THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 268, No. 18, Issue of June 25, pp. 13601-13608,1993 Printed in U. S. A.

Characterization of the Human Interleukin-2 Receptor y Chain Gene* (Received for publication, February 2, 1993, and in revised form, March 12, 1993)

Masayuki Noguchi, Stephen Adelstein, Xiqing Cao, and Warren J. Leonard$ From the Section on Pulmonary and Molecular Immunology, Office of the Director, Intramural Research Program, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland 20892

The interleukin-2 (IL-2) receptor y chain is an essen- tial component of high and intermediate affinity IL-2 receptors (IL-~Rs), playing critical roles for ligand binding and internalization. We report here the isola- tion and characterization of the genomic locus for hu- man IL-2Ry, which, like IL-2R@, is a member of the cytokine receptor superfamily. The IL-2Ry gene is composed of eight exons and seven introns and spans approximately 4.2 kilobases. Analogous to the IL-BRB gene, the two pairs of conserved cysteines typical of cytokine receptor superfamily proteins are located in adjacent exons, and the conserved WSXWS motif is located in the exon preceding the one that encodes the transmembrane domain and a small part of the cyto- plasmic domain. In each gene, the remainder of the cytoplasmic domain is encoded by the final two exons. Southern blot analysis suggests that IL-2R7 is encoded by a single copy gene. Cross-hybridizing sequences were detected in DNA derived from a number of other mammalian species but not from yeast. Primer exten- sion analysis and ribonuclease protection assays re- vealed that there are three principal transcription ini- tiation sites located 32-38 nucleotides 5‘ to the trans- lation initiation AUG codon. These sites are upstream of the 6’ end of the published IL-2Ry cDNA sequence. The region 5’ to the transcription initiation sites ex- hibited promoter activity when cloned upstream of the luciferase reporter gene. With this study, the organi- zation of the genes encoding all three chains (e,@, and y) of the IL-2 receptor has been determined and pro- moters for each identified.

IL-2l and IL-2 receptors critically regulate the magnitude and duration of the T cell immune response following antigen activation (for review see Refs. 1-3). Resting lymphocytes express intermediate affinity receptors, whereas activated lymphocytes express high and low affinity receptors (1-3). High and intermediate affinity receptors can transduce IL-2 signals, but the low affinity receptors cannot (1-3). Different combinations of three distinct chains, denoted the a, P, and

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in thispaper hos been submitted to the GenBankTM/EMBL Data Bank with accession number(s) L12176, L12177, L12178, LI2179, L12180, L12181, L12182, and L12183.

$ T O whom correspondence should be addressed Bldg. 10, Rm.

0971. 7N244, NIH, Bethesda, MD 20892. Tel.: 301-496-0098; Fax: 301-402-

The abbreviations used are: IL-2, interleukin-2; IL-ZR, interleu- kin-2 receptor; kb, kilobase(s); PCR, polymerase chain reaction; bp, base pair(s).

y chains (4-17), form these three different classes of IL-2 receptors. Whereas low affinity receptors contain IL-2Ra, but not IL-2RP or IL-2R7, intermediate affinity IL-2 receptors contain IL-2RP and IL-2R-y chains, but not IL-2Ra. High affinity receptors contain all three chains.

The genes for IL-2Ra and IL-2Rp have been characterized previously. IL-2Ra is not expressed on resting cells but is strongly induced following T cell activation (1-3). Its gene spans more than 35 kb on chromosome 10~14-15 (18-20) and is organized in eight exons and seven introns. IL-2RP is constitutively expressed but is induced 5-10-fold following antigen stimulation (11). Its gene spans 24 kb on chromosome 22q11.2-12 and is organized in 10 exons and nine introns (21, 22). Relatively little is known about the IL-2R-y gene or the regulation of its expression. As one important step toward understanding the mechanism of expression of the human IL- 2R-y gene, we have cloned the IL-2Ry chromosomal gene. We report the genomic organization, characterization of tran- scription initiation sites, and the identification of the IL-2Ry promoter.

MATERIALS AND METHODS

Oligonucleotides-Oligonucleotides were synthesized on an Applied Biosystems model 392 DNA/RNA synthesizer. These are summarized in Table I. The numbering of all oligonucleotides and sequences in this paper is based on assigning the major transcription site defined in this paper as +l. The oligonucleotides used for identifying cDNA and genomic clones were based on the IL-2R-y cDNA sequence of Takeshita et al. (15).

Identification of a Full-length IL-2R-y cDNA-A full-length IL-2Ry cDNA was generated by PCR using oligonucleotide primers ycDNAl and ycDNA2 (Table I) and a double-stranded DNA template prepared from a YT-1 human natural killer-like cell cDNA library. The oligo- nucleotides contained artifical HindIII and XhoI sites, respectively, and the cDNA was cloned into pcDNAIneo (Invitrogen) between the HindIII and XhoI sites. The cDNA sequence was identical to that of the published cDNA except that Ser-29 is encoded by AGT instead of AGC.

Identification of IL-2R-y Genomic Phage Clones-A human genomic DNA library (made in the laboratory of T. Maniatis, Harvard Uni- versity) was prepared by partial AluI plus HaeIII digestion of fetal liver DNA followed by cloning into the EcoRI site of Charon 4A (23). 1.2 X lo6 phage were plated at a density of 40,000 phage/plate. A 5’ 62-mer, ygenl (Table I), was labeled using [32P]ATP and polynucle- otide kinase and hybridized to duplicate filters. DNA from each of 22 hybridizing clones was analyzed by ethidium staining of EcoRI digests and by Southern blotting with 32P-labeled ygenl and ygen2, which are at the 3’ end of the cDNA (Table I). The hybridizing 5’ EcoRI fragment of 7.9 kb and 3’ EcoRI fragment of 4.0 kb (see Fig. L4) were subcloned into pBluescript I1 SK(+) (Stratagene). A truncated 5’ fragment of 5 kb (Fig. L4) from a foreshortened phage clone was also subcloned into pBluescript I1 SK(+).

DNA Sequence Analysis-All DNA sequences were determined by the dideoxy method, using Sequenase 2.0 (U. S. Biochemical Corp.).

Polymerase Chain Reaction-100-pl PCR reactions contained 5 ng of template DNA in 50 mM KC1, 10 mM Tris-HC1, pH 8.3, 1.5 mM MgC12, 0.01% gelatin, a 1 FM concentration of each oligonucleotide primer, a 200 PM concentration of each dNTP, and 2.5 units of Pfu DNA polymerase (Stratagene). Twenty-five cycles were performed

13601

13602 Characterization of Human IL-2Rr Gene

TABLE I Oligonucleotides used in this paper

Coordinates for all oligonucleotides are given from 5’ to 3’. Thus, if an oligonucleotide corresponds to the bottom strand, the 5’ coordinate is downstream of the 3’ coordinate.

ycDNAl

ycDNA2

~ ~~ ~~~ ~

5’ - CCCAAGCTTGAAGAGCAAGCGCCATGTTG - 3’ , ~~~~~

top strand of 5’ end of cDNA, +23 to +42, and adding an artificial HindIII site (underlined) and three flanking Cs

5“CCGCTCGAGCCACTTAGGGCTACAGGAC - 3’, corresponding to the bottom strand downstream of stop codon, +1195 to +1177, and adding an artificial XhoI site (underlined) and three flanking nucleotides

5’-GAAGAGCAAGCGCCATGTTGAAGCCATCATTACCATTCACATCCCTCTTATTCCTGCAGCTG-3‘, 62-mer corresponding to +23 to +84 (5’ end of cDNA)

5’-TCCATCTACCCTCCGATTGTTCCTGAACCGATGAGAAAT~GTTTCTGTTGATAATCATC-3‘, 61-mer corresponding to nucleotides +1413 to +1473, at the 3’ end of the cDNA, spanning the poly(A) addition signal

?Primer A 5’-CCATTGGGCGTCAGAATTGTCGTGTTCAGC-3’, +131 to +102, for primer extension

?Primer B 5’-AACGCTGAGGGAGTCAGTGGGCATAGTGGTC-3’, +192 to +162, for primer extension

yProl

yPro2

5’ - GATGGGAAGCTTGAAGCTAGTA- 3’, for PCR amplification of the IL-2Ry promoter, naturally occurring HindIII site is underlined, -612 to -591

5‘ -GTACTAAAGCTTGGCGCTTGCTCTTCATTCC- 3‘, for PCR amplification of the IL-2Ry promoter, +36 to +18 plus artificial Hind11 site (underlined) and 6 flanking bases

Oligonucleotides for sequencing the promoter, exons and splice junctions: Promoter plus exon 1, top strand

M34 5’-GACTGAGAGGGTGACGATAC-3‘, -679 to -660 M24“ 5’ -GTCACACTTCCTCCCCAGTC-3’, -551 to -532 M39 5’ -ACAGTAGAGCTTTGACAGAG- 3’ . -410 to -390 M40 5’ -ATGATTTAGAGGAGAAGGTG-3’, -300 to -281 M41 5‘-AATCTCCTAGAGGACTTAGC-3’, -153 to -134 M1O 5’ -CTCTTATTCCTGCAGCTGCC- 3’, +67 to +86

Promoter plus exon 1, bottom strand y 5’ - GAAATCAGCTGTGGTGTCTTC - 3 ‘ , +156 to +136 yPrimer A 5’ -CCATTGGGCGTCAGAATTGTCGT

GTTCAGC - 3‘, +131 to +lo2 M9“ 5’-TCCTCTGTCATAGCTTTCG-3’, -51 to -69 M18 5’-CGACATCACCGTTCTATGC-3’, -337 to -355 M23” 5’ - GACTGGGGAGGAAGTGTGAC - 3 ‘ , -532 to -551

Exon 2 Top strand M16 5’ - TTTCTTCCTGACCACTATGCC - 3‘ , +153 to +173 Bottom strand M17 5‘ - ATAATGCAGAGTGAGGTTGG - 3‘ , +303 to +284

Top strand M11 5‘ - GTACAAGAACTCGGATAATG - 3’, +306 to +325 Bottom strand y8 5‘-GTTTGGTAGAGGTGGATCTC-3‘, +416 to +397

Exon 3

Exon 4 TOD strand M12 5’ - CTTCACAAACTGAGTGAATC - 3‘. +520 to +539 Boltom strand y9 5’-CAGTCCAGCTGTGGTCCCAG-3’, +631 to +612

Top strand 75 5 ’ - CTCTGTGGAAGTGCTCAG - 3’ , +724 to +741 Bottom strand M13 5’ - CTTTTGAAGTATTGCTCCC- 3‘. +793 to +775

Top strand M14 5‘ - GAATCCTTTCCTGTTTGC - 3’ , +795 to +812 Bottom strand M19 5‘ - CGTTCCAGCCAGAAATACAC - 3’ , +890 to +871

Top strand T7 primer, initiating in plasmid containing the 4-kb 3’ genomic fragment (see Fig. 1A) Bottom strand T3 primer, initiating in plasmid containing the 5-kb 5’ genomic fragment

Top strand 76 5‘ - GAGTGGTGTGTCTAAGGGA C - 3‘ , +966 to +985 Bottom strand y l l ’ 5’-TCAGGTTTCAGGCTTTAGGGTG-3’, +1146 to +1125 ,I These oligonucleotides contain single base differences from the correct sequence, but they nevertheless functioned as sequencing primers.

Exon 5

Exon 6

Exon 7

Exon 8

Characterization of Human IL-2Rr Gene 13603

using a DNA Thermal Cycler (Perkin- Elmer-Cetus Instruments 9600) with denaturation, annealing, and extension for 1 min each at 94,55, and 72 "C, respectively.

RNA Preparation-Total cellular RNA was prepared from human Jurkat leukemic T cells using guanidine isothiocyanate followed by centrifugation through a cesium chloride gradient.

Primer Extension Assay-Synthetic oligonucleotides complemen- tary to mRNA and corresponding to +131 to +lo2 (primer A) and +192 to +162 (primer B) of the IL-2Ry cDNA were endlabeled with [Y-~'P]ATP and polynucleotide kinase (New England Biolabs) and purified by Sephadex G-25 chromatography. Each probe (500,000

cpm) was added to 20 pg of Jurkat total RNA, precipitated with ethanol, dissolved in 30 pl of aqueous hybridization solution (0.16 M Hepes, pH 7.5, 1 M NaCl, 0.3 mM EDTA pH 8.0), heated at 65 "C for 5 min, and hybridized at 42 "C for 20 h. The reaction mixtures were ethanol precipitated and resuspended in 27 pl of reverse transcriptase buffer containing actinomycin D (50 pglml), 3.5 pl of 4 mM dNTPs, and 40 units of avian myeloblastosis virus reverse transcriptase. The reactions were incubated at 42 "C for 90 min and then stopped by adding Na'EDTA to a final concentration of 20 mM. 1 p1 of 1 mg/ml pancreatic ribonuclease A was added and incubation continued for 30 min at 37 "C; the mixtures were extracted with phenol/CHCl&oa-

A IL-2Ry cDNA '

I IL-2R-y gene I Eco RI Eco RI

Hind 111 Bgi II Eco Ri m 4.7 kb fragment

Eco RI 5kb

fragment Eco RI 1 kb - ECO RI

5' Peptide Signal

I 1 151 1 9 305306 490 491 -630 631 4 4 793 794 890 891 960 961 1454

put.nve wsxws U Leuclne SH2 Ilk8

Conserved Cy.tdnes dpp.r Motif rubdomaina

K l inkd glycosylatlon siten t FIG. 1. Organization of the human IL-2R-y gene. Panel A, at the top is a schematic representation of the cDNA, divided according to

exon boundaries. Below the cDNA is a scale representation of the exons and introns. The positions of restriction enzyme recognition sites are indicated. All exons are contained on two contiguous EcoRI fragments of 7.9 and 4 k b the EcoRI site dividing these fragments corresponds to the EcoRI site contained within the cDNA. The 4.7- and 5-kb fragments referred to in the text are indicated. Panel B, the relationship between exons and functional domains of IL-2Ry. Locations of the signal sequence, extracellular region, transmembrane domain, and cytoplasmic region are indicated. Numbers denote the nucleotide positions at which the introns interrupt the cDNA. The positions of the 4 conserved cyteine residues (black solid arrows) and six potential N-linked glycosylation sites (gray arrows) are indicated. Exons 1-6 encode the extracellular domain. Exon 4 encodes the region hypothesized to potentially represent a leucine zipper (15), and exon 5 encodes the WSXWS motif. Exon 6 encodes the transmembrane domain, and exons 7 and 8 encode the cytoplasmic domain.

13604 Characterization of Human IL-2R-y Gene

TABLE I1 Exon-intron organization of the IL-2Ry gene

Exon sequences are in capital letters, and intron sequences are in lowercase letters. The length of each exon is indicated on the left, and the amino acids interruDted by each intron are indicated on the right. Estimated sizes of the introns are also given.

Exon size

bP 151 154 185 140 163 97 70

494 to poly(A) signal

5' Splice donor

ACA-GCT-G gtggga CAT-TAT-TG gtatga AAT-CTG-G gtaatt TGG-ACT gtgagt TCA-AAA-G gtaaaa CTG-GAA-CG gtgaga TTT-TCG gtgaga

3' Splice acceptor

atctag AT-TTC-TTC ctctag G-TAC-AAG ctccag TG-ATC-CCC ctcaag GAA-CAA ctatagAG-AAT-CCT tgtcag G-ACG-ATG ctttag GCC-TGG

Approximate intron size

bP 360 240 220 730 530 260 370

Amino acid interrupted

ASP-17 Tw-68 Val-130 Thr-176/Glu-177

Arg-265 Ser-286/Ala-287

Glu-231

FIG. 2. DNA sequence of the IL- 2Rr promoter. + I corresponds to the major transcription initiation site iden- tified by primer extension and ribonucle- ase protection assays. The three princi- pal transcription initiation sites are underlined (-2, +1, and +5). Also in- cluded is the sequence of the entire first exon and part of the first intron. The coding region and deduced amino se- quence are in bold. The beginning of the first intron is indicated by an open bracket. The HindIII, PleI, and BglII sites are marked. The arrow indicates the point of digestion by PleI on the bottom strand and therefore represents the 3' end of the RNA probe generated in the ribonuclease protection assay.

Hind III ~~;?;AAGCTAGTATTTGTTCCTCCATTTCTAGAATATTTTTGTATTATAAGTCAC

ACTTCCTCGCCAGTCTCAACAGGGACCCAGCTCAGGCAGCAGCTAAGGGTGGGTATTCTG

GTTTGGATTAGATCAGAGGAACAGCTGTATATGTGCCCACAGGAGCCAAGACGGTAT

TTTCCATCCTCCCAAAACAGGTATGAGCTTTGACAGAGATTTAAGGGTGACCAAGTCMG

GAAGAGGCATGGCATAGAACGGTGATGTCGGGGGTGGGGGGlTCAGAACmCA~ATAG

AAGGTAATGATTTAGAGGAGAAGGTGGTTGAGAATGGTGCTAGTGGTAGTGAACAGATCC Ple I

TTCCCAGGATCTAGGTGGGCTGAGGATTTT$~~Z~Y~~Y~TGA ACTATTGTATATCCAGCT c TTAGTTTCTGTTTACCACCTTACAGCAGCACCTAATCTCCTAGAGGACTTAGCCCGTGTC

A C A C A G C A C A T A T T T G C C A C A C C C T C T G T A A A G C C C T G G T C A C C G G

AAGCTATGACAGAGGAAACGTGTGGGTGGGGAGGGGTAGTGGGTGAGGGACCCAGGTTCC +1

TGACACAGACAGACTACACCCAGGGAATGMGAGCAAGCGCCATQ-QCCATCATTA MetLeuLysProSerLeu

C C A T T C A C A T C C C T C T T A T T C C ~ ~ ~ C C C C M C T O O O ProPhaThrSerLeuLeuPheLeuQlnLeuProLeuLeuQ1yVa1QlyLeuAsnThrThr

ATTCTOACOCCCCACCACA~~TGGGAATCTGGGACTGGAGGG

G G C ~ G ~ A G ~ G G G ~ G ~ ~ ~ G G ~ ~ G G G ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~

IleLeuThrProAsnQlyAsnQl~~~T~~Ala

CCAZTACAATCATGTGGGCAGAATTGAAAAGTGGAGTGGGAAGGGCMGGGGGAGGG~

CCWCCT . . . . . . . . . . . . .

-547

-487

-427

-367

-307

-247

-187

-127

-67

-7

+54

+114

my1 alcohol, precipitated with ethanol, and analyzed on sequencing gels. Primer A was used in parallel in a sequencing reaction to determine the exact positions of the transcription start sites.

Ribonuclease Protection Assays-Ribonuclease protection assays were performed using the RPA I1 Ribonuclease Protection Assay Kit (Ambion, Inc.). The 4.7-kb EeoRI to BglII fragment spanning exon 1 (see Fig. L4) was subcloned into EeoRI/BamHI-digested pBluescript I1 SK(+). After linearization with PleI (position shown in Fig. 21, a 474-base long RNA probe (Fig. 3B) was generated by in vitro tran- scription using T3 polymerase (Stratagene). This probe initiates in pBluescript at +1 relative to the T3 promoter and spans IL-2Ry from the BglII site (in intron 1) to the upstream PleI cleavage site a t -206 (see Figs. 2 and 3B). The probe was purified using an 8 M urea, 6% polyacrylamide gel. lo6 cpm were denatured at 95 "C for 4 min and hybridized at 44 "C for 18 h to Jurkat RNA (1.25-20 pg). Samples were treated with RNase A and RNase T1, ethanol precipitated, and analyzed on a 6% sequencing gel.

Luciferase Assays-A 641-bp promoter fragment (-606 to +35) was generated by PCR as described above using oligonucleotides yPro1 and yPro2. The PCR product was digested with HindIII and cloned into pLuc0, a promoterless negative control vector that con- tains the luciferase cDNA downstream of a HindIII cloning site. pLuc0 was derived from pCMV-luciferase (24) by replacement of the cytomegalovirus promoter with the X h I to HindIII fragment derived

from the multiple cloning site of pBluescript 11. Transient transfec- tion of Jurkat T cells was performed using 5 pg of DNA, 500 pg/ml DEAE-dextran, and a 30-min incubation with cells, as previously described (25). Forty-eight hours following transfection, cells were harvested and lysed by sequential freezing and thawing, and luciferase activity (relative luciferase units) was determined using a Monolite 2010 model Luminometer (Analytical Luminescence) and the Pro- mega Luciferase Assay System kit.

Southern Blotting-Hybridizations were performed with Quikhyb

hybridization at 68 "C for 2-3 h and washes of 1 X SSC, 0.1% sodium (Stratagene) according to the manufacturer's recommendation, using

dodecyl sulfate twice at room temperature for 15 min, followed by 0.1 X SSC, 0.1% sodium dodecyl sulfate at 60 "C for 30 min.

RESULTS

Isolation of IL-2Ry Genomic Phage Clones-We screened approximately 1.2 X IO6 clones from a human genomic phage library using a probe corresponding to the 5' end of the human IL-2Ry cDNA (ygenl, see Table I). Four unique patterns of EcoRI digestion were identified in DNA derived from 22 original hybridizing phage clones. Based on digestion patterns and Southern blot hybridization data, we concluded that the

Characterization of Human IL-2Ry Gene 13605

A 246 -

123 -

2 Probe

369 -

246 -

123 -

I I I- 1-4 I I I

I r- Primer A I , Exon1

I, 120 90 60 30 (+I31 to +1oz) Pie I(-21g) +

Bgl II 13 - promoter

I I I 1 I& I I I I r- I Primer B Protected RNA (-150 bp)

180 150 120 90 60 30 (+192 to +162)

FIG. 3. Identification of the transcription initiation sites of the IL-2Ry gene. Panel A, primer extension analysis. Total cellular RNA was isolated from Jurkat cells and hybridized to two different 32P-end-labeled primers. Primer extension products generated from +131 to +lo2 (primer A, lane I ) and +192 to +162 (primer B, lane 2 ) were analyzed on a 6% sequencing gel. This was calibrated using primer A to generate a dideoxy sequencing ladder of IL-2R-y gene (lanes marked G, A, T, and C ) with the 7.9-kb EcoRI genomic fragment containing the promoter region. Three transcription start sites were identified (arrows). The bands visible on the gel below the 123-base marker presumably represent incomplete extension from the primers since they are downstream of ATG translation start site and therefore cannot represent initiation sites that would encode a mature IL-2R7 protein. The bottom of the panel shows a schematic of primers A and B and the primer extension products. Panel B, ribonuclease protection assay. Lune I, 32P-labeled 123-bp ladder; lane 2, no RNase control; lane 3, no RNA control; lanes 4 and 5, 10 pg of total Jurkat RNA with a 1:lOO and 1:300 dilution of 0.5 mg/ml of RNase A and 1,000 units/ml RNase T1. At the bottom of the panel is a schematic of the 474-base long RNA probe. Three bands (arrows) were detected, corresponding exactly to the transcription initiation sites identified in the primer extension study.

gene was contained on two contiguous EcoRI fragments of approximately 7.9 and 4.0 kb; the EcoRI site joining these two fragments corresponds to the single EcoRI present within the cDNA. These EcoRI fragments were separately subcloned into pBluescript I1 SK(+). The 7.9-kb fragment hybridized to the 5' oligonucleotide, and the 4.0-kb fragment hybridized to the 3' oligonucleotide. One group of phage clones had a foreshort- ened 5' end so that the 5' end of the 7.9-kb genomic EcoRI fragment was absent, and a 5-kb fragment was present instead (shown in Fig. U). We also subcloned this 5-kb fragment. Digestion of the genomic fragments with multiple restriction enzymes and Southern blot analysis allowed us to establish the relative positions of restriction endonuclease recognition sites (Fig. U).

Organization of the Human IL-2R-y Gene-We determined the DNA sequence of each exon and exon/intron splice junc- tion, using as templates the IL-2R-y genomic fragments of 5 kb (foreshortened form of the 7.9-kb genomic EcoRI frag- ment) and 4 kb subcloned in pBluescript I1 SK(+), and the

oligonucleotide sequencing primers listed in Table I. Some of these oligonucleotides had been made to confirm the sequence of our PCR-generated IL-2R-y cDNA, whereas others were specifically designed for sequencing exons as exonlintron boundaries were identified. We found that the human IL-2R-y gene is divided into eight exons and seven introns (Table I1 and Fig. 1). Each intron had typical splice donor and acceptor motifs (26) and began with GT and ended with AG. The length of each intron was determined by PCR using pairs of oligonucleotides in exons flanking each intron followed by analysis on agarose gels. The introns ranged in size from approximately 220 to approximately 730 bp (Table 11). Based on all of these data, the physical map of the IL-2R-y gene, shown in Fig. U, middle panel, was found to span approxi- mately 4.2 kb. The exon sequences were identical to the published IL-2R-y cDNA (15) except for two third-position changes. In our genomic clone, Leu-33 is encoded by CTA instead of CTG. We hypothesize that this represents a poly- morphism since we have found both CTG and CTA in se-

13606 Characterization of Human IL-2Rr Gene A

I -606 +1 +35

B I Hlnd 111

Hlnd 111

Promoter

.- %

5 c)

.= 5

8 % 4 2 g 3 0 3 4 2 0) 5 .- - L m l aI U

0 pLuc0 PlL-PRy-Luc

FIG. 4. Sequences 5’ of the XL-2R-y gene have promoter activity. Panel A, schematic of the 641-bp fragment (-606 to +35) generated by PCR. Panel B, this promoter fragment (-606 to +35) was digested by HindIII and subcloned in both orientations in the vector pLuc0, which contains the luciferase reporter gene. A DNA fragment of 5’-AAGCTTATCGATACCGTCGACCTCGAGG-3’ from the multiple cloning site of pBluescript was inserted in the HindIII site of pLuc0 and used as a promoterless control. Panel C, the pIL-2Ry-luciferase construct resulted in 3,910 relative luciferase units of activity (right bar) which is 4.5-fold greater than that seen with the promoterless construct (890 relative luciferase units, left bar). These data presented are the average of two simultaneously performed duplicate experiments. A second set of duplicate experi- ments yielded similar results.

”

1 2 3

1 2 3 4 5 6 7 8 9 1 0

FIG. 5. IL-2R-y is encoded by a single copy gene. Panel A, Southern blot hybridization of human total genomic DNA. DNA was isolated from peripheral blood cells from a normal human donor, digested with EcoRI (lane I ) , EcoRV (lane 2), and HindIII (lane 3 ) and then electrophoresed on a 0.8% agarose gel. The DNA was transferred to nylon membrane (Zetaprobe, Bio-Rad) and hybridized with the radiolabeled IL-2Ry cDNA. Panel B, genomic Southern blot using the full-length IL-2Ry cDNA probe and EcoRI-digested DNA isolated from yeast (lane I ) , chicken (lane 2), rabbit (lane 3 ) , cow (lane 4 ) , dog (lane 5), mouse (lane 6 ) , rat ( l a n e 7) , monkey (lane 8), and human ( l a n e 9 ) . Lane 10 contains molecular weight markers.

quencing the IL-2R-y gene from additional independent cell lines (data not shown). Ser-29 is encoded by AGC in the published cDNA but by AGT in our PCR-generated cDNA, our genomic clone, and in sequencing DNA derived from four different individuals.

The locations of structural components of the receptor are summarized in Fig. 1B. The extracellular domain is spanned by exons 1-6, the transmembrane domain is contained within exon 6, and the cytoplasmic domain is encoded by exons 6-8. The first exon contains the 5’ untranslated region, the signal peptide, and the N-terminal 16 amino acids of the mature protein. The two pairs of cyteine residues conserved in the cytokine receptor superfamily were located in exons 2 and 3. Potential N-linked glycosylation sites (Asn-X-Ser/Thr) were located in exons 1,2,4, and 5. The W S X W S motif is in exon 5.

In addition to sequencing the exons and exonlintron splice junctions, we sequenced the region upstream of the 5’ end of the published cDNA (Fig. 2). Nucleotide numbering in Fig. 2 is based on the major transcription initiation site (+I) based on the primer extension analysis and ribonuclease protection assay (see below).

Identification of the Transcription Initiation Sites-To identify the 5’ end of the IL-2R-y mRNA, we performedprimer extension studies (Fig. 3A) using oligonucleotide primers com- plementary to mRNA corresponding to +131 to +lo2 (primer A, lane 1 ) and +192 to +162 (primer B, lane 2) . One major transcription start site and two minor start sites were identi- fied (arrows). The exact locations of the initiation sites were determined by comparison with a DNA sequencing reaction using primer A and the 7.9-kb EcoRI genomic fragment span- ning exon 1 and the promoter region (Fig. 3A, lanes marked G, A, T, and C). The initiation sites were all located upstream of the 5‘ end of the published IL-2R-y cDNA sequence (15).

To confirm the validity of the primer extension analysis, we performed ribonuclease protection assays (Fig. 3B) utiliz- ing Jurkat RNA and a 474-base long RNA probe that was generated by in vitro transcription by using the T3 promoter (see “Materials and Methods”). Corresponding to the results of the primer extension study, three protected RNA species were found, located approximately 150 bp from the end of the first exon. Thus, the major, middle band seen in both primer extension and ribonuclease protection assays was assigned the position of +1, and the two minor initiation sites were assigned positions of -2 and +5. The concordance of primer extension and ribonuclease extension assay results rules out the possiblility of a cryptic 5’ exon. Faint larger bands are seen on longer exposures in the RNase protection assay, suggesting that other minor initiation sites may exist further upstream. Consistent with this hypothesis, we have identified one IL-2Ry cDNA that begins at -43 (data not shown).

Identification of an IL-2R-y Promoter Fragment-We noted that the sequence of IL-2R-y upstream of the transcription initiation sites did not have canonical TATA or CAAT boxes at typical distances upstream of +1 (Fig. 2). However, the region upstream of the initiation sites is GC-rich and thus has features of a housekeeping gene. To determine if the 5’ flanking sequences had promoter activity, we subcloned the -606 to +35 fragment (Fig. 4A) upstream of the luciferase reporter gene in pLuc0 to generate pIL-2R-y-Luc (Fig. 4B). When transfected into Jurkat cells, pIL-2R-y-Luc resulted in a 4.5-fold higher level of luciferase activity than the promot- erless parental vector pLuc0 (3,910 uersus 890 relative lucif- erase units), demonstrating that these IL-2R-y sequences con- tained a functional promoter (Fig. 4C, right bar uersus left bar). When cloned in antisense orientation, luciferase activity was not increased and in fact was even lower than in the promoterless control (data not shown).

A Human IL-2R-y cDNA Can Hybridize to DNA from Other Mammalian Species under High Stringency Conditions-We next performed Southern blot hybridization using the IL-2R-y

Characterization of Human IL-2R7 Gene 13607

FIG. 6. Comparison of genomic organization of IL-2Ra, IL-2Rh and IL-2Rr chain genes.

cDNA insert and genomic DNA isolated from peripheral blood cells from normal human donors (Fig. 5A). The DNA was digested with EcoRI (lane I), EcoRV ( l a m 2 ) , and Hind111 (lane 3). The simple pattern of digestion with three different enzymes (shown) and seven other enzymes (not shown) was most consistent with IL-2Ry being encoded by a single copy gene.

A genomic Southern blot (Clontech) containing DNA from different species was hybridized with the full-length IL-2Ry cDNA as a probe under high stringency conditions (see “Ma- terials and Methods”). Distinct bands were detected with DNA from rabbit (Fig. 5B, lam 3 ) , cow (lane 4 ) , dog (lane 51, mouse (lane 6) , rat (lane 7), monkey (lane 8), and human (lane 9), suggesting that the DNA sequence among these different species has regions of significant homology. In con- trast, no hybridization was seen with DNA from yeast (lane I ) and only a nondefinitive smear was seen with chicken DNA (lane 2 ) .

DISCUSSION

The IL-2 receptor is known to consist of three proteins that contribute to ligand binding. IL-2Ra is unlike any other cytokine receptor protein, whereas both IL-2RP and IL-2Ry are members of the cytokine receptor superfamily (27). The highly inducible a chain has an extremely short 13-amino acid long cytoplasmic domain. IL-2Ra appears to play an important role in augmenting the affinity of IL-2 binding and concentrating IL-2 on the cell surface, presumably facilitating its delivery to the other chains. In contrast, the P and y chains have larger cytoplasmic domains. Based on transfection stud- ies (15), together they can reconstitute IL-2 receptors in fibroblasts which can bind IL-2 with intermediate affinity and mediate ligand internalization.

The IL-2 receptor a and P chain genes have been charac- terized previously (18-22). In this study we describe the structure of the human gene for IL-2Ry. This gene is divided into eight exons and seven introns but is relatively small, spanning only 4.2 kb, far smaller than either IL-2Ra (>35 kb) or IL-2RP (approximately 24 kb). Like both IL-2Ra and IL-2R@, IL-2Ry has multiple transcription initiation sites.

The organization of the IL-2Ry gene appears similar to that of IL-2RP (compared schematically in Fig. 6). First, the two pairs of conserved cysteines typical of the cytokine recep- tor superfamily are positioned so that each pair is located in

one of two adjacent exons (exons 2 and 3 in IL-2Ry, exons 3 and 4 in IL-2RD). Second, the WSXWS motif typical of the cytokine receptor superfamily is located in the exon just upstream of the one containing the transmembrane domain (exon 5 in IL-2Ry, exon 7 in IL-2RD). Third, essentially the entire cytoplasmic domain in each case is encoded by two exons (exons 7 and 8 in IL-2Ry and exons 9 and 10 in IL- 2RP). The main organizational difference between IL-2RP and IL-2Ry is that IL-2RP has 10 exons instead of 8. One of these (exon 1) is an extra 98-bp long upstream exon consisting solely of 5’ untranslated sequences. It is this difference that largely explains the significant difference in lengths of the IL-ZRO and IL-2Ry 5’ untranslated regions (131 nucleotides for IL-2RP versus 32-38 nucleotides for IL-2Ry). The second difference is that IL-BRP has two exons instead of one between the exon containing the second pair of cysteines and the exon containing the WSXWS motif. The overall pattern is one consistent with a common ancestral gene. In this regard, the organization is similar to that of a number of other cytokine receptor superfamily members, including the IL-3, IL-4, IL- 7 , growth hormone, and erythropoietin receptors (summarized in Ref. 28). In contrast to the similarity to IL-2RP, IL-2Ry bears relatively little resemblance to IL-2Ra (not a member of the cytokine receptor superfamily) except that both are encoded by eight exons.

In this study, we have also identified the IL-2Ry promoter. The promoter lacks classic TATA motifs at typical distances relative to the transcription initiation sites. Its sequence is GC-rich, typical of a housekeeping gene. It lacks KB and CArG motifs found in IL-2Ra, which are required for the inducibility of that gene (29, 30). This is consistent with the apparent constitutive expression of the y chain on lymphoid cell lines and the lack of or low level of inducibility following mitogenic stimulation (Ref. 15 and data not shown). Additional experi- mentation will be required to elucidate the elements respon- sible for the regulation of tissue-specific expression of this critical component of the IL-2 receptor.

Acknowledgments-We thank Dr. Atsushi Miyajima, in whose laboratory W. J. L. prepared the YT-1 cDNA library; Dr. Edward Fritsch, Genetics Institute, for providing the human genomic library; Dr. Takashi Shimada for providing pCMV-luciferase; Sarah Mess for technical assistance; and Drs. Susan John and Jian-Xin Lin for critical comments.

13608 Characterization of Human IL-2R-y Gene Note added inproof-Since original submission of this manuscript,

our laboratory has reported that the IL-SRr gene is located on human chromosome Xq13 and is the gene which is mutated in X-linked severe combined immunodeficiency disease (XSCID) in humans (31).

REFERENCES 1. Leonard, W. J. (1992) in Interleukin-2 (Waxman, J., and Balkwill, F., eds)

pp. 29-46, Blackwell Scientific Publications, Ltd., Osney Mead, Oxford, United Kingdom

2. Smith, K. A. (1989) Annu. Reu. Cell Biol. 5,397-425

4. Leonard, W. J., Depper, J. M., Crabtree, J. R., Rudikoff, S., Pumphrey, J., 3. Waldmann, T. A. (1989) Annu. Reu. Biochem. 58,875-911

Robb, R. J., Kronke, M., Svetlik, P. B., Peffer, N. J., Waldmann, T. A.,

5. Nikaido, T., Shimizu, A,, Ishida, N., Sabe, H., Teshigawara, K., Maeda, M., and Greene, W. C. (1984) Nature 311,625-631

6. Sharon, M., Klausner, R. D., Cullen B. R., Chizzonite, R., and Leonard, W. Uchiyama, T., Yodoi, J., and Honjo, T. (1984) Nature 311,631-635

J. (1986) Science 234,859-863 7. Tsudo, M., Kozak, R. .W., Goldman, C. K., and Waldmann, T. A. (1986)

8. Teshigawara, K., Wang, H. M., Kata, K., and Smith, K. A., (1987) J. Exp. Proc. Natl. Acad. Scr. U. S. A. 83,9694-9698

Med. 166,223-238 9. Dukovich, M., Wano, Y., Thuy, L.-t. B., Katz, P., Cullen, B. R., Kehrl, J.

10. Sharon, M., Siegel, J. P., Tosato, G., Yodoi, J., Gerrard, T. L., and Leonard, H., and Greene, W. C. (1987) Nature 327,518-522

11. Siegel, J. P., Sharon, M., Smith, P. L., and Leonard, W. J. (1987) Science W. J. (1988) J. Exp. Med. 167 , 1265-1270

12. Hatakeyama, M., Tsudo, M., Minamoto, S., Kono, T., Doi, T., Miyata, T., 2 3 8 , 75-78

13. Takeshita, T., Asao, H., Suzuki, J., and Sugamura, K. (1990) Int. Immunol. Miyasaka, M., and Taniguchi, T. (1989) Science 244,551-556

14. Takeshita, T., Ohtani, K., Asao, H., Kumaki, S., Nakamura, M., and 2 , 551-556

Sugamura, K. (1992) J. Immunol. 148 , 2154-2158

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27. 28.

29.

30.

31.

Takeshita, T., Asao, H., Ohtani, K., Ishii, N., Kumaki, S., Tanaka, N., Munakata, H., Nakamura, M., and Sugamura, K. (1992) Science 2 6 7 , 379-382

Vo_ss, S. D., Sondel, P. M., and Robb, R. J. (1992) J. Exp. Med. 176 , 531-

Arima, N., Kamio, M., Imada, K., Hori, T., Hattori, T., Tsudo, M., Okuma, 54 1

Leonard W. J., Depper, J. M., Kanehisa, M. Kronke, M., Peffer, N. J., M., and Uchiyama, T. (1992) J. Exp. Med. 1 7 6 , 1265-1272

Svetlik, P. B., Su hvan, M I and Greene, W. 'c. (1985) Science 230,633-

Leonard, W. J., Donlon, T. A., Lebo, R. V., and Greene, W. C. (1985) 639

Ishida, N., Kanamori, H., Noma, T., Nikaido, T., Sabe, H., Suzuki, N., Science 228,1547-1549

Gnarra, J. R 'Otani, H., Wang, M. G., McBride, 0. W., Sharon, M., and Shimizu, A. and Honjo, T. (1985) Nucleic Acids Res. 13,7579-7589

Shibuya, H., Yoneyama, M., Nakamura, Y., Harada, H., Hatakeyama, M., Leonard, W. J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,3440-3444

Minamoto, S., Kono, T., Doi, T., White, R., and Taniguchi, T. (1990) Nucleic Acids Res. 18 3697-3703

Lawn, R. M., Fritsch, A. F., Parker, R. C., Blake, G., and Maniatis, T. (1978) Cell 15, 1157-1174

Liu, J. M., Fujii, H., Green, S. W., Komatsu, N., Young, N. S., and Shimada, T. (1991) Virology 182,361-364

Cross, S. L., Feinberg, M. B., Wolf, J. B., Holbrook N. J., Wong-Staal, F., and Leonard, W. J. (1987) Cell 49,47-56

Breathnach, R., and Chambon, P. (1981) Annu. Reo. Biochem. 50, 349- 383

Bazan, J. F. (1990) Proc. Natl. Acad. Sci. U. S. A. 8 7 , 6934-6938 Gorman, D. M., Itoh, N., Jenkins, N. A., Gilbert, D. J., Copeland, N. G.,

Ballard, D. h. Bohnlein, E., Hoffman, J. A,, Bogerd, H., Dixon, E., Franza, and Miya'ima A. (1992) J. Biol. Chem. 15842-15848

Toledano M. B., Roman, D. G., Halden, N. F., Lin, B. B., and Leonard, B. R., and Greene, W. C. (1989) New Biologist 1,83-92

Nogochi, M., Yi, H., Rosenblatt, H. M., Filipovich, A. H., Adelstein, S., W. J. (i990) Proc. Natl. Acad. Sci. U. S. A. 8 7 , 1830-1834

Modi, W. S., McBride, 0. W., and Leonard, W. J. (1993) Cell 7 3 , 147- 157