characterization of the gja1 jrt /+ skeletal …...owen, thank you for your support and expertise...
TRANSCRIPT
Characterization of the Gja1Jrt/+ Skeletal Phenotype and the Cellular and Molecular Effects of the G60S Connexin
43 Mutation in the Long Bone Microenvironment
by
Tanya Zappitelli
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Department of Medical Biophysics University of Toronto
© Copyright by Tanya Zappitelli 2015
ii
Characterization of the Gja1Jrt/+ Skeletal Phenotype and the
Cellular and Molecular Effects of the G60S Connexin 43 Mutation
in the Long Bone Microenvironment
Tanya Zappitelli
Doctor of Philosophy
Department of Medical Biophysics
University of Toronto
2015
Abstract
Gja1Jrt/+ mice carry a mutation in one allele of the gap junction protein, alpha 1 gene
(Gja1), encoding for a dominant negative G60S Connexin 43 (Cx43) mutant protein. Similar to
other Cx43 mutant mouse models described, a reduction in Cx43 gap junction formation and/or
function resulted in mice with early onset osteopenia. Here we show that in contrast to other
Cx43 mutants, the G60S Cx43 mutation activates the osteoblast lineage, with higher bone
marrow stromal osteoprogenitor numbers and increased appendicular skeleton osteoblast
activity. The data presented in this thesis are the first to describe a Cx43 mutation in which
osteopenia is caused by activation of osteoclasts secondary to activation of osteoblast lineage
cells, which occurs not only through increased membrane-bound receptor activator of nuclear
factor kappa-B ligand (mbRANKL) but production of an abnormal resorption-stimulating bone
matrix. Gja1Jrt/+ is also the only Cx43 mutant mouse model described to date with early and
progressive bone marrow atrophy, with a significant increase in bone marrow adiposity and
adipocyte-specific gene expression in Gja1Jrt/+ mice compared to wild type littermates. We
analyzed the mechanism by which the G60S Cx43 mutation activates the osteoblast and
iii
adipocyte lineage and show that increased bone morphogenic protein 2 and 4 (BMP2/4)
production and signaling increase osteoblast-specific marker expression and peroxisome
proliferator-activated receptor gamma (Pparg2) gene expression in Gja1Jrt/+ osteoblasts and
bone marrow stromal cells. Taken together, this thesis provides new insight into the role of Cx43
and the effects of the G60S mutation on bone formation and homeostasis, and on the
differentiation and activity of bone cell lineages.
iv
Acknowledgments
To my supervisor, Dr. Jane Aubin, thank you for taking me into your lab when I was still an
undergraduate student and knew nothing about conducting scientific research. Thank you for
teaching me the skills required to become a successful scientist, and for always pushing me to
learn and grow. To my supervisory committee, Dr. Jane Mitchell, Dr. Liliana Attisano and Dr.
Minna Woo, thank you for your knowledge, advice and guidance over the years.
To all of the former Aubin lab members, you truly made my time here memorable. Thank you
especially to Frieda Chen, Ralph Zirngibl, Marco Cardelli and Ruolin Guo for sharing your
expertise and knowledge with me, and for all of the insightful conversations (both scientific and
not). Frieda, I am so grateful for all of the guidance, help and encouragement you provided me,
thank you. To the members of the Centre for Modeling Human Disease, particularly Celeste
Owen, thank you for your support and expertise over the years.
To my parents, Angelo and Angela, thank you so much for everything! I dedicate this thesis to
you. Your support throughout my studies -both emotional and financial- was instrumental in
allowing me to successfully complete my graduate studies. I could not have done this without
your love, encouragement and unwavering support. To my brother, Anthony, thank you for your
humor during my times of struggle and for listening whenever I really needed it.
To all of my family and friends, thank you for your love and encouragement throughout all of
these years. To LM, LH, GF, MU and to MC thank you for all the agendas/breaks/weekends
away from my lab work and studying!
~~~~~~~~~~~~~~~~~~~~~~~~~~~~
In loving memory
Nonno Antonio Zappitelli
1929 - 2013
v
Table of Contents
Acknowledgments .......................................................................................................................... iv
Table of Contents ............................................................................................................................ v
List of Tables ................................................................................................................................ vii
List of Figures .............................................................................................................................. viii
Chapter 1 Introduction .................................................................................................................... 1
1.1 Bone .................................................................................................................................... 2
1.1.1 Processes of Bone Formation .................................................................................. 2
1.1.2 Bone Structure and Composition ............................................................................ 3
1.2 Regulation of Bone Formation ............................................................................................ 4
1.2.1 Description and Expression Patterns of Osteoblast-Specific Genes ....................... 6
1.2.2 Regulation of Osteoblast Differentiation by Growth Factors and Small
Molecules ................................................................................................................ 7
1.3 Regulation of Bone Resorption ........................................................................................... 8
1.3.1 Description and Expression Patterns of Osteoclast-Specific Genes ....................... 9
1.3.2 Regulation of Osteoclast Differentiation by Cytokines, Hormones, and Small
Molecules .............................................................................................................. 10
1.4 Connexins: Gap Junctions and Hemichannels .................................................................. 10
1.4.1 Structure and Function .......................................................................................... 11
1.4.2 Connexin 43 .......................................................................................................... 13
1.5 Cx43 Mouse Models ......................................................................................................... 13
1.5.1 Cx43 disruption: Effect on bone development and skeletal homeostasis ............. 18
1.5.2 Cx43 disruption: Effect on development and activity of osteoblast lineage
cells ....................................................................................................................... 19
1.5.3 Cx43 disruption: Effect on the development and activity of osteoclasts .............. 20
1.6 Cx43 channels and signaling in bone cells’ response to stimuli ....................................... 21
1.6.1 Growth factors, morphogens, and other molecules .............................................. 22
vi
1.6.2 Mechanostimulation .............................................................................................. 23
1.7 Age-related changes in Cx43 channel formation and function ......................................... 23
1.8 Thesis Objectives .............................................................................................................. 24
Chapter 2 The G60S Connexin 43 Mutation Activates the Osteoblast Lineage and Results in
a Resorption-Stimulating Bone Matrix and Abrogation of old Age-related Bone Loss .......... 26
2.1 Abstract ............................................................................................................................. 27
2.2 Introduction ....................................................................................................................... 27
2.3 Materials and Methods ...................................................................................................... 29
2.4 Results ............................................................................................................................... 35
2.5 Discussion ......................................................................................................................... 51
Chapter 3 Upregulation of BMP2/4 signaling increases both osteoblast-specific marker
expression and bone marrow adipogenesis in Gja1Jrt/+ stromal cell cultures ......................... 59
3.1 Abstract ............................................................................................................................. 60
3.2 Introduction ....................................................................................................................... 60
3.3 Materials and Methods ...................................................................................................... 62
3.4 Results ............................................................................................................................... 66
3.5 Discussion ......................................................................................................................... 83
Chapter 4 Discussion, Future Directions and Final Conclusions ................................................. 88
4.1 Summary and Discussion of Findings .............................................................................. 89
4.2 Future Directions .............................................................................................................. 97
4.2.1 Effect of the G60S mutation on Cx43 hemichannel function ............................... 97
4.2.2 Gja1Jrt/+ ‘rescue’ experiments .............................................................................. 98
4.2.3 Gja1Jrt/+ response to challenge or stimuli ............................................................ 99
4.2.4 Further investigations into other Cx43-deficient models .................................... 100
4.3 Conclusions ..................................................................................................................... 101
References ................................................................................................................................... 103
vii
List of Tables
Table 1.1 Connexin 43 missense point mutation summary chart. ................................................ 17
Table 2.1 Quantitative RT-PCR primer sequences used in this study .......................................... 31
Table 2.2 List of antibodies used in this study. ............................................................................. 33
Table 2.3 Longitudinal analysis of femoral length and mechanical-material properties of
Gja1Jrt/+ and WT mice are presented. .......................................................................................... 40
Table 3.1 Quantitative RT-PCR primer sequences used in this study. ......................................... 65
Table 3.2 List of antibodies used in this study. ............................................................................. 67
Table 3.3 Results of the Mouse Signal Transduction Pathway Finder™ RT²
Profiler™ PCR Array.................................................................................................................... 74
Table 4.1 Connexin 43 mutant mice summary chart. ................................................................... 96
viii
List of Figures
Figure 1.1 Development of the osteoblast and osteoclast lineage. ................................................. 5
Figure 1.2 Illustrations of connexin protein structure, hemichannels and gap junctions in the
plasma membranes of cells. .......................................................................................................... 12
Figure 1.3 Connexin 43 in the bone microenvironment. .............................................................. 14
Figure 1.4. Schematic of osteoblast lineage development and the different promoters used to
drive Cre for differentiation stage-specific Cx43 ablation. .......................................................... 16
Figure 2.1 Longitudinal analysis of BMD and trabecular bone parameters. ................................ 37
Figure 2.2 Longitudinal analysis of cortical bone parameters. ..................................................... 38
Figure 2.3 Longitudinal analysis of cortical parameters. .............................................................. 39
Figure 2.4 Longitudinal analyses of trabecular osteoblast parameters and activity. .................... 42
Figure 2.5 Analysis of osteoblast and osteocyte-specific genes in cortical bone extracts. ........... 43
Figure 2.6 Effect of the Gja1Jrt mutation on osteoprogenitors, osteoblasts and bone matrix
composition. .................................................................................................................................. 45
Figure 2.7 Expression of Rankl-Opg and osteoclast-specific gene expression in Gja1Jrt/+ versus
WT mice. ....................................................................................................................................... 46
Figure 2.8 Gja1Jrt/+ osteoclast number and activity are increased in young mice in vivo, but not
in vitro. .......................................................................................................................................... 48
Figure 2.9 The abnormal bone matrix produced by Gja1Jrt/+ mice promotes bone matrix
resorption. ..................................................................................................................................... 50
Figure 2.10 The cellular and molecular age-related changes that occur in the bone
microenvironment. ........................................................................................................................ 58
ix
Figure 3.1 The Gja1Jrt mutation activates the osteoblast lineage and alters bone matrix
composition. .................................................................................................................................. 68
Figure 3.2 Adipocyte number and activity are increased in Gja1Jrt/+ versus WT bone marrow. 70
Figure 3.3 The Gja1Jrt mutation does not cause a systemic increase in adipogenesis or adipocyte
activity. .......................................................................................................................................... 71
Figure 3.4 The Gja1Jrt mutation does not affect adipocyte lineage development in vitro. ........... 72
Figure 3.5 Effect of the Gja1Jrt mutation on formation of bone marrow- derived adipocytes in
vitro. .............................................................................................................................................. 73
Figure 3.6 Changes in Wnt/β-catenin signaling cannot account for the upregulation of Bsp
expression in hyperactive Gja1Jrt/+ osteoblasts. ........................................................................... 76
Figure 3.7 BMP2/4 signaling is increased in Gja1Jrt/+ in vivo and in vitro. ................................ 77
Figure 3.8 Upregulated BMP2/4 signaling is responsible for the increased osteoblast marker
expression and the increased Pparg2 expression in bone marrow-derived adipocytes and
adipogenic precursors in Gja1Jrt/+ versus WT mice. .................................................................... 78
Figure 3.9 Levels of pSMAD1/5/8 were significantly reduced in both WT and Gja1Jrt/+ stromal
cells treated with 200ng/mL of Noggin versus vehicle treated cells. ........................................... 79
Figure 3.10 Intracellular levels of cAMP and cAMP signaling are increased in Gja1Jrt/+ versus
WT osteogenic stromal cells. ........................................................................................................ 82
1
Chapter 1 Introduction
Some of the text, tables, and figures presented in Chapter 1 are published in:
The “connexin” between bone cells and skeletal functions
Tanya Zappitelli1 and Jane E. Aubin1,2
1Department of Medical Biophysics and 2Department of Molecular Genetics, University of
Toronto, 1 King's College Circle, Toronto, Ontario M5S 1A8, Canada.
J Cell Biochem. 2014 Oct;115(10):1646-58
2
1
1.1 Bone
Bone is a living and dynamic tissue whose structural and material properties are critical to the
skeleton’s functions, which include providing structural support to the body, protecting internal
organs, assisting in limb mobility, and acting as a reservoir for and participating in calcium and
phosphate homeostasis. Bone not only responds to hormonal signals, but is itself an endocrine
organ, with secretion of factors influencing such diverse functions as phosphate excretion by the
kidney and insulin production by pancreatic beta cells, amongst other targets (1). Bone tissue
consists of a mineralized organic matrix formed and maintained by cells that are continuously
engaged in modeling and remodeling to adapt the tissue to the demands (mechanical and
physiological) that are put on it. Forming and maintaining the integrity of the adult skeleton
requires equilibrium between the amount of bone formed and the amount resorbed, i.e.
coordinated activity between osteoblasts and osteoclasts. Osteoporosis or osteopetrosis can occur
when this equilibrium is disrupted causing a net loss or gain of bone mass, respectively.
1.1.1 Processes of Bone Formation
The formation of bone occurs by two processes: intramembranous ossification and endochondral
ossification (reviewed in (2)). Intramembranous ossification takes place within a condensation
of mesenchymal tissue called a primary ossification center. Groups of cells then begin to
differentiate into osteoblasts, which produce bone matrix followed by calcification,
encapsulating some of the osteoblasts to become osteocytes. The ossification centers grow
radially and fuse together replacing the original connective tissue. This type of bone formation is
typical of membrane bones, such as the flat bones of the skull. Endochondral ossification is
primarily responsible for the formation of short and long bones. In this case, mesenchymal cells
migrate to the site of eventual bone formation, condense or aggregate and differentiate into
chondrocytes, which produce cartilage (loose extracellular matrix comprised of collagen and
mucopolysaccharides) in the shape of the ensuing bone. Midway between the ends of the
elongated cartilage template or anlage, the chondrocytes hypertrophy and the matrix erodes.
Blood vessels invade the cartilage, which is degraded by osteoclasts, and strands of the
3
remaining cartilage act as a template for osteoblasts to secrete more ECM that undergoes
calcification, forming the trabecular and cortical bone.
1.1.2 Bone Structure and Composition
Bone tissue consists of a mineralized organic matrix formed and maintained by cells that are
continuously engaged in modeling and remodeling. Approximately 20-30% by weight of bone is
organic, 10% is water and the remainder is mineral. The organic matrix typically contains
approximately 90% collagen and 10% noncollagenous proteins (e.g., bone sialoprotein,
osteopontin, osteocalcin), proteoglycans, and lipids.
Irrespective of the process by which it forms, bone is generally classified into two types:
1. cortical/compact bone and 2. trabecular/cancellous/spongy bone, based on porosity and unit
microstructure (reviewed in (3)). Cortical bone is the semi-solid shell that covers the entire bone.
It contributes about 80% of the adult skeletal mass, but the surface area is relatively small - only
33% of total bone surface. The main function of cortical bone is to provide biomechanical
strength, support and protective properties. Trabecular bone is a sponge-like network (rod or
plate-like trabeculae) that occupies the inner area of the epiphysis and metaphysis. It contributes
only ~20% of total bone mass but its surface area is large - 75% of the total surface of the
skeletal system. Trabecular bone is more metabolically active and remodelled more frequently
than cortical bone. Cortical and trabecular bone appear in all bones, including the long bones,
vertebrae and calvaria.
Within the solid bone shell is the bone marrow, which contains a number of stromal cell
types, including precursors of the bone cells described below (hematopoietic stem cells (HSCs)
and mesenchymal stem cells (MSCs)), blood cells, immune cells, megakaryocytes, and
adipocytes (reviewed in (4)). Bone and bone marrow function interdependently, as a single unit.
The cells within the bone marrow are closely associated with and can affect the developing and
mature bones; for instance, bone precursor cells have a direct regulatory role in their own
development and in bone remodeling activities, while other stromal cells may regulate these
processes through the production of local and systemic factors (discussed below). Bone and bone
marrow composition both exhibit age-related changes: bones (particularly in humans) undergo
4
age-related bone loss, where osteopenia and osteoporosis develop most commonly in the elderly
and post-menopausal women, and bone marrow becomes increasingly fatty with age, with higher
numbers of adipocytes present in old versus young marrow. This correlation is at least in part
due to the decreased osteogenic potential of precursors in older versus younger bone marrow (5);
that is, an increase in adipocyte formation at the expense of osteoblast formation, both of which
derive from common precursors, MSCs.
1.2 Regulation of Bone Formation
Cells that produce bone matrix are called osteoblasts (reviewed in (6,7)). Osteoblasts derive from
MSCs that undergo several fate choices and transitional stages to become committed progenitors,
and eventually the differentiated end-stage cells of the osteoblast lineage. These commitment and
differentiation stages require and are identified by changes in proliferative capacity, along with
temporal acquisition and loss of expression of specific molecular and morphological traits, as
depicted in Figure 1.1. When their matrix forming phase terminates, osteoblasts may either:
undergo programmed cell death (apoptosis), differentiate into lining cells on the bone surface or
become enclosed in the bone matrix within small lacunae as osteocytes (reviewed in (8-10)).
Osteocytes are the major cell type in adult bone. They can communicate with neighboring
osteocytes and cells on the bone surface, and can access nutrients though connections that are
made via thin cellular processes called dendrites, located within a canalicular network
permeating throughout the bone tissue. Osteocytes can sense mechanical strain and are essential
for the skeleton’s adaptive response to load, emitting signals to promote or inhibit bone
formation and resorption.
Osteoblastogenesis and bone formation are directed and controlled by the coordination of
a number of molecules and factors, including expression of transcription factors, growth factors
and small molecules which activate signals to guide cellular commitment, differentiation, and
activity.
5
Figure 1.1 Development of the osteoblast and osteoclast lineage.
The temporal morphological changes that accompany the differentiation of the ‘bone forming’ osteoblast lineage cells (left) and the ‘bone resorbing’ osteoclast lineage cells (right) are shown in the upper half of the diagram. For simplicity, ‘general’ stages of the differentiation sequences are shown. The sequences of molecular changes in gene expression that occur through differentiation are shown in the lower part of the diagram, below each representative differentiation stage. RANK-RANKL-OPG signaling molecules are depicted in the diagram (for simplicity, at only one stage), and their protein expression profiles are found below.
6
1.2.1 Description and Expression Patterns of Osteoblast-Specific Genes
MSC differentiation down the osteoblast lineage requires the activation of specific transcription
factors that control the progenitor cell commitment and expression of downstream osteoblast-
specific genes, which are necessary for the differentiation and activation of the osteoblast
lineage. A complete description of the transcription factor networks that regulate
osteoblastogenesis and osteogenesis is beyond the scope of this Introduction, but two key
transcriptional regulators are:
• Runx2 (runt related transcription factor 2) is the master regulator/transcription factor
required to activate the process of osteoblast differentiation (11,12).
• Osx (osterix) is also considered a major transcriptional regulator of osteoblastogenesis and
its expression is downstream of Runx2 (13).
The temporal expression patterns of not only Runx2 and Sost, but also the following genes are
often used to characterize the lineage development of the osteoblast:
• Alp (alkaline phosphatase) enzyme has an important role in the mineralization of bone
matrix by osteoblasts (14). It generally functions to promote mineralization by increasing the
local concentration of inorganic phosphate and decreasing the concentration of
extracellular pyrophosphate.
• Col1a1 (collagen type 1 alpha 1) is an extracellular matrix protein. Collagen fibrils form
the organized scaffold of the bone matrix and their cross-linking contributes to bone
strength (reviewed in (15)).
• Major non-collagenous proteins in bone: Bsp (bone sialoprotein) is a phosphoprotein that
promotes and is necessary for mineralization (16). Ocn (osteocalcin) is a calcium binding
bone matrix protein and an inhibitor of bone formation (17); it has also been shown to have
an endocrine function (18). Dmp1 (dentin matrix protein 1) is generally established as an
osteocyte-specific marker and regulator of extracellular matrix mineralization. Loss of
DMP1 in mice results in hypomineralization of bones and defective osteocyte maturation
(19).
• Phex (phosphate regulating endopeptidase homolog, X-linked) protein is a member of the
M13 class of cell-surface zinc-dependant proteases and is involved in the bone-kidney axis,
7
along with fibroblast growth factor 23 (Fgf23). Disruption of PHEX in humans and mice
results in hypophosphatemia, renal phosphate wasting and rickets/osteomalacia (20,21).
• Sost (Sclerostin) mRNA is expressed in mature osteoblasts and osteocytes, but the protein
is only secreted by osteocytes. At the bone surface, it functions to inhibit osteoblastic bone
formation by antagonizing Wnt signaling (22).
1.2.2 Regulation of Osteoblast Differentiation by Growth Factors and Small Molecules
Osteoblast differentiation and bone formation are regulated by a number of autocrine and
paracrine factors, including growth factors (cytokines and hormones) and other small molecules
that are present in the bone microenvironment via secretion from nearby and neighboring cells or
via release from the bone matrix during resorption.
There are a large number of growth factor families or groups that are known to be
important in bone formation and repair, including numerous hormones (e.g. insulin-like growth
factor (IGF-1) (23), sex steroids [reviewed in (24)], parathyroid hormone (PTH) (25), etc.), fibroblast
growth factors (FGFs; reviewed in (26,27)), platelet-derived growth factor (PDGF (28,29)), and the
transforming growth factor beta (TGFB) superfamily (reviewed in (30)). For instance, bone
morphogenic proteins (BMPs), which are a large subfamily of the TGFB superfamily, have been
well documented to induce osteogenesis, particularly BMPs 2, 4, 5, 6 and 7 (31). BMPs are
secreted proteins that function by binding to the BMP receptors type I and II on the surface of
cells, the signal is then mediated by phosphorylation of specific receptor-regulated Smads (R-
Smads), such as Smads 1, 5, and 8. The phosphorylated R-Smads interact with common-partner
Smad (Co-Smad), Smad4, and the complex translocates to the nucleus where it can regulate
transcription of target genes, e.g. genes related to osteoblast differentiation, such as: Osx, Alp,
Ocn and Bsp (32,33).
In addition to growth factors, there are a number of small signaling molecules that also
regulate bone formation and turnover, for example prostaglandins (34,35) and Wnt proteins. In
particular, the Wnt family of secreted glycoproteins and their downstream signaling is a major
pathway that has been shown to affect bone mass and strength, where activation of the pathway
8
induces bone formation and inhibition of the pathway results in osteopenia. Wnt/β-catenin
signaling, also known as canonical Wnt signaling (reviewed in (36)), is initiated by secreted Wnt
ligands which bind to a receptor complex composed of low-density lipoprotein receptor-related
protein 5 or 6 (Lrp5/6) and the frizzled receptor. This causes a signaling cascade downstream of
the receptors that inhibits cytoplasmic glycogen synthase kinase 3 beta (GSK3b), which is
normally involved in the proteasomal degradation of β-catenin. Cytoplasmic levels of β-catenin
then accumulate and translocate to the nucleus, where it associates with the T-cell specific
transcription factor/ lymphoid enhancer binding factor (TCF/lef) family transcription factors to
control transcription of target genes which regulate osteogenic differentiation.
As mentioned above, osteoblasts and adipocytes both derive from MSCs, and their
progression along each lineage is guided by various molecules and factors that activate the
required master transcription factors for each lineage, i.e. Runx2 for osteoblasts and Pparg2 for
adipocyte. In addition to this, the significant plasticity between the osteoblast and adipocyte
lineages provides a basis for transdifferentiation, and experimental evidence of an osteoblast-
adipocyte switch has been documented (37,38). For instance, Song et al. showed that loss of β-
catenin from pre-osteoblasts leads to a cell-fate switch from osteoblasts to adipocytes (39). This
has important implications in bone pathological conditions, and further studies are required to
identify the exact molecular mechanisms that regulate the balance of osteoblasts and adipocytes
within the bone marrow.
1.3 Regulation of Bone Resorption
Osteoclasts are the bone resorbing cells (reviewed in (40)). They may be mononuclear but are
more typically recognized as multinuclear cells that are located on or adjacent to bone surfaces.
Osteoclasts are terminally differentiated post-proliferative cells of hematopoietic origin whose
differentiation, as with osteoblasts, is delineated by a temporal sequence of molecular and
morphological traits, as shown in Figure 1.1, right panel. Their size and number may increase
due to differentiation and fusion of mononuclear precursor cells with each other or existing
osteoclasts. The process of bone resorption by osteoclasts is critically important to maintain
skeletal health (as it is required in order to repair daily wear, microfractures, and even breaks in
9
the bone) and to whole body functioning via the release of important minerals and proteins
which are stored in the bone matrix. Balancing rates of bone resorption and bone formation are
necessary to ensure that skeletal integrity is maintained.
1.3.1 Description and Expression Patterns of Osteoclast-Specific Genes
HSC differentiation down the osteoclast lineage also requires the activation of specific
transcription factors that control the progenitor cell commitment and expression of downstream
osteoclast-specific genes, which are necessary in the differentiation, fusion, and activation of the
osteoclast lineage cells. A complete description of the transcription factor networks that regulate
osteoclastogenesis is beyond the scope of this Introduction, but one key transcriptional regulator
is:
• Nfatc1 (nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1) is the
major osteoclastogenic transcription factor, required to stimulate osteoclastogenesis (41).
In addition to Nfatc1, the temporal expression patterns of the following genes are often used to
characterize the lineage development of the osteoclast:
• Oscar (osteoclast associated receptor) has been shown to be a collagen receptor on the
surface of preosteoclasts and osteoclasts that promotes osteoclastogenesis (42).
• Trap (tartrate-resistant acid phosphatase) is an enzyme secreted by osteoclasts during
bone resorption (43). Trap staining in bone and in vitro cultures is often used as a marker of
osteoclastogenesis, though its expression is not restricted to osteoclasts, as mononuclear
cells may also stain Trap positive.
• Calcr (Calcitonin receptor) located on the surface of osteoclasts binds the hormone
calcitonin, a mediator of calcium homeostasis (44). When binding to its receptor, calcitonin
inhibits calcium release from the bone by restricting osteoclastic bone resorption. The
calcitonin receptor is generally a mature osteoclast marker.
• (Ctsk) Cathepsin K is a cysteine protease that is expressed in bone resorbing osteoclasts.
Cathespin K is capable of cleaving bone matrix proteins and plays a role in degrading the
organic portion of the bone during resorption (45,46).
10
1.3.2 Regulation of Osteoclast Differentiation by Cytokines, Hormones, and Small Molecules
As described above for osteoblasts, osteoclast differentiation and bone resorbing activity are also
controlled by a number of autocrine and paracrine factors, including various cytokines, hormones
and other small molecules present in the bone microenvironment. Several of the growth factors
and small molecules listed above have also been documented to affect osteoclastogenesis, either
directly or via their effects on osteoblasts and stromal cells, including prostaglandins (35), sex
steroid hormones (reviewed in (24)), and PTH (47), among others.
However, one of the major signaling systems/cytokines that regulate (stimulate or inhibit)
the formation and activity of osteoclasts is the RANK/RANKL/OPG signaling axis (reviewed in
(40,48) and depicted in Figure 1.1). Receptor activator of nuclear factor kappa B (RANK) is a
receptor found on the surface of osteoclasts and their precursors. Osteoblasts and bone marrow
stromal cells express receptor activator of nuclear factor kappa B- ligand (RANKL), which binds
to its receptor RANK, to promote osteoclastogenesis and osteoclast activity. RANKL may be
present in a soluble form (sRANKL) or in membrane-bound form (mbRANKL). These same
cells also express osteoprotegerin (OPG), a decoy receptor for RANKL, which can bind RANKL
molecules inhibiting them from binding to the RANK receptors. The RANKL/OPG ratio has
important implications for bone mass; an increase in the ratio favors osteoclastogenesis and bone
resorption, while a decrease in the ratio has an osteoprotective role.
1.4 Connexins: Gap Junctions and Hemichannels
The tightly regulated processes of bone modeling and remodeling (i.e. the coupling of bone
formation and bone resorption) require the coordination of osteoblasts, osteocytes and
osteoclasts. The coordinated activity between these cells is mediated by cell-cell and cell-
extracellular environment communication (e.g. communication across gap junctions and
hemichannels, and cell-extracellular matrix interactions mediated by cell surface integrins), in
addition to soluble factors (e.g. RANKL-OPG) as well as other cell-cell interactions.
11
1.4.1 Structure and Function
Connexins are a multigene family of hemichannel- and gap junction-forming proteins (reviewed
in (49,50)). The connexin proteins contain highly conserved transmembrane domains, extracellular
domains required for hemichannel or connexon pairing between adjacent cells, and a carboxyl-
terminal region that serves as a docking platform for signaling complexes, as depicted in Figure
1.2. Six connexin proteins form the hemichannel or connexon with a central pore. Intercellular
gap junctions form when hemichannels from adjacent cells dock onto one another.
Hemichannels and gap junctions both display relatively low substrate specificity and
allow the passage of ions and small molecules (molecular weight less than 1 kDa). Hemichannels
mediate communication between cells and the extracellular environment, including the bone
matrix. They are essential for the transduction of signals and can activate intracellular signaling
by mediating transport of signaling molecules such as ATP (51,52) and PGE2 (53,54). On the other
hand, gap junctions are involved in communication between adjacent cells, via transport of
intracellular signaling molecules such as calcium (55,56), cAMP (57,58), and inositol triphosphate
(55,56).
12
Figure 1.2 Illustrations of connexin protein structure, hemichannels and gap junctions in
the plasma membranes of cells.
(A) Schematic of Cx43 protein structure showing the three missense mutations described in the ODDD mouse models highlighted in red. The mutations are denoted by the correct amino acid followed by the number and the substituted amino acid. (B) Illustration of six connexin proteins which oligomerize forming a hemichannel or connexon in the plasma membrane. (C) Hemichannels and gap junctions allow the passage of ions and small molecules to the extracellular environment and between cells, respectively. Abbreviations: plasma membrane (PM).
13
Many cells express more than one member of the connexin family, and each member
forms channels with different functional properties. A connexin channel’s permeability to
specific cytoplasmic molecules, voltage, and chemical gating properties are determined by the
type of channel formed, e.g. hemichannel versus gap junction, and the channel’s composition,
e.g. homomeric (composed of a single connexin member) versus heteromeric (composed of 2 or
more different connexins). These differences are the reason that connexins cannot fully substitute
or compensate for one another.
1.4.2 Connexin 43
Cx43, encoded by the gap junction protein alpha 1 gene (GJA1 (human), Gja1 (mouse)), is the
most widely expressed and abundant vertebrate gap junction protein. It is expressed in cells of
almost all tissues in the body, including the brain (59,60), heart (61), ovary (62), tooth (63,64), eye (65)
and bone (66,67). Cx43 is the major connexin protein expressed in developing and mature skeletal
tissues, and is expressed in chondrocytes (68,69), osteoblasts (66,70), osteocytes (70), osteoclasts (71),
and bone marrow stromal cells (72). Cx45 (66,73), Cx46 (74) and Cx37 (75,76) are also expressed in
bone tissue, albeit at significantly lower levels than Cx43. In bone as in other tissues, osteoblasts,
osteocytes, osteoclasts and cells in the bone marrow can communicate with one another via
passage of signaling molecules and ions across gap junctions and hemichannels; see Figure 1.3.
This communication is crucial in cellular control of the tightly regulated processes of bone
formation and bone turnover. However, the signaling pathways involved in this multi-cellular
communication and the functional consequences on bone of aberrant gap junction and
hemichannel communication are only beginning to be elucidated.
1.5 Cx43 Mouse Models
Understanding the role of gap junctions and hemichannels in bone metabolism has long been an
area of pursuit, but has accelerated over the last decade by characterization of novel mutations in
humans and genetically-engineered mice, in which markedly affected gap junction and
hemichannel formation and function are associated with aberrant bone structure and activity.
14
Figure 1.3 Connexin 43 in the bone microenvironment.
The interconnected network of cells, comprised of cells on/within the bone (osteoblasts, osteocytes, and osteoclasts) and within the bone marrow (osteoprogenitors and other stromal cells) can communicate with one another via Cx43 channels, soluble factors (RANKL-OPG) and other cell-cell interactions. This communication coordinates bone formation and resorption, ensuring that skeletal integrity is maintained. The consequences of aberrant Cx43 channel formation and function are, therefore, complex and multifactorial. Question marks (?) denote instances where direct communication across Cx43 gap junctions has yet to be reported or requires further study to confirm.
15
Cx43 globally- and conditionally-deleted mouse models have provided much insight into
the importance of Cx43 in bone formation and function and osteoblast lineage development. The
models include: Cx43 global knockout mice (Cx43-/-) (77), and conditional deletion of Cx43 in
early osteochondro progenitors (DM1Cre;Cx43-/fl and DM1Cre;Cx43+/fl(G138R)) (78,79), osteoblasts
(ColCre;Cx43-/fl) (80-82), mature osteoblasts/ osteocytes (OcnCre;Cx43-/fl) (83-87) and osteocytes
(DMP1Cre;Cx43fl/fl) (87,88); see Figure 1.4). In addition to the knockout models, three mouse
strains with missense point mutations in one allele of the Gja1 gene have been generated
(Gja1Jrt(G60S)/+ (89), Cx43I130T/+ (90), Cx43G138R/+ (91); Figure 1.2, Table 1.1). These strains serve as
phenotypic mimics and thus useful models of a rare human disorder termed oculodentodigital
dysplasia (ODDD), characterized by a spectrum of clinical features including, amongst others,
craniofacial abnormalities, syndactyly, neurological problems and cardiac defects (92,93).
To date, over 65 mutations in GJA1 have been identified and reported to cause ODDD (92-
94). The functional effects of many of these GJA1 mutations have been extensively studied and
shown to act in a dominant negative manner, significantly reducing total and phosphorylated
levels of Cx43 protein. Formation and function of Cx43 gap junctions are concomitantly
significantly reduced, since a large portion of Cx43 remains trapped in intracellular structures,
such as the Golgi (89-91,95,96). Interestingly, however, the effect of the Cx43 mutant proteins on
the activity of opened hemichannels is more variable (97,98). The only point mutation models
whose bone phenotypes have been reported upon are the Gja1Jrt/+ and Cx43G138R/+ mouse
models.
Below and in Table 4.1, we summarize the consequences of Gja1 mutation and ablation
in these various mouse models. Comparison across models highlights the complex roles and
underlying mechanisms of Cx43 in bone cell lineage development, activities, and in the
formation and maintenance of the skeleton. Furthermore, the table documents how the work
presented in this thesis adds valuable information to the field of Cx43 research regarding the
bone-related effects of the Gja1Jrt mutation, and puts it in the context of the published data on
other Cx43 models.
16
Figure 1.4. Schematic of osteoblast lineage development and the different promoters used
to drive Cre for differentiation stage-specific Cx43 ablation.
The figure depicts in simplified form osteoblast differentiation from mesenchymal progenitor (osteochondroprogenitor) to terminally differentiated osteocyte. Displayed are the promoter-Cre constructs, which depict the point in the lineage development that Cx43 is disrupted in the conditional deletion mouse models. All cells in the body that express Cx43, which is amongst the most ubiquitously expressed of Cxs, are affected in the Cx43 global knockout and Cx43 point mutation mouse models.
17
Gja1Jrt/+ Cx43I130T/+ Cx43G138R/+
Reference Flenniken et al., 2005;
McLachlan et al., 2008
Kalcheva et al., 2007 Dobrowolski et al., 2008
Mutation G60S I130T G138R
Mutation Location first extracellular loop intracellular loop intracellular loop
Mutation described in
human ODDD
No Yes Yes
Effect on
total CX43 levels unaffected or ↓ ↓ ↓
p-CX43 levels ↓ ↓ ↓
Gap junction formation ↓ ↓ unaffected or ↓
Gap junction function ↓ ↓ ↓
Hemichannel function Unknown ↓ ↑
Table 1.1 Connexin 43 missense point mutation summary chart.
The location and functional effects of the Cx43 missense point mutations shown in Figure 1.1A are described.
18
1.5.1 Cx43 disruption: Effect on bone development and skeletal homeostasis
Functional Cx43 gap junctions and hemichannels are crucial for the processes of bone formation,
maintenance and healing. Loss or disruption of Cx43 gap junction formation and/or function
results in varying degrees of osteopenia in all the mouse models studied. The osteopenic
phenotype includes reduced bone mineral density (77,78,80,85,89), changes in geometrical properties
(e.g. decreased cortical thickness and increased marrow space) (78,79,81,85,87), reduced bone
biomechanical properties (e.g. material and structural parameters) (78,79,83,85,87,88), and reduced
ability to heal after a bone fracture (84). The impact of Cx43 extends to bones formed via both
endochondral ossification, e.g., the long bones of the appendicular skeleton and
intramembranous ossification, e.g., the calvaria bones. Cx43 is important during initial formation
and mineralization of early prenatal and neonatal bones, as its disruption can lead to shortened
and/or misshapen bones and delayed mineralization, as in the Cx43-/-, DM1Cre;Cx43-/fl, and
DM1Cre;Cx43+/fl(G138R) mice (77,78,89). While phenotypic traits paralleling those seen in human
ODDD (e.g., craniofacial and other bone geometry anomalies, enamel hypoplasia, syndactyly
amongst others) have been reported in some mouse Cx43 models, we have found no reports of
low bone mass in patients with GJA1 mutations. Whether this is due to interspecies differences
in the importance of CX43 in bone maintenance (e.g. other factors compensating for the loss of
functional Cx43 channels), or reflects that the presentation of more severe symptoms (e.g.
various neurological and cardiac symptoms, ocular abnormalities, conductive hearing loss) have
precluded the testing or reporting of altered bone density is not yet clear (92).
While not yet reported in human ODDD or exhaustively studied in the Cx43 mutant mice
described to date, it is thought that Cx43 channels play a role in controlling both the composition
and quality of the bone matrix. For example, at least certain mutations of Cx43 negatively affect
the maturation of collagen fibrils (88) and result in disorganization of collagen fibers in the bone
matrix (78). The decreased maturation of collagen fibrils in OcnCre;Cx43–/fl mice decreases the
strength of the bone material (88), while the disorganization of collagen fibers in the matrix of
DM1Cre;Cx43-/fl mice is accompanied by a reduction in mineralization (78). More work is needed
to further assess the bone matrix - changes in make-up and quality - in Cx43 murine mutant
models and potentially ODDD patients, and their impacts on the resultant bone phenotypes.
19
1.5.2 Cx43 disruption: Effect on development and activity of osteoblast lineage cells
Although functional Cx43 channels are required for the normal processes of differentiation,
function and bone-forming activities of osteoblasts, understanding the exact role - or multiplicity
of roles - of Cx43 in the osteoblast lineage is still evolving. For example, there have been
discordant findings in terms of osteoblastogenesis and osteoblast function in various Cx43
mutant models. The discrepancies are, in part, related to the stage in the lineage development that
Cx43 channels are disrupted. For example, disruption in early stage cells indicates that Cx43 has
a role in stromal cell commitment, maintenance of precursor populations and/or in controlling
the subpopulation makeup of the stroma. At these earlier stages, disruption of Cx43 channels
results in increased mesenchymal progenitor and osteoprogenitor numbers, as seen in the
DM1Cre;Cx43-/fl and ColCre;Cx43–/fl mice (78,82), suggesting that Cx43 may function to restrain
progenitor numbers in the bone marrow, possibly by suppressing proliferation (99) or by
promoting apoptosis; this is in contrast to its role in osteocytes, where Cx43 is necessary to
maintain viability (see below) (86,87).
It should also be noted that when Cx43 channels are disrupted very early in the lineage
(e.g., in Cx43 -/-, DM1Cre;Cx43-/fl and +/fl(G138R) and Cx43 +/G138R mice), general osteoblast
dysfunction (reduced mineralization capacity and decreased expression of osteoblast markers)
has been reported (77-79,100). Importantly, however, osteoblasts from different skeletal locations
(e.g. calvaria versus trabecular versus cortical bone-derived; endocortical- versus perisoteal-
derived; and calvaria-derived versus bone marrow stromal-derived osteoblasts in vitro) are
differentially sensitive to loss of Cx43. For instance, ablation of Cx43 typically results in
upregulated osteoblast bone formation on periosteal surfaces of cortical bone and enhanced
responsiveness to in vivo loading (e.g. DM1Cre;Cx43-/fl and OcnCre;Cx43–/fl mice) (78,79,87).
While the effect of Cx43 ablation on endosteal bone formation has been reported to be different
in different models, osteoblastic responsiveness to mechanical loading on endosteal surfaces is
attenuated in Cx43 knockout mice (e.g. DM1Cre;Cx43-/fl and ColCre;Cx43–/fl mice) (78,81,85,101).
The differing responses to loading on the periosteal and endosteal envelopes of Cx43-deficient
bone have been posited to arise due to decreased SOST production specifically by osteocytes
close to the periosteal surface or from site-specific (periosteal versus endosteal) cell autonomous
20
alterations in sensitivity to mechanical load and mechanotransduction. While more remains to be
done to understand the mechanisms, the results highlight the complex role that Cx43 has in
osteoblastic and their accessory cells in different skeletal locations.
Finally, when Cx43 channels are disrupted at later stages (e.g. in MC3T3 cells, a
preosteoblastic cell line, or in OcnCre;Cx43-/fl and DMP1Cre;Cx43fl/fl mice), osteoblastogenesis
and osteoblast activity have been reported to be normal (95). However, Cx43 appears to have a
role in maintaining osteocyte viability specifically in the cortical bone compartment. Studies on
the OcnCre;Cx43-/fl and DMP1Cre;Cx43fl/fl mice reveal that loss of Cx43 in mature osteoblast
and osteocyte populations leads to increased osteocyte apoptosis (86,87). Bivi et al. suggested that
the reduced osteocyte number results in changes in levels of osteocyte-derived factors (e.g.
SOST, RANKL and OPG) that control bone formation and resorption, and that osteocytes
undergoing apoptosis emit signals that act as chemoattractants to induce osteoclast recruitment
and resorption, driving changes in the bone geometry of these Cx43 mutant mice (87).
Nevertheless, it remains unclear why when Cx43 channels are also disrupted earlier, that is in
osteoblast precursors (e.g. in the DM1Cre;Cx43-/fl mice), osteocyte numbers and apoptosis are
unaffected (78).
1.5.3 Cx43 disruption: Effect on the development and activity of osteoclasts
A variety of in vitro studies indicate that functional Cx43 gap junctions are essential for
osteoclastogenesis (differentiation and fusion), osteoclastic bone resorption and/or osteoclastic
survival (71,102-104). For example, disruption of Cx43, with the use of antibodies, mimetic peptides
(e.g. Gap 27) or pharmacological inhibitors, reduces osteoclastogenesis (formation and fusion of
TRAP-positive osteoclasts), bone resorption (number and/or size of resorption pits) and
osteoclastic survival rate in culture models. Such studies have suggested that Cx43 gap junction
communication has a direct effect on osteoclast development, activities and survival, perhaps by
influencing signaling pathways downstream of RANKL (105), other inducers of
osteoclastogenesis, or factors controlling proliferation and/or apoptosis.
21
On the other hand, in vivo disruption of Cx43 at various stages of the osteoblast lineage,
as in DM1Cre;Cx43-/fl, OcnCre;Cx43–/fl and DMP1Cre;Cx43fl/fl mice, results in increased
osteoclast numbers and bone resorption in bones, especially on endosteal surfaces (78,85,87). These
results suggest that the effect of Cx43 disruption on osteoclast formation and function is indirect
or secondary to communication from osteoblasts, osteocytes and/or stromal cells either directly
through gap junction intercellular communication, through signals emitted from apoptotic
osteocytes acting as chemoattractants for osteoclasts and their precursors (as discussed above), or
through changes to factors such as RANKL and OPG, or a combination of these.
That Cx43 gap junction communication affects the expression of RANKL and OPG,
chemokines produced by osteoblasts, osteocytes and stromal cells that are crucial to the
formation and activation of osteoclasts, is now well-established. Disruption of Cx43 in
DM1Cre;Cx43-/fl, OcnCre;Cx43–/fl, and DMP1Cre;Cx43fl/fl mice causes changes in the RANKL-
OPG signaling axis favoring an increase in the RANKL/OPG ratio (78,85,87), promoting
osteoclastogenesis and bone resorption, and contributing to the osteopenic phenotypes of Cx43
mutant mice.
Given the results to date, it remains unclear whether osteoclasts and adjacent cells
communicate directly via gap junction intercellular communication and/or whether osteoclasts
rely on hemichannels to communicate (receive and emit signals) with nearby cells on the bone or
within the stroma. Regardless, more work is needed to determine the precise direct and/or
indirect mechanism(s) by which Cx43 gap junction communication regulates bone resorption.
1.6 Cx43 channels and signaling in bone cells’ response to stimuli
Modulating the formation and function of gap junctions and hemichannels allows cells to
modulate (propagate or diminish) signaling responses in networks of nearby and connected cells.
Notably, osteoblastic cells respond to a variety of mechanical and hormonal signals, to bone
endogenous (autocrine/paracrine) factors, such as cytokines and growth factors, and to
exogenous factors, such as pharmacological agents, with changes to Cx43 expression. This leads
to differences in functional coupling (passage of signaling molecules and ions) between cells or
22
cells and their environment, in turn altering osteoblastic cell responsiveness to the same or other
signals(106,107), and resulting in an overall adaptive response of the skeleton to a particular
stimulus. For instance, gap junction intercellular communication in bone cells plays an important
role in response to mechanotransduction, e.g. by propagating such signals through osteoblast
networks with second messengers Ca2+ (108) and PGE2 (109).
1.6.1 Growth factors, morphogens, and other molecules
Connexin 43 gap junction intercellular communication plays an important role in enhancing the
signaling and transcriptional response of osteoblasts to growth factors, morphogens, or
hormones. In addition to the important role of Cx43 channels in transport of signaling molecules,
Cx43 has been shown to interact with intracellular structural and signaling molecules to
modulate cellular signaling activities. For instance, Cx43 proteins have been proposed and/or
shown to interact with Src kinase to activate ERKs in response to bisphosphonate-mediated cell
survival signaling (110), with β-arrestin in response to PTH survival signaling (111), and with
protein kinase C-delta during FGF2 signaling (112). Cx43 can alter the transcriptional regulation
of particular genes’ promoter elements via select signaling pathways, like MAP-kinase and
protein kinase C -δ, which may be required to integrate and enhance signals or transduce them
across the osteoblast network(113,114). Specifically for instance, Cx43-dependent amplification of
FGF2 signaling in osteoblasts occurs via cell-cell communication and activation of ERK and
PKC-δ; this allows for a coordinated response to the FGF2 signal, enhancing the transcriptional
activation of Runx2, in an osteoblast population (114,115).
Cx43 has also been proposed to physically interact with β-catenin protein (116), although
its direct involvement in two of the major osteoblastic signaling pathways, the Wnt and BMP
signaling pathways, remains unknown. Interestingly, Dobrowolski et al. showed that the
syndactyly phenotype of the Cx43+/G138R and Cx43-/- mice arises from decreased interdigital
apoptosis due to decreased SHH and BMP2, along with subsequent increase in FGF signaling
due to increased FGF4 and FGF8 (117). Kim et al. showed that disruption of Cx43 by antisense-
oligonucleotides caused increased Shh and decreased Bmp2 expression levels during fungiform
papillae development (118). Clearly, disruption of Cx43 gap junction coupling can lead to
23
alterations of morphogens or growth factors such as BMPs and FGFs, but the mechanism by
which this occurs must continue to be investigated (119).
1.6.2 Mechanostimulation
Responsiveness to, for example, mechanical stress is needed to maintain the integrity of the
skeleton. Ablation of Cx43 (e.g. in DM1Cre;Cx43-/fl, OcnCre;Cx43–/fl and DMP1Cre;Cx43fl/fl
mice) generally enhances the anabolic response to mechanical loading(78,81,85,101). The increased
responsiveness has been linked to changes in signaling molecules, specifically to a decrease in
SOST expression (in bones of DM1Cre;Cx43-/fl mice(120)) or to an upregulation of β-catenin
protein levels (‘priming’ osteocytes of DMP1Cre;Cx43fl/fl mice to respond to stimulation(121)).
Conversely, loss of Cx43 attenuates the catabolic response to unloading (e.g. in ColCre;Cx43–
/fl(120) and OcnCre;Cx43–/fl(83) mice). This phenomenon has also been linked to a reduction in
SOST (i.e. the decreased number of SOST-positive osteocytes in OcnCre;Cx43–/fl mice(122)), or
to the increase in baseline osteoclast numbers (in ColCre;Cx43–/fl mice(81,120)) which may limit
further osteoclast activation upon unloading. Regardless, these data suggest that disruption of
Cx43 alters how bones perceive and respond to mechanical stimulation, possibly because Cx43
has a role in desensitizing the bone to mechanical signals either by controlling molecules that
enhance sensitivity to such signals (e.g. SOST and β-catenin) or by directly controlling the
viability/activities of cells that respond to mechanical stimulation (e.g. osteocytes, osteoblasts
and osteoclasts).
1.7 Age-related changes in Cx43 channel formation and function
The formation and responses of Cx43 channels to stimuli decline as a function of age(123,124).
Cx43 gap junction formation is significantly lower in older versus younger bone marrow MSCs
and HSCs(123,125,126). This is interesting vis-a-vis the proposed role of Cx43 in developing bone
marrow, during cell division and progenitor proliferation, and in repopulation of the bone
marrow during regeneration(125,126), but cause versus effect relationships remain to be rigorously
determined. Functional Cx43 channels are necessary to modulate the response of osteoblasts to
physiological signals, as outlined above. However, it has been shown that Cx43 gap junction
24
intercellular communication in response to at least one signal, that of PTH, decreases as a
function of age(124), and ablation of Cx43 in mice results in an attenuated response to PTH(81).
Under normal conditions, treatment with PTH upregulates Cx43 expression and gap junction
intercellular communication in osteoblastic cells(106,127,128).
The decrease in Cx43 gap junction formation and function with age may explain, at least
in part, why the adult skeleton is less able to adapt to the physical demands placed on it. Also the
decreased responsiveness of cells to hormonal and mechanical signals with age, due to decreased
formation and function of Cx43 channels, likely contributes to the presence of osteopenia and
osteoporosis with increasing age. The early-onset osteopenic phenotypes displayed by the Cx43
mutant mouse models further support the link between reduced Cx43 channel formation/function
and osteopenia/low BMD.
1.8 Thesis Objectives
Osteopenia and osteoporosis are conditions characterized by varying degrees of low bone mass,
arising from a shift in the normal equilibrium maintained between the actions of osteoblasts
(bone forming cells) and osteoclasts (bone resorbing cells). Coordination between these cells is
maintained, in part, by cell-cell communication across gap junctions and hemichannels, in
addition to other cell-cell and cell-environment interactions. Cx43 is the major gap junction-
forming protein found in bone, and its disruption (deletion, conditional-deletions, and missense
mutations) in mouse models has been documented to reduce bone mineral density and bone
biomechanical properties. While the Cx43 mutant models maintain several unique features,
resulting from the stage in the osteoblast lineage development that Cx43 is disrupted, the
osteopenic phenotypes have generally been attributed to osteoblast dysfunction and/or increased
osteoclast numbers/activity.
The work presented here is based on a new osteopenic mouse model carrying a unique
mutated Cx43 allele. Through a genome-wide ENU mutagenesis screen, a mouse line, Gja1Jrt/+,
was isolated with a missense mutation leading to a G60S amino acid substitution in Cx43 (89). In
addition to having the classical symptoms of ODDD, Gja1Jrt/+ mice are osteopenic, with reduced
bone mineral density, bone mineral content and mechanical strength at 22 weeks of age, delayed
25
ossification of craniofacial bones of mesoderm and neural crest origin, osteopenic endochondral
bones in adult mice (8- 51 weeks of age), and increased bone marrow adipogenesis in young
mice (18 weeks of age) that progresses with age (until 51 weeks of age). My goal was to further
describe the bone phenotypes and to identify the mechanism(s) behind the bone phenotypes
exhibited by the Gja1Jrt/+ mice.
26
Chapter 2 The G60S Connexin 43 Mutation Activates the Osteoblast
Lineage and Results in a Resorption-Stimulating Bone Matrix and Abrogation of old Age-related Bone Loss
The work presented in Chapter 2 is published as:
The G60S Connexin 43 Mutation Activates the Osteoblast Lineage and Results in a
Resorption-Stimulating Bone Matrix and Abrogation of old Age-related Bone Loss
Tanya Zappitelli*1, Frieda Chen*2, Luisa Moreno3, Ralph A. Zirngibl2, Marc Grynpas3,4, Janet E.
Henderson5 and Jane E. Aubin1,2,4
*co-first authors, 1Department of Medical Biophysics, 2Department of Molecular Genetics, and 3Department of Laboratory Medicine and Pathobiology, University of Toronto, 1 King's College
Circle, Toronto, Ontario M5S 1A8, Canada, 4Centre For Modeling Human Disease, Samuel
Lunenfeld Research Institute, Mount Sinai Hospital, 600 University Avenue, Toronto, Ontario
M5G 1X5, Canada, 5Division of Orthopedics, Montreal General Hospital, 1650 Cedar Avenue,
Montreal, Quebec H3G 1A4, Canada.
J Bone Miner Res. 2013 Nov;28(11):2400-13
Author Contributions: Study design and conduct: TZ, FC, LM, RAZ, MG, JEH, and JEA. Data
collection: TZ, FC, LM, and RAZ. Data analysis: TZ, FC, LM, RAZ, and JEH. Data
interpretation: TZ, FC, LM, RAZ, MG, JEH, and JEA. Drafting manuscript: TZ, FC, and JEA.
Revising manuscript content and approving final version of manuscript: TZ, FC, LM, RAZ, MG,
JEH, and JEA. TZ, FC, LM, RAZ, MG, JEH and JEA take responsibility for the integrity of the
data analysis.
27
2
2.1 Abstract
We previously isolated a low bone mass mouse, Gja1Jrt/+, with a mutation in the gap junction
protein, alpha 1 gene (Gja1), encoding for a dominant negative G60S Connexin 43 (Cx43)
mutant protein. Similarly to other Cx43 mutant mouse models described, including a global
Cx43 deletion, four skeletal cell conditional-deletion mutants and a Cx43 missense mutant
(G138R/+), a reduction in Cx43 gap junction formation and/or function resulted in mice with
early onset osteopenia. In contrast to other Cx43 mutants, however, we found that Gja1Jrt/+ mice
have both higher bone marrow stromal osteoprogenitor numbers and increased appendicular
skeleton osteoblast activity leading to cell autonomous upregulation of both matrix bone
sialoprotein (BSP) and membrane-bound receptor activator of nuclear factor kappa-B ligand
(mbRANKL). In younger Gja1Jrt/+ mice, these contributed to increased osteoclast number and
activity resulting in early onset osteopenia. In older animals, however, this effect was abrogated
by increased osteoprotegerin (OPG) levels and serum alkaline phosphatase (ALP) so that
differences in mutant and wild type (WT) bone parameters and mechanical properties lessened or
disappeared with age. Our study is the first to describe a Cx43 mutation in which osteopenia is
caused by increased rather than decreased osteoblast function and where activation of osteoclasts
occurs not only through increased mbRANKL but an increase in a matrix protein that affects
bone resorption, which together abrogate age-related bone loss in older animals.
2.2 Introduction
Connexins comprise the gap junction- and hemichannel-forming membrane proteins in bone and
other tissues. Gap junctions allow direct cell-cell coupling and communication, whereas
hemichannels, the unopposed halves of gap junctions, allow for release of extracellular signaling
molecules. Cx43 is the major connexin expressed in osteoblasts and osteocytes and is also
expressed in osteoclasts and bone marrow stromal cells (66,129,130), and as such has been
implicated in mediating cell-cell coupling and intercellular communication/signaling in the
tightly regulated process of bone metabolism.
28
Cx43 global and conditional knockout (KO) mutant mice with decreased gap junction
function are osteopenic and/or exhibit alterations in the structure/geometry of long bones
(77,78,80,85,87,88). The low bone mass phenotype was attributed in earlier studies to fewer and
dysfunctional osteoblasts, or increased bone resorption by osteoclasts, or both. For example,
Cx43 global and collagen 1a1 (Co1a1) promoter-Cre osteoblast-deleted Cx43 mice have fewer
and dysfunctional osteoblasts producing less bone matrix and with reduced mineralization in vivo
and in vitro (77,80). Mice with Cx43 ablation in the osteo-chondrogenic lineage via use of the
Dermo1/Twist2 (DM1) promoter results in both dysfunctional osteoblasts and increased
osteoclastogenesis and bone resorption (78). Mice with Cx43 deleted at later stages of the
osteoblast lineage have also been generated. One osteocalcin (Ocn) promoter-Cre osteoblast-
deleted Cx43 mouse line with Cx43 ablation in osteoblasts and osteocytes was reported to have
no detectable change in bone mineral density but an abrogated response to the anti-apoptotic
effect of bisphosphonates on osteocytes and osteoblasts (86) whereas another OcnCre Cx43 mouse
line was reported to exhibit increased osteoclastogenesis and bone resorption due to an increase
in the RANKL/OPG ratio in osteocytes, as well as an enhanced anabolic response to load (85). In
these cases, although bone density was unaffected, the structural parameters of the long bone
were still affected (79,83,85). In other recent analyses, Plotkin and colleagues reported that in both
their OcnCre Cx43 mouse strain and a dentin matrix protein-1 (Dmp1) promoter-Cre Cx43
mouse strain in which Cx43 is deleted from osteocytes only, no change in bone mineral density
is detectable (except for a slight decrease at 2 months in the Dmp1Cre Cx43 strain) but increased
osteocyte apoptosis and altered osteoclast and osteoblast activity via reduced expression of OPG
and sclerostin (Sost) respectively (87) promote geometric changes in long bones. In the +/G138R
mouse, which carries a mutation in the cytoplasmic loop of Cx43 and expresses normal levels of
Cx43 protein but has reduced gap junction function, osteopenia and a non-statically significant
decrease in osteoblast number were reported (91). Taken together, the data from the KO and
G138R missense mutants suggest differences in the mechanisms underlying changes in
osteoblast and osteoclast activity upon disruption of Cx43 globally or at different stages of
osteoblast development.
Through an N-ethyl-N-nitrosourea mutagenesis screen, we generated a mouse line,
Gja1Jrt/+, containing a glycine to serine mutation (G60S) in the first extracellular loop of Cx43
(denoted herein as Gja1Jrt for the allele and G60S for the mutation). Like other Cx43 mutants,
29
this line had a bone phenotype of decreased bone mass and mechanical strength, and like G138R
mice, exhibited the classical features of human oculodentodigital dysplasia (ODDD) (89), a rare
disease characterized by syndactyly, enamel hypoplasia, craniofacial abnormalities, abnormal
eye development and small stature (131). Although Gja1Jrt/+ mice express less than 50% of wild
type (WT) levels of Cx43 and have markedly reduced gap junction formation and function in
osteoblasts and other Cx43-expressing cell types (89,95), we now report the unexpected finding
that Gja1Jrt/+ mice have more active osteoblasts than their WT littermates. We also report that
while young Gja1Jrt/+ mice are osteopenic, older mutant mice do not exhibit the old age-related
bone loss seen in WT, and report the novel cellular and molecular basis of the osteopenia and
age-related phenotypic anomaly in Gja1Jrt/+ mice.
2.3 Materials and Methods
Animals and Ethics Statement
Gja1Jrt/+ founders in a C57BL/6J background were backcrossed four generations to C3H/HeJ
mice. Males from the fourth generation (C4) were crossed to FVB females to generate F1 mice;
a second crossing to FVB produced F2 mice. This study was performed using litters from a cross
between F2 males to C3H/HeJ females. All experimental procedures were performed in
accordance with protocols approved by the Canadian Council on Animal Care and the University
of Toronto Faculty of Medicine and Pharmacy Animal Care Committee.
Bone mineral density
Dual energy x-ray absorptiometry (PIXImus, Lunar Corp., Madison, WI) was used to measure
bone mineral content (BMC), bone area and bone mineral density (BMD) of femurs in mice (89).
MicroCT of femurs and vertebrae
The distal metaphysis of the left femurs were scanned with a Skyscan 1072 microCT instrument
(Skyscan, Belgium) at the Centre for Bone and Periodontal Research (www.bone.mcgill.ca) as
described (132). Morphometric parameters were calculated with 3D Creator software.
30
Mechanical testing
Destructive three-point bending was performed as previously described (133) and the ultimate
load, failure displacement, stiffness and energy to failure were determined from the load
displacement curve. These parameters were normalized to the cross-section of the femurs
(measured with calipers) to calculate the ultimate stress, ultimate strain, young’s modulus and
toughness.
Dynamic histomorphometry
Mice were given two intra-peritoneal injections of 30mg/kg aqueous calcein prior to sacrifice as
described (132). Polymethylmethacrylate (MMA) embedded left femurs were cut in 3 µm sections.
Histochemistry
The right femur in 4% paraformaldehyde (PFA) was embedded in a mixture of MMA and
glycolmethacrylate (GMA) and 5 µm sections stained with 5% silver nitrate and 0.2% toluidine
blue to visualize mineralized bone, osteoid and osteoblasts. Visualization of osteoclasts in
sections was tartrate resistant acid phosphatase (TRAP) staining and counterstained with 0.4%
methyl green (Vector Laboratories Inc.) and mounted in aqueous medium (134).
Plasma Biochemistry
Whole blood was collected through the saphenous vein, and the plasma was separated from
whole blood by centrifugation and stored at -80° C until biochemical analysis (Vita-Tech,
Ontario, Canada).
Quantitative RT-PCR
Total RNA was isolated from bone and cell cultures using TriReagent (Sigma-Aldrich, St. Louis,
MO) and reverse transcribed using Superscript II (Invitrogen, Carlsbad, CA) and random
hexamers. cDNA was combined with 0.5 µM each of the forward and reverse primers (135) (Table
2.1) and iQ™ SYBR® Green Supermix and run in the MyIQ Real-Time PCR system (BioRad
Laboratories, Hercules, CA). Raw data were analyzed with PCR Miner (136) and normalized using
the internal control transcript for ribosomal protein L32.
31
Gene Direction Sequence Product size (bp)
Alp* Forward
Reverse
CCAACTCTTTTGTGCCAGAGA
GGCTACATTGGTGTTGAGCTTTT 110
Bsp* Forward
Reverse
CAGGGAGGCAGTGACTCTTC
AGTGTGGAAAGTGTGGCGTT 158
CalR ~ Forward
Reverse
CTGGTGCGGCGGGATCCTATAA
AGGGCACGAGTGATGGCGTG 218
Cathepsin K ~
Forward
Reverse
ACCCATATGTGGGCCAGGATGA
GAGATGGGTCCTACCCGCGC 136
Col1a1* Forward
Reverse
GCTCCTCTTAGGGGCCACT
CCACGTCTCACCATTGGGG 103
Dmp1~ Forward
Reverse
CATTCTCCTTGTGTTCCTTTGGG
TGTGGTCACTATTTGCCTGTC 185
E11~ Forward
Reverse
TGCTACTGGAGGGCTTAATGA
TGCTGAGGTGGACAGTTCCT 103
L32 #
Forward
Reverse
CACAATGTCAAGGAGCTGGAAGT
TCTACAATGGCTTTTCGGTTCT 100
NFATc1~ Forward
Reverse
CAGCTGTTCCTTCAGCCAAT
GGAGGTGATCTCGATTCTCG 140
Ocn* Forward
Reverse
CTGACCTCACAGATCCCAAGC
TGGTCTGATAGCTCGTCACAAG 187
Opg* Forward
Reverse
GGGCGTTACCTGGAGATCG
GAGAAGAACCCATCTGGACATTT 125
Opn* Forward
Reverse
AGCAAGAAACTCTTCCAAGCAA
GTGAGATTCGTCAGATTCATCCG 134
OSCAR ~ Forward
Reverse
GTCCCTCCCCTGGCCTGCAT
AGGCAGATTGAGGTGCGCGG 149
Osx* Forward
Reverse
ATGGCGTCCTCTCTGCTTG
TGAAAGGTCAGCGTATGGCTT 156
Phex* Forward
Reverse
GATGCAGGGACAAAAAGGAA
AAATACTTGCGGGTTTGCAG 167
Rankl* Forward
Reverse
CAGCATCGCTCTGTTCCTGTA
CTGCGTTTTCATGGAGTCTCA 107
Runx2* Forward
Reverse
TGTTCTCTGATCGCCTCAGTG
CCTGGGATCTGTAATCTGACTCT 146
Sost ~ Forward
Reverse
TTCAGGAATGATGCCACAGA
GTCAGGAAGCGGGTGTAGTG 179
Trap ~ Forward
Reverse
TGGCAGGGCAGGAACTCTGGA
GTAGGCCCAGCAGCACCACC 139
Table 2.1 Quantitative RT-PCR primer sequences used in this study
Oligonucleotides were obtained from *PrimerBank, ~ NCBI primer design, and designed with #Primer Express, version 2.0 (Perkin-Elmer, Foster City, Calif.)
32
Isolation of Bone Marrow Cells and CFU-O assay
Bone marrow cells were isolated from resected tibia and femora, using a modification of a
previously published method (137). Cells were plated in α-MEM supplemented with 10% heat-
inactivated FBS and antibiotics (1 IU penicillin, 1µg/mL streptomycin, 50µg/mL gentamicin,
250ng/mL fungizone) (standard medium) at 1x 106 nucleated cells/35-mm dish. After three days,
the medium was changed to differentiation medium (standard medium with 50 µg/mL ascorbic
acid and 10 mM β-glycerophosphate). At day 19, cultures were stained for alkaline phosphatase
(ALP) activity and mineralization (Von Kossa) (138), counted, then re-stained with methylene
blue.
Protein isolation from bone and stromal culture and Western blotting
Long bones, cleaned of surrounding tissue, epiphysis and bone marrow, were cut slightly below
the growth plate to separate trabecular bone. Matrix proteins were extracted following a protocol
modified from Goldberg and Sodek (139). Briefly, bones were transferred to 4.0 M Guanidine
HC1 for 30 minutes, washed in PBS and crushed into bone powder in liquid nitrogen. Bone
powder or stromal cultures were washed in PBS then extracted with 0.5 M EDTA in 50 mM
Tris/HCl pH 7.4 buffer for four sequential 24-hour extracts. Non-matrix proteins (mbRANKL)
were extracted in cell lysis buffer as described (140). Protein extracts (30 µg) underwent
immunoblotting with antibodies of interest (Table 2.2). Densitometry was done by
chemiluminescence detected on film and quantified using Image J software; BSP levels were
normalized against either ACTIN or OPN, and in either case was increased significantly.
Osteoclast differentiation assay
Spleen-derived: Spleens were crushed through a sterile 100 µm mesh in standard medium. Cells
were collected by centrifugation, resuspended in PBS, treated with ammonium chloride to lyse
the red blood cells and plated in standard medium supplemented with cytokines RANKL and M-
CSF at 50ng/mL at a density of 1x106 cells per well of 12-well culture plate. Medium was
changed after three days. On day 6, cells were fixed and stained for TRAP according to the
manufacturer’s instructions (Sigma).
Bone marrow-derived: Bone marrow stromal cells were isolated as above and resuspended in
standard medium supplemented with 100ng/mL of M-CSF. After two days, medium was
changed to standard medium supplemented with 50ng/mL M-CSF and 100ng/mL RANKL.
33
Antigen Host Company Catalogue ID
ACTIN Rabbit Sigma-Aldrich A2066
BSP Rabbit Millipore AB1854
mRANKL Mouse Abcam ab45039
OCN Rabbit Millipore AB10911
OCN Rabbit Santa Cruz Biotech., Inc. sc-30045
OPN Goat Abcam ab11503
Anti-goat IgG-HRP Donkey Santa Cruz Biotech., Inc. sc-2020
Anti-mouse IgG-HRP Goat Thermo Scientific LE146795
Anti-rabbit IgG-HRP Goat Santa Cruz Biotech., Inc. sc-2004
Table 2.2 List of antibodies used in this study.
Information regarding the antibody host, company of purchase and catalogue ID is included.
34
Bone resorption assays
Artificial substrate assay: Osteoclasts isolated as above were plated onto Corning® Osteo Assay
Surface plates (Corning Inc., NY). Resorption area was measured using ImageJ (version 1.44p).
Trabecular bone resorption assay: Trabecular bone isolated as above was crushed into fine
pieces under liquid nitrogen, using a mortar and pestle. The bone chips were washed and
sonicated in ice cold water for 4 times then transferred to ice cold 70% ethanol and stored at -
20oC until use. Prior to use, the bone powder was washed 3 times with sterile water and
incubated overnight in α-MEM containing antibiotics solution (10X concentrations above). On
the day of the experiment, the bone powder was washed with and then resuspended in
osteoclastogenic medium (as above) and distributed into 96-well plates in excess. Bone marrow
cells were plated on top of the bone chips, and cultured as above for osteoclast formation and
resorption.
Enzyme-linked immunosorbent assay (ELISA)
OPG and TRANCE/RANKL in serum were assayed using a Quantikine M Murine OPG ELISA
kit and a Quantikine M Murine TRANCE/RANKL ELISA kit (No.MOP00 and No.MTR00,
R&D Systems, Minneapolis, MN), respectively following the manufacturer’s directions. CTX-1
levels in serum was determined from fasted mice using Serum CrossLaps® ELISA (RatLaps EIA
No. AC-06F1, Immunodiagnostic Systems, Fountain Hills, AZ).
Statistical analysis
Results are presented as mean ± SD. Experiments were repeated at least three times. Statistical
analysis was performed using GraphPad Software program InStat. Longitudinal analysis was
analyzed by one-way analysis of variance (ANOVA). Unpaired t-Test was used for direct
comparisons between mutant and WT parameters; n values presented are independent biological
samples.
35
2.4 Results
Gja1Jrt/+ mice have low bone mineral density (BMD) throughout life but improve with age and
do not exhibit an old age-related decrease in bone mass
At birth, Gja1Jrt/+ mice were indistinguishable from their WT littermates in terms of size, but the
syndactyly phenotype was evident by day 10. Consistent with our previous results from the
phenotypic screen used to identify the Gja1Jrt/+ founder (89), Gja1Jrt/+ mice were markedly
smaller than their WT littermates by 2 months of age, reflected in a lower body weight, and this
persisted throughout life (data not shown). Gja1Jrt/+ mice had significantly lower BMD at all
ages studied compared to age-matched WT littermates, although differences between Gja1Jrt/+
and WT mice became less pronounced with increasing age (Figure 2.1A); total body BMD
reached maximal value by 4 months of age and plateaued thereafter in WT, but in Gja1Jrt/+ mice,
BMD continued to increase until at least 12 months of age (the oldest age quantified).
Microcomputed tomography (microCT) analysis revealed differences in age-related
changes in bone parameters between the genotypes. The percent bone volume to tissue volume
(BV/TV) at 2, 4 and 8 months was significantly lower in the trabecular bone of the distal femur
of Gja1Jrt/+ versus WT mice (Figure 2.1B), with the most striking difference at 4 months (after
which BV/TV plateaued in Gja1Jrt/+ mice) and no difference at 12 months (Figure 2.1C). At 2
months, the lower BV/TV in Gja1Jrt/+ versus WT mice was due to decreased trabecular
thickness (Tb.Th) alone, whereas at 4 and 8 months, both Tb.Th and trabecular number (Tb.N)
were lower in the mutant bone (Figure 2.1C). Consistent with these observations, the structure
model index (SMI) of Gja1Jrt/+ femoral trabecular bone increased from 1.5 to 2.0 between 2 and
4 months of age reflecting a deterioration in the 3-dimensional structure of trabeculae from a
more plate-like to a more rod-like structure. Whereas WT mice exhibited a typical age-related
decrease in trabecular BV/TV after 4 months of age, Gja1Jrt/+ mice did not.
Gja1Jrt/+ femurs were smaller than WT femurs at all ages, with significantly reduced
total tissue, cortical bone and marrow areas (Figure 2.2A and B, Figure 2.3A). When normalized
to total tissue area, femoral cortical bone area (Ct.Ar/Tt.Ar) was significantly reduced and
marrow area (Ma.Ar/Tt.Ar) significantly increased in young (2-4 months) Gja1Jrt/+ versus WT
36
mice, corresponding to reduced cortical bone thickness at 2 months in Gja1Jrt/+. However,
whereas WT cortical thickness remained constant throughout the age range studied (2-12
months), Gja1Jrt/+ cortical thickness increased over time and by 8 months had surpassed that of
WT, resulting in no significant difference in Ct.Ar/Tt.Ar or Ma.Ar/Tt.Ar between genotypes in
older mice (Figure 2.2B). Gja1Jrt/+ femurs were also significantly shorter than those of WT
littermates at all ages (Table 2.3), however WT femurs reached maximum length by 4 months,
and Gja1Jrt/+ femurs by 8 months of age (data not shown). Mechanical testing for material and
structural properties showed that Gja1Jrt/+ bones were less tough, weaker (lower ultimate stress)
and less stiff (lower Young’s modulus) than WT bones at 2 and 4 months of age, but more
ductile (higher failure strain) than WT at 2 months; no significant differences between genotypes
were seen in the older mice. However, the structural properties (ultimate load, energy to failure
and stiffness), which depend on the size and shape of the bone, were significantly decreased in
Gja1Jrt/+ versus WT femoral bones at all ages tested. The average polar moment of inertia
(ability to resist torsion), which usually correlates with the width of the midshaft, was
significantly decreased from 4 to 12 months in Gja1Jrt/+ versus WT femurs (Table 2.3).
37
Figure 2.1 Longitudinal analysis of BMD and trabecular bone parameters.
(A) Whole mouse BMD was significantly lower in Gja1Jrt/+ versus WT mice at all ages tested. (B) Representative microCT images of femurs of Gja1Jrt/+ and WT mice. (C) Histomorphometric analysis of the distal metaphysis of femurs showed significantly lower trabecular bone volume, trabecular number and trabecular thickness in the Gja1Jrt/+ versus WT mice up to 8 months of age, but no difference at 12 months. Solid and dashed lines indicate significant differences over time in WT and Gja1Jrt/+ mice, respectively; n ≥ 6; *p < 0.05, **p < 0.01 and ***p < 0.001.
38
Figure 2.2 Longitudinal analysis of cortical bone parameters.
(A) Representative microCT images of cross-sections of the distal femurs of Gja1Jrt/+ and WT mice. (B) Histomorphometric analysis of the structural properties of the femurs showed significantly lower total tissue area in Gja1Jrt/+ versus WT mice at all ages. Cortical bone of the distal femur of Gja1Jrt/+ mice was thinner than WT at 2 months of age, but increased with age and was higher than that of WT littermates in older mice. Similarly, Ct.Ar/Tt.Ar was significantly decreased and Ma.Ar/Tt.Ar increased at 2 and 4 months of age in Gja1Jrt/+ mice, but no difference at 8 and12 months; n ≥ 6. (C) Endosteal bone formation (BFR) and mineral apposition rate (MAR) were significantly lower at 2 months but not significantly different thereafter in Gja1Jrt/+ versus WT mice. Mineralizing surface per bone surface (MS/BS) was not significantly different between genotypes at 2 to 4 months of age, but was significantly increased at 8 months in Gja1Jrt/+ versus WT bones. (D) Endosteal osteoblast surface per bone surface (Ob.S/BS) and osteocyte number per bone area (Osy.N/BA) were not significantly different between Gja1Jrt/+ and WT from 2 to 8 months of age; n ≥ 2. Solid and dashed lines indicate significant differences over time in WT and Gja1Jrt/+ mice, respectively. *p < 0.05, **p < 0.01 and ***p < 0.001.
39
Figure 2.3 Longitudinal analysis of cortical parameters.
(A) Histomorphometric analysis of the structural properties of the femurs showed significantly decreased cortical bone area at all ages and decreased marrow area at 4- 12 months in Gja1Jrt/+ versus WT mice. Solid and dashed lines indicate significant differences over time in WT and Gja1Jrt/+ mice, respectively; n ≥ 6. (B) There was no difference in the percentage of lacunae that were empty in the cortical bone of Gja1Jrt/+ versus WT mice at 2 and 8 months of age; n ≥ 4. *p < 0.05, **p < 0.01 and ***p < 0.001.
40
Table 2.3 Longitudinal analysis of femoral length and mechanical-material properties of
Gja1Jrt/+ and WT mice are presented.
Arrows indicate the direction of change of each parameter and the percentage difference in Gja1Jrt/+ versus WT; n≥ 6; ns= no significant differences between Gja1Jrt/+ and WT samples, *p < 0.05, **p < 0.01 and ***p < 0.001.
Test Age (months)
2 4 8 12
Femoral Length ns ↓ 10% *** ↓ 5% ** ↓ 4% *
Material Properties
Ultimate Stress ↓ 51% ** ↓ 42% ** ns ns
Failure Strain ↑ 44% ** ns ns ns
Young's Modulus ↓ 65% ** ↓ 47% ** ns ns
Toughness ↓ 29% ** ↓ 38% ** ns ns
Femoral Neck Fracture
Ultimate Load ↓ 28% ** ↓ 32% ** ↓ 32% ** ↓ 21% **
Energy to Failure ↓ 21% * ns ns ↓ 27% *
Stiffness Ns ↓ 47% ** ns ↓ 17% *
Failure Displacement Ns ↑ 23% * ns ns
Structural Properties
Ultimate Load ↓ 37% ** ↓ 42% ** ↓ 27% ** ↓ 20% **
Energy to Failure ↓ 23% * ↓ 41% ** ↓ 33% * ↓ 33% **
Stiffness ↓ 47% ** ↓ 41% ** ↓ 26% ** ↓ 17% **
Failure Displacement ↑ 21% ** ns ns ns
Polar moment of inertia ns ↓ 55% *** ↓ 58% *** ↓ 46% ***
41
G60S is an activating mutation in Gja1Jrt/+ osteoblasts and results in bone matrix with
abnormally high levels of BSP
Given the age-related abrogation of the osteopenia observed in the cortical and trabecular
compartments of Gja1Jrt/+ mice, we next assessed osteoblast and osteocyte numbers and activity.
Gja1Jrt/+ bones exhibited no evidence of changes to bone periosteal surfaces (data not shown)
and there was no significant difference between genotypes in the number of osteoblasts per bone
surface (data not shown), osteoblast surface per bone surface (Ob.S/BS), osteocyte number per
bone area (Osy.N/BA) or number of empty lacunae in the cortical (Figure 2.2D, Figure 2.3B) or
trabecular (Figure 2.4A) bone compartments. Mineral apposition rate (MAR) and bone formation
rate (BFR) were highest in 2 month-old animals in both genotypes, but whereas no significant
differences were seen between genotypes at any age tested in the trabecular compartment (Figure
2.4B), both MAR and BFR were significantly lower on the endosteal surface of cortical bones of
younger (2 month-old) but not older Gja1Jrt/+ versus WT mice (Figure 2.2C). Notably, whereas
MAR and BFR significantly declined after 2 months on the WT endosteal surface, MAR
significantly declined only by 8 months of age and BFR did not decline significantly in Gja1Jrt/+.
Also, mineralizing surface per bone surface (MS/BS) was not significantly different in Gja1Jrt/+
versus WT, but by 8 months of age MS/BS was significantly higher in Gja1Jrt/+ cortical bone,
reflecting a decrease with age in WT but not Gja1Jrt/+ bones.
Expression of early-, mid- and late-osteoblast and osteocyte markers was not different in
cortical bone, with the exception of lower expression of the osteocyte marker Sost in 2 month-old
but not other ages of Gja1Jrt/+ versus WT mice (Figure 2.5). However, whereas Sost expression
was unaffected in trabecular bone, expression of most osteoblast-associated genes, including
Runx2, Osx, Alp, Col1a1, Bsp, Ocn and Phex, was increased in Gja1Jrt/+ versus WT trabecular
bone at all ages (4 month-old bones shown; Figure 2.4D). Similarly, serum ALP, a bone
formation marker, was also significantly elevated at 4, 8 and 12 months of age in Gja1Jrt/+
compared to WT mice (Figure 2.4C).
42
Figure 2.4 Longitudinal analyses of trabecular osteoblast parameters and activity.
Dynamic histomorphometry and histochemistry on the femoral bones of Gja1Jrt/+ and WT littermates showed (A) osteoblast surface per bone surface (Ob.S/BS) and osteocyte number per bone area (Osy.N/BA) were not significantly different between Gja1Jrt/+ and WT trabecular bone; n ≥ 6. (B) Mineral apposition rate (MAR), mineralizing surface to bone surface (MS/BS), and bone formation rate (BFR) were not significantly different in Gja1Jrt/+ versus WT mice; n ≥ 4. (C) Serum concentration of ALP was significantly increased in Gja1Jrt/+ versus age-matched WT mice from 4 to 12 months of age; n ≥ 6. (D) Expression of osteoblast-associated markers in RNA isolated from the trabecular bone of 4 month-old mice was significantly increased in Gja1Jrt/+ versus WT mice. Expression of the osteocyte-associated marker, Sost, was not different between genotypes. n ≥ 4; samples were run in triplicate. *p < 0.05, **p < 0.01 and ***p < 0.001.
43
Figure 2.5 Analysis of osteoblast and osteocyte-specific genes in cortical bone extracts.
(A) Expression of early-, mid- and late-osteoblast and osteocyte differentiation markers were unaffected in RNA isolated from cortical bone of 2, 4, 8 and 12 month old mice, with the exception of decreased Sost expression at 2 months in Gja1Jrt/+ versus WT mice; n ≥ 3 and each sample is comprised of two or more independent biological samples. Samples were run in triplicate. *p < 0.05, **p < 0.01 and ***p < 0.001.
44
G60S was also an activating mutation for stromal cell colony-forming efficiency in vitro,
as evidenced by the significant increase in stromal progenitor populations isolated from the
Gja1Jrt/+ versus WT bone marrow (CFU-fibroblast (CFU-F), CFU-ALP or CFU-osteoblast
(CFU-O)) (Figure 2.6A). Neither stromal cell proliferation nor the sizes of individual colonies
and bone nodules, ALP area/CFU-ALP and mineralized area/CFU-O, was significantly different
between genotypes (data not shown).
Expression patterns of osteoblast-associated differentiation markers in cultured stromal
cells harvested at day 8, 11, 14 and 19, corresponding roughly to the proliferation,
differentiation, maturation-early mineralization and late mineralization stages, were not different
between genotypes during the proliferation or early differentiation stages. However, at later
maturational and late mineralization stages, most osteoblast-associated markers were more
highly expressed in Gja1Jrt/+ bone marrow stromal cultures (Figure 2.6B). Protein extracts
isolated from both trabecular bone (Figure 2.6C) and from mineralized nodules of end point
cultures (Figure 2.6D) showed that the matrix produced by Gja1Jrt/+ osteoblasts contained
strikingly elevated levels of BSP compared to WT matrix although levels of other matrix
proteins, such as osteopontin (OPN) and OCN, were normal.
Gja1Jrt/+ osteoclast number and activity are increased in vivo, but not in vitro
No differences were found in the expression of osteoclast differentiation and fusion markers,
including nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1 (Nfatc1),
calcitonin receptor (CalR), tartrate-resistant acid phosphatase (Trap), and osteoclast associated
receptor (Oscar) as assessed by quantitative RT-PCR (QPCR) of RNA isolated from bones of the
two genotypes (Figure 2.7C). However, several observations suggested that mutant osteoclasts
were more active in vivo than their WT counterparts in younger mice.
45
Figure 2.6 Effect of the Gja1Jrt mutation on osteoprogenitors, osteoblasts and bone matrix
composition.
(A) The number of CFU-F, CFU-ALP, and CFU-O was higher in bone marrow stromal cell cultures Gja1Jrt/+ mice cultured under osteogenic conditions; values are normalized to WT; n = 3. (B) RNA was isolated at four time points throughout proliferation-differentiation in the osteogenic stromal cultures. Expression of osteoblast-associated markers was higher at late differentiation-maturation stages in cultures of bone marrow stromal cells from 2 month-old Gja1Jrt/+ mice; n = 3; samples were run in triplicate; shown is a representative experiment. (C) The ratio of BSP to OPN was increased in the trabecular bone matrix proteins of Gja1Jrt /+ versus WT mice. OPN was not significantly different between genotypes. n ≥ 3; shown are representative blots. A nonspecific band of approximately 37kDa located below the 45kDa ACTIN band is an artifact of the extraction procedure and was not used in quantification (See also Methods). (D) OCN was unchanged but BSP was significantly increased in endpoint bone marrow stromal cell cultures containing mineralized nodules, from Gja1Jrt/+ versus WT mice; n ≥ 3, shown are representative blots. #p < 0.1, *p < 0.05, **p < 0.01 and ***p < 0.001.
46
Figure 2.7 Expression of Rankl-Opg and osteoclast-specific gene expression in Gja1Jrt/+
versus WT mice.
(A) The Rankl/Opg expression ratio in RNA extracted from cortical bone at all ages was unaffected in Gja1Jrt/+ versus WT; n ≥ 3 and each sample is comprised of two or more independent biological samples. (B) Rankl/Opg expression ratio was also unaffected in trabecular bone at 2 and 4 months of age; n ≥ 4. (C) Expression of osteoclast differentiation and fusion markers was unaffected in RNA from trabecular bone of 2 and 4 month-old Gja1Jrt/+ versus WT mice; n ≥ 3. Samples were run in triplicate. *p < 0.05, **p < 0.01 and ***p < 0.001.
47
First, osteoclast surface per bone surface (Oc.S/BS) was significantly increased at 2 months in
both cortical and trabecular compartments in Gja1Jrt/+ versus WT femurs (Figure 2.8A),
increases that were no longer detectable in 4 month or older mice; indeed, in cortical bone,
Oc.S/BS was significantly decreased with age in Gja1Jrt/+ versus WT. Second, expression of
Cathepsin K, an osteoclast activity marker, was increased at 2 (p=0.061) and 4 (p=0.008) months
of age in Gja1Jrt/+ versus WT bone (trabecular bone shown; Figure 2.8B). Finally, although there
was no significant difference between genotypes at any of the ages examined, the serum
concentration of a resorption marker, the C-telopeptide fragment of collagen type I (CTX-1),
remained level in Gja1Jrt/+ mice whereas in WT serum it declined significantly with increasing
age (Figure 2.8C).
To determine whether these differences were cell autonomous, osteoclast cultures derived
from both spleen and bone marrow of mice at 2 (Figures 2.8D), 4, 8, and 12 (data not shown)
months of age were cultured in the presence of RANKL and M-CSF and evaluated for osteoclast
differentiation and activity. No significant differences were found in vitro in osteoclast number,
size (number of nuclei) or resorption activity between Gja1Jrt/+ and WT cells irrespective of
mouse age.
Age-related changes in the RANKL/OPG axis exacerbate or abrogate respectively a BSP-
induced increase in osteoclastogenesis and osteoclast bone resorption in younger versus older
Gja1Jrt/+ mice
Taken together, the data suggest that G60S is an osteoblast autonomous and osteoclast non-
autonomous Cx43 activating mutation in Gja1Jrt/+ bone, leading us to investigate the basis of the
activation of Gja1Jrt/+ osteoclasts. We showed previously that in Bsp-/- mice, bone resorption is
diminished, resulting in mice with increased trabecular bone volume (16). We therefore asked
whether the abnormally high levels of BSP in Gja1Jrt/+ bone contributed to increased bone
resorption in Gja1Jrt/+ mice by plating WT osteoclasts onto bone fragments generated from WT,
Gja1Jrt/+, Bsp+/+ (WT littermates of Bsp-/- mice) and Bsp-/- mice. WT osteoclasts exhibited
significantly higher resorption activity, assessed via CTX-1 concentration in cell culture
medium, when plated onto Gja1Jrt/+ mouse bone fragments than on WT. Conversely, osteoclasts
48
Figure 2.8 Gja1Jrt/+ osteoclast number and activity are increased in young mice in vivo, but
not in vitro.
(A) Endosteal and trabecular osteoclast surface per bone surface (Oc.S/BS) were significantly increased in 2 month-old Gja1Jrt/+ versus WT mice. Endosteal Oc.S/BS was significantly decreased in 4 and 8 month-old Gja1Jrt/+ versus WT mice; n ≥ 3. (B) Cathepsin K expression was increased in RNA from trabecular bone of 2 and 4 month-old Gja1Jrt/+ versus WT mice; n ≥ 2; samples were run in triplicate. (C) Bone resorption, assessed by serum concentrations of CTX-1 fragments, declined significantly after 2 months of age in WT but not Gja1Jrt/+ mice; n ≥ 3. Solid and dashed lines indicate significant differences over time in WT and Gja1Jrt/+ mice, respectively. (D) The number of bone marrow-derived osteoclasts (TRAP-positive) and osteoclast activity (resorbed areas (dark patches) on artificial substrate) in vitro was not significantly different in Gja1Jrt/+ versus WT bone marrow cells cultured with RANKL and M-CSF. Shown are the results from cells isolated from 2 month old mice; n ≥ 3; #p < 0.1, *p < 0.05, **p < 0.01 and ***p < 0.001.
49
had lower resorption activity when plated onto Bsp-/- bone fragments than when plated onto
Bsp+/+ strain-matched bone fragments (Figure 2.9A). This finding was further supported by
QPCR expression analyses which showed that WT osteoclasts plated onto Gja1Jrt/+ bone
fragments had a significantly increased expression of Cathepsin K over those plated onto WT
bone fragments (Figure 2.9B).
The finding that the osteopenic phenotype is present early and at first worsens
precipitously at 4 months but then becomes less pronounced in older mutant mice relative to WT,
despite the fact that BSP over-production is sustained throughout the lifespan of Gja1Jrt/+ mice,
prompted us to examine the OPG/RANKL signaling system at different ages. Although there
was no difference between genotypes in the Rankl/Opg gene expression in either cortical or
trabecular bone (Figure 2.7A, B respectively), in trabecular bone, mbRANKL significantly
increased from 2 to 4 months of age in Gja1Jrt/+ (2.4-fold change; p=0.02) consistent with the
dramatic decline in bone volume from 2 to 4 months, whereas there was no age-related change in
mbRANKL in WT samples (Figure 2.9C). In older mice (8 month old), relative serum
concentrations of OPG were higher in the mutant compared with that in the WT mice, an
observation not found in younger mice (2 month old), whereas serum concentrations of RANKL
were similar between the genotypes at both ages (Figure 2.9D). The increased OPG, along with
unchanged RANKL, in older Gja1Jrt/+ versus WT mice may thus contribute to the relative
protection of the older Gja1Jrt/+ mice against a further age-related decrease in BMD.
50
Figure 2.9 The abnormal bone matrix produced by Gja1Jrt/+ mice promotes bone matrix
resorption.
Bone marrow cells were plated on trabecular bone chips, and cultured for osteoclast formation and resorption. (A) CTX-1 concentration in supernatant of WT osteoclast cultures plated onto either WT, Gja1Jrt/+, Bsp+/+ or Bsp-/- bone fragments. CTX-1 was higher in the supernatant of WT osteoclasts plated onto Gja1Jrt/+ versus WT bone fragments, and lower in the supernatant of WT osteoclasts plated onto Bsp-/- versus Bsp+/+ bone fragments; n = 5. (B) QPCR analysis showed increased Cathepsin K expression in osteoclasts plated on Gja1Jrt/+ versus WT bone fragments; n = 5; samples run in triplicate. The Gja1Jrt mutation affects the RANKL/OPG signaling pathway. (C) In trabecular bone, mbRANKL significantly increased from 2 to 4 months in Gja1Jrt/+, whereas mbRANKL was unchanged over time in WT samples. Shown is one representative blot; n = 3. (D) Serum concentrations of RANKL and OPG in WT versus Gja1Jrt/+ in young (2 month) and old (8 month) mice. Serum OPG was significantly increased in older Gja1Jrt/+ mice versus WT; n ≥ 4. *p < 0.05, **p < 0.01 and ***p < 0.001.
51
2.5 Discussion
Gja1Jrt/+ mice, which carry a G60S missense mutation in Cx43, express less than 50% of WT
levels of Cx43 and have markedly reduced gap junction formation and function in osteoblasts
and other Cx43-expressing cell types (89,95). Like other Cx43 mutants with loss or reduction in
Cx43 gap junction formation and or function, Gja1Jrt/+ mice exhibit early onset osteopenia and
changes in the structural and biomechanical properties of bone, and like G138R Cx43 missense
mutation knockin (+/G138R) mice, exhibit the classical features of human ODDD (89). We report
here a longitudinal study of Gja1Jrt/+ mutant mice, which recapitulate some phenotypic traits of
other Cx43 loss-of-gap junction function models, but also exhibit novel and age-related bone
phenotypes, and we show that the mechanism underlying the osteopenia in these mice results
from activation of osteoblast activity, which also protects mice from further old age-related bone
loss.
G60S is unique in being an osteoblast autonomous activating mutation
Several Cx43 mutant mouse models have been described previously, including a global Cx43
deletion (77), conditional-deletion of Cx43 in bipotent osteo-chondroprogenitors (DM1Cre) (78),
osteoblasts (Col1a1Cre) (80), mature osteoblasts-ostecytes (OcnCre) (85,87), and osteocytes
(Dmp1Cre) (87,88), and a mutant Cx43 knockin (+/G138R) (91). In all these cases except the
Dmp1Cre-osteocyte-specific Cx43 deletion (87,88), a reduction in Cx43 gap junction formation
and/or function resulted in mice that displayed varying degrees of osteopenia, as seen also in the
Gja1Jrt/+ model. The early osteopenic phenotype has usually been attributed to a reduction in
osteoblast number and/or function and/or changes in RANKL/OPG signaling that increase
osteoclast formation and activity; differences in the different models have been attributed to
different consequences of loss of Cx43 function in less or more mature progenitor or osteoblast-
osteocyte populations. We report that the G60S mutation does not abrogate but instead activates
osteoblast function in appendicular bones and in stromal populations as manifested by increases
in MAR-BFR-MS/BS, and increased expression of many osteoblast-associated genes and
increased production of BSP, mbRANKL, OPG and ALP proteins. It should also be noted that
while a previous study suggested that terminal differentiation is diminished in neonatal G60S
52
calvarial osteoblast cells in culture (based on lower Bsp and Ocn expression versus WT cells) (95),
our studies showed that Gja1Jrt/+ calvarial cells are indistinguishable from WT cells in vitro with
regards to ALP production, mineralization, and expression of osteoblast-associated markers
tested including Bsp and Ocn (data not shown). The reasons for the discrepancies are unclear but
may include differences in cell isolation, culturing conditions, and/or mouse strain variations
resulting from independent breeding of successive generations.
In addition to increased osteoblast activity, mesenchymal progenitor and osteoprogenitor
numbers were also increased in stromal cells isolated from Gja1Jrt/+ compared to WT mice, thus
suggesting a role for Cx43 in stromal cell commitment, maintenance of precursor populations,
and/or controlling the overall subpopulation make-up of the stroma. It was recently reported that
mesenchymal and osteoblastic progenitors were increased in the bone marrow of
Col1a1Cre;Cx43flox/flox mice relative to WT littermates (82); the increases were attributed to
downregulated expression of Sost, a factor that prevents mesenchymal stem cell (MSC)
proliferation (141). Similarly, osteoblast activity was reported to be increased in Dmp1Cre-Cx43
ablated mice also as a consequence of downregulation of SOST due to increased apoptosis of
osteocytes (87). However, we found no evidence for increased osteocyte apoptosis, altered
osteocyte number or altered number of empty lacunae at any age in cortical or trabecular bone
compartments, or for altered Sost expression in cortical and trabecular bone in Gja1Jrt/+ versus
WT, with the exception of a decrease in Gja1Jrt/+ cortical bone at 2 months; similarly, Sost
expression was increased at later differentiation stages in Gja1Jrt/+ stromal cell cultures,
consistent with the increased osteoblastogenesis observed. Additionally, in Gja1Jrt/+ cells,
proliferation rates and self-renewal capacity in vitro were unchanged (data not shown). It
remains to be determined what other factors affect the MSC microenvironment, but we
previously reported biphasic expression of BSP during mesenchymal cell differentiation, with
early upregulated or “primed” expression of BSP in very primitive osteoprogenitors (142),
suggesting that BSP overexpression in Gja1Jrt/+ mice may be a factor contributing to MSC
commitment. Further studies are ongoing to dissect how the G60S mutation elicits this effect
specifically on stromal progenitor populations, but altered response to mechanical loading and
hormonal signals may also play roles (see below).
In contrast to osteoblasts, the G60S mutation had no detectable cell autonomous effect on
osteoclasts. This is consistent with previous studies on Cx43-deficient mice in which changes in
53
the RANKL/OPG ratio (increased osteocyte-derived Rankl/Opg mRNA ratio in OcnCre;Cx43fl/fl
mice (85), decreased Opg mRNA levels in DM1Cre;Cx43-/fl osteoblasts (78), and decreased OPG
expression by osteocytes in DMP1Cre;Cx43fl/fl mice (87)) have been reported to underlie the
increased osteoclastogenesis and bone resorption and contribute to the osteopenia and/or altered
bone structure in these mutants. We found no evidence to suggest that the Rankl/Opg changes
were specific to changes in expression by osteocytes, as evidenced by no significant difference in
Rankl/Opg in mutant versus WT cortical bone. However, we did find an osteoblast-dependent
upregulation of osteoclast activity in Gja1Jrt/+ mice due to changes in the RANKL/OPG
signaling axis, with increased mbRANKL protein but normal levels of serum OPG in young
Gja1Jrt/+ mice, concomitant with increased osteoclast number and activity, phenotypic traits that
changed with aging (see below). It is also important to consider that the Gja1Jrt/+ osteoclasts
may be affected by changes in RANKL/OPG expression by other G60S Cx43-expressing cells
that are not in the osteoblast lineage, such as stromal cells, fibroblasts (143) or activated T-cells
(144).
Gja1Jrt/+ is the first Cx43 mutant mouse in which unusually high levels of matrix BSP have been
reported and linked to increased osteoclast activity
Although gene expression of most osteoblast-associated markers was upregulated, only BSP
content and not that of other osteoid proteins (e.g., OPN, OCN) was increased in the trabecular
bone matrix and mineralized nodules of stromal cultures of Gja1Jrt/+ compared to WT mice.
Whether this is due to preferential degradation of matrix proteins other than BSP, more robust
sequestration of BSP into the bone matrix, or other possibilities, is currently not known.
Additionally, this does not preclude the possibility that the content of other untested matrix
proteins may be altered, contributing to the abnormal composition and enhanced resorption rate
of the Gja1Jrt/+ bone matrix. In any case, the in vitro resorption assay we developed indicated
that the abnormal composition of the Gja1Jrt/+ bone matrix was a significant factor in Gja1Jrt/+
osteopenia, with high BSP promoting high resorption. RANKL and human recombinant BSP
were shown to act synergistically to induce osteoclastogenesis and bone resorption in vitro (145).
We have also reported that Bsp-/- mice, in contrast to the Gja1Jrt/+ mice, had higher trabecular
bone density and lower bone turnover (16). Similarly, many histological features of the Gja1Jrt/+
54
skeleton correlate with observations in BSP-overexpressing CMV-BSP transgenic mice, which
display a decrease in trabecular bone due to an increased Oc.S/BS (146). Thus, from both our in
vivo analyses of young Gja1Jrt/+ bones and in vitro resorption assays testing the Gja1Jrt/+ bone
matrix, we conclude that the decrease in Gja1Jrt/+ bone volume results from increased
osteoclastogenesis and bone resorption at least in part in response to increased matrix BSP.
No other studies have yet reported a bone matrix containing abnormal levels of bone
proteins in Cx43 mutant mice (77,80,85,91), however, we predict that the disordered collagen
bundles recently reported in cortical bone matrix of DM1Cre;Cx43-/fl mice (78) and the decreased
mineralization of the femoral diaphysis in DMP1Cre;Cx43fl/fl mice (88) may reflect abnormal
content of the non-collagenous proteins, in particular BSP. This may also be a factor in the
recently reported OCNCre;Cx43fl/- mice, in which reduced quality of the bone matrix and its
decreased material properties were linked to improper maturation of collagen cross-links (88)
(decreased fraction of non-reducible to reducible collagen cross-links) in the cortical bone
matrix. We also suggest that matrix anomalies, in particular changes in BSP, may contribute to
the alteration in the osteogenic BM niche recently reported in Col1a1Cre;Cx43fl/fl mice (82).
Taken together, the data indicate a need for additional analysis of the matrix in various Cx43
mutant mouse lines and the role of matrix anomalies, i.e., niche anomalies, in both altered
osteoclast and altered osteoblast activities.
Gja1Jrt/+ mice are protected from old age-related diminution in BMD and exhibit age-related
improvement in femoral bone structural and material parameters
While many phenotypic traits are seen in the Gja1Jrt/+ mouse model that parallel those reported
in various other Cx43 mutant mouse models, some traits are unique, including certain phenotypic
changes with aging and the underlying mechanisms. For example, lower BMD versus WT
controls has been reported in almost all Cx43 mutant models with loss of gap junction function,
and low BMD, where observed, persists up to at least 12 months of age (78,80,85,91), as it does in
Gja1Jrt/+ mice. Similarly to what has been described for DM1Cre;Cx43–/fl and
DM1Cre;Gja1+/fl(G138R) mice (78), the greatest difference in Gja1Jrt/+ versus WT BMD was seen at
younger ages. Notably, however, no significant difference in trabecular parameters (BV/TV,
Tb.N and Tb.Th) was seen in 12 month-old Gja1Jrt/+ versus WT femurs, and Gja1Jrt/+ femoral
55
cortical thickness surpassed that of age-matched WT bones by 8 months of age. Corresponding
age-related changes in the structural and material properties of Gja1Jrt/+ long bones were also
seen. Thus, similar to observations made in DM1Cre, Col1a1Cre, OcnCre and Dmp1Cre Cx43-
conditionally deleted mice (78,79,81,83,85,87,88), Gja1Jrt/+ femurs exhibited reduced structural and
material properties versus WT at younger ages. Gja1Jrt/+ bone material quality improved in older
mice, although the structural properties remained lower versus WT, most likely because the
Gja1Jrt/+ femoral total tissue cross-sectional area remained smaller than WT throughout life.
This is in contrast to what is seen in OcnCre;Cx43fl/- and DMP1Cre;Cx43fl/fl mice, where
structural parameters were unaffected even though material properties were reduced, presumably
because the benefit of the increased femoral cross-section off-set the lower bone quality in these
mutants (88).
To our knowledge, Gja1Jrt/+ is the only mouse model in which loss of gap junction
function leads to increased cortical thickness with age, and age-related elimination or abrogation
of the reduced cortical thickness, increased marrow space and reduced material properties
compared to that observed in younger Gja1Jrt/+ mice versus WT. In most Cx43 conditional-
deletion models, changes in the cortical parameters and bone geometry reflect increased
endocortical resorption and increased or unaffected periosteal bone formation (78,79,81,83,85,87,88). In
contrast, in Gja1Jrt/+ mice, cortices in younger (2 month-old) are thinner due to decreased bone
formation and increased bone resorption on the endosteal surface, with no detectable change in
periosteal parameters. The correction of the cortical bone and marrow area proportions and
thickening of the cortical bone in older Gja1Jrt/+ mice results from a significant decrease in
endosteal bone resorption hand-in-hand with maintenance of endosteal bone formation and
mineralization parameters higher than those seen in WT at the same ages. Our data suggest an
age-related switch in the Rankl-Opg signaling mechanism, with increased mbRANKL and
increased resorption in younger Gja1Jrt/+ mice, followed by increased serum OPG in older mice
reducing bone resorption, allowing cortical and trabecular bone thickness to increase over time.
As already mentioned, the changes in Gja1Jrt/+ mice do not appear to reflect changes in
osteocyte-specific changes in either Rankl-Opg signaling or Sost expression.
In addition to age-related effects on osteoclasts and resorption, expression of osteoblast-
associated genes is higher in Gja1Jrt/+ versus WT mice at all ages tested and up to at least one
year; amongst upregulated genes was ALP which would be expected to contribute to increased
56
total mineral deposition, and increases in BMD with age. An expanded osteoprogenitor
population, as seen in Gja1Jrt/+ versus WT stromal cell cultures, presumably contributes to
maintenance if not expansion of the bone itself in older Gja1Jrt/+ mice; an increased capacity to
generate active osteoblasts could contribute to the lack of further decreases in BMD, Tb.N and
BV/TV and increased cortical thickness seen in aging Gja1Jrt/+ mice. The age-related changes in
the Gja1Jrt/+ bone phenotype may arise as a consequence of age-related changes in Cx43 gap
junction formation and/ or function, altered responsiveness to mechanical load or hormonal and
molecular signals, skeletal site-specific differences in sensitivity to disruption of Cx43, and/or
other factors. Recently, for example, Cx43 deficiency has been shown to result in an increased
responsiveness to mechanical load (79,85), with several studies demonstrating that cells from
different skeletal locations are differentially sensitive to loss of Cx43, particularly within the
endocortical and periosteal surfaces of the cortical bone (78,85,87). Specifically, in response to
mechanical loading, DM1Cre;Cx43fl/fl mice displayed an increased periosteal, but decreased
endocortical (BFR) response (79), Col1a1Cre;Cx43-/fl mice a decreased endocortical (BFR)
response (81), and OcnCre;Cx43-/fl mice both enhance periosteal and endocortical (BFR) response
versus WT (79,85). After loading, DM1Cre;Cx43fl/fl also experienced a significant increase in
trabecular BV/TV, an effect not seen in WT mice (79). Interestingly, Llyod et. al. very recently
showed that after unloading via hind limb suspension, OcnCre;Cx43-/fl mice experienced an
attenuated response (less of a decline in trabecular bone parameters and no suppression of
periosteal and endosteal bone formation) versus WT. Other recent studies in rat stromal and
osteoblastic cells have indicated that Cx43 gap junction formation (123) and the capacity for gap
junction intercellular communication in response to a hormonal signal (PTH) (124) is significantly
decreased as a function of age. Whether and how the G60S mutation in Cx43 alters responses to
hormonal or mechanical stimuli remains to be determined, but the differences observed in the
Gja1Jrt/+ versus other loss-of-function bone phenotypes support the view that the mechanisms
are multifactorial and, reflect a complex summation of positive and negative effects across the
diversity of bone cell populations and maturational stages affected (77-83,85-87,91).
In summary, we report that the G60S mutation results in a cell autonomous activation of
the osteoblast population and further link the resulting production of abnormally high matrix
levels of BSP protein to increased osteoclastogenesis and bone resorption (summary Figure
57
2.10). Our results also show that the G60S mutation, unlike Cx43 knockout mutations, exerts a
significant age-related enhancement of trabecular and cortical bone volume and quality.
58
Figure 2.10 The cellular and molecular age-related changes that occur in the bone
microenvironment.
Both the cellular (osteoblast bone formation and osteoclast bone resorption) and molecular (RANK/RANKL/OPG signaling, ALP/BSP matrix molecules) age-related changes that occur in the bone microenvironment of WT (upper panel) and Gja1Jrt/+ (lower panel) mice are depicted. In young WT mice, osteoblast activity is greater than or equal to osteoclast activity, allowing for bone formation/growth and healthy bone turnover/remodelling. Osteoblasts express ALP and secrete bone matrix proteins, such as BSP, that are incorporated into the extracellular matrix, and chemokines such as RANKL (both membrane bound (mbRANKL) and secreted forms) and OPG. RANKL binds to RANK receptor, on the surface of osteoclasts promoting their differentiation and activity(147,148), while OPG, the decoy receptor, prevents these(149-152). As osteoclasts resorb bone, matrix molecules are released into the surrounding microenvironment, including BSP which works synergistically with RANKL to promote osteoclastogenesis and bone resorption(145). As WT mice age, osteoclast resorptive activity surpasses that of osteoblast bone formation, which results in age-related bone loss. In young Gja1Jrt/+ mice, both osteoblast and osteoclast activity is upregulated, however bone resorption exceeds bone formation to result in early-onset high turnover osteopenia. Mutant osteoblasts overexpress mbRANKL and produce an abnormal matrix that is high in BSP content leading to excessive bone resorption. In old Gja1Jrt/+ mice, an upregulation of serum OPG reduces the effects of RANKL on the osteoclast population and increased serum ALP levels indicate an increase in bone formation, both of which provide protection against further old age-related bone loss in Gja1Jrt/+ mice.
59
Chapter 3 Upregulation of BMP2/4 signaling increases both osteoblast-specific marker expression and bone marrow adipogenesis in
Gja1Jrt/+ stromal cell cultures
The work presented in Chapter 3 is published as:
Upregulation of BMP2/4 signaling increases both osteoblast-specific marker expression and
bone marrow adipogenesis in Gja1Jrt/+ stromal cell cultures
Tanya Zappitelli1, Frieda Chen2 and Jane E. Aubin1,2,3
1Department of Medical Biophysics and 2Department of Molecular Genetics, University of
Toronto, 1 King's College Circle, Toronto, Ontario M5S 1A8, Canada, 3Centre For Modeling
Human Disease, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, 600 University
Avenue, Toronto, Ontario M5G 1X5, Canada.
Mol Biol Cell. 2015 Mar 1;26(5):832-42
Author Contributions: Study design and conduct: TZ, FC and JEA. Data collection: TZ and FC.
Data analysis: TZ and FC. Data interpretation: TZ, FC and JEA. Drafting the manuscript: TZ and
JEA. Revising manuscript content and approving final version of manuscript: TZ, FC and JEA.
TZ, FC and JEA take responsibility for the integrity of the data analysis.
60
3
3.1 Abstract
Gja1Jrt/+ mice carry a mutation in one allele of the gap junction protein, alpha 1 gene (Gja1),
resulting in a G60S Connexin 43 (Cx43) mutant protein that is dominant negative for Cx43
protein production of less than 50% of wild type (WT) levels and significantly reduced gap
junction formation and function in osteoblasts and other Cx43-expressing cells. Earlier we
reported that Gja1Jrt/+ mice exhibited early-onset osteopenia caused by activation of osteoclasts
secondary to activation of osteoblast lineage cells, which expressed increased RANKL and
produced an abnormal resorption-stimulating bone matrix, high in BSP content. Gja1Jrt/+ mice
also displayed early and progressive bone marrow atrophy, with a significant increase in bone
marrow adiposity versus WT littermates but no increase in adipose tissues elsewhere in the body.
BMP2/4 production and signaling were increased in Gja1Jrt/+ trabecular bone and osteogenic
stromal cell cultures, which contributed to the upregulated expression of osteoblast-specific
markers (e.g. Bsp and Ocn) in Gja1Jrt/+ osteoblasts and increased Pparg2 expression in bone
marrow-derived adipoprogenitors in vitro. The elevated levels of BMP2/4 signaling in G60S
Cx43-containing cells resulted at least in part from elevated levels of cAMP. We conclude that
upregulation of BMP2/4 signaling in trabecular bone and/or stromal cells increases osteoblast-
specific marker expression in hyperactive Gja1Jrt/+ osteoblasts, and may also increase bone
marrow adipogenesis by upregulation of Pparg2 in the Cx43-deficient Gja1Jrt/+ mouse model.
3.2 Introduction
Gap junctions and hemichannels mediate cellular communication by allowing the passage of
small molecules and ions (e.g. ATP, Ca2+, IP3, cAMP) directly between cells and between cells
and their extracellular environment, respectively (153,154). Cx43, one member of the large
connexin protein family, is the major gap junctional protein found in bone, and is expressed by
osteoblasts, osteocytes (66,106) and bone marrow stromal cells (including osteoblast and adipocyte
precursors) (72). Other members of the connexin protein family expressed in bone are Cx45 (73),
Cx46 (74,155) and Cx37 (75,76), although their expression is much lower than that of Cx43. In bone,
61
Cx43 is important in mediating hormonal and molecular signals (80,85,86), fracture repair (84),
mechanical loading (79,81,85), and controlling the subpopulation makeup of the stroma (82).
Cx43 gap junction function is critical to the processes of osteoblast and osteocyte
differentiation and activity, bone formation and maintenance, and has been studied extensively
through the generation of Cx43 knockout (77), conditionally-deleted (78,80,82,85,88), and point-
mutation mutant mice (89,91,156), and by overexpression of mutant Cx43 proteins in cell lines (95).
The role of Cx43 in adipocytes and adipogenesis is less well studied. However, it has been
reported that functional Cx43 gap junctions are present and required for mitotic expansion and
C/EBPbeta expression in pre-adipocytes (157), and that levels of Cx43 protein and gap junction
formation and function are downregulated during adipocyte differentiation (158-160).
In addition to the important role of Cx43 channels in transport of signaling molecules,
Cx43 has been shown to interact with intracellular structural and signaling molecules to
modulate cellular signaling activities. For instance, Cx43 proteins have been proposed and/or
shown to interact with Src kinase to activate ERKs in response to bisphosphonate-mediated cell
survival signaling (110), with β-arrestin in response to PTH survival signaling (111), and with
protein kinase C-delta during FGF2 signaling (112). Cx43 has also been proposed to physically
interact with β-catenin (116), although its involvement in Wnt and BMP signaling pathways
remains unknown.
Loss or disruption of Cx43 gap junctions and hemichannels in cells early in the
osteogenic lineage has been reported to impair osteoblast differentiation, bone formation and
mineralization activities in various mouse models (77,78,80,95). However, in Gja1Jrt/+ mice, in
which a dominant negative G60S Cx43 mutation results in a significant (over 50%) reduction of
Cx43 protein production, phosphorylation and gap junction formation and function in osteoblasts
(95) and other cell types (89), we recently showed that osteoblast differentiation and function are
not decreased, but are instead activated (156). In particular, we found that Gja1Jrt/+ osteoblasts
overexpress many osteoblast-associated genes, including Bsp, and deposit an abnormal
resorption-stimulating bone matrix high in BSP content. In addition to its novel osteoblast
phenotype, Gja1Jrt/+ is the only Cx43 mutant mouse model with a reported change in bone
marrow adipogenesis, leading to progressive bone marrow atrophy beginning at 17 weeks of age
(89).
62
We now report that the G60S Cx43 mutation increases the expression level of osteoblast-
specific markers in the osteoblasts by upregulation of BMP2/4 production and signaling, and that
the increased BMP production by activated osteoblasts and/or stromal cells may also upregulate
Pparg2 expression leading to increased bone marrow adipogenesis.
3.3 Materials and Methods
Animals and Ethics Statement
Gja1Jrt/+ mice were generated as previously described (156). The studies reported here were done
on male Gja1Jrt/+ and WT littermates between 2 and 4 months of age. All experimental
procedures were performed in accordance with protocols approved by the Canadian Council on
Animal Care and the University of Toronto Faculty of Medicine and Pharmacy Animal Care
Committee.
Body Composition
Dual energy x-ray absorptiometry (PIXImus, Lunar Corp., Madison, WI, USA) was used to
measure body composition (% fat, lean tissue mass) on the whole body (excluding the head).
Immunocytochemistry
Mouse embryonic fibroblasts cultured on glass coverslips were permeabilized in 1%Triton X-
100 in phosphate buffered saline (PBS), washed in PBS, blocked in 2% fetal bovine serum
(FBS)-PBS, incubated with rabbit anti-Cx43 (Invitrogen Corporation, Carlsbad, CA, USA)
diluted 1:200 in PBS at room temperature for 2 hours, washed in PBS, incubated in Alexa
Fluor® goat anti-rabbit IgG (Molecular Probes, Inc., Eugene, OR, USA), washed in PBS and
then stained with 1mg/mL Hoechst 33258 diluted 1:1000 in PBS for 5 minutes at room
temperature. Coverslips were mounted and stored at 4oC overnight. Cells were imaged on a Leitz
Dialux 20 microscope with fluorescence and camera attachments (Leitz, Inc., Rockleigh, NJ,
USA).
Histochemistry
The right femur fixed in 4% paraformaldehyde (PFA) was embedded in a mixture of methyl
methacrylate (MMA) and glycolmethacrylate (GMA) and 5 µm sections were stained with
63
hematoxylin and eosin stain (134). Images were captured and analysed using a Bioquant
Osteoimager and Bioquant Osteo 2012 (BIOQUANT Image Analysis Corporation, Nashville,
TN, USA).
Isolation of Bone Marrow Cells
Bone marrow cells were isolated from resected tibia and femora, using a modification of a
previously published method (137). Cells were plated in α-MEM supplemented with 10% heat-
inactivated FBS and antibiotics (100µg/mL penicillin, 1µg/mL streptomycin, 50µg/mL
gentamicin, 250ng/mL fungizone) (standard medium) at 1x106 nucleated cells/35-mm dish.
Osteogenic Assay: After three days, the medium was changed to differentiation medium
(standard medium supplemented with 50 µg/mL ascorbic acid and 10 mM β-glycerophosphate).
Adipogenic Assay: After three days, the medium was changed to differentiation medium
(standard medium with 50 µg/mL ascorbic acid and 10-5M thiazolidinedione (BRL 49653)).
Conditioned medium: Conditioned medium was collected from osteogenic stromal cell cultures
at confluence after 24-48 hours of conditioning. The conditioned medium was then used at 50:50
with fresh adipogenic medium.
Inhibitor Studies in Stromal Cells
IWP-2: Stromal cells were cultured in standard medium with 50µg/mL ascorbic acid until day 6
(matrix-forming time point). Cells were then treated for 24 hours with 0.1 or 1µM IWP-2 (Cat.
I0536; Sigma-Aldrich, St. Louis, MO, USA) in dimethyl sulfoxide (DMSO) or vehicle (DMSO)
alone. RNA was isolated as described below.
Noggin: Osteogenic cells- Stromal cells were cultured in standard osteogenic differentiation
medium with vehicle (20µg/mL acetic acid in 0.1% BSA PBS), or 25, 50, 100, 200, 500 ng/mL
Noggin (Cat. ab50156; Abcam Inc., Cambridge, MA, USA). Cells were cultured until vehicle-
treated wells contained mineralized nodules and RNA was then isolated as below.
Adipogenic cells- Stromal cells were cultured in standard adipogenic differentiation medium for
24 hours, then treated with vehicle (20µg/mL acetic acid in 0.1% BSA PBS), or 25, 50, 200
ng/mL Noggin for 48 hours. RNA was isolated as below.
64
IBMX (3-isobutyl-1-methylxanthine): Stromal cells were cultured in standard medium with 50
µg/mL ascorbic acid to confluence, serum starved (α-MEM with 0.5% heat-inactivated FBS and
antibiotics) overnight, and treated with 1mM IBMX (Cat. I5879; Sigma-Aldrich, St. Louis, MO,
USA) for 40 minutes, 2 hours or 4 hours. RNA and protein were isolated as described below.
cAMP-dependent protein kinase inhibitor (14-22), myristoylated (mPKI):
Osteogenic cells- Stromal cells were cultured in standard medium with 50 µg/mL ascorbic acid
until confluence. Cells were then treated with vehicle (water) or 5, 10, 20 µM mPKI (Cat.
PHZ1202; Life Technologies, Carlsbad, CA, USA) for 24 hours and RNA was collected.
Adipogenic cells- Stromal cells were cultured in standard adipogenic differentiation medium for
48 hours, and then treated with vehicle (water) or 5, 10, 20 µM mPKI for 24 hours and RNA was
collected.
Quantitative RT-PCR
Total RNA was isolated from bone, bone marrow and cell cultures using TriReagent (Sigma-
Aldrich, St. Louis, MO, USA) and reverse transcribed using Superscript II (Invitrogen, Carlsbad,
CA, USA) and random hexamers. cDNA was combined with 0.5 µM each of the forward and
reverse primers (Table 3.1) and iQ™ SYBR® Green Supermix and run in the MyIQ Real-Time
PCR system (BioRad Laboratories, Inc., Hercules, CA, USA). Raw data were analyzed with
PCR Miner (136) and normalized using the internal control transcript for ribosomal protein L32.
SA Biosciences Mouse Signal Transduction PathwayFinder PCR Array
RNA was isolated from trabecular bone samples. Sample preparation and RNA isolation were
performed using TriReagent (Sigma-Aldrich, St. Louis, MO, USA) and SA Biosciences qPCR-
Grade RNA isolation kit (Qiagen, Venlo, NL) following manufacturer’s instructions. The Mouse
Signal Transduction Pathway Finder™ RT² Profiler™ PCR Array (Qiagen, Venlo, NL) was
performed following the manufacturer’s instructions.
Protein isolation from bone and stromal culture and Western blotting
Long bones, cleaned of surrounding tissue, epiphysis and bone marrow, were cut slightly below
the growth plate to separate trabecular bone and washed in PBS. Stromal culture plates were
65
Gene Direction Sequence
Adipsin Forward
Reverse
TTGCAGGGGAGACTCCGGCAG
CTCGGGTATAGACGCCCGGCT
aP2 Forward
Reverse
TAACCCTAGATGGCGGGGCCC
AACACATTCCACCACCAGCTTGT
Axin2 Forward
Reverse
GCATCGCAGTGTGAAGGCCAA
AGCAGGTTCCACAGGCGTCA
Bsp* Forward
Reverse
CAGGGAGGCAGTGACTCTTC
AGTGTGGAAAGTGTGGCGTT
Bmp2 Forward
Reverse
GAGGCGAAGAAAAGCAACAG
GGGGAAGCAGCAACACTAGA
Bmp4 Forward
Reverse
TTCCTGGTAACCGAATGCTGA
CCTGAATCTCGGCGACTTTTT
L32 #
Forward
Reverse
CACAATGTCAAGGAGCTGGAAGT
TCTACAATGGCTTTTCGGTTCT
LPL Forward
Reverse
GACTTGCCCTACGGCGCTCC
AATCTCTTCCCGCGTCTGCTGC
Nkd1 Forward
Reverse
GGAGGACAGCCGGCAAGAGTG
ACCCGCAGTGTCTTGCTTGATG
Pparg2 Forward
Reverse
TCGCTGATGCACTGCCTATG
GAGAGGTCCACAGAGCTGATT
Tcf7 Forward
Reverse
AGCCAGAAGCAAGGAGTTCACAGG
GCAGGAAGGGGACAGGGGGTAG
Table 3.1 Quantitative RT-PCR primer sequences used in this study.
All primer sequences were from NCBI primer design, except those marked “*” which were obtained from PrimerBank, and those marked “#” which were designed using Primer Express software, version 2.0 (Perkin-Elmer, Foster City, CA).
66
washed with PBS. Proteins were extracted in cell lysis buffer as previously described (140).
Protein extracts (30 µg) underwent immunoblotting with antibodies of interest (Table 3.2);
ACTIN was used as a loading control. Western blots were developed using chemiluminescence,
imaged with BioRad ChemiDocTM-XRS+ and analysed using Image Lab software (BioRad
Laboratories, Inc., Hercules, CA, USA).
Statistical analysis
Results are presented as mean ± standard deviation (SD). Experiments were repeated at least
three times with independent biological samples. Statistical analysis was performed using
Graphpad Prism 4.0 software. One-way analysis of variance (ANOVA) was used to determine
longitudinal significance in dosage experiments. Unpaired t-Test was used for direct
comparisons between mutant and WT parameters; paired t-Test was used for comparisons within
genotypes (e.g. changes over treatment time); n values presented are independent biological
samples.
3.4 Results
The G60S Cx43 mutation concomitantly activates the osteoblast lineage and increases bone
marrow adipogenesis in early-onset osteopenic Gja1Jrt/+ mice.
As we previously reported, Gja1Jrt/+ mice, which carry a G60S Cx43 mutation resulting in
reduced gap junction formation (Figure 3.1A) and function, exhibited early-onset osteopenia and
changes in the structure and biomechanical properties of bone (156). The osteopenic phenotype
results from activation of osteoclasts secondary to activation of the osteoblast lineage both in
trabecular bone in vivo and in bone marrow stromal cultures. We confirmed here that activation
of Gja1Jrt/+ osteoblastic cells resulted in increased bone nodule formation, increased osteoblast
marker expression - with Bsp being the most highly and significantly upregulated - and
production of an abnormal bone matrix high in BSP content (Figure 3.1B, C), which we
previously showed stimulates resorption (156).
67
Antigen Host Company Catalogue ID
ACTIN Rabbit Sigma-Aldrich A2066
β-CATENIN (active) Mouse Millipore 05-665
β-CATENIN (total) Rabbit Abcam ab6302
CREB Rabbit Cell Signaling Technology 4820
Connexin 43 Rabbit Invitrogen 71-0700
pCREB Rabbit Cell Signaling Technology 4276
SMAD 1 Rabbit Invitrogen 38-5400
pSMAD 1/5/8 Rabbit Cell Signaling Technology 9511
Anti-mouse IgG-HRP Goat Thermo Scientific LE146795
Anti-rabbit IgG-HRP Goat Santa Cruz Biotech., Inc. sc-2004
Table 3.2 List of antibodies used in this study.
68
Figure 3.1 The Gja1Jrt mutation activates the osteoblast lineage and alters bone matrix
composition.
(A) The formation of gap junctional plaques on the surface of Gja1Jrt/+ mouse embryonic fibroblasts was significantly decreased versus WT cells, whereas intracellular localization of CX43 protein was significantly increased in Gja1Jrt/+ versus WT cells. (B) Levels of Bsp mRNA and BSP protein were significantly increased in the trabecular bone matrix of Gja1Jrt/+ versus WT mice. (C) ALP and VonKossa stained end-point osteogenic stromal cultures revealed that numbers of CFU-F, CFU-ALP, and CFU-O were higher in Gja1Jrt/+ versus WT cultures. Expression of osteoblast-associated markers, Bsp and Ocn, at end-point of culture was significantly increased in stromal cultures isolated from Gja1Jrt/+ versus WT mice; n ≥ 3. *p<0.05 and **p<0.01.
69
As early as 7 weeks of age, Gja1Jrt/+ mice exhibited increased bone marrow atrophy
versus WT mice (Figure 3.2A, see also (89)). Histomorphometry confirmed that whereas
adipocyte size (adipocyte volume, Ad.V/adipocyte number, Ad.No) and percent marrow fat
(adipocyte volume, Ad.V)/ marrow volume, Ma.V) were not significantly different between
genotypes, adipocyte density (adipocyte number, Ad.No/tissue volume, mm2) was significantly
increased at 2 and 4 months of age in Gja1Jrt/+ versus WT bone marrow (Figure 3.2B).
Expression of all adipocyte markers tested, including Pparg2, the master adipogenic
transcription factor, and downstream adipogenic markers aP2, LPL and Adipsin, were
significantly increased in Gja1Jrt/+ versus WT bone marrow (Figure 3.2C).
The increase in adipogenesis in Gja1Jrt/+ mice was restricted to the bone marrow, as
evidenced by the fact that neither body mass composition (Figure 3.3A) nor expression of
adipocyte markers in the epididymal fat pads (Figure 3.3B) were significantly different between
Gja1Jrt/+ and WT mice at any age tested. Notably, Gja1Jrt/+ stromal cells cultured under
adipogenic conditions displayed significantly increased expression of adipocyte markers at day 1
compared to WT cells, but not thereafter (Figure 3.4); consistent with this, no difference was
seen in oil red-O staining at end point between genotypes (Figure 3.5).
The BMP2/4 and Wnt/β-catenin signaling pathways are upregulated in Gja1Jrt/+ trabecular
bone and osteogenic stromal cell cultures but only BMP2/4 is responsible for the increase in
osteoblast-specific gene expression.
We next sought to identify which signaling pathway(s) downstream of Cx43 were altered by the
G60S Cx43 mutation and might account for the increased expression of markers in the Gja1Jrt/+
osteoblasts. Using a Pathway Finder QPCR array and RNA isolated from Gja1Jrt/+ and WT
trabecular bone samples, we identified and selected two candidate pathways, the BMP2/BMP4
pathway and the Wnt/β-catenin pathway (based on expression differences of 1.5-fold or greater
between genotypes; Table 3.3) for further analysis. Given the reported ability of β-CATENIN to
interact physically with CX43 (116), we first examined the Wnt/β-catenin signaling pathway.
70
Figure 3.2 Adipocyte number and activity are increased in Gja1Jrt/+ versus WT bone
marrow.
(A) H&E stained tibia bones revealed an increased bone marrow atrophy in Gja1Jrt/+ mice at 2 and 4 months of age versus WT littermates. (B) Histomorphometric analysis of the long bones showed a significant increase in adipocyte density at 2 and 4 months of age. Percentage marrow fat and adipocyte size were unaffected between genotypes; n ≥ 4. (C) Expression of adipocyte-associated markers was significantly increased in Gja1Jrt/+ versus WT whole bone marrow of 4 month old mice; n ≥ 4. Solid and dashed lines indicate significance over time in WT and Gja1Jrt/+ mice, respectively. #p<0.1, *p<0.05 and **p<0.01.
71
Figure 3.3 The Gja1Jrt mutation does not cause a systemic increase in adipogenesis or
adipocyte activity.
(A) Representative DEXA images of WT and Gja1Jrt/+ mice at 2 and 8 months of age. Measurements showed that Gja1Jrt/+ mice had significantly lower body weight than WT littermates at all ages. No differences in percentage fat or percentage lean mass were noted at any age; n = 9. (B) Representative images of WT and Gja1Jrt/+ epididymal fat pads. Expression of adipocyte-associated markers were unchanged in RNA isolated from epididymal fat pads of WT versus Gja1Jrt/+ mice; n ≥ 3. *p<0.05, **p<0.01 and ***p<0.001.
72
Figure 3.4 The Gja1Jrt mutation does not affect adipocyte lineage development in vitro.
RNA was isolated at four time points throughout proliferation-differentiation in adipogenic stromal cultures derived from 4 month old mice. Expression of adipocyte- associated markers, Bmp2, Bmp4, and Tcf7 were unchanged between genotypes, except at day 1, when expression of these markers was increased in Gja1Jrt/+ versus WT adipogenic stromal cultures; n ≥ 3. #p<0.1, *p<0.05 and **p<0.01.
73
Figure 3.5 Effect of the Gja1Jrt mutation on formation of bone marrow- derived adipocytes
in vitro.
(A) Representative images of end-point adipogenic stromal cultures stained with Oil Red-O. The stromal cells were cultured under adipogenic conditions for approximately 6 days or until adipocytes could be identified by the presence of visible lipid droplets. (B) The amount of Oil Red-O staining was unaffected between genotypes; n = 3.
74
Gene Symbol Gene Name Fold change versus WT
Bmp2 bone morphogenetic protein 2 2.33
Bmp4 bone morphogenetic protein 4 3.00
Ccl2 chemokine (C-C motif) ligand 2 -1.56
Cdkn2a cyclin-dependent kinase inhibitor 2A -1.58
Cxcl1 chemokine (C-X-C motif) ligand 1 -2.53
Egr1 early growth response 1 1.79
Fn1 fibronectin 1 -2.02
Hhip Hedgehog-interacting protein 2.79
Il1a interleukin 1 alpha 1.65
Il4ra interleukin 4 receptor, alpha -1.75
Mmp10 matrix metallopeptidase 10 -1.91
Pparg peroxisome proliferator activated receptor gamma 2.53
Selp selectin, platelet -3.82
Tcf7 transcription factor 7, T cell specific 3.21
Tfrc transferrin receptor 1.69
Pmepa1 prostate transmembrane protein, androgen induced 1 -1.56
Vcam1 vascular cell adhesion molecule 1 1.54
Vegfa vascular endothelial growth factor A 1.52
Wisp1 WNT1 inducible signaling pathway protein 1 1.89
Table 3.3 Results of the Mouse Signal Transduction Pathway Finder™ RT²
Profiler™ PCR Array.
The table shows the gene symbol and the gene name. Expression of the genes are shown as fold change versus WT; genes of interest were identified as those whose expression was changed 1.5-fold or greater in Gja1Jrt/+ versus WT samples. RNA was isolated from trabecular bone of 2 month old WT and Gja1Jrt/+ mice; n = 2 and each sample was the combination of n ≥ 2 independent biological samples.
75
Whereas total β-CATENIN protein was significantly increased in Gja1Jrt/+ versus WT
stromal cells, the level of transcriptionally active β-CATENIN was not (Figure 3.6A). When
expression of Axin2 and naked cuticle 1 (Nkd1), two direct targets of β-catenin signaling, was
assessed via QPCR, we found that Axin2 was unaffected, but expression of Nkd1 was
significantly upregulated in Gja1Jrt/+ versus WT stromal cells (Figure 3.6B). The inconsistent
changes in Wnt/β-catenin target genes suggested that this pathway was not involved in the
increased marker expression by Gja1Jrt/+ osteoblasts. The latter was confirmed by treating WT
and Gja1Jrt/+ stromal cells with a Wnt signaling inhibitor, IWP-2. Treatment with 1µM IWP-2
significantly reduced Wnt/β-catenin signaling in both WT and Gja1Jrt/+ stromal cells as
evidenced by downregulation of expression of Axin2 (Figure 3.6C), however, IWP-2 treatment
had no significant effect on expression of Bsp in either WT or Gja1Jrt/+ stromal cells and Bsp
expression remained higher in Gja1Jrt/+ versus WT stromal cells, regardless of the IWP-2
concentration used (Figure 3.6D).
We therefore next examined the BMP2/4 signaling pathway and confirmed that
expression of Bmp2, Bmp4 and Tcf7 was significantly increased in RNA isolated from both
Gja1Jrt/+ trabecular bone (Figure 3.7A) and osteogenic stromal cell cultures (Figure 3.7B) versus
WT specimens. Bmp2/4 signaling, determined by immunoblotting for phosphorylated
SMAD1/5/8 (pSMAD1/5/8) proteins, was also significantly increased in Gja1Jrt/+ versus WT
stromal cell cultures. Levels of SMAD1 were unaffected between genotypes (Figure 3.7C).
To determine whether the upregulated marker expression in Gja1Jrt/+ osteoblasts resulted
directly from upregulated BMP2/4 signaling, we treated osteogenic stromal cell cultures with
Noggin, a BMP2/4 signaling inhibitor. The dose of Noggin required for either half (ID50) or
maximal knockdown of both Bsp and Ocn expression was higher in Gja1Jrt/+ versus WT cells
(e.g. ID50's 12.5-25ng/mL of Noggin in WT cells versus ID50 100-200 ng/mL of Noggin in
Gja1Jrt/+ cells) (Figure 3.8A). The significant reduction in pSMAD1/5/8 levels confirmed that
Noggin treatment knocked down BMP2/4 signaling in cells of both genotypes (Figure 3.9).
76
Figure 3.6 Changes in Wnt/ββββ-catenin signaling cannot account for the upregulation of Bsp
expression in hyperactive Gja1Jrt/+ osteoblasts.
(A) The level of total β -CATENIN protein was significantly increased in Gja1Jrt/+ versus WT confluent osteogenic
stromal cultures derived from 4 month old mice. Levels of active β -CATENIN (antibody recognizes the active form of
β -CATENIN, dephosphorylated on Ser37 and Thr41) were unchanged. Shown is one representative blot; n ≥ 4. (B)
Expression of direct β-catenin target genes, Axin2 and Nkd1, were unaffected and increased, respectively, in Gja1Jrt/+ versus WT cells; n ≥ 8. When confluent osteogenic stromal cells were treated with IWP-2, a Wnt signaling inhibitor, (C) the expression of Axin2 decreased significantly, but (D) the expression of Bsp remained significantly increased in Gja1Jrt/+ versus WT cells. Expression of Bsp was unchanged by IWP-2 treatment in cells of both genotypes; n ≥ 3. Solid and dashed lines indicate significant differences over dosage concentration in WT and Gja1Jrt/+ mice, respectively. *p < 0.05, **p < 0.01 and ***p < 0.001.
77
Figure 3.7 BMP2/4 signaling is increased in Gja1Jrt/+ in vivo and in vitro.
Expression of Bmp2, Bmp4, and Tcf7 were increased in Gja1Jrt/+ versus WT (A) trabecular bone at 4 months of age; n ≥ 8, and in (B) osteogenic stromal cultures at confluence; n ≥ 3. (C) Levels of pSMAD1/5/8 were significantly increased in Gja1Jrt/+ versus WT confluent osteogenic stromal cultures. Levels of SMAD1 were unchanged. One representative blot is shown; n ≥ 4. #p<0.1, *p<0.05 and **p<0.01.
78
Figure 3.8 Upregulated BMP2/4 signaling is responsible for the increased osteoblast
marker expression and the increased Pparg2 expression in bone marrow-derived
adipocytes and adipogenic precursors in Gja1Jrt/+ versus WT mice.
(A) The dose of Noggin required for either half (ID50) or maximal knockdown of both Bsp and Ocn expression was higher in Gja1Jrt/+ versus WT osteogenic stromal cells. One representative experiment is shown, samples were run in triplicate; n = 3. (B) Both WT and Gja1Jrt/+ adipogenic stromal cells grown in the presence of Gja1Jrt/+ conditioned medium expressed higher levels of Pparg2 versus those grown with the addition of WT conditioned medium; n ≥ 3. Solid and dashed lines indicate significant differences between cells cultured in either conditioned media situation in WT and Gja1Jrt/+ cells, respectively. (C) Expression of Pparg2 declined significantly when cells of either genotype (cultured under adipogenic conditions and with the addition of Gja1Jrt/+ conditioned medium) were treated with Noggin; n = 5. Stars indicate significance between genotypes at that dosage concentration *p<0.05, **p<0.01 and ***p<0.001. Capital letters indicate significance between WT samples, lower case letters indicate significance between Gja1Jrt/+ samples, letters are ascribed in alphabetical order to the dosages (e.g. significant difference versus dose 0 is denoted ‘A’ in WT or ‘a’ in Gja1Jrt/+). A p-value of less than 0.05 was considered statistically significant.
79
Figure 3.9 Levels of pSMAD1/5/8 were significantly reduced in both WT and Gja1Jrt/+
stromal cells treated with 200ng/mL of Noggin versus vehicle treated cells.
One representative blot is shown; n = 3. *p<0.05, **p<0.01 and ***p<0.001.
80
Upregulated BMP2/4 production by Gja1Jrt/+ osteogenic stromal cell cultures increases
adipocyte gene expression in adipogenic stromal cultures.
As summarized above, adipocyte density and volume were increased in the bone marrow but not
elsewhere in the body (e.g., fat pads, trunk) of Gja1Jrt/+ mice, suggesting that the increase was
dependent on factors in the marrow microenvironment. The fact that increased expression of
adipocyte-associated genes was seen only at early times, i.e., day 1, but not thereafter, in
Gja1Jrt/+ versus WT stromal cell cultures, also supported the possibility that cells other than
adipocytes or their endogenous factors in the marrow microenvironment were responsible for the
increased adipogenesis. Previously, we showed that mature endosteal osteoblasts are dislodged
from bone surfaces when bone marrow is flushed from long bones and they remain viable for
only short periods of time in culture (161). We therefore hypothesized that it is the hyperactive
Gja1Jrt/+ osteoblasts that are responsible, potentially through their increased production of
BMP2/4, for increased marrow adipogenesis in Gja1Jrt/+ mice. The increased Bmp2/4
expression and signaling in Gja1Jrt/+ versus WT osteogenic stromal cell cultures at confluence
(Figure 3.7B, C) supports this possibility. To test this hypothesis further, we cultured stromal
cells under adipogenic conditions but further supplemented with addition of either WT or
Gja1Jrt/+ osteogenic stromal cell-conditioned medium. The expression of Pparg2 was
significantly increased when cells of either genotype were grown in the presence of Gja1Jrt/+
conditioned medium versus those supplemented with WT conditioned medium (Figure 3.8B). To
determine whether this increase was due to increased BMP2/4 in the Gja1Jrt/+ conditioned
medium, we next treated adipogenic stromal cells supplemented with Gja1Jrt/+ conditioned
medium with Noggin for 48 hours. In cultures supplemented with Gja1Jrt/+ conditioned medium,
treatment with 6.25ng/mL of Noggin significantly reduced the expression of Pparg2 in both WT
and Gja1Jrt/+ adipogenic cells (Figure 3.8C).
Increased levels of cAMP contribute to the upregulation of BMP2/4 signaling in Gja1Jrt/+ versus
WT osteogenic stromal cell cultures.
To establish the link between decreased G60S Cx43 channel function and the increased activity
of Gja1Jrt/+ osteoblasts including increased BMP2/4 production, we next compared the
intracellular concentrations of several molecules and ions known to be transported through Cx43
81
channels in WT and Gja1Jrt/+ stromal cells. Whereas intracellular levels of ATP and Ca2+ were
not different between genotypes, cAMP levels were significantly increased in Gja1Jrt/+ versus
WT stromal cells cultured under osteogenic conditions (Figure 3.10A). To determine whether
cAMP signaling was upregulated, we quantified phosphorylation of cAMP-responsive element-
binding protein (CREB), a cAMP-responsive transcription factor; given the relatively rapid
decay of cAMP and low basal levels of pCREB/CREB, we performed the assay in the presence
of 3-isobutyl-1-methylxanthine (IBMX), a nonselective phosphodiesterase inhibitor, which
inhibits cAMP breakdown, thereby amplifying any differences in levels of cAMP and its targets
between genotypes. Levels of pCREB/CREB increased significantly in Gja1Jrt/+ cells after 2
hours of IBMX treatment, whereas no change in cAMP levels were detectable in WT cells;
notably, pCREB/CREB levels were also significantly increased in Gja1Jrt/+ versus WT stromal
cells at 2 hours of IBMX treatment (Figure 3.10B). To determine whether increased cAMP
signaling in Gja1Jrt/+ cells was the mechanism behind the increased BMP2/4 production, we
next treated WT and Gja1Jrt/+ stromal cells with an inhibitor of cAMP signaling and assessed
Bmp2 expression. Myristoylated cAMP-dependent protein kinase inhibitor (mPKI) knocks down
cAMP signaling by interfering with the activation of protein kinase A (PKA)(162,163). Treatment
with mPKI had no significant effect on Bmp2 expression in WT stromal cells, but knocked down
Bmp2 expression in Gja1Jrt /+ cells to WT levels (Fig. 3.10C).
82
Figure 3.10 Intracellular levels of cAMP and cAMP signaling are increased in Gja1Jrt/+
versus WT osteogenic stromal cells.
(A) Intracellular levels of cAMP were significantly increased in confluent Gja1Jrt/+ versus WT osteogenic stromal cells. Intracellular levels of ATP and Ca2+ were unchanged; n ≥ 6. Levels of the signaling molecules and ions were normalized to WT levels. (B) Basal levels of pCREB/CREB were unaffected in osteogenic stromal cells isolated from 4 month old mice. However, treatment of cells with 1mM IBMX for at least 2 hours resulted in increased levels of pCREB/CREB in Gja1Jrt/+ versus WT cells. Two representative blots are shown; n=3. (C) Bmp2 expression
decreased when Gja1Jrt/+ osteogenic stromal cells were treated with 20µM mPKI, a cAMP signaling inhibitor, for 15 minutes. Treatment of WT cells with mPKI had no effect on Bmp2 expression. One representative experiment is shown; n ≥ 4. Solid and dashed lines indicate significant differences over time in WT and Gja1Jrt/+ mice, respectively. *p<0.05 and **p<0.01.
83
3.5 Discussion
G60S Cx43-containing cells exhibit significantly reduced levels of total CX43 protein, gap
junction formation, and gap junction coupling between cells (89,95), which results in an early onset
osteopenic phenotype in Gja1Jrt/+ mice due to activation of osteoclast bone resorption by
production of an abnormal resorption stimulating bone matrix, high in BSP, as well as changes in
RANKL-OPG signaling, both of which arise from activation of osteoblast lineage cells (156). We
now report that the activation (i.e. upregulated Bsp and Ocn expression) of the osteoblast lineage
results from increased BMP2/4 production and signaling. Increased BMP2/4 also increases
Pparg2 expression to promote bone marrow adipogenesis in Gja1Jrt/+ versus WT mice. Our data
also suggest that the increased production of BMP2/4 is due to reduced gap junction intercellular
communication and consequent buildup of intracellular cAMP and its downstream signaling in
Gja1Jrt/+ osteogenic stromal cells.
Increased BMP2/4 signaling results in upregulated osteoblast-specific marker expression in
Gja1Jrt/+ osteoblasts.
Gja1Jrt/+ mice, like other Cx43 mutant mice exhibiting reduced gap junction formation and
function, are osteopenic, but the osteopenia results not from decreased osteogenesis and
osteoblast activity but from osteoblast hyperactivity which activates osteoclasts (156). We show
here that BMP2/4 production and signaling is significantly increased in Gja1Jrt/+ versus WT
trabecular bone and/or osteogenic stromal cells, both in vivo and in vitro. The knockdown of
expression of upregulated genes such as Bsp and Ocn in Gja1Jrt/+ stromal cell cultures to WT
levels by Noggin treatment confirmed that the upregulation of gene expression in Gja1Jrt/+
osteoblasts is at least partly, if not entirely, due to upregulated levels of BMP2/4. Whether the
increase in BMP2/4 production is directly responsible for all of the upregulated osteoblast
activities (i.e., not only increased osteoblast-specific gene expression, but also production of an
abnormal bone matrix due to increased BSP incorporation and changes in RANKL-OPG
production), which result in activation of osteoclasts and therefore the early-onset osteopenic
phenotype of Gja1Jrt/+ mice, remains to be determined, for example by knocking down BMP2/4
signaling in Gja1Jrt/+ mice. We also cannot exclude the possibility that other intrinsic defects or
84
disrupted signaling molecules or pathways may be responsible for or contribute to the activation
of the Gja1Jrt/+ osteoblasts.
To date, no other studies have attributed the osteopenic bone phenotypes of Cx43 mutants
to increased BMP2/4 signaling, albeit osteoblast hyperactivity has also not been reported in other
mouse models with decreased Cx43 gap junction formation and function. However, Gja1Jrt/+
mice also exhibit all the classical features of oculodentodigital dysplasia (ODDD), including
syndactyly (89). Alterations in BMP2 levels have been reported to underlie common phenotypic
features of ODDD, although in contrast to the activation we report in Gja1Jrt/+ cells, others have
shown that disruption of Cx43 gap junction function causes a reduction in BMP2 signaling. For
instance, Dobrowolski et al. showed that the syndactyly phenotype of the Cx43+/G138R and
Cx43-/- mice arises from decreased interdigital apoptosis due to decreased SHH and BMP2,
along with subsequent increase in FGF signaling due to increased FGF4 and FGF8 (117). Kim et
al. showed that disruption of Cx43 by antisense-oligonucleotides caused increased Shh and
decreased Bmp2 expression levels during fungiform papillae development (118). Clearly,
disruption of Cx43 gap junction coupling can lead to alterations of morphogens such as BMP2,
but differences may arise due to the specific and diverse effects that the various mutations have
on gap junction and hemichannel formation and function (119).
Altered Cx43 gap junction and hemichannel formation and functioning can vary
significantly depending on the location and type of Cx43 point mutation (96,97). For instance, the
H194P Cx43 mutation inhibits gap junction coupling, but has no effect on hemichannel activity,
whereas the G138R and G143S mutants reduce gap junction coupling but increase hemichannel
activity (97). The effect of the mutation on the differing channels is important, since hemichannels
and gap junctions exhibit distinct specificity with regards to molecules which they transport and
the functions that they perform (reviewed in (164)). The impact of the G60S Cx43 mutation on
hemichannel activity remains to be determined, but alterations in formation, transport, and/or
degradation of small second messenger molecules which are transported across Cx43 channels,
like cAMP (as discussed below), suggest that changes in signaling by hemichannels may play a
role in the upregulation of BMP production and the hyperactive phenotype of the Gja1Jrt/+
osteoblasts.
85
Whereas the increase in BMP2/4 signaling is directly responsible for the increased
expression of osteoblast-specific markers in hyperactive Gja1Jrt/+ osteoblasts, our data with the
Wnt/β-catenin inhibitor IWP-2, indicate that the upregulation of Wnt/β-catenin signaling is not.
However, the inconsistent and variable changes in the Wnt/β-catenin pathway that we report in
the Gja1Jrt/+ mice is consistent with recently published data by Bivi et al., 2013 who reported
increased expression of (total) β-catenin protein and some Wnt target genes (e.g. Axin2) when
Cx43 is disrupted in osteocytes (in bones of DMP1Cre;Cx43fl/fl mice and in MLO-Y4 osteocytic
cell line). At the same time, however, the expression of other Wnt/β-catenin target genes (e.g.
cyclin D1 and Smad6) and Wnt-mediated transcription (assessed via a TCF/Lef1-luciferase
reporter assay) were unaffected in Cx43-silenced MLO-Y4 cells (121). These results, along with
the data we present here, suggest that the accumulation of β-catenin protein in Cx43-deficient
cells may not lead to increased Wnt/β-catenin-mediated transcription; rather, elevated levels of
total β-catenin in Cx43 mutant mice may be involved in other cellular processes, such as
mediating the responsiveness of cells to mechanical stimulation (i.e. enhancing the
responsiveness of “primed” Cx43-deficient cells to mechanical stimulation) or to other
signals/factors, independently of classical Wnt/β-catenin transcription. As such, it will be
interesting to determine whether sensitivity to mechanical loading or unloading in the Gja1Jrt/+
mice is altered as a result of the increased β-catenin protein levels.
Increased bone marrow adipogenesis in Gja1Jrt/+ mice.
Whether the Gja1Jrt/+ mouse bone marrow adipocyte phenotype is a direct consequence of
altered Cx43 function in adipogenic cells and/or is indirect through other cell types is not yet
clear. Adipogenesis and expression of adipocyte markers are increased in Gja1Jrt/+ bone marrow
but not at other anatomic sites in Gja1Jrt/+ mice. Similarly, several adipocyte markers and BMP2
were increased at very early times in cultures of Gja1Jrt/+ versus WT stromal cells, but not later
and no increase in adipogenesis was detectable in these cultures. We therefore hypothesized that
the upregulated production of BMP2 and BMP4 in Gja1Jrt/+ trabecular bone and osteogenic
stromal cell cultures are responsible for the increased marrow adipogenesis in vivo and in stromal
cultures respectively. The fact that Noggin abrogated the increased expression of Pparg2 in
86
adipogenic stromal cells treated with Gja1Jrt/+ osteogenic stromal cell conditioned medium is
consistent with such a hypothesis. Similarly, no other Cx43 mutant mouse models have been
described to have an adipocyte phenotype or an increase in bone marrow adipogenesis, either
because the marrow has not been screened in other models or, more likely, reflecting the unique
activated osteoblast phenotype seen in the Gja1Jrt/+ model with its associated upregulated BMP
production. Thus, no increase in adipogenesis was described in either the global G138R mutant,
Cx43+/G138R, or the conditional deletion and conditional G138R mutant, DM1Cre;Cx43-/fl and
DM1Cre;Cx43+/fl(G138R) mice whose osteoblasts are dysfunctional but not hyperactive as in the
Gja1Jrt/+ mice (78,91).
It is also worth noting that early in adipogenesis in vitro, Cx43 is highly phosphorylated
and localized in the plasma membrane of 3T3-L1 cells (159) and H-1/A stromal cells (160), and
functional gap junctions are required in these early stages (157). However, as preadipocytes
differentiate into mature adipocytes, the level of Cx43 protein declines via proteasomal
degradation, an effect reported to be essential for the development of mature adipocytes (158). In
Gja1Jrt/+ mice, however, the reduction in Cx43 expression and gap junction function appears to
have no effect on adipogenesis in epididymal fat pads or elsewhere, except in the bone marrow,
where our data suggest that the adipogenic consequences of Cx43 deficiency are indirect and via
osteoblasts and possibly other BMP2/4 producing cells. The data suggest that only a low level of
gap junctional communication is necessary for the early differentiation stages of adipogenesis,
levels commensurate with the low residual gap junction communication seen in Gja1Jrt/+ cells,
or that other pathways, such as an enhanced BMP2/4 pathway, can compensate for low Cx43.
However, we cannot entirely rule out a direct action of the G60S Cx43 mutation on bone marrow
adipocyte precursors, which may behave phenotypically differently than adipocytes in other
tissues. Future experiments will be aimed at assessing the direct effects of the germline G60S
Cx43 mutation in bone marrow-derived adipocyte precursors, and testing more rigorously the
link between increased BMP2/4 production and increased bone marrow adipogenesis in Gja1Jrt/+
mice.
Increased intracellular cAMP in G60S Cx43 osteogenic stromal cells plays a role in increased
BMP2/4 production.
87
To uncover a link between the G60S Cx43 mutant channels and the upregulation of BMP2/4
production by Gja1Jrt/+ cells, we investigated intracellular levels of several signaling molecules
and ions known to be released via Cx43 channels. Although our results revealed only a small
increase in levels of intracellular cAMP, a second messenger signaling molecule known to pass
through Cx43 gap junctions (165), such small changes can have profound impacts on cell
activities. Consistent with this, treatment with the cAMP-dependent protein kinase inhibitor
mPKI reduced the elevated levels of Bmp2 expression in Gja1Jrt/+ cells to WT levels, suggesting
that increased cAMP signaling was at least partly responsible for the upregulation of Bmp2
expression. We cannot exclude the possibility that the transport of other small second messenger
molecules, which we did not test, were also affected by the G60S Cx43 mutation and involved in
the upregulation of BMP2/4 production and/or the expression of downstream osteoblast markers
in Gja1Jrt/+ cells. Further analysis of the G60S Cx43 mutation on hemichannel and gap junction
channel conductance, permeability, pore size, and specificity are underway.
Importantly, we and others have found no evidence of changes in/compensation by Cx45
(gene or protein expression levels; data not shown) in Cx43-mutant ODDD mouse models to
account for alteration in levels of BMP2/4 molecules (i.e. upregulated BMP2/4 levels in
Gja1Jrt/+ mice or downregulated BMP2 levels in Cx43+/G138R mice (91)). This likely reflects
the inability of connexin family members to adequately compensate for one another, since the
channels have different molecular and ionic permeabilities (73,166,167), serving different functions
as cells differentiate (77). Alternatively though, elevated levels of Cx45 protein have been
proposed to partially compensate for loss of Cx43 in Cx43-/- neonatal calvaria osteoblasts (77); it
is possible that compensatory mechanisms by other connexins can be influenced on the basis of
whether Cx43 is entirely deleted, as in the knockout, or simply mutated, as in the G60S or
G138R mutants.
In summary, we report the novel findings that upregulation of BMP2/4 signaling in
trabecular bone and/or stromal cells increases osteoblast-specific marker expression in
hyperactive Gja1Jrt/+ osteoblasts, and may also increase bone marrow adipogenesis by
upregulation of Pparg2 in the Cx43-deficient Gja1Jrt/+ mouse model. We also report that
increased cAMP signaling may promote the upregulated production of BMP2 and BMP4
signaling molecules by Gja1Jrt/+ cells.
88
Chapter 4 Discussion, Future Directions and Final Conclusions
Table 4.1 and some of the text presented in Chapter 4 are published in:
The “connexin” between bone cells and skeletal functions
Tanya Zappitelli1 and Jane E. Aubin1,2
1Department of Medical Biophysics and 2Department of Molecular Genetics, University of
Toronto, 1 King's College Circle, Toronto, Ontario M5S 1A8, Canada.
J Cell Biochem. 2014 Oct;115(10):1646-58
89
4
4.1 Summary and Discussion of Findings
The development and study of the Gja1Jrt/+ mouse model, with a dominant negative G60S Cx43
mutation, has provided new information on the role that Cx43 channels play in skeletal
development and turnover, as well as in bone cell differentiation and function. The work
presented in this thesis is summarized in Table 4.1 (as published in (168)), where comparisons
across different mutant models reveal the complex role of Cx43 in bone and how the Gja1Jrt
mutation is similar to, and unique from other published Cx43 knockout and missense models.
Below are the main conclusions derived from the research presented in this thesis:
1. G60S is unique in being an osteoblast autonomous activating mutation. Disruption of
Cx43 protein formation and function, and Cx43 gap junction intercellular communication
has been well established to negatively impact osteoblast differentiation and activity
(77,78,80,95,100). However, our findings show that the G60S mutation activates osteoblast
function in appendicular bones and in stromal populations as manifested by increased
expression of many osteoblast-associated genes, increased production of BSP, mbRANKL,
OPG and ALP proteins, and increased mesenchymal progenitor and osteoprogenitor
numbers in stromal cells isolated from Gja1Jrt/+ compared to WT mice. Furthermore, we
show that BMP2/4 production and signaling are also significantly increased in Gja1Jrt/+
osteoblasts/stromal cells, and that this is at least partly responsible for the upregulated gene
expression by Gja1Jrt/+ osteoblasts.
2. Early-onset osteopenia in Gja1Jrt/+ mice is caused by activation of osteoclasts which
occurs through increased mbRANKL and an increase in a matrix protein (BSP) that
promotes bone resorption. Previous studies on Cx43-deficient mice have reported that
changes in the RANKL/OPG ratio underlie the increased osteoclastogenesis and bone
resorption and contribute to the osteopenia and/or altered bone structure in Cx43 mutants
(78,85,87). Gja1Jrt/+ is the first Cx43 mutant mouse in which unusually high levels of matrix
BSP have been reported and linked to increased osteoclast activity (156).
90
3. Gja1Jrt/+ mice are protected from old age-related diminution in BMD and exhibit age-
related improvement in femoral bone structural and material parameters. While many
of the bone phenotypes seen in the Gja1Jrt/+ mouse model parallel those reported in other
Cx43 mutant mouse models, we have reported several unique traits including certain
phenotypic changes with aging. To our knowledge, Gja1Jrt/+ is the only mouse model in
which loss of gap junction function leads to increased cortical thickness with age, and age-
related elimination or abrogation of the reduced cortical thickness, increased marrow space
and reduced material properties compared to that observed in younger Gja1Jrt/+ mice
versus WT. The correction or improvement of these parameters in older Gja1Jrt/+ mice
results from a significant decrease in endosteal bone resorption (due to increased serum
OPG) hand-in-hand with maintenance of endosteal bone formation and mineralization
parameters higher than those seen in WT at the same ages (due to increased expression of
osteoblast-associated genes, upregulated serum ALP, and an expanded osteoprogenitor
population) (156).
4. The Gja1Jrt/+ mice exhibit increased bone marrow adipogenesis. No other Cx43 mutant
mouse models to date have been described to have an adipocyte phenotype or an increase
in bone marrow adipogenesis. This likely reflects the unique activated osteoblast phenotype
seen in the Gja1Jrt/+ model, where increased production of BMP2/4 by Gja1Jrt/+
osteoblasts and/or stromal cells increases the expression of Pparg2 in bone marrow-derived
adipogenic precursors and adipocytes, resulting in increased bone marrow adipocyte
density and expression of adipocyte-associated genes. Along with the reported increase in
osteoprogenitors and no change in osteoblast numbers, these results further suggest an
important and complex role for Cx43 in stromal and progenitor cell maintenance and
commitment.
5. Increased levels of cAMP contribute to the upregulation of BMP2/4 signaling in
Gja1Jrt/+ versus WT osteogenic stromal cells. The anabolic effects of the cAMP-PKA-
CREB pathway in bone have been described both in vivo and in vitro (169-172), and CREB
has been shown to bind to the Bmp2 promoter, stimulating Bmp2 expression in cultures of
primary osteoblast cells and osteoblastic cell lines (173). Our results reveal a small increase
in levels of intracellular cAMP, a second messenger signaling molecule known to pass
through Cx43 gap junctions (165), in Gja1Jrt/+ stromal cells, which may be at least partly
91
responsible for the upregulation of Bmp2 expression by Gja1Jrt/+ cells. While these data are
intriguing and provide further insight into the effects of the Gja1Jrt mutation, further studies
are required to determine the precise mechanism(s) by which the G60S Cx43 mutation
would cause an accumulation of cAMP, as discussed below.
92
Cx43-/- DM1Cre;Cx43-/fl;
DM1Cre;Cx43+/fl(G138R) ColCre;Cx43–/fl
OcnCre;Cx43–/fl
DMP1Cre;
Cx43fl/fl
Cx43G138R/+
Gja1Jrt/+
ODDD-like craniofacial
abnormalities yes (77) not reported no (80) not reported not reported yes (91) yes (89)
Body weight ↓ (80) ~ (86) or ↓ (83) ↓ (156)
Bo
ne
dev
elo
pm
ent
an
d s
kel
eta
l h
om
eost
asi
s
BMD ↓BMD (78)
↓BMD & BMC (80)
~ BMD (tibial
diaphysis) (81)
~ BMD (86-88)
↓BMD (83,85)
~ BMD (87,88) ↓BMD & BMC (89,156)
Geometrical
properties ↑TtAr, ↑MaAr (78,79)
↑TtAr, ↑MaAr (81)
↑TtAr, ↑MaAr
(83,85,87) ↑TtAr, ↑MaAr (87)
↓TtAr, ↓MaAr
young: ↑MaAr/TtAr
old: ~MaAr/TtAr (156)
Cortical Bone ↓CtTh (78), ↓CtBV (79)
↑ porosity (78,79) ↓CtTh (81)
~ (85,87) or ↓ (83) CtTh
~porosity (85)
↑porosity (83,87)
~CtTh
↑CtAr (87)
young: ↓CtTh &
↓CtAr/TtAr
old: ↑CtTh, ~CtAr/TtAr (89,156)
Trabecular Bone ~ (78,79) ↓BV/TV, ↓TbTh,
~TbN (80) ~ (83,87,88) ~ (87,88)
↓BV/TV
↑TbSp (91)
↓TbN & TbTh (89,156)
↓BV/TV until 8mo.(156)
Calvaria Bone
1 mo. cKO:
hypomineralized,
hypoplastic bones
1 mo. cODDD:
~ mineralization
↓ size (78)
Biomechanical
Properties
↓ultimate force to failure
↓yield force
↓bone strength
↑moment of inertia (78,79)
~moment of
inertia (81)
↓material properties (85,88)
~ structural properties (88)
↑ultimate bending
moment (83)
↑moment of inertia (83,87,88)
↓material
properties (87,88)
~ structural
properties (88)
↑moment of inertia (87)
↓mechanical strength (89)
young: ↓material
properties
all ages: ↓structural
properties
↓moment of inertia (156)
Bone matrix
disorganized collagen fibers,
appearance of woven bone,
↓ mineralization (78)
↓collagen maturation (88)
~mineralization (86,87)
~collagen
maturation
↓mineralization (88)
↑BSP content
~OCN & OPN content (156)
(Table 4.1 continued…)
93
Cx43-/-
DM1Cre;Cx43-/fl;
DM1Cre;Cx43+/fl(G138R) ColCre;Cx43–/fl
OcnCre;
Cx43–/fl
DMP1Cre;
Cx43fl/fl Cx43G138R/+ Gja1Jrt/+
Pre
na
tal/
Neo
na
tal
Sk
elet
on
Neural crest-
derived skull
elements
E16.5: delayed ossification
E18.5: hypomineralized, smaller
skull
P0: open parietal foramen,
smaller calvaria, flattened skull,
thin & brittle bones (77)
P0 cKO: hypoplastic,
hypomineralized & smaller
P0 cODDD:
hypomineralized (78)
P0: no major
skeletal
abnormalities (80)
P3: delayed
ossification, thin,
porous (89)
Mesoderm-
derived skull
elements
E16.5: most elements displayed
delayed ossification, reduced
size, hypomineralization (77)
P0 cKO: hypoplastic
smaller
cODDD skull
hypomineralization (78)
P0: no major
skeletal
abnormalities (80)
P3: delayed
ossification, thin &
porous, open
foramena (89)
Axial skeleton
E15.5- 18.5: delayed
endochondral ossification
E16.5- 18.5: deformed ribs
P0: normal mineralization (77)
P0 cKO: shortened ribs (78)
P0: no major
skeletal
abnormalities (80)
Appendicular
skeleton
E14.5: delayed ossification,
decreased size
P0: morphologically normal (77)
P0 cKO: shortened tibia
and femur (78)
P0: no major
skeletal
abnormalities (80)
(Table 4.1 continued…)
94
Cx43-/- DM1Cre;Cx43-/fl;
DM1Cre;Cx43+/fl(G138R) ColCre;Cx43–/fl
OcnCre;Cx43–
/fl
DMP1Cre;Cx43fl/fl
Cx43G138R/+
Gja1Jrt/+
Dev
elo
pm
ent
an
d A
ctiv
ity
of
Ost
eob
last
Lin
eag
e C
ells
Osteoprogenitors&
BMSCs
↓CFU-O (calvarial-
derived) (77)
↑CFU-F, ↑CFU-O,
↑proliferation (78)
↑CFU-F,
↑CFU-O,
↑proliferation (82)
↑CFU-F, ↑CFU-
ALP, ↑CFU-O
~ proliferation,
late culture: ↑OB
marker expression (156)
Calv
In vivo
In vitro
~ proliferation
↓ALP
↓mineralization↓Col1a1
& Ocn ↑Opn (77)
↓ALP,
delayed
mineralization,
↓Runx2,
Col1a1, Opn &
Ocn (80)
~ proliferation
↑apoptosis (87)
~proliferation
~ ALP
~mineralization,
~Col1a1, Opn
↓Bsp, ↓Ocn (95)
Ct
Ob
Neonatal long bone
cultures:
↓Col1a1, Ocn & Opn (77)
↑periosteal BF
↓endosteal BF
~Runx2, Opn, Bsp
↓Osx, Alp, Col1al (78,79)
↓Sost (82)
↑periosteal BF (87)
↓periosteal BF (83)
~ periosteal
BF (85)
~ endosteal BF (83,87)
↑endosteal BF (85)
↑periosteal BF
↑endosteal BF (87)
~ObS/BS
2mo.: ↓endosteal
MAR
8mo: ↑endosteal
MS/BS
~marker
expression (156)
Osy ~OsyN/BA
↓Dmp1 & Sost (78,79)
↑apoptosis
↑empty
lacunae (86-88)
↑apoptosis (87,88)
↑empty lacunae (87)
↓SOST+ OsyN (87)
~OsyN/BA
↓Sost (2mo.) (156)
Tb Ob ~ObN/BS (78)
↓ObS/BS
~ MAR (80)
~ ObS/BS (91)
~ObS/BS
~BF
↑marker
expression (156)
Osy ~ apoptosis (86) ~ OsyN/BA (156)
Serum Parameters ↑OCN (78,79) ↓OCN (87)
~ PINP (85) ↑OCN (87) ↑ALP (156)
(Table 4.1 continued…)
95
Cx43-/- DM1Cre;Cx43-/fl;
DM1Cre;Cx43+/fl(G138R) ColCre;Cx43–/fl
OcnCre;Cx43–/fl
DMP1Cre;Cx43fl/fl
Cx43G138R/+
Gja1Jrt/+
Dev
elo
pm
ent
an
d A
ctiv
ity
of
Ost
eocl
ast
s
Ct ↑endosteal OcN/BS
↑ endosteal resorption (78)
↑endosteal
OcN &
OcS/BS (120)
↑endosteal OcN & OcS/BS (87)
↑OcN/BS (85)
↑ endosteal resorption (85,87)
↑endosteal OcN/BS (87)
2mo.: ↑ endosteal
OcS/BS
4- 8mo.: ↓ endosteal
OcS/BS (156)
Tb ~ OcN/BS (78) ~ OcS/BS (80) ↑OcN/BS (85)
2mo: ↑OcS/BS
4mo: ~OcS/BS
~expression of fusion/
diff markers
↑CtsK (156)
In vitro (BM-
and spleen-
derived)
~ BM-derived
osteoclastogenesis (78)
~ BM- and spleen-
derived
osteoclastogenesis &
resorption (156)
Serum
Parameters ↑CTX (78) ↑CTX (85) ~ CTX (87) ~ CTX (156)
RANKL/ OPG ~Rankl
↓Opg (78)
long bones: ~Rankl/Opg
MLO-Y4 cells: ↑Rankl/Opg (85)
whole bone:
~Rankl/Opg
↓OPG+ Osy (%)
~RANKL+ Osy (%) (87)
MLO-Y4 & primary
calvaria cells: ↑Rankl,
↓Opg (87)
2mo.Tb: ~mRANKL
4mo. Tb: ↑mRANKL
young: ~serum OPG
old: ↑serum OPG
~ serum RANKL (156)
(Table 4.1 continued…)
96
Cx43-/- DM1Cre;Cx43-/fl;
DM1Cre;Cx43+/fl(G138R) ColCre;Cx43–/fl OcnCre;Cx43–/fl DMP1Cre;Cx43fl/fl Cx43G138R/+
Gja1Jrt/+
Res
po
nse
to c
hal
leng
e o
r st
imu
li
In vivo loading
Compressive loading:
↑periosteal response
(BFR & MS/BS)
↑endosteal response (where
BFR was further decreased
versus WT*)
↑Tb BV/TV & TbTh (79)
3-point bending:
↓endosteal response
(BMD, BFR, MAR, MS) (81)
Cantilever loading:
↑periosteal response (BFR, MS) (85)
Axial loading:
↑periosteal response
(BFR, MAR)
~ endosteal response (121)
In vivo unloading
Botulinum toxin A
muscle paralysis:
No effect on Tb bone loss
Attenuated loss of Ct
structure (CtAr) and
strength (120)
Hind limb suspension:
Attenuated loss of Tb bone
(BV/TV, TbTh)
No effect on loss of Ct bone (CtAr,
CtTh),
↑loss femoral strength,
Preservation of BF
no ↓peri- & endosteal BF (83)
Fracture Healing
↓BF (↓mineralized callus),
↓remodelling (↓OcN/BA),
↓biomechanical properties (84)
Response to
treatments
Attenuation of anabolic
action of PTH (e.g.
attenuated response of
BMC, BV/TV, MAR) (80)
Response to glucocorticoids
(prednisolone): ~ (86)
Response to bisphosphonates
(alendronate)= ↓protective effect
against apoptosis, but the result of
↑BMD is unaffected (86)
Response to bisphosphonates
(alendronate):
attenuated periosteal response,
~ endosteal response (87)
Abbreviations: decreased versus WT (↓); increased versus WT (↑); unaffected versus WT (~); bone mineral density (BMD); bone mineral content (BMC); total tissue area (TtAr); marrow area (MaAr); cortical bone area (CtAr); cortical thickness (CtTh); bone volume/ tissue volume (BV/TV); trabecular (Tb); trabecular thickness (TbTh); trabecular number (TbN); trabecular separation (TbSp); bone surface (BS); moment of inertia (MOI); DM1Cre;Cx43-/fl (cKO); DM1Cre;Cx43+/fl(G138R) (cODDD); cortical bone (Ct); calvaria bone (Calv); osteoblast (Ob); osteocyte (Osy); bone formation (BF); mineral apposition rate (MAR); mineralizing surface/ bone surface (MS/BS); bone area (BA); osteoblast number (ObN); osteoblast surface (ObS); osteocyte number (OsyN); osteoclast number (OcN); osteoclast surface (OcS); bone marrow (BM).
Table 4.1 Connexin 43 mutant mice summary chart.
The major skeletal consequences of Cx43 ablation and disruption by point mutations are shown. Empty boxes signify that the parameter(s) has not been reported.
97
4.2 Future Directions
The work presented here on the Gja1Jrt/+ mice has provided further insights into the role of Cx43
and the effect of the Gja1Jrt mutation on bone homeostasis, bone cell differentiation and activity,
and mesenchymal cell commitment; however, further studies are required to define fully the
mechanisms underlying these effects.
4.2.1 Effect of the G60S mutation on Cx43 hemichannel function
Hemichannels and gap junctions exhibit distinct specificity with regards to the signaling
molecules which they transport and the functions that they perform (reviewed in (164)). It was
previously shown that the G60S mutation has a dominant negative effect on the production of
Cx43 protein, formation of Cx43 gap junctional plaques, and gap junction intercellular
communication (89,95), however the function of G60S Cx43-containing hemichannels has yet to
be tested. Altered Cx43 gap junction and hemichannel formation and functioning can vary
significantly depending on the location and type of Cx43 point mutation (96,97). For instance, the
H194P Cx43 mutation inhibits gap junction coupling, but has no effect on hemichannel activity,
whereas the G138R and G143S mutants reduce gap junction coupling but increase hemichannel
activity (97). Though the G60S mutation has already been shown to reduce gap junction
intercellular communication and electrical coupling between cells (95), further analysis of the
G60S mutation on Cx43 hemichannel and gap junction channel permeability, pore size, and
molecular specificity should be undertaken to fully identify how the G60S mutation affects the
formation and function of Cx43 channels. This would not only help to establish a possible
mechanism behind phenotypic differences (e.g. hyperactive versus dysfunctional osteoblasts)
between the G60S Cx43 mutant and other Cx43 missense and knockout models, but help to
further delineate the specific and individual roles that Cx43 hemichannels and gap junctions have
in bone (i.e. skeletal architecture, bone formation, and turnover) and bone cell functions (i.e.
proliferation, differentiation, and activity).
Additionally, while our studies strongly suggest a role for cAMP and downstream
signaling in the upregulated production of BMP2 and BMP4 molecules, we cannot exclude the
possibility that the transport of other small second messenger molecules, which we did not test,
98
are also affected by the G60S Cx43 mutation and involved in the upregulation of BMP2/4
production and/or the expression of downstream osteoblast markers in Gja1Jrt/+ cells. Future
studies should assess alterations in formation, transport, and/or degradation of small second
messenger molecules which can be transported across Cx43 channels.
4.2.2 Gja1Jrt/+ ‘rescue’ experiments
We have reported that the abnormal bone matrix produced by the Gja1Jrt/+ osteoblasts (due to
increased BSP protein production and incorporation) is, in part, directly responsible for the
increased bone resorption by osteoclasts (156). An important next step for this work would be to
test whether the increase in matrix BSP is directly responsible for the increased bone resorption
and the subsequent early-onset-osteopenic phenotype of the Gja1Jrt/+ mice by reducing the
production of BSP in vivo by breeding the Gja1Jrt/+ with Bsp+/- mice. Studies of the bone
matrix composition and skeletal features in mice with the Gja1Jrt mutation and one deleted Bsp
allele, would reveal whether knocking down the upregulated BSP levels in Gja1Jrt/+ mice would
correct the production of the abnormal matrix and resultant increased bone resorption rate. We
would expect some skeletal phenotypes to still be present albeit less severe, since the mechanism
behind the increased osteoclasts and resorption was both the abnormal bone matrix and the
increased mbRANKL levels in young Gja1Jrt/+ mice.
Also, whether the increase in BMP2/4 production that we report is directly responsible
for all of the upregulated osteoblast activities (i.e., not only increased osteoblast-specific gene
expression, but also production of an abnormal bone matrix due to increased BSP incorporation
and changes in RANKL-OPG production), which result in activation of osteoclasts and therefore
the early-onset osteopenic phenotype of Gja1Jrt/+ mice, remains to be determined. Future
experiments can be aimed at knocking down BMP2/4 signaling in Gja1Jrt/+ mice, for instance by
breeding Gja1Jrt/+ mice to Bmp2+/- or Bmp4+/- mice, and studying osteoblast activities, matrix
composition and production of RANKL-OPG proteins to assess whether the loss of a Bmp2 or
Bmp4 allele in Gja1Jrt/+ mice could correct all or some of the aspects of the hyperactive
osteoblast phenotype.
99
Furthermore, it also remains to be determined what factors produced by the G60S Cx43-
containing cells affect the MSC microenvironment, since we have reported that the Gja1Jrt/+
mice have increased numbers of mesenchymal and osteoprogenitor cells (156). Biphasic
expression of BSP during mesenchymal cell differentiation has been previously reported, with
early upregulated or “primed” expression of BSP in very primitive osteoprogenitors (142). Also,
the composition of extracellular matrices, in conjunction differentiation factors like BMP2, can
significantly affect the commitment/differentiation of MSCs (174). The breeding strategies
suggested above would also help to delineate whether the abnormal bone matrix and/or the
increase in BMP2/4 production in Gja1Jrt/+ mice are factors affecting MSC commitment.
4.2.3 Gja1Jrt/+ response to challenge or stimuli
Beyond elucidating critical roles for Cx43-containing gap junctions and hemichannels in
development and turnover of the skeleton, the genetically-engineered mouse models discussed
have provided insights into the cellular and molecular mechanisms by which Cx43 functions in
bone, including its role in adapting the skeleton to mechanical stimulation and in fracture
healing. For instance, mechanical load modulates Cx43 expression in osteoblastic cells, and
Cx43 channels mediate different cellular responses (bone formation and resorption) based on the
different forces generated and felt, leading to changes in skeletal architecture, bone mass, and
mechanical properties of the bone. Cx43 deficiency in mutant mouse models has been shown to
alter responsiveness (increase OR decrease BFR) to mechanical loading or unloading (79,83,85),
with several studies also demonstrating that cells from different skeletal locations, e.g.
endocortical and periosteal surfaces of the cortical bone (78,85,87), are differentially sensitive to
loss of Cx43. Additionally, loss of Cx43 in OcnCre;Cx43-/fl mice also results in a decreased
ability to heal after a bone fracture, due to a reduction in bone formation and remodelling (84).
These results are summarized in Table 4.1.
Given the fact that Gja1Jrt/+ osteoblasts are uniquely hyperactive (increased production
of BMP2/4, BSP, ALP) and that Gja1Jrt/+ have an expanded osteoprogenitor population
(increased CFU-O numbers), we would expect an enhanced (BFR) response to loading and an
increased ability to heal after a fracture, versus WT littermates and versus other Cx43 deficient
models. Similarly, the response to unloading (i.e. loss of bone mass) may be dampened by the
100
hyperactive osteoblast phenotype in Gja1Jrt/+ mice. However, since osteocytes within the bone
and Cx43 channels on bone cells both play essential roles in the sensing and propagating the
signals from such stimuli, respectively, it is possible that the G60S Cx43 mutation could interfere
with such functions as the propagation of signals between cells or alter the production of certain
signaling factors by osteocytes. Thus, it would be interesting to challenge the Gja1Jrt/+ mice as
outlined above and in Table 4.1, and to assess bone cell response and the mechanism(s) by which
the Gja1Jrt/+ cells would react to presence or lack of stimuli or heal post-fracture, versus WT
and/or other Cx43-deficient mouse models.
Of particular interest to these experiments are the variable changes in the Wnt/β-catenin
pathway that we report in the Gja1Jrt/+ mice (increased total, but not active β-catenin and
increased Nkd1 but not Axin2 expression), along with similar results reported by Bivi et al., 2013
in DMP1Cre;Cx43fl/fl mice (121). These results suggest that the accumulation of β-catenin protein
in Cx43-deficient cells does not lead to increased Wnt/β-catenin-mediated transcription; rather,
elevated levels of total β-catenin in Cx43 mutant mice may be involved in other cellular
processes, such as mediating/enhancing the responsiveness of cells to mechanical stimulation,
hormones or other signals/factors, independently of classical Wnt/β-catenin transcription.
Therefore, increased levels of total β-catenin protein in osteoblastic cells may be one mechanism
by which sensitivity/responsiveness to mechanical loading or unloading in the Gja1Jrt/+ mice is
altered.
4.2.4 Further investigations into other Cx43-deficient models
An area deserving more attention is the understanding how Cx43 influences osteoblast and
osteocyte activity, including expression of osteoblast-associated genes and proteins such as BSP,
OCN and FGFs, as well as resultant changes in matrix quality and composition (e.g. matrix
content of SIBLING proteins). Although the result of increased BSP incorporation in the
Gja1Jrt/+ bone matrix has not been reported in other Cx43 deficient mouse models to date,
several other studies have reported defects in collagen maturation and reduced mineralization of
the bone matrix in Cx43 mutant models (78,87,88). It is possible that matrix anomalies, in particular
changes in BSP, may contribute to the alteration in the osteogenic bone marrow niche reported in
101
Gja1Jrt/+ and Col1a1Cre;Cx43fl/fl mice (82), as discussed above. Taken together, the data indicate
a need for additional analysis of the matrix in various Cx43 mutant mouse lines and the role of
matrix anomalies, i.e., niche anomalies, in both altered osteoclast and altered osteoblast
activities.
4.3 Conclusions
The development of Cx43 mutant mouse models has provided significant support for and new
understanding of the critical role(s) that Cx43 channels play in multiple aspects of skeletal
development, turnover and function. Cx43 channels are both generated in response to stimuli
(e.g. mechanical, hormonal and other (cytokines, growth factors)) and essential in the
propagation of these and other signals between cells in the skeleton and the cells and their
environment for such critical cell functions as bone cell differentiation-survival-apoptosis, bone
formation-resorption and the composition and quality of the matrix formed. Further, it is now
clear that the formation and function of Cx43 channels and their impact on cellular activities
vary as a function of skeletal site, age of the organism, and stage of lineage development of
osteoblastic cells. The numerous genetically-engineered Cx43 mouse models, including the
Gja1Jrt/+ mouse and the results presented in this thesis, have provided insights into the cellular
and molecular mechanisms by which Cx43 functions in bone. How the G60S Cx43 mutation
alters these functional responses remain to be fully determined, but the differences observed in
the Gja1Jrt/+ versus other loss-of-function bone phenotypes support the view that the
mechanisms are multifactorial and, reflect a complex summation of positive and negative effects
across the diversity of bone cell populations and maturational stages affected (77-83,85-87,91).
As mentioned previously, low bone mass has not been reported in ODDD patients with
mutations in the GJA1 gene, nor have genetic variations in the GJA1 gene been linked to the low
bone mass phenotype of osteoporotic patients. However the data presented on the Gja1Jrt/+ mice,
along with previously published data, suggest that CX43 could affect the composition and
quality of the bone matrix and age-related changes in bone homeostasis in humans as it does in
mice, both of which can significantly affect bone formation and resorption rates leading to bone
loss and osteoporosis. Furthermore, although the cause versus effect relationships have yet to be
fully elucidated, bone density and Cx43 gap junction channels and their responses to stimuli
102
decline as a function of age (123,124). It is possible that age-related decrease in gap junction
intercellular communication disrupts the equilibrium between bone formation and resorption
required in order to maintain skeletal integrity, leading to development of old-age related
osteopenia and osteoporosis. Thus, Cx43 may be a potential therapeutic target in the future, but
its ubiquitous expression means that any methods targeting Cx43 expression or channel function
would have to be targeted to the bone tissue with a high amount of specificity. Also, the
importance of Cx43 in mediating the cellular responses to osteoporotic treatments like
bisphosphonates (86,87) or PTH (80), means that Cx43 may be an important target in patients
identified as ‘non-responsive’ to current treatments. In the meantime, it is important that we gain
further understanding about the complex roles of Cx43 in bone.
103
References
1. Fukumoto S, Martin TJ. Bone as an endocrine organ. Trends Endocrinol Metab.
2009;20:230-6.
2. Franz-Odendaal TA. Induction and patterning of intramembranous bone. Front Biosci
(Landmark Ed). 2011;16:2734-46.
3. Rho JY, Kuhn-Spearing L, Zioupos P. Mechanical properties and the hierarchical
structure of bone. Med Eng Phys. 1998;20:92-102.
4. Compston JE. Bone marrow and bone: a functional unit. J Endocrinol. 2002;173:387-94.
5. D'Ippolito G, Schiller PC, Ricordi C, Roos BA, Howard GA. Age-related osteogenic
potential of mesenchymal stromal stem cells from human vertebral bone marrow. J Bone
Miner Res. 1999;14:1115-22.
6. Aubin JE. Advances in the osteoblast lineage. Biochem Cell Biol. 1998;76:899-910.
7. Aubin JE, Liu F, Malaval L, Gupta AK. Osteoblast and chondroblast differentiation.
Bone. 1995;17:77S-83S.
8. Bonewald LF. Osteocytes as dynamic multifunctional cells. Ann N Y Acad Sci.
2007;1116:281-90.
9. Bonewald LF, Johnson ML. Osteocytes, mechanosensing and Wnt signaling. Bone.
2008;42:606-15.
10. Franz-Odendaal TA, Hall BK, Witten PE. Buried alive: how osteoblasts become
osteocytes. Dev Dyn. 2006;235:176-90.
11. Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson
RT, Gao YH, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S, Kishimoto T.
Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to
maturational arrest of osteoblasts. Cell. 1997;89:755-64.
12. Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GW,
Beddington RS, Mundlos S, Olsen BR, Selby PB, Owen MJ. Cbfa1, a candidate gene for
cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone
development. Cell. 1997;89:765-71.
13. Nakashima K, Zhou X, Kunkel G, Zhang Z, Deng JM, Behringer RR, de Crombrugghe
B. The novel zinc finger-containing transcription factor osterix is required for osteoblast
differentiation and bone formation. Cell. 2002;108:17-29.
14. Fedde KN, Blair L, Silverstein J, Coburn SP, Ryan LM, Weinstein RS, Waymire K,
Narisawa S, Millan JL, MacGregor GR, Whyte MP. Alkaline phosphatase knock-out
104
mice recapitulate the metabolic and skeletal defects of infantile hypophosphatasia. J Bone
Miner Res. 1999;14:2015-26.
15. Viguet-Carrin S, Garnero P, Delmas PD. The role of collagen in bone strength.
Osteoporos Int. 2006;17:319-36.
16. Malaval L, Wade-Gueye NM, Boudiffa M, Fei J, Zirngibl R, Chen F, Laroche N, Roux
JP, Burt-Pichat B, Duboeuf F, Boivin G, Jurdic P, Lafage-Proust MH, Amedee J, Vico L,
Rossant J, Aubin JE. Bone sialoprotein plays a functional role in bone formation and
osteoclastogenesis. J Exp Med. 2008;205:1145-53.
17. Ducy P, Desbois C, Boyce B, Pinero G, Story B, Dunstan C, Smith E, Bonadio J,
Goldstein S, Gundberg C, Bradley A, Karsenty G. Increased bone formation in
osteocalcin-deficient mice. Nature. 1996;382:448-52.
18. Lee NK, Sowa H, Hinoi E, Ferron M, Ahn JD, Confavreux C, Dacquin R, Mee PJ,
McKee MD, Jung DY, Zhang Z, Kim JK, Mauvais-Jarvis F, Ducy P, Karsenty G.
Endocrine regulation of energy metabolism by the skeleton. Cell. 2007;130:456-69.
19. Feng JQ, Ward LM, Liu S, Lu Y, Xie Y, Yuan B, Yu X, Rauch F, Davis SI, Zhang S,
Rios H, Drezner MK, Quarles LD, Bonewald LF, White KE. Loss of DMP1 causes
rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat
Genet. 2006;38:1310-5.
20. Holm IA, Huang X, Kunkel LM. Mutational analysis of the PEX gene in patients with X-
linked hypophosphatemic rickets. Am J Hum Genet. 1997;60:790-7.
21. Yuan B, Takaiwa M, Clemens TL, Feng JQ, Kumar R, Rowe PS, Xie Y, Drezner MK.
Aberrant Phex function in osteoblasts and osteocytes alone underlies murine X-linked
hypophosphatemia. J Clin Invest. 2008;118:722-34.
22. Piters E, Culha C, Moester M, Van Bezooijen R, Adriaensen D, Mueller T, Weidauer S,
Jennes K, de Freitas F, Lowik C, Timmermans JP, Van Hul W, Papapoulos S. First
missense mutation in the SOST gene causing sclerosteosis by loss of sclerostin function.
Hum Mutat. 2010;31:E1526-43.
23. Yakar S, Rosen CJ, Beamer WG, Ackert-Bicknell CL, Wu Y, Liu JL, Ooi GT, Setser J,
Frystyk J, Boisclair YR, LeRoith D. Circulating levels of IGF-1 directly regulate bone
growth and density. J Clin Invest. 2002;110:771-81.
24. Syed F, Khosla S. Mechanisms of sex steroid effects on bone. Biochem Biophys Res
Commun. 2005;328:688-96.
25. Jilka RL, Weinstein RS, Bellido T, Roberson P, Parfitt AM, Manolagas SC. Increased
bone formation by prevention of osteoblast apoptosis with parathyroid hormone. J Clin
Invest. 1999;104:439-46.
26. Marie PJ. Fibroblast growth factor signaling controlling osteoblast differentiation. Gene.
2003;316:23-32.
105
27. Marie PJ. Fibroblast growth factor signaling controlling bone formation: an update. Gene.
2012;498:1-4.
28. Hock JM, Canalis E. Platelet-derived growth factor enhances bone cell replication, but
not differentiated function of osteoblasts. Endocrinology. 1994;134:1423-8.
29. Yu X, Hsieh SC, Bao W, Graves DT. Temporal expression of PDGF receptors and PDGF
regulatory effects on osteoblastic cells in mineralizing cultures. Am J Physiol.
1997;272:C1709-16.
30. Chen G, Deng C, Li YP. TGF-beta and BMP signaling in osteoblast differentiation and
bone formation. Int J Biol Sci. 2012;8:272-88.
31. Noel D, Gazit D, Bouquet C, Apparailly F, Bony C, Plence P, Millet V, Turgeman G,
Perricaudet M, Sany J, Jorgensen C. Short-term BMP-2 expression is sufficient for in
vivo osteochondral differentiation of mesenchymal stem cells. Stem Cells. 2004;22:74-
85.
32. Chen D, Harris MA, Rossini G, Dunstan CR, Dallas SL, Feng JQ, Mundy GR, Harris SE.
Bone morphogenetic protein 2 (BMP-2) enhances BMP-3, BMP-4, and bone cell
differentiation marker gene expression during the induction of mineralized bone matrix
formation in cultures of fetal rat calvarial osteoblasts. Calcif Tissue Int. 1997;60:283-90.
33. Liu T, Gao Y, Sakamoto K, Minamizato T, Furukawa K, Tsukazaki T, Shibata Y, Bessho
K, Komori T, Yamaguchi A. BMP-2 promotes differentiation of osteoblasts and
chondroblasts in Runx2-deficient cell lines. J Cell Physiol. 2007;211:728-35.
34. Ke HZ, Jee WS, Zeng QQ, Li M, Lin BY. Prostaglandin E2 increased rat cortical bone
mass when administered immediately following ovariectomy. Bone Miner. 1993;21:189-
201.
35. Tian XY, Zhang Q, Zhao R, Setterberg RB, Zeng QQ, Iturria SJ, Ma YF, Jee WS.
Continuous PGE2 leads to net bone loss while intermittent PGE2 leads to net bone gain
in lumbar vertebral bodies of adult female rats. Bone. 2008;42:914-20.
36. Westendorf JJ, Kahler RA, Schroeder TM. Wnt signaling in osteoblasts and bone
diseases. Gene. 2004;341:19-39.
37. Yoshiko Y, Oizumi K, Hasegawa T, Minamizaki T, Tanne K, Maeda N, Aubin JE. A
subset of osteoblasts expressing high endogenous levels of PPARgamma switches fate to
adipocytes in the rat calvaria cell culture model. PLoS One. 2010;5:e11782.
38. Clabaut A, Delplace S, Chauveau C, Hardouin P, Broux O. Human osteoblasts derived
from mesenchymal stem cells express adipogenic markers upon coculture with bone
marrow adipocytes. Differentiation. 2010;80:40-5.
39. Song L, Liu M, Ono N, Bringhurst FR, Kronenberg HM, Guo J. Loss of wnt/beta-catenin
signaling causes cell fate shift of preosteoblasts from osteoblasts to adipocytes. J Bone
Miner Res. 27:2344-58.
106
40. Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and activation. Nature.
2003;423:337-42.
41. Takayanagi H, Kim S, Koga T, Nishina H, Isshiki M, Yoshida H, Saiura A, Isobe M,
Yokochi T, Inoue J, Wagner EF, Mak TW, Kodama T, Taniguchi T. Induction and
activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in
terminal differentiation of osteoclasts. Dev Cell. 2002;3:889-901.
42. Barrow AD, Raynal N, Andersen TL, Slatter DA, Bihan D, Pugh N, Cella M, Kim T,
Rho J, Negishi-Koga T, Delaisse JM, Takayanagi H, Lorenzo J, Colonna M, Farndale
RW, Choi Y, Trowsdale J. OSCAR is a collagen receptor that costimulates
osteoclastogenesis in DAP12-deficient humans and mice. J Clin Invest. 2011;121:3505-
16.
43. Kirstein B, Chambers TJ, Fuller K. Secretion of tartrate-resistant acid phosphatase by
osteoclasts correlates with resorptive behavior. J Cell Biochem. 2006;98:1085-94.
44. Shen Z, Crotti TN, Flannery MR, Matsuzaki K, Goldring SR, McHugh KP. A novel
promoter regulates calcitonin receptor gene expression in human osteoclasts. Biochim
Biophys Acta. 2007;1769:659-67.
45. Gowen M, Lazner F, Dodds R, Kapadia R, Feild J, Tavaria M, Bertoncello I, Drake F,
Zavarselk S, Tellis I, Hertzog P, Debouck C, Kola I. Cathepsin K knockout mice develop
osteopetrosis due to a deficit in matrix degradation but not demineralization. J Bone
Miner Res. 1999;14:1654-63.
46. Saftig P, Hunziker E, Everts V, Jones S, Boyde A, Wehmeyer O, Suter A, von Figura K.
Functions of cathepsin K in bone resorption. Lessons from cathepsin K deficient mice.
Adv Exp Med Biol. 2000;477:293-303.
47. Fuller K, Owens JM, Chambers TJ. Induction of osteoclast formation by parathyroid
hormone depends on an action on stromal cells. J Endocrinol. 1998;158:341-50.
48. Boyce BF, Xing L. Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res Ther.
2007;9 Suppl 1:S1.
49. Kumar NM, Gilula NB. The gap junction communication channel. Cell. 1996;84:381-8.
50. Dbouk HA, Mroue RM, El-Sabban ME, Talhouk RS. Connexins: a myriad of functions
extending beyond assembly of gap junction channels. Cell Commun Signal. 2009;7:4.
51. Stout CE, Costantin JL, Naus CC, Charles AC. Intercellular calcium signaling in
astrocytes via ATP release through connexin hemichannels. J Biol Chem.
2002;277:10482-8.
52. Eltzschig HK, Eckle T, Mager A, Kuper N, Karcher C, Weissmuller T, Boengler K,
Schulz R, Robson SC, Colgan SP. ATP release from activated neutrophils occurs via
connexin 43 and modulates adenosine-dependent endothelial cell function. Circ Res.
2006;99:1100-8.
107
53. Cherian PP, Siller-Jackson AJ, Gu S, Wang X, Bonewald LF, Sprague E, Jiang JX.
Mechanical strain opens connexin 43 hemichannels in osteocytes: a novel mechanism for
the release of prostaglandin. Mol Biol Cell. 2005;16:3100-6.
54. Jiang JX, Cherian PP. Hemichannels formed by connexin 43 play an important role in the
release of prostaglandin E(2) by osteocytes in response to mechanical strain. Cell
Commun Adhes. 2003;10:259-64.
55. Christ GJ, Moreno AP, Melman A, Spray DC. Gap junction-mediated intercellular
diffusion of Ca2+ in cultured human corporal smooth muscle cells. Am J Physiol.
1992;263:C373-83.
56. Saez JC, Connor JA, Spray DC, Bennett MV. Hepatocyte gap junctions are permeable to
the second messenger, inositol 1,4,5-trisphosphate, and to calcium ions. Proc Natl Acad
Sci U S A. 1989;86:2708-12.
57. Kam Y, Kim DY, Koo SK, Joe CO. Transfer of second messengers through gap junction
connexin 43 channels reconstituted in liposomes. Biochim Biophys Acta. 1998;1372:384-
8.
58. Webb RJ, Marshall F, Swann K, Carroll J. Follicle-stimulating hormone induces a gap
junction-dependent dynamic change in [cAMP] and protein kinase a in mammalian
oocytes. Dev Biol. 2002;246:441-54.
59. Yamamoto T, Ochalski A, Hertzberg EL, Nagy JI. On the organization of astrocytic gap
junctions in rat brain as suggested by LM and EM immunohistochemistry of connexin43
expression. J Comp Neurol. 1990;302:853-83.
60. Simburger E, Stang A, Kremer M, Dermietzel R. Expression of connexin43 mRNA in
adult rodent brain. Histochem Cell Biol. 1997;107:127-37.
61. Beyer EC, Paul DL, Goodenough DA. Connexin43: a protein from rat heart homologous
to a gap junction protein from liver. J Cell Biol. 1987;105:2621-9.
62. Mayerhofer A, Garfield RE. Immunocytochemical analysis of the expression of gap
junction protein connexin 43 in the rat ovary. Mol Reprod Dev. 1995;41:331-8.
63. Pinero GJ, Parker S, Rundus V, Hertzberg EL, Minkoff R. Immunolocalization of
connexin 43 in the tooth germ of the neonatal rat. Histochem J. 1994;26:765-70.
64. Fried K, Mitsiadis TA, Guerrier A, Haegerstrand A, Meister B. Combinatorial expression
patterns of the connexins 26, 32, and 43 during development, homeostasis, and
regeneration of rat teeth. Int J Dev Biol. 1996;40:985-95.
65. Ruangvoravat CP, Lo CW. Connexin 43 expression in the mouse embryo: localization of
transcripts within developmentally significant domains. Dev Dyn. 1992;194:261-81.
108
66. Civitelli R, Beyer EC, Warlow PM, Robertson AJ, Geist ST, Steinberg TH. Connexin43
mediates direct intercellular communication in human osteoblastic cell networks. J Clin
Invest. 1993;91:1888-96.
67. Su M, Borke JL, Donahue HJ, Li Z, Warshawsky NM, Russell CM, Lewis JE.
Expression of connexin 43 in rat mandibular bone and periodontal ligament (PDL) cells
during experimental tooth movement. J Dent Res. 1997;76:1357-66.
68. Zimmermann B. Assembly and disassembly of gap junctions during mesenchymal cell
condensation and early chondrogenesis in limb buds of mouse embryos. J Anat. 1984;138
( Pt 2):351-63.
69. Donahue HJ, Guilak F, Vander Molen MA, McLeod KJ, Rubin CT, Grande DA, Brink
PR. Chondrocytes isolated from mature articular cartilage retain the capacity to form
functional gap junctions. J Bone Miner Res. 1995;10:1359-64.
70. Yellowley CE, Li Z, Zhou Z, Jacobs CR, Donahue HJ. Functional gap junctions between
osteocytic and osteoblastic cells. J Bone Miner Res. 2000;15:209-17.
71. Ilvesaro J, Vaananen K, Tuukkanen J. Bone-resorbing osteoclasts contain gap-junctional
connexin-43. J Bone Miner Res. 2000;15:919-26.
72. Dorshkind K, Green L, Godwin A, Fletcher WH. Connexin-43-type gap junctions
mediate communication between bone marrow stromal cells. Blood. 1993;82:38-45.
73. Steinberg TH, Civitelli R, Geist ST, Robertson AJ, Hick E, Veenstra RD, Wang HZ,
Warlow PM, Westphale EM, Laing JG, et al. Connexin43 and connexin45 form gap
junctions with different molecular permeabilities in osteoblastic cells. Embo J.
1994;13:744-50.
74. Koval M, Harley JE, Hick E, Steinberg TH. Connexin46 is retained as monomers in a
trans-Golgi compartment of osteoblastic cells. J Cell Biol. 1997;137:847-57.
75. Paic F, Igwe JC, Nori R, Kronenberg MS, Franceschetti T, Harrington P, Kuo L, Shin
DG, Rowe DW, Harris SE, Kalajzic I. Identification of differentially expressed genes
between osteoblasts and osteocytes. Bone. 2009;45:682-92.
76. Yamada Y, Ando F, Shimokata H. Association of candidate gene polymorphisms with
bone mineral density in community-dwelling Japanese women and men. Int J Mol Med.
2007;19:791-801.
77. Lecanda F, Warlow PM, Sheikh S, Furlan F, Steinberg TH, Civitelli R. Connexin43
deficiency causes delayed ossification, craniofacial abnormalities, and osteoblast
dysfunction. J Cell Biol. 2000;151:931-44.
78. Watkins M, Grimston SK, Norris JY, Guillotin B, Shaw A, Beniash E, Civitelli R.
Osteoblast connexin43 modulates skeletal architecture by regulating both arms of bone
remodeling. Mol Biol Cell. 2011;22:1240-51.
109
79. Grimston SK, Watkins MP, Brodt MD, Silva MJ, Civitelli R. Enhanced periosteal and
endocortical responses to axial tibial compression loading in conditional connexin43
deficient mice. PLoS One. 2012;7:e44222.
80. Chung DJ, Castro CH, Watkins M, Stains JP, Chung MY, Szejnfeld VL, Willecke K,
Theis M, Civitelli R. Low peak bone mass and attenuated anabolic response to
parathyroid hormone in mice with an osteoblast-specific deletion of connexin43. J Cell
Sci. 2006;119:4187-98.
81. Grimston SK, Brodt MD, Silva MJ, Civitelli R. Attenuated response to in vivo
mechanical loading in mice with conditional osteoblast ablation of the connexin43 gene
(Gja1). J Bone Miner Res. 2008;23:879-86.
82. Gonzalez-Nieto D, Li L, Kohler A, Ghiaur G, Ishikawa E, Sengupta A, Madhu M, Arnett
J, Santho R, Dunn SK, Fishman GI, Gutstein DE, Civitelli R, Barrio LC, Gunzer M,
Cancelas JA. Connexin-43 in the osteogenic BM niche regulates its cellular composition
and the bidirectional traffic of hematopoietic stem cells and progenitors. Blood.
2012;119:5144-54.
83. Lloyd SA, Lewis GS, Zhang Y, Paul EM, Donahue HJ. Connexin 43 deficiency
attenuates loss of trabecular bone and prevents suppression of cortical bone formation
during unloading. J Bone Miner Res. 2012;27:2359-72.
84. Loiselle AE, Paul EM, Lewis GS, Donahue HJ. Osteoblast and osteocyte-specific loss of
Connexin43 results in delayed bone formation and healing during murine fracture
healing. J Orthop Res. 2012;31:147-54.
85. Zhang Y, Paul EM, Sathyendra V, Davison A, Sharkey N, Bronson S, Srinivasan S,
Gross TS, Donahue HJ. Enhanced osteoclastic resorption and responsiveness to
mechanical load in gap junction deficient bone. PLoS One. 2011;6:e23516.
86. Plotkin LI, Lezcano V, Thostenson J, Weinstein RS, Manolagas SC, Bellido T. Connexin
43 is required for the anti-apoptotic effect of bisphosphonates on osteocytes and
osteoblasts in vivo. J Bone Miner Res. 2008;23:1712-21.
87. Bivi N, Condon KW, Allen MR, Farlow N, Passeri G, Brun LR, Rhee Y, Bellido T,
Plotkin LI. Cell autonomous requirement of connexin 43 for osteocyte survival:
consequences for endocortical resorption and periosteal bone formation. J Bone Miner
Res. 2012;27:374-89.
88. Bivi N, Nelson MT, Faillace ME, Li J, Miller LM, Plotkin LI. Deletion of Cx43 from
osteocytes results in defective bone material properties but does not decrease extrinsic
strength in cortical bone. Calcif Tissue Int. 2012;91:215-24.
89. Flenniken AM, Osborne LR, Anderson N, Ciliberti N, Fleming C, Gittens JE, Gong XQ,
Kelsey LB, Lounsbury C, Moreno L, Nieman BJ, Peterson K, Qu D, Roscoe W, Shao Q,
Tong D, Veitch GI, Voronina I, Vukobradovic I, Wood GA, Zhu Y, Zirngibl RA, Aubin
JE, Bai D, Bruneau BG, Grynpas M, Henderson JE, Henkelman RM, McKerlie C, Sled
JG, Stanford WL, Laird DW, Kidder GM, Adamson SL, Rossant J. A Gja1 missense
110
mutation in a mouse model of oculodentodigital dysplasia. Development. 2005;132:4375-
86.
90. Kalcheva N, Qu J, Sandeep N, Garcia L, Zhang J, Wang Z, Lampe PD, Suadicani SO,
Spray DC, Fishman GI. Gap junction remodeling and cardiac arrhythmogenesis in a
murine model of oculodentodigital dysplasia. Proc Natl Acad Sci U S A.
2007;104:20512-6.
91. Dobrowolski R, Sasse P, Schrickel JW, Watkins M, Kim JS, Rackauskas M, Troatz C,
Ghanem A, Tiemann K, Degen J, Bukauskas FF, Civitelli R, Lewalter T, Fleischmann
BK, Willecke K. The conditional connexin43G138R mouse mutant represents a new
model of hereditary oculodentodigital dysplasia in humans. Hum Mol Genet.
2008;17:539-54.
92. Paznekas WA, Boyadjiev SA, Shapiro RE, Daniels O, Wollnik B, Keegan CE, Innis JW,
Dinulos MB, Christian C, Hannibal MC, Jabs EW. Connexin 43 (GJA1) mutations cause
the pleiotropic phenotype of oculodentodigital dysplasia. American Journal of Human
Genetics. 2003;72:408-418.
93. Paznekas WA, Karczeski B, Vermeer S, Lowry RB, Delatycki M, Laurence F, Koivisto
PA, Van Maldergem L, Boyadjiev SA, Bodurtha JN, Jabs EW. GJA1 mutations, variants,
and connexin 43 dysfunction as it relates to the oculodentodigital dysplasia phenotype.
Hum Mutat. 2009;30:724-33.
94. Laird DW. Closing the gap on autosomal dominant connexin-26 and connexin-43
mutants linked to human disease. J Biol Chem. 2008;283:2997-3001.
95. McLachlan E, Plante I, Shao Q, Tong D, Kidder GM, Bernier SM, Laird DW. ODDD-
linked Cx43 mutants reduce endogenous Cx43 expression and function in osteoblasts and
inhibit late stage differentiation. J Bone Miner Res. 2008;23:928-38.
96. Shibayama J, Paznekas W, Seki A, Taffet S, Jabs EW, Delmar M, Musa H. Functional
characterization of connexin43 mutations found in patients with oculodentodigital
dysplasia. Circ Res. 2005;96:e83-91.
97. Dobrowolski R, Sommershof A, Willecke K. Some oculodentodigital dysplasia-
associated Cx43 mutations cause increased hemichannel activity in addition to deficient
gap junction channels. J Membr Biol. 2007;219:9-17.
98. Lai A, Le DN, Paznekas WA, Gifford WD, Jabs EW, Charles AC. Oculodentodigital
dysplasia connexin43 mutations result in non-functional connexin hemichannels and gap
junctions in C6 glioma cells. J Cell Sci. 2006;119:532-41.
99. Zhang YW, Morita I, Ikeda M, Ma KW, Murota S. Connexin43 suppresses proliferation
of osteosarcoma U2OS cells through post-transcriptional regulation of p27. Oncogene.
2001;20:4138-49.
111
100. Lecanda F, Towler DA, Ziambaras K, Cheng SL, Koval M, Steinberg TH, Civitelli R.
Gap junctional communication modulates gene expression in osteoblastic cells. Mol Biol
Cell. 1998;9:2249-58.
101. Grimston SK, Screen J, Haskell JH, Chung DJ, Brodt MD, Silva MJ, Civitelli R. Role of
connexin43 in osteoblast response to physical load. Ann N Y Acad Sci. 2006;1068:214-
24.
102. Ransjo M, Sahli J, Lie A. Expression of connexin 43 mRNA in microisolated murine
osteoclasts and regulation of bone resorption in vitro by gap junction inhibitors. Biochem
Biophys Res Commun. 2003;303:1179-85.
103. Jones SJ, Boyde A. Questions of quality and quantity--a morphological view of bone
biology. Kaibogaku Zasshi. 1994;69:229-43.
104. Ilvesaro J, Tavi P, Tuukkanen J. Connexin-mimetic peptide Gap 27 decreases osteoclastic
activity. BMC Musculoskelet Disord. 2001;2:10.
105. Matemba SF, Lie A, Ransjo M. Regulation of osteoclastogenesis by gap junction
communication. J Cell Biochem. 2006;99:528-37.
106. Donahue HJ, McLeod KJ, Rubin CT, Andersen J, Grine EA, Hertzberg EL, Brink PR.
Cell-to-cell communication in osteoblastic networks: cell line-dependent hormonal
regulation of gap junction function. J Bone Miner Res. 1995;10:881-9.
107. Schiller PC, Roos BA, Howard GA. Parathyroid hormone up-regulation of connexin 43
gene expression in osteoblasts depends on cell phenotype. J Bone Miner Res.
1997;12:2005-13.
108. Romanello M, Veronesi V, D'Andrea P. Mechanosensitivity and intercellular
communication in HOBIT osteoblastic cells: a possible role for gap junction
hemichannels. Biorheology. 2003;40:119-21.
109. Saunders MM, You J, Trosko JE, Yamasaki H, Li Z, Donahue HJ, Jacobs CR. Gap
junctions and fluid flow response in MC3T3-E1 cells. Am J Physiol Cell Physiol.
2001;281:C1917-25.
110. Plotkin LI, Manolagas SC, Bellido T. Transduction of cell survival signals by connexin-
43 hemichannels. J Biol Chem. 2002;277:8648-57.
111. Bivi N, Lezcano V, Romanello M, Bellido T, Plotkin LI. Connexin43 interacts with
betaarrestin: a pre-requisite for osteoblast survival induced by parathyroid hormone. J
Cell Biochem. 2011;112:2920-30.
112. Niger C, Hebert C, Stains JP. Interaction of connexin43 and protein kinase C-delta during
FGF2 signaling. BMC Biochem. 11:14.
113. Stains JP, Civitelli R. Gap junctions regulate extracellular signal-regulated kinase
signaling to affect gene transcription. Mol Biol Cell. 2005;16:64-72.
112
114. Niger C, Buo AM, Hebert C, Duggan BT, Williams MS, Stains JP. ERK acts in parallel
to PKCdelta to mediate the connexin43-dependent potentiation of Runx2 activity by
FGF2 in MC3T3 osteoblasts. Am J Physiol Cell Physiol. 2012;302:C1035-44.
115. Niger C, Hebert C, Stains JP. Interaction of connexin43 and protein kinase C-delta during
FGF2 signaling. BMC Biochem. 2010;11:14.
116. Ai Z, Fischer A, Spray DC, Brown AM, Fishman GI. Wnt-1 regulation of connexin43 in
cardiac myocytes. J Clin Invest. 2000;105:161-71.
117. Dobrowolski R, Hertig G, Lechner H, Worsdorfer P, Wulf V, Dicke N, Eckert D, Bauer
R, Schorle H, Willecke K. Loss of connexin43-mediated gap junctional coupling in the
mesenchyme of limb buds leads to altered expression of morphogens in mice. Hum Mol
Genet. 2009;18:2899-911.
118. Kim JY, Cho SW, Lee MJ, Hwang HJ, Lee JM, Lee SI, Muramatsu T, Shimono M, Jung
HS. Inhibition of connexin 43 alters Shh and Bmp-2 expression patterns in embryonic
mouse tongue. Cell Tissue Res. 2005;320:409-15.
119. Laird DW. Syndromic and non-syndromic disease-linked Cx43 mutations. FEBS Lett.
2014;http://dx.doi: 10.1016/j.febslet.2013.12.022.
120. Grimston SK, Goldberg DB, Watkins M, Brodt MD, Silva MJ, Civitelli R. Connexin43
deficiency reduces the sensitivity of cortical bone to the effects of muscle paralysis. J
Bone Miner Res. 2011;26:2151-60.
121. Bivi N, Pacheco-Costa R, Brun LR, Murphy TR, Farlow NR, Robling AG, Bellido T,
Plotkin LI. Absence of Cx43 selectively from osteocytes enhances responsiveness to
mechanical force in mice. J Orthop Res. 2013;31:1075-81.
122. Lloyd SA, Loiselle AE, Zhang Y, Donahue HJ. Connexin 43 deficiency desensitizes bone
to the effects of mechanical unloading through modulation of both arms of bone
remodeling. Bone. 2013;57:76-83.
123. Asumda FZ, Chase PB. Age-related changes in rat bone-marrow mesenchymal stem cell
plasticity. BMC Cell Biol. 2011;12:44.
124. Genetos DC, Zhou Z, Li Z, Donahue HJ. Age-related changes in gap junctional
intercellular communication in osteoblastic cells. J Orthop Res. 2012;30:1979-84.
125. Rosendaal M, Green CR, Rahman A, Morgan D. Up-regulation of the connexin43+ gap
junction network in haemopoietic tissue before the growth of stem cells. J Cell Sci.
1994;107 ( Pt 1):29-37.
126. Krenacs T, Rosendaal M. Connexin43 gap junctions in normal, regenerating, and
cultured mouse bone marrow and in human leukemias: their possible involvement in
blood formation. Am J Pathol. 1998;152:993-1004.
113
127. Schiller PC, Mehta PP, Roos BA, Howard GA. Hormonal regulation of intercellular
communication: parathyroid hormone increases connexin 43 gene expression and gap-
junctional communication in osteoblastic cells. Mol Endocrinol. 1992;6:1433-40.
128. Civitelli R, Ziambaras K, Warlow PM, Lecanda F, Nelson T, Harley J, Atal N, Beyer EC,
Steinberg TH. Regulation of connexin43 expression and function by prostaglandin E2
(PGE2) and parathyroid hormone (PTH) in osteoblastic cells. J Cell Biochem. 1998;68:8-
21.
129. Mason DJ, Hillam RA, Skerry TM. Constitutive in vivo mRNA expression by osteocytes
of beta-actin, osteocalcin, connexin-43, IGF-I, c-fos and c-jun, but not TNF-alpha nor
tartrate-resistant acid phosphatase. J Bone Miner Res. 1996;11:350-7.
130. Jones SJ, Gray C, Sakamaki H, Arora M, Boyde A, Gourdie R, Green C. The incidence
and size of gap junctions between the bone cells in rat calvaria. Anat Embryol (Berl).
1993;187:343-52.
131. Gladwin A, Donnai D, Metcalfe K, Schrander-Stumpel C, Brueton L, Verloes A,
Aylsworth A, Toriello H, Winter R, Dixon M. Localization of a gene for
oculodentodigital syndrome to human chromosome 6q22-q24. Hum Mol Genet.
1997;6:123-7.
132. Valverde-Franco G, Liu H, Davidson D, Chai S, Valderrama-Carvajal H, Goltzman D,
Ornitz DM, Henderson JE. Defective bone mineralization and osteopenia in young adult
FGFR3-/- mice. Hum Mol Genet. 2004;13:271-84.
133. Sardone LD, Renlund R, Willett TL, Fantus IG, Grynpas MD. Effect of rosiglitazone on
bone quality in a rat model of insulin resistance and osteoporosis. Diabetes.
2011;60:3271-8.
134. Carson FL. Histotechnology: A Self-Instructional Text. American Society for Clinical
Pathology Press; 1990. 294.
135. Wang X, Seed B. A PCR primer bank for quantitative gene expression analysis. Nucleic
Acids Res. 2003;31:e154.
136. Zhao S, Fernald RD. Comprehensive algorithm for quantitative real-time polymerase
chain reaction. J Comput Biol. 2005;12:1047-64.
137. Scutt A, Beier N, Fittschen C. EMD273316 & EMD95833, type 4 phosphodiesterase
inhibitors, stimulate fibroblastic-colony formation by bone marrow cells via direct
inhibition of PDE4 and the induction of endogenous prostaglandin synthesis. BMC
Pharmacol. 2004;4:10.
138. Bellows CG, Aubin JE, Heersche JN, Antosz ME. Mineralized bone nodules formed in
vitro from enzymatically released rat calvaria cell populations. Calcif Tissue Int.
1986;38:143-54.
114
139. Goldberg HA, Sodek J. Purification of mineralized tissue-associated osteopontin.
Methods in Cell Science. 1994;16:211-215.
140. Thomas T, Telford D, Laird DW. Functional domain mapping and selective trans-
dominant effects exhibited by Cx26 disease-causing mutations. J Biol Chem.
2004;279:19157-68.
141. Li X, Ominsky MS, Niu QT, Sun N, Daugherty B, D'Agostin D, Kurahara C, Gao Y, Cao
J, Gong J, Asuncion F, Barrero M, Warmington K, Dwyer D, Stolina M, Morony S,
Sarosi I, Kostenuik PJ, Lacey DL, Simonet WS, Ke HZ, Paszty C. Targeted deletion of
the sclerostin gene in mice results in increased bone formation and bone strength. J Bone
Miner Res. 2008;23:860-9.
142. Liu F, Malaval L, Aubin JE. Global amplification polymerase chain reaction reveals
novel transitional stages during osteoprogenitor differentiation. J Cell Sci.
2003;116:1787-96.
143. Wilson SE, Mohan RR, Netto M, Perez V, Possin D, Huang J, Kwon R, Alekseev A,
Rodriguez-Perez JP. RANK, RANKL, OPG, and M-CSF expression in stromal cells
during corneal wound healing. Invest Ophthalmol Vis Sci. 2004;45:2201-11.
144. Kong YY, Feige U, Sarosi I, Bolon B, Tafuri A, Morony S, Capparelli C, Li J, Elliott R,
McCabe S, Wong T, Campagnuolo G, Moran E, Bogoch ER, Van G, Nguyen LT, Ohashi
PS, Lacey DL, Fish E, Boyle WJ, Penninger JM. Activated T cells regulate bone loss and
joint destruction in adjuvant arthritis through osteoprotegerin ligand. Nature.
1999;402:304-9.
145. Valverde P, Tu Q, Chen J. BSP and RANKL induce osteoclastogenesis and bone
resorption synergistically. J Bone Miner Res. 2005;20:1669-79.
146. Valverde P, Zhang J, Fix A, Zhu J, Ma W, Tu Q, Chen J. Overexpression of bone
sialoprotein leads to an uncoupling of bone formation and bone resorption in mice. J
Bone Miner Res. 2008;23:1775-88.
147. Anderson DM, Maraskovsky E, Billingsley WL, Dougall WC, Tometsko ME, Roux ER,
Teepe MC, DuBose RF, Cosman D, Galibert L. A homologue of the TNF receptor and its
ligand enhance T-cell growth and dendritic-cell function. Nature. 1997;390:175-9.
148. Wong BR, Rho J, Arron J, Robinson E, Orlinick J, Chao M, Kalachikov S, Cayani E,
Bartlett FS, 3rd, Frankel WN, Lee SY, Choi Y. TRANCE is a novel ligand of the tumor
necrosis factor receptor family that activates c-Jun N-terminal kinase in T cells. J Biol
Chem. 1997;272:25190-4.
149. Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, Tomoyasu
A, Yano K, Goto M, Murakami A, Tsuda E, Morinaga T, Higashio K, Udagawa N,
Takahashi N, Suda T. Osteoclast differentiation factor is a ligand for
osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to
TRANCE/RANKL. Proc Natl Acad Sci U S A. 1998;95:3597-602.
115
150. Yasuda H, Shima N, Nakagawa N, Mochizuki SI, Yano K, Fujise N, Sato Y, Goto M,
Yamaguchi K, Kuriyama M, Kanno T, Murakami A, Tsuda E, Morinaga T, Higashio K.
Identity of osteoclastogenesis inhibitory factor (OCIF) and osteoprotegerin (OPG): a
mechanism by which OPG/OCIF inhibits osteoclastogenesis in vitro. Endocrinology.
1998;139:1329-37.
151. Tsuda E, Goto M, Mochizuki S, Yano K, Kobayashi F, Morinaga T, Higashio K.
Isolation of a novel cytokine from human fibroblasts that specifically inhibits
osteoclastogenesis. Biochem Biophys Res Commun. 1997;234:137-42.
152. Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang MS, Luthy R, Nguyen HQ,
Wooden S, Bennett L, Boone T, Shimamoto G, DeRose M, Elliott R, Colombero A, Tan
HL, Trail G, Sullivan J, Davy E, Bucay N, Renshaw-Gegg L, Hughes TM, Hill D,
Pattison W, Campbell P, Sander S, Van G, Tarpley J, Derby P, Lee R, Boyle WJ.
Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell.
1997;89:309-19.
153. Loewenstein WR. Junctional intercellular communication: the cell-to-cell membrane
channel. Physiol Rev. 1981;61:829-913.
154. Alexander DB, Goldberg GS. Transfer of biologically important molecules between cells
through gap junction channels. Curr Med Chem. 2003;10:2045-58.
155. Sanches DS, Pires CG, Fukumasu H, Cogliati B, Matsuzaki P, Chaible LM, Torres LN,
Ferrigno CR, Dagli ML. Expression of connexins in normal and neoplastic canine bone
tissue. Vet Pathol. 2009;46:846-59.
156. Zappitelli T, Chen F, Moreno L, Zirngibl RA, Grynpas M, Henderson JE, Aubin JE. The
G60S Connexin 43 Mutation Activates the Osteoblast Lineage and Results in a
Resorption-Stimulating Bone Matrix and Abrogation of old Age-related Bone Loss. J
Bone Miner Res. 2013;28:2400-13.
157. Yanagiya T, Tanabe A, Hotta K. Gap-junctional communication is required for mitotic
clonal expansion during adipogenesis. Obesity (Silver Spring). 2007;15:572-82.
158. Yeganeh A, Stelmack GL, Fandrich RR, Halayko AJ, Kardami E, Zahradka P. Connexin
43 phosphorylation and degradation are required for adipogenesis. Biochim Biophys
Acta. 2012;1823:1731-44.
159. Azarnia R, Russell TR. Cyclic AMP effects on cell-to-cell junctional membrane
permeability during adipocyte differentiation of 3T3-L1 fibroblasts. J Cell Biol.
1985;100:265-9.
160. Umezawa A, Hata J. Expression of gap-junctional protein (connexin 43 or alpha 1 gap
junction) is down-regulated at the transcriptional level during adipocyte differentiation of
H-1/A marrow stromal cells. Cell Struct Funct. 1992;17:177-84.
116
161. Malaval L, Modrowski D, Gupta AK, Aubin JE. Cellular expression of bone-related
proteins during in vitro osteogenesis in rat bone marrow stromal cell cultures. J Cell
Physiol. 1994;158:555-72.
162. Ashby CD, Walsh DA. Characterization of the interaction of a protein inhibitor with
adenosine 3',5'-monophosphate-dependent protein kinases. I. Interaction with the
catalytic subunit of the protein kinase. J Biol Chem. 1972;247:6637-42.
163. Ashby CD, Walsh DA. Characterization of the interaction of a protein inhibitor with
adenosine 3',5'-monophosphate-dependent protein kinases. II. Mechanism of action with
the holoenzyme. J Biol Chem. 1973;248:1255-61.
164. Jiang JX, Siller-Jackson AJ, Burra S. Roles of gap junctions and hemichannels in bone
cell functions and in signal transmission of mechanical stress. Front Biosci.
2007;12:1450-62.
165. Lawrence TS, Beers WH, Gilula NB. Transmission of hormonal stimulation by cell-to-
cell communication. Nature. 1978;272:501-6.
166. Koval M, Geist ST, Westphale EM, Kemendy AE, Civitelli R, Beyer EC, Steinberg TH.
Transfected connexin45 alters gap junction permeability in cells expressing endogenous
connexin43. J Cell Biol. 1995;130:987-95.
167. Veenstra RD, Wang HZ, Beyer EC, Brink PR. Selective dye and ionic permeability of
gap junction channels formed by connexin45. Circ Res. 1994;75:483-90.
168. Zappitelli T, Aubin JE. The "Connexin" Between Bone Cells and Skeletal Functions. J
Cell Biochem. 2014;
169. Ghayor C, Ehrbar M, San Miguel B, Gratz KW, Weber FE. cAMP enhances BMP2-
signaling through PKA and MKP1-dependent mechanisms. Biochem Biophys Res
Commun. 2009;381:247-52.
170. Horiuchi H, Saito N, Kinoshita T, Wakabayashi S, Tsutsumimoto T, Takaoka K.
Enhancement of bone morphogenetic protein-2-induced new bone formation in mice by
the phosphodiesterase inhibitor pentoxifylline. Bone. 2001;28:290-4.
171. Matsuo N, Tanaka S, Gordon MK, Koch M, Yoshioka H, Ramirez F. CREB-AP1 protein
complexes regulate transcription of the collagen XXIV gene (Col24a1) in osteoblasts. J
Biol Chem. 2006;281:5445-52.
172. Takai H, Nakayama Y, Kim DS, Arai M, Araki S, Mezawa M, Nakajima Y, Kato N,
Masunaga H, Ogata Y. Androgen receptor stimulates bone sialoprotein (BSP) gene
transcription via cAMP response element and activator protein 1/glucocorticoid response
elements. J Cell Biochem. 2007;102:240-51.
173. Zhang R, Edwards JR, Ko SY, Dong S, Liu H, Oyajobi BO, Papasian C, Deng HW, Zhao
M. Transcriptional regulation of BMP2 expression by the PTH-CREB signaling pathway
in osteoblasts. PLoS One. 2011;6:e20780.
117
174. Kwon SH, Lee TJ, Park J, Hwang JE, Jin M, Jang HK, Hwang NS, Kim BS. Modulation
of BMP-2-induced chondrogenic versus osteogenic differentiation of human
mesenchymal stem cells by cell-specific extracellular matrices. Tissue Eng Part A.
2013;19:49-58.