(oligonucleotide/oligosaccharide binding). OB-folds are tertiary structures formed by
β1-β2 and β4-β5 loops and they are common in telomeric DNA interacting proteins.7
The DNA-contacting residues identified in the scerCdc13p classical OB-fold domain are
highly conserved in scasCdc13p (45% identity and 82% similarity), suggesting a similar
mode of DNA binding for scasCdc13p.1 Typically a OB-fold domain interacts with small
ligands of 2 to 5 nt.8 Although only one OB-fold has been demonstrated to exist in S.
cerevisiae, a second one has been predicted bioinformatically.9 Here we are beginning
to delineate the functional DBD of scasCdc13p.
Electrophoretic mobility shift assay has been long used in studies on DNA-
protein interactions. The rationale is that a protein bound to a DNA probe (radioactively
marked) will cause a shift in its mobility in a native gel electrophoresis. Thus, by
devising different DNA probes one can test the ability of binding (or not) of a given
protein to that specific probe. Common assays include: increasing amount of protein
concentration and competition with specific and non-specific sequences.
With the identification of the scasCDC13 gene and its product protein it is
important to identify the protein region that interacts with DNA itself – the DNA
Binding Domain. Six different constructs of the scasCDC13 gene – all containing the
![Page 7: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/7.jpg)
Introduction
7
region that has the highest amino acid identity with scerCDC13 region encoding the
DBD – had previously been constructed and cloned (see Figure 1).
Here we report the findings on the binding features of 4 of those truncated
proteins. We show that amplicon I and VI cannot produce any clear shift in an EMSA
using the known minimal binding site (MBS) while amplicon IV and V do bind albeit
showing different characteristics.
Figure 1. scasCdc13p partial constructs (amplicons). The box delimits the protein region with highest similarity and identity with scerCdc13p DBD. Amplicon I gene has 1323 bp and its protein weighs 48,9kDa. Amplicon II gene has 1970 bp and its protein weighs 73,3 kDa. Amplicon III gene has 1266 bp and its protein weighs 46,9 kDa. Amplicon IV gene has 771 bp and its protein weighs 28,6 kDa. Amplicon V gene has 1269 bp and its protein weighs 46,9 kDa. Amplicon VI gene has 570 bp and its protein weighs 26 kDa. The four shortest constructs (I, IV, V and VI) were chosen for the present DBD localization.
![Page 8: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/8.jpg)
Materials and Methods
8
Materials and Methods
ix different scasCDC13 partial gene constructs (amplicon) were conceptualized
and prepared (as briefly described in this paragraph) prior to the studies
narrated in this report. Each construct was fused with a pGEX-6p-1 (Amersham
Biosciences) plasmid upstream to the Glutathione S-transferase (GST) gene and
transformed into E. coli (DH5α strain). scasCDC13+GST fusion constructs as well as
empty vectors were transformed into E. coli (BL21 strain) for expression.
Electrophoresis of Plasmid cleavage products
Verification of the success of previous transformation into E. coli BL21 was
required. Overnight cultures prepared with one colony of each amplicon. Amplicon I
and V were cleaved with EcoRI restriction enzyme; amplicon III, IV and VI were cleaved
with BamHI; amplicon II was cleaved with BanII. All cleavage reaction contained 1,5 μL
of cleavage buffer, aprox. 500 ng of DNA and 0,5 μL of restriction enzyme. Reactions
were incubated at 37 ̊ C for 1 hour. Reaction products were loaded to a 0,8 agarose gel
(0,8g agarose and 5 μL Ethidium Bromide) immersed in 0,25xTBE buffer (diluted from
10xTBE – 108 g/L of Tris-hydroxymethylaminomethane, 55 g/L of Boric acid and 40
mL of 0,5 M EDTA pH 8,0).
Expression and Purification of scasCdc13p amplicons
Expression of each scasCdc13p amplicon was induced in previously prepared
cultures of transformed E. coli (BL21 strain) with pGEX-6p-1 plasmid fused with one
gene construct. Overnight cultures of pGEX-6p-1 were prepared by inoculating 5 mL of
LB medium (10g/L of peptone, 5g/L of yeast extract, 10g/L of NaCl) and 2,5 μL of
ampicillin (100mg/mL) with one colony. These transformants were cultured in 1 L of LB
medium with 100 μg/mL carbenicillin at 30 ̊C to A 600=0,5. At this point IPTG was
added to a final concentration of 1 mM and the culture is left to grow for another 4h at
25 ˚C. Samples are taken before adding IPTG, after 2 hours after the growth and at the
end of 4th hour, to be analysed in SDS-PAGE. The pellet resulted by centrifugation at
S
![Page 9: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/9.jpg)
Materials and Methods
9
6000 rpm for 20 minutes (at 4 ̊ C) is kept at -20 ˚C overnight. The pellet is thawed on
ice and resuspended in 20 mL of lysis buffer (50 mM Tris–HCl (pH 7,6), 1% (v/v)
Triton-X100, 2 mM EDTA, 10% (v/v) glycerol, 0,5 M NaCl, 5 mM DTT and 1x protease
inhibitor cocktail (Roche)) and passed through French Press 3 times. The lysate is
centrifuged (at 14000 rpm for 20 minutes, at 4 ̊ C), the supernatant is passed through a
Whatman filter and a 45 μm filter (samples are taken out for raw extract analysis) and
the resulting solution is freeze overnight at -80 ˚C. The cleared lysate is mixed with the
purification slurry (2 mL GS4B slurry and 2 mL of 1xPBS) for purification in the
Glutathione Sepharose 4B column (Amersham Biosciences). Glutathion elution buffer is
added to the column and approximately 2 mL of purified GST+scasCdc13p-construct is
collected. The first EMSA tests are performed with these hybrid proteins. Later on it was
decided to cleaved-off the GST-tag by first exchanging to a cleavage buffer and then
adding 20 units/mL of PreScission protease (Amersham Biosciences). After some other
EMSA it was decided to cleave the rest of the uncleaved fraction without the buffer
exchange step, only by adding 40 units/mL of PreScission protease directly to the
solution.
SDS-PAGE of different purified fractions
Samples precipitated and the pellet solved in SDS-PAGE Sample Buffer. For each
loading reaction 3 μL of sample is mixed with 4,5 μL of TrisHCl (0,5 M pH6,8) and 7,5
μL of 2xSDS-PAGE Sample buffer. A total of 15 μL is loaded to each well on stacking gel
(1,25 mL of Acrylamide 40% 29:1, 2,52 mL of TrisHCl 0,5 M pH6,8, 10% SDS, 10% APS
and 10 μL TEMED; for a total of 10mL volume) and run at 16mA (running buffer – 3 g/L
Tris-base, 14,4 g/L of glycine and 1 g/L of SDS). The current is then switched to 22mA at
the resolving gel (6 mL of Acrylamide 40% 29:1, 7,5 mL TrisHCl 1 M pH8,8, 10% SDS,
10% APS and 8 μL TEMED) for approximately 45 minutes. The gel is then immersed in
fixing solution (25% isopropanol and 10% acetic acid) for 45 minutes, then transferred
to the staining solution for overnight, then de-stained for 1 hour in de-staining solution
(10% acetic acid). Finally, gel is dried attached to a porous paper for 2 hours at 80 ˚C.
![Page 10: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/10.jpg)
Materials and Methods
10
5’-end labelling of oligonucleotides
For a 10 μL reaction volume, 5 pmol/μL of oligonucleotide were mixed with 2 μL
of [γ-32P]ATP, 0,5 μL of T4 Polynucleotide kinase (5 units – Promega) and enough water
and incubated in 37 ̊C for 1 hour. Enzyme was inactivated by heat at 70 ˚C for 10
minutes. Unincorporated labelled nucleotides were removed using MicroSpin™ G-25
columns (Amersham) following manufacturer protocol.
Electrophoretic Mobility Shift Assay (EMSA)
Different fractions and elutions from protein expression and purification process were
tested using different oligonucleotides (see Table 1). Probes were labelled at 5’-end with [γ-32P]ATP and all single stranded oligonucleotides were boiled for 2 minutes and snap-cooled
before use. In all reactions 10 fmol of radioactively labelled oligonucleotide was mixed with 1
μg non-specific competitor poly(dI-dC), purified protein and binding buffer (final concentration
of 50 mM Tris-HCl – pH 7,5 –, 2,5 mM MgCl2 and 8% glycerol). For competition analysis
increasing amounts of non-labelled oligonucleotides were added to the reaction. The binding
reactions were incubated at 25 ˚C and then loaded on a 4% non-denaturing polyacrylamide gel.
The electrophoresis were carried-out in 1xTBE buffer (89 mM Tris-borate, 2 mM EDTA – pH
8,0 –) at 150 V for 2 hours and the gels were dried and analysed using a phosphorimager.
Table 1. Oligonucleotides used in this study Name Sequence 5’ to 3’ Length (nt)
Scast8E GTGTCTGG 16
Scast10C GGGTGTCTGG 10
Scast11B TGTCTGGGTGT 11
Scast12A GTCTGGGTGTCT 12
Scast12C GGGTGTCTGGGT 12
Scast14C GGGTGTCTGGGTGT 14
Scast14C5 GGGTCCTCTGGGTGT 14
Scast14C9 GGGTGTCTCCGGTGT 14
Scast16B TGTCTGGGTGTCTGGG 16
Scast16B:R CCCAGACACCCAGACA 16
Scast16C GGGTGTCTGGGTGTCT 16
Scast17A GTCTGGGTGTCTGGGTG 17
Scast20iiF ACCTGGGTGTCTGGGTGTAC 20
![Page 11: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/11.jpg)
Results and Discussion
11
Results and Discussion
efore working with the different construct, some preliminary assays were
performed while the GST-tag was still fused to each truncated protein. All
amplicons displayed a shift in their test although some more strongly than
others (data not shown). Later on we proceeded with the protocol and the GST-tag was
cleaved after a buffer exchange. Because the following EMSA showed a drastic change in
the binding of amplicon I, IV and VI, we hypothesised that the several thawing steps and
the buffer exchange step might have had an influence in the results and thus we decided
to perform the cleavage directly in the elution buffer.
Amplicon I and VI cannot induce a shift
Although in preliminary EMSA, where different fractions of the purified
amplicon I were mixed with labelled Scast20iiF (the longest probe), a slightly faint shift
could be observed, after the cleavage of the GST-tag that shift is lost (see Figure 2). Also,
in subsequent tests with Scast10C and Scast8E it also failed to produce any shift (data
not shown).
Amplicon VI, which is the equivalent to scerCdc13p DBD, also failed to produce
any shift after cleaving off the GST-tag (data not shown). Moreover, the shift produced
by amplicon VI fused to GST-tag is almost undetectable even when tested with the
longest Scast20iiF labelled probe.
B
Figure 2 Amplicon I: shift detected when protein fused to GST (arrow, +GST) but is lost when GST is cleaved off (-GST, cleavage after the buffer exchange). All lanes has labelled Scast20iiF. Black triangles indicates increasing ammount of protein in the wells
![Page 12: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/12.jpg)
Results and Discussion
12
Amplicon V induces a shift
Amplicon V produced a clear shift in EMSA in all its different fractions of
purification. In a test where 8-mer, 10-mer and 16-mer oligonucleotides were used it
showed that amplicon V binds more stably to the longer probe (see Figure 3) (result also
in accordance to a previous test where amplicon V bound stably to labelled Scast20iiF –
data not shown). Also important to note is that even though amplicon V binds strongly
to long probe (leaving almost no noticeable free probe) when mixed with Scast20iiF and
Scast16B we get a long smear from the well to the band of probe-protein complex. This
could indicate that we have complexes with different motilities, which might suggest
that more than one protein is being attached to the same probe or proteins aggregated
together. This could be caused by high concentration of protein (concentration of
protein was not determined after expression), which promoted the aggregation.
Alternatively it could be caused by aggregation in the well, followed by subsequent
release during the run.
Amplicon IV induces a shift
Although amplicon IV couldn’t induce any shift when mixed with the minimal
binding site (MBS) of the full-length protein, Scast8E, it showed a clear shift against
longer probes such as the Scast17A (see Figure 4). Also, in competing tests with the
reverse C-rich strand of Scast16B and double stranded Scast16B it couldn’t produce any
shift even when present in higher concentration (see Figure 5). Moreover, when mixed
with mutated Scast14C5 (5th nt mutated) and Scast14C9 (9th nt permutated) amplicon VI
also failed to produce a shift (see Figure 6a). Interestingly, this same analysis was done to
Figure 3 Amplicon V binds more strongly to long probes (arrows). (-) lanes don't have protein, (+) lanes contain full-length Cdc13p. Notice that no free probe can be detected at the gel front. Also notice the long smear in the Scast16B lanes.
![Page 13: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/13.jpg)
Results and Discussion
13
the full-length scasCdc13p and it showed that the binding was not seriously affected by
these point mutations (see Figure 6b). This finding is interesting because previously it was
described1 that both nucleotides mutated were essential for the stability of the binding
in a shorter 10-mer oligonucleotide including the MBS at the 3’-end. Now with a longer
oligonucleotide we could retain the binding which might suggest that even though the
MBS motif is crucial for a correct binding, the size of the sequence in which MBS is
included might also be relevant. Moreover, the absence of binding with the partial
scasCdc13p, amplicon IV, could suggest that for the correct binding an additional region
of the C-end sequence may be required. This statement is in agreement to the fact that
amplicon V (which is longer than IV in the C-end direction) can bind to shorter
oligonucleotides (although no mutational analysis was made with amplicon V). This
extra sequence of amplicon V might contain the predicted second OB-fold which is
increasing the affinity of the protein to its specific motif.
Figure 4 Amplicon IV binding to labelled Scast16B is challanged by a) Scast17A b) Scast11B. Competitor 10x, 100x and 1000x the concentration of Scast16B as indicated by black triangles.
Figure 5 First lane contains Amplicon IV mixed with Scast16B. Second lane full-length is mixed with the complementing oligonucleotide Scast16B:R. Next 3 lanes contain increasing amount of amplicon IV mixed with Scast16B:R while the last 3 lanes the same were mixed with double strand Scast16B:R/F.
![Page 14: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/14.jpg)
Results and Discussion
14
Moreover, amplicon I differs from IV and V in lacking part of the N-terminal
sequence. Since amplicon I failed to show any clear binding we suggest that the gene
construct did not include (at least) the total sequence necessary for the DBD. However
we cannot exclude the possibility that the amplicon I protein was not properly folded.
These are all very preliminary findings and more conclusive statements cannot be
made before further studies with Amplicon V and eventually amplicon III, which
includes more of the N-end sequence and which could elucidate the amplicon I result.
For the next steps we would suggest the creation of an additional amplicon based
on amplicon VI but adding to it the portion of C-terminal sequence included in amplicon
V to elucidate the presence of a second OB-fold. Furthermore, and depending on results
given by studying these two amplicons (III and VI with amplicon V C-terminal) the
creation of further shorted amplicons would delimit more accurately the DBD and its
hypothetical two OB-folds.
Figure 6 a) Amplicon IV mixed (in increasing amount) with Scast14C5 (first 2 lanes) and Scast14C9 (next 4 lanes). The (+) lane is the control with amplicon IV binding to Scast14C. b) Full-length scasCdc13p (in increasing amount) mixed with Scast14C (first 4 lanes), with Scast14C5 (next 4 lanes) and Scast14C9 (last 4 lanes). Black triangles indicates increasing amount of protein.
![Page 15: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/15.jpg)
15
References
1. Rhodin, J., Astromskas, E. & Cohn, M. (2006). Characterization of the DNA
binding features of Saccharomyces castellii Cdc13p. J Mol Biol 355, 335-46.
2. Lin, J. J. & Zakian, V. A. (1996). The Saccharomyces CDC13 protein is a single-
strand TG1-3 telomeric DNA-binding protein in vitro that affects telomere
behavior in vivo. Proc Natl Acad Sci U S A 93, 13760-5.
3. Nugent, C. I., Hughes, T. R., Lue, N. F. & Lundblad, V. (1996). Cdc13p: a single-
strand telomeric DNA-binding protein with a dual role in yeast telomere
maintenance. Science 274, 249-52.
4. Shampay, J. & Blackburn, E. H. (1988). Generation of telomere-length
heterogeneity in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A 85, 534-8.
5. Cliften, P. F., Hillier, L. W., Fulton, L., Graves, T., Miner, T., Gish, W. R.,
Waterston, R. H. & Johnston, M. (2001). Surveying Saccharomyces genomes to
identify functional elements by comparative DNA sequence analysis. Genome Res
11, 1175-86.
6. Garvik, B., Carson, M. & Hartwell, L. (1995). Single-stranded DNA arising at
telomeres in cdc13 mutants may constitute a specific signal for the RAD9
checkpoint. Mol Cell Biol 15, 6128-38.
7. Mitton-Fry, R. M., Anderson, E. M., Hughes, T. R., Lundblad, V. & Wuttke, D. S.
(2002). Conserved structure for single-stranded telomeric DNA recognition.
Science 296, 145-7.
8. Theobald, D. L., Mitton-Fry, R. M. & Wuttke, D. S. (2003). Nucleic acid
recognition by OB-fold proteins. Annu Rev Biophys Biomol Struct 32, 115-33.
9. Theobald, D. L. & Wuttke, D. S. (2004). Prediction of multiple tandem OB-fold
domains in telomere end-binding proteins Pot1 and Cdc13. Structure 12, 1877-9.
![Page 16: Characterization of the Saccharomyces castellii telomeric protein Cdc13](https://reader031.vdocuments.site/reader031/viewer/2022020217/546765d6af795974338b5674/html5/thumbnails/16.jpg)
16
Appendix