characterization of newcastle disease viruses in wild 2...

1

Characterization of Newcastle disease viruses in wild 1

and domestic birds in Luxembourg from 2006 to 2008 2

Running title: Characterization of NDV in Luxembourg 3

4

Chantal J. Snoeck1, Marianna Marinelli1*, Emilie Charpentier1, Aurélie Sausy1, Tom 5

Conzemius2, Serge Losch3, Claude P. Muller1# 6

7

1Institute of Immunology, Centre de Recherche Public - Santé /Laboratoire National de 8

Santé, Luxembourg, Luxembourg 9

2Lëtzebuerger Natur- a Vulleschutzliga, Kockelscheuer, Luxembourg 10

3Laboratoire de Médecine Vétérinaire de l’Etat, Administration des Services Vétérinaires, 11

Ministère de l'Agriculture, de la Viticulture et du Développement rural, Luxembourg, 12

Luxembourg 13

14

#Corresponding author: Claude P. Muller, Institute of Immunology, Centre de Recherche 15

Public - Santé /Laboratoire National de Santé, 20A rue Auguste Lumière, L-1950 16

Luxembourg. Tel: +352 49 06 04 220. Fax: +352 49 06 86. E-mail address: 17

[email protected] 18

19

*Current affiliation: Novartis Vaccines and Diagnostics srl Via Fiorentina 1, 53100 Siena, 20

Italy 21

Copyright © 2012, American Society for Microbiology. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02437-12 AEM Accepts, published online ahead of print on 16 November 2012

on July 1, 2018 by guesthttp://aem

.asm.org/

Dow

nloaded from

http://aem.asm.org/

2

Abstract 22

Newcastle disease virus (NDV) is one of the most important viral diseases of birds. Wild 23

birds constitute a natural reservoir of low virulent viruses while poultry are the main 24

reservoir of virulent strains. Exchange of virus between both reservoirs represents a risk 25

for both bird populations. Samples from wild and domestic birds collected between 2006 26

and 2010 in Luxembourg were analyzed for NDV. Three similar avirulent genotype I 27

strains were found in ducks during consecutive years, suggesting that the virus may have 28

survived and spread locally. However, separate introductions cannot be excluded because 29

no recent complete F gene sequences of genotype I from other European countries are 30

available. Detection of vaccine-like strains in wild waterbirds suggested the spread of 31

vaccine strains, despite the non-vaccination policy in Luxembourg. Among domestic 32

birds, only one chicken was positive for a genotype II strain differing from the LaSota 33

vaccine and exhibiting a so far unrecognized fusion protein cleavage site of predicted 34

lowvirulence. Three genotype VI strains from pigeons were the only virulent strains 35

found. The circulation of NDV in wild and free-ranging domestic birds warrants a 36

continuing surveillance because of increased concern that low virulent wild bird viruses 37

could become more virulent in domestic populations. 38

39


.asm.org/

Dow

nloaded from

http://aem.asm.org/

3

Introduction 40

Newcastle disease, caused by virulent strains of the Newcastle disease virus, is the most 41

important viral disease in poultry together with highly pathogenic avian influenza. 42

Newcastle disease virus (NDV), or avian paramyxovirus type-1, is a negative single-43

stranded RNA virus belonging to the Avulavirus genus in the Paramyxoviridae family. 44

Based on clinical signs in chickens, several pathotypes have been defined (23). The 45

sequence of the fusion (F) protein cleavage site is considered a major virulence 46

determinant and it appears that a minimum of three basic amino acids between residues 47

112 and 116, followed by a phenylalanine at residue 117 are required for virulence (23). 48

However, other factors are also involved in the virulent phenotype as indicated by strains 49

found in pigeons around the world and in healthy migratory ducks in Alaska that have a 50

virulent cleavage site motif but are not always virulent for chicken in standard 51

pathogenicity tests (9, 27). 52

Besides its phenotypic heterogeneity, NDV is also genetically diverse and several 53

phylogenetic classes and genotypes (10) or lineages (2) are recognized and its diversity is 54

still unfolding (10, 26). Class I strains and genotypes I and X of class II are mainly 55

constituted by avirulent strains. Genotype II contains a broad spectrum of strains but 56

nowadays, mainly avirulent strains are found. The other class II genotypes (III to IX and 57

XI to XV) contain almost exclusively viruses with a virulent cleavage site. 58

Wild birds constitute a natural reservoir of viruses of low virulence for chickens. In 59

particular waterbirds may play an important role in NDV epidemiology due to shedding 60

of viral particles into the aquatic environment more favorable for virus stability, and their 61

potential for long distance dissemination by migration (14). Although no direct 62


.asm.org/

Dow

nloaded from

http://aem.asm.org/

4

epidemiological link was found, successions of outbreaks in the UK, Sweden, Denmark 63

and Finland between 1996 and 2005 were all related at least on the basis of strain 64

similarity, suggesting multiple introductions of viruses from the same pool by wild birds 65

(5). Moreover, isolation of similar viruses in wild birds (a goosander in Finland, a 66

cormorant in Denmark) together with the proximity to water of a significant number of 67

the affected flocks was suggestive of a wild bird reservoir at least of genotype XIII 68

strains in Western and Northern Europe (4). Another more common threat for poultry 69

arises from pigeon paramyxovirus type-1 (PPMV-1) strains, variants of NDV grouping 70

within genotype VI. PPMV-1 strains exhibit a broad range of pathogenicity for poultry 71

(9) and pathogenicity may increase after serial passages in chickens (9, 20). On several 72

occasions, PPMV-1 viruses caused outbreaks in chickens (7, 12, 34). 73

During the last decade, virulent viruses from genotypes VI, VII and XIII have been 74

detected in wild and domestic birds in several European countries (4), and avirulent 75

strains of class I and class II (genotypes I and II) have also been reported sporadically 76

(http://ec.europa.eu/food/animal/diseases/controlmeasures/avian/crls_proceedings_en.ht77

m). However, in Europe, only few sequences from wild birds are available, despite their 78

importance for epidemiological surveillance. In this retrospective study, we examined 79

stored samples collected in the framework of avian influenza surveillance in Luxembourg 80

to investigate the presence of avirulent and virulent NDV in wild and domestic birds. All 81

viruses found had a predicted low virulence, except for three PPMV-1 strains. 82

Material and Methods 83

Sample collection. Between January 2006 and July 2010, pooled tracheal and cloacal 84

swabs (n=576), cloacal swabs (n=196), tracheal swabs (n=22) or fresh feces (n=337) 85


.asm.org/

Dow

nloaded from

http://aem.asm.org/

5

were collected during active and passive surveillance for avian influenza virus. The 86

majority of the samples originated from wild birds (n= 1003), but a smaller number of 87

domestic birds was also sampled, including chickens (n=120), turkey (n=1), quail (n=1), 88

peafowl (n=1) and pheasants (n=2, Table 2). Samples from healthy passerines were 89

mainly collected with mist nests during migration surveys at three locations: Nospelt, 90

Ubersyren and Schifflange. Wild waterfowl, primarily targeted for avian influenza 91

surveillance, were mainly sampled along the Moselle River in Remich and Wasserbillig. 92

Some samples from injured or sick animals, especially from birds of prey, were also 93

collected at a wildlife shelter, while exotic species (n=3) were sampled at a zoological 94

park and at the international airport. The other bird species were sampled throughout the 95

country but with a bias towards the southern part of the country (Fig. 1). 96

All swab samples were immediately placed in the field in 500 µl of virus transport 97

medium (PBS pH 7.0 with 2000 U penicillin/ml, 200 mg streptomycin/ml, 2000 U 98

polymyxin B/ml, 250 mg gentamicin/ml, 60 mg ofloxacin/ml, 200 mg 99

sulfamethoxazole/ml and 2.5 mg amphotericin B/ml). All samples were kept refrigerated 100

until delivery to the laboratory. Approximately 100 mg of fecal samples were 101

homogenized in 500 μl of virus transport medium upon arrival at the laboratory. 786 102

samples were processed immediately and cDNA was kept at -20°C, while 345 samples 103

were stored at -80°C before being processed. The majority of the samples (86%, 104

968/1131) were stored at -80°C within 48h after collection. 105

Nucleic acid extraction, PCR, and sequencing. RNA was extracted from 140 μl of 106

medium using QIAamp Viral RNA Mini Kit (Qiagen, Venlo, The Netherlands) or from 107

50 μl using MagMAXTM-96 AI/ND Viral RNA Isolation Kit (Life Technologies, 108


.asm.org/

Dow

nloaded from

http://aem.asm.org/

6

Merelbeke, Belgium) with KingFisher (Thermo Fisher, Waltham, Massachusetts, USA). 109

Screening for class I strains was only performed on the 345 samples collected after June 110

2007 (according to Kim et al. (19)). Class II strain detection by nested PCR (16, 26) and 111

sequencing of positive PCR products (26) were carried out as described previously. 112

Whenever enough material was available, the entire F gene was amplified using several 113

primer combinations in (semi-)nested PCR formats (Table 1). 114

Statistical analyses. Statistical analyses to assess whether differences in sampling or 115

sample processing had an effect on the outcome of the detection tests were performed 116

using the Chi-square test with Yates correction in SigmaPlot software. 117

Sequence analyses. Kimura distances were calculated according to the Kimura 2-118

parameter model on partial (240 nt) or complete (1662 nt) F gene sequences. The 119

sequence lengths used for distance calculations are mentioned between brackets in the 120

Results section. Phylogenetic relationships were inferred by comparing the 121

Luxembourgish strains with all NDV sequences available on NCBI (downloaded in 122

October 2012) after dataset curation. Datasets were aligned using ClustalW (30). Trees 123

were calculated with the Neighbour-Joining method, using the Kimura 2-parameter 124

model and 1000 bootstrap replicates as implemented in MEGA v5.03 software (28). 125

Representative strains were selected based on these preliminary analyses and are 126

displayed in Fig. 2 and 3. The classification nomenclature was used according to Diel et 127

al. (10) and the nucleotide numbering of F gene sequence according to Kho et al. (16). 128

Nucleotide sequence accession numbers. Sequences were submitted to GenBank under 129

accession numbers HE972209 to HE972217. The following strain nomenclature was 130

used: host/country/strain number/year. 131


.asm.org/

Dow

nloaded from

http://aem.asm.org/

7

Results 132

None of the 345 samples tested for class I strains was positive for these strains. A total of 133

9 samples out of 1131 were positive in the PCR detecting class II NDV strains (Table 2), 134

corresponding to an overall prevalence of 0.8% during the 2006-2010 period (4/619 in 135

2006, 4/349 in 2007, 1/84 in 2008, 0/67 in 2009 and 0/12 in 2010). However, prevalences 136

may be somewhat underestimated since virus isolation and some RT-PCR protocols may 137

be more sensitive. Statistical analyses revealed that the type of samples, the time between 138

collection and storage (categorized as less or more than 48h) or the type of material used 139

in the PCR (cDNA stored at -20°C or freshly prepared from original samples stored at -140

80°C) had no significant effect on the number of positive samples per group (p-141

values=0.816, 0.847, 0.583 respectively). The apparent absence of NDV in 2009-2010 as 142

well as in the northern part of the country (Fig. 1) was most probably due to a suboptimal 143

surveillance effort rather than a disappearance of NDV in Luxembourg or the existence 144

of regional differences. 145

Phylogenetic analyses of partial (9 strains; Fig. 2) and complete (5 strains; Fig. 3) F gene 146

sequences revealed an equal distribution of the samples in three class II genotypes. 147

Genotype I. Three similar strains (Kimura distances from 0 to 0.5%, 1662 nt) from 148

ducks, including one Mallard Anas platyrhynchos, clustered in genotype I. They clustered 149

together with strains from waterfowls from Finland, the Far East and China (Fig. 2 and 3) 150

and were most closely related to each other based on complete F gene sequences (Fig. 3). 151

They all had a Kimura distance of 0.4% (240 nt) to mallard/Finland/9360/2010. The 152

deduced amino acid sequence of the F protein cleavage site 112GKQGR*L117 was typical 153

of avirulent genotype I strains. 154


.asm.org/

Dow

nloaded from

http://aem.asm.org/

8

Genotype II. Three samples from a chicken, a Great Cormorant Phalocrocorax carbo 155

and a duck clustered in genotype II, together with the commonly used vaccines LaSota 156

and B1. Kimura distances (240 nt) to the LaSota and B1 vaccines ranged from 0 157

(duck/Luxembourg/26/06) to 1.3% (chicken/Luxembourg/2871-18/07). Both 158

duck/Luxembourg/26/06 and Great Cormorant/Luxembourg/2547/2006 exhibited a 159

cleavage site typical of avirulent genotype II strains, 112GRQGR*L117, while the 160

chicken/Luxembourg/2871-18/07 strain encoded 112GGQGR*L117 due to a non-161

synonymous A to G substitution at nucleotide position 380. 162

Genotype VI. The last three sequences from pigeons Columba livia var. domestica 163

clustered in genotype VI, together with recent isolates mainly found in Columbiformes 164

worldwide. Kimura distances ranged from 0.4% between pigeon/Luxembourg/2657-2/06 165

and pigeon/Luxembourg/119/06 (240 nt) to 2.6% between pigeon/Luxembourg/119/06 166

and pigeon/Luxembourg/3821-1/07 (1662 nt). All genotype VI strains encoded for 167

virulent fusion cleavage site motifs 112RRQKR*F117, as defined by World Organization 168

for Animal Health standard (23), and were similar to those of other previously described 169

PPMV-1 strains. 170

Discussion 171

There is increasing evidence that wild waterbirds are natural carriers of avirulent class I 172

and class II genotype I and X strains (13, 18, 22, 24, 36). It was thus not surprising to find 173

five out of nine positive samples in waterbirds, including three avirulent genotype I 174

strains in ducks in our study. Based on the full F gene sequences (Fig. 3), these genotype 175

I strains formed a monophyletic cluster, which may suggest that they evolved from a 176

recent common ancestor and resulted from a single introduction event in Luxembourg. In 177


.asm.org/

Dow

nloaded from

http://aem.asm.org/

9

this scenario, the detection of similar strains in 2007 and 2008 would indicate that 178

avirulent viruses could be maintained in the local bird population throughout the year. 179

However, their relationship with NDV isolates recently identified in migratory species in 180

Finland (21, 22) could not be further clarified on the basis of the short Finnish sequences. 181

Wild Anatidae, such as Eurasian Teals, Mallards and Northern Shoveler, have different 182

migratory routes, which mainly depend on weather conditions and the availability of food 183

resources. These three species, among others, are also commonly observed at migratory 184

stopovers in Luxembourg. Similarly, the three ducks sampled in August 2007 and in 185

October 2008 in Luxembourg could have arrived in Luxembourg shortly before being 186

sampled. It is therefore possible that genotype I strains have been introduced by 187

migratory species on a single or several occasions. Complete F gene sequences from 188

other European countries, as well as more detailed information on the bird species 189

sampled, would be required to further address this question. 190

The strains of genotype VI found in three Luxembourg pigeons probably originate from 191

separate introduction events, as they do not share a direct common ancestor and are 192

interspersed with strains found in other countries (Fig. 2 and 3). While PPMV-1 strains 193

initially circulated mainly in racing and show pigeons, they are now considered enzootic 194

in feral pigeons and doves in countries such as Germany and Italy (29, 34). Cases in 195

pigeons have been detected almost every year between 2000 and 2009 in the 196

neighbouring countries (4) and dissemination to Luxembourg is not unexpected. 197

While genotypes I and X (class II) and class I strains are often detected in waterfowl, 198

vaccine-like strains of genotype II are mainly found in poultry and are usually associated 199

with the use of live vaccines (26, 35, 37). In this respect, our finding of a vaccine-like 200


.asm.org/

Dow

nloaded from

http://aem.asm.org/

10

strain in a Great Cormorant and a duck in Luxembourg is somewhat unusual. The 201

detection of vaccine strains in non-vaccinated flocks suggested that lentogenic vaccine 202

strains can spread at least within poultry (33). In addition, wild type virus transmission 203

between wild and domestic birds were already suspected to be at the origin of the 204

similarity of strains found in wild birds and domestic birds in live bird markets (17, 18) 205

or in flocks with possible contacts with wild birds (14), and of the spill-back of virulent 206

strains into wild birds (31, 37). Therefore it seems reasonable to expect that vaccine 207

strains may also be exchanged between poultry and wild birds. Similar cases of strains 208

close to LaSota or B1 vaccines in wild birds have been reported elsewhere, including 209

Asia (China, India and Malaysia), Argentina or France (Fig. 2). Although NDV 210

vaccination is not allowed in Luxembourg, vaccinated animals are also sometimes 211

imported (Losch S., pers comm.). Also bridge species such as sparrows that live in close 212

proximity with domestic birds (37), in particular in regions where backyard chickens are 213

commonly reared, or food/water contamination (3, 7) may have contributed to the 214

transmission of vaccine-like strains to waterbirds in Luxembourg. On the other hand, 215

wild birds may have been infected in other European countries which sometimes allow 216

vaccination. Since Great Cormorants tend to migrate late during the season, it is difficult 217

to known whether the bird infected with a genotype II strain sampled in April spent the 218

winter locally, or was sampled during its northwards migration. Unfortunately, the 219

species of the other bird infected with a genotype II strain was not known. 220

The only strain found in a domestic bird belonged to genotype II, but did not seem to be 221

directly related to a vaccine strain because of three mutations in a short region of the F 222

gene leading to two amino acid substitutions, one being in the cleavage site. To our 223


.asm.org/

Dow

nloaded from

http://aem.asm.org/

11

knowledge, this particular cleavage site sequence has not been reported before, but this 224

strain is probably not virulent for chickens as it contains only one basic amino acid 225

between residues 112 and 116 and a leucine at residue 117. Unfortunately no further 226

information about potential clinical signs in the flock was available. 227

No virulent NDV strains were found in wild or domestic birds in Luxembourg, except for 228

the three PPMV-1 strains. Although the latter are normally found in pigeons, PPMV-1 229

transmission to poultry was reported on a few occasions in Europe during the past decade 230

(4). Even if most cases occurred in small backyard flocks with low biosecurity, the 231

circulation of PPMV-1 in pigeons represents a potential threat for the poultry industry. 232

The presence of avirulent strains in wild birds may also be a risk for poultry. Although 233

excessively rare in the field, virulent strains may develop from low virulent strains after 234

mutation, as was postulated for outbreaks that occurred in Ireland (6) and Australia (11). 235

This was also demonstrated by serial experimental passages in chickens (25), which may 236

have given minor populations of virulent NDV in field isolates a selective advantage 237

(15). All these scenarios highlight the importance of virological surveillance and 238

preventive measures to reduce the intermingling of wild and domestic birds. 239

In conclusion, we found avirulent genotype I strains in waterfowls in Luxembourg 240

similar to those circulating in wild migratory birds in Finland, suggesting that these 241

viruses represent typical avirulent strains found in European wild birds and that migratory 242

birds may contribute to their spread. Detection of vaccine-like strains in wild waterbirds 243

suggests the spread of vaccine strains, despite the non-vaccination policy in Luxembourg. 244

Although the three PPMV-1 strains from pigeons were the only virulent strains found in 245


.asm.org/

Dow

nloaded from

http://aem.asm.org/

12

Luxembourg, the presence of NDV in wild and free-ranging domestic birds justifies the 246

need for continuous surveillance in wild and domestic birds. 247

Acknowledgments 248

The authors wish to thank Dr. A. Reye and F. Leenen for technical assistance using 249

ArcGIS and SigmaPlot software, as well as S. Farinelle for sharing her ornithological 250

knowledge. They gratefully acknowledge the Administration des Services Vétérinaries 251

and the Lëtzebuerger Natur- a Vulleschutzliga for their expertise in sample collection. 252

The authors wish to thank Dr. Claudio Afonso, Southeast Poultry Research Laboratory, 253

USDA, for providing positive controls. 254

The authors acknowledge the Ministry of Health, the Ministry of Research and the Centre 255

de Recherche Public-Santé for their generous financial and moral support. C.J. Snoeck 256

was supported by an AFR fellowship TR_PHD BFR08-095 from the Fonds National de 257

la Recherche, Luxembourg. 258

References 259

1. Abolnik C, Horner RF, Bisschop SP, Parker ME, Romito M, Viljoen GJ. 260

2004. A phylogenetic study of South African Newcastle disease virus strains 261

isolated between 1990 and 2002 suggests epidemiological origins in the Far East. 262

Arch Virol 149:603-619. 263

2. Aldous EW, Mynn JK, Banks J, Alexander DJ. 2003. A molecular 264

epidemiological study of avian paramyxovirus type 1 (Newcastle disease virus) 265

isolates by phylogenetic analysis of a partial nucleotide sequence of the fusion 266

protein gene. Avian Pathol 32:239-256. 267


.asm.org/

Dow

nloaded from

http://aem.asm.org/

13

3. Alexander DJ. 1995. The epidemiology and control of avian influenza and 268

Newcastle disease. J Comp Pathol 112:105-126. 269

4. Alexander DJ. 2011. Newcastle disease in the European Union 2000 to 2009. 270

Avian Pathol 40:547-558. 271

5. Alexander DJ, Banks J, Collins MS, Manvell RJ, Frost KM, Speidel EC, 272

Aldous EW. 1999. Antigenic and genetic characterisation of Newcastle disease 273

viruses isolated from outbreaks in domestic fowl and turkeys in Great Britain 274

during 1997. Vet Rec 145:417-421. 275

6. Alexander DJ, Campbell G, Manvell RJ, Collins MS, Parsons G, McNulty 276

MS. 1992. Characterisation of an antigenically unusual virus responsible for two 277

outbreaks of Newcastle disease in the Republic of Ireland in 1990. Vet Rec 278

130:65-68. 279

7. Alexander DJ, Parsons G, Marshall R. 1984. Infection of fowls with Newcastle 280

disease virus by food contaminated with pigeon faeces. Vet Rec 115:601-602. 281

8. Cattoli G, Fusaro A, Monne I, Molia S, Le Menach A, Maregeya B, Nchare 282

A, Bangana I, Maina AG, Koffi JN, Thiam H, Bezeid OE, Salviato A, Nisi R, 283

Terregino C, Capua I. 2010. Emergence of a new genetic lineage of Newcastle 284

disease virus in West and Central Africa--implications for diagnosis and control. 285

Vet Microbiol 142:168-176. 286

9. Collins MS, Strong I, Alexander DJ. 1994. Evaluation of the molecular basis of 287

pathogenicity of the variant Newcastle disease viruses termed "pigeon PMV-1 288

viruses". Arch Virol 134:403-411. 289


.asm.org/

Dow

nloaded from

http://aem.asm.org/

14

10. Diel DG, da Silva LH, Liu H, Wang Z, Miller PJ, Afonso CL. 2012. Genetic 290

diversity of avian paramyxovirus type 1: Proposal for a unified nomenclature and 291

classification system of Newcastle disease virus genotypes. Infect Genet Evol 292

12:1770-1779. 293

11. Gould AR, Kattenbelt JA, Selleck P, Hansson E, Della-Porta A, Westbury 294

HA. 2001. Virulent Newcastle disease in Australia: molecular epidemiological 295

analysis of viruses isolated prior to and during the outbreaks of 1998-2000. Virus 296

Res 77:51-60. 297

12. Irvine RM, Aldous EW, Manvell RJ, Cox WJ, Ceeraz V, Fuller CM, Wood 298

AM, Milne JC, Wilson M, Hepple RG, Hurst A, Sharpe CE, Alexander DJ, 299

Brown IH. 2009. Outbreak of Newcastle disease due to pigeon paramyxovirus 300

type 1 in grey partridges (Perdix perdix) in Scotland in October 2006. Vet Rec 301

165:531-535. 302

13. Jindal N, Chander Y, Chockalingam AK, de Abin M, Redig PT, Goyal SM. 303

2009. Phylogenetic analysis of Newcastle disease viruses isolated from waterfowl 304

in the upper midwest region of the United States. Virol J 6:191. 305

14. Jørgensen PH, Handberg KJ, Ahrens P, Therkildsen OR, Manvell RJ, 306

Alexander DJ. 2004. Strains of avian paramyxovirus type 1 of low pathogenicity 307

for chickens isolated from poultry and wild birds in Denmark. Vet Rec 154:497-308

500. 309

15. Kattenbelt JA, Stevens MP, Selleck PW, Gould AR. 2010. Analysis of 310

Newcastle disease virus quasispecies and factors affecting the emergence of 311

virulent virus. Arch Virol 155:1607-1615. 312


.asm.org/

Dow

nloaded from

http://aem.asm.org/

15

16. Kho CL, Mohd-Azmi ML, Arshad SS, Yusoff K. 2000. Performance of an RT-313

nested PCR ELISA for detection of Newcastle disease virus. J Virol Methods 314

86:71-83. 315

17. Kim BY, Lee DH, Kim MS, Jang JH, Lee YN, Park JK, Yuk SS, Lee JB, 316

Park SY, Choi IS, Song CS. 2012. Exchange of Newcastle disease viruses in 317

Korea: The relatedness of isolates between wild birds, live bird markets, poultry 318

farms and neighboring countries. Infect Genet Evol 12:478-482. 319

18. Kim LM, King DJ, Curry PE, Suarez DL, Swayne DE, Stallknecht DE, 320

Slemons RD, Pedersen JC, Senne DA, Winker K, Afonso CL. 2007. 321

Phylogenetic diversity among low-virulence newcastle disease viruses from 322

waterfowl and shorebirds and comparison of genotype distributions to those of 323

poultry-origin isolates. J Virol 81:12641-12653. 324

19. Kim LM, Suarez DL, Afonso CL. 2008. Detection of a broad range of class I 325

and II Newcastle disease viruses using a multiplex real-time reverse transcription 326

polymerase chain reaction assay. J Vet Diagn Invest 20:414-425. 327

20. Kommers GD, King DJ, Seal BS, Brown CC. 2001. Virulence of pigeon-origin 328

Newcastle disease virus isolates for domestic chickens. Avian Dis 45:906-921. 329

21. Lindh E, Ek-Kommonen C, Vaananen VM, Alasaari J, Vaheri A, Vapalahti 330

O, Huovilainen A. 2012. Molecular epidemiology of outbreak-associated and 331

wild waterfowl- derived Newcastle disease virus strains in Finland, including a 332

novel class I genotype. J Clin Microbiol. 333


.asm.org/

Dow

nloaded from

http://aem.asm.org/

16

22. Lindh E, Huovilainen A, Ratti O, Ek-Kommonen C, Sironen T, Huhtamo E, 334

Poysa H, Vaheri A, Vapalahti O. 2008. Orthomyxo-, paramyxo- and flavivirus 335

infections in wild waterfowl in Finland. Virol J 5:35. 336

23. OIE. 2012. Chapter 2.3.14. - Newcastle disease. In OIE (ed.), Manual of 337

Diagnostic Tests and Vaccines for Terrestrial Animals, 7th ed, 338

http://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2.03.14_NEWCA339

STLE_DIS.pdf. 340

24. Ruenphet S, Jahangir A, Shoham D, Morikawa K, Miyoshi Y, Hanawa E, 341

Okamura M, Nakamura M, Takehara K. 2011. Surveillance and 342

characterization of Newcastle disease viruses isolated from northern pintail (Anas 343

acuta) in Japan during 2006-09. Avian Dis 55:230-235. 344

25. Shengqing Y, Kishida N, Ito H, Kida H, Otsuki K, Kawaoka Y, Ito T. 2002. 345

Generation of velogenic Newcastle disease viruses from a nonpathogenic 346

waterfowl isolate by passaging in chickens. Virology 301:206-211. 347

26. Snoeck CJ, Ducatez MF, Owoade AA, Faleke OO, Alkali BR, Tahita MC, 348

Tarnagda Z, Ouedraogo JB, Maikano I, Mbah PO, Kremer JR, Muller CP. 349

2009. Newcastle disease virus in West Africa: new virulent strains identified in 350

non-commercial farms. Arch Virol 154:47-54. 351

27. Takakuwa H, Ito T, Takada A, Okazaki K, Kida H. 1998. Potentially virulent 352

Newcastle disease viruses are maintained in migratory waterfowl populations. Jpn 353

J Vet Res 45:207-215. 354

28. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011. 355

MEGA5: molecular evolutionary genetics analysis using maximum likelihood, 356


.asm.org/

Dow

nloaded from

http://aem.asm.org/

17

evolutionary distance, and maximum parsimony methods. Mol Biol Evol 357

28:2731-2739. 358

29. Terregino C, Cattoli G, Grossele B, Bertoli E, Tisato E, Capua I. 2003. 359

Characterization of Newcastle disease virus isolates obtained from Eurasian 360

collared doves (Streptopelia decaocto) in Italy. Avian Pathol 32:63-68. 361

30. Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the 362

sensitivity of progressive multiple sequence alignment through sequence 363

weighting, position-specific gap penalties and weight matrix choice. Nucleic 364

Acids Res 22:4673-4680. 365

31. Vidanovic D, Sekler M, Asanin R, Milic N, Nisavic J, Petrovic T, Savic V. 366

2011. Characterization of velogenic Newcastle disease viruses isolated from dead 367

wild birds in Serbia during 2007. J Wildl Dis 47:433-441. 368

32. Wang Z, Liu H, Xu J, Bao J, Zheng D, Sun C, Wei R, Song C, Chen J. 2006. 369

Genotyping of Newcastle disease viruses isolated from 2002 to 2004 in China. 370

Ann N Y Acad Sci 1081:228-239. 371

33. Wehmann O, Herczeg J, Tanyi J, Nagy E, Lomniczi B. 1999. Lentogenic field 372

isolates of Newcastle disease virus isolated in Canada and Hungary are identical 373

with the vaccine type used in the region. Avian Pathol 28:6-12. 374

34. Werner O, Romer-Oberdorfer A, Kollner B, Manvell RJ, Alexander DJ. 375

1999. Characterization of avian paramyxovirus type 1 strains isolated in Germany 376

during 1992 to 1996. Avian Pathol 28:79-88. 377


.asm.org/

Dow

nloaded from

http://aem.asm.org/

18

35. Wu S, Wang W, Yao C, Wang X, Hu S, Cao J, Wu Y, Liu W, Liu X. 2011. 378

Genetic diversity of Newcastle disease viruses isolated from domestic poultry 379

species in Eastern China during 2005-2008. Arch Virol 156:253-261. 380

36. Zanetti F, Berinstein A, Pereda A, Taboga O, Carrillo E. 2005. Molecular 381

characterization and phylogenetic analysis of Newcastle disease virus isolates 382

from healthy wild birds. Avian Dis 49:546-550. 383

37. Zhu W, Dong J, Xie Z, Liu Q, Khan MI. 2010. Phylogenetic and pathogenic 384

analysis of Newcastle disease virus isolated from house sparrow (Passer 385

domesticus) living around poultry farm in southern China. Virus Genes 40:231-386

235. 387

388

389

390


.asm.org/

Dow

nloaded from

http://aem.asm.org/

19

Figure legends 391

FIG 1 Geographic distribution of collected samples by municipalities in Luxembourg. 392

The shading corresponds to the number of samples collected per municipalities. The 393

numbers indicate the origin of the following isolates: 1) duck/Luxembourg/26/2006 and 394

pigeon/Luxembourg/119/2006; 2) great cormorant/Luxembourg/2547/2006; 3) 395

chicken/Luxembourg/2871-18/2007; 4) duck/Luxembourg/3785/2007 and 396

duck/Luxembourg/3786/2007; 5) pigeon/Luxembourg/3821-1/2007; 6) 397

mallard/Luxembourg/4178/2008. The strain pigeon/Luxembourg/2657-2/2006 originated 398

from an animal rescued at the animal wildlife shelter in Dudelange (7). Template map © 399

Origine Cadastre: Droits Reserves a l’Etat de Grand-Duche de Luxembourg (2012). 400

401

FIG 2 Phylogenetic analysis of partial F gene sequences based on nucleotides 332–571. 402

Sequences generated in this study are indicated by the symbols ● (strains presented in 403

Fig. 1 and Fig. 2) and ■ (strains presented in Fig. 1 only). Previously published sequences 404

are indicated with their accession numbers. Only bootstrap values ≥ 50% are shown. The 405

scale corresponds to number of base substitutions per site. 406

407

FIG 3 Phylogenetic analysis of complete F gene sequences (1662 nt). Symbols are as in 408

Fig. 1. Only bootstrap values ≥ 50% are shown. The scale corresponds to number of base 409

substitutions per site.410


.asm.org/

Dow

nloaded from

http://aem.asm.org/

20

Tables 411

Table 1: Sequences of primers used to amplify and sequence partial or full F genes. 412

413 Primer Orientation Sequence (5’ – 3’) Localization Reference FOP1 Forward TACACCTCATCCCAGACAGGGTC F gene (16) FOP2 Reverse AGGCAGGGGAAGTGATTTGTGGC F gene (16) FIP1 Forward TACTTTGCTCACCCCCCTT F gene (16) FIP2 Reverse CATCTTCCCAACTGCCACT F gene (16) M610 Forward CTGTACAATCTTGCGCTCAATGTC M gene (1)

P1 Forward ATGGGCYCCAGAYCTTCTAC F gene (32) F581 Reverse CTGCCACTGCTAGTTGTGATAATCC F gene (1)

F-4639f Forward TGAYGGCAGGCCTCTT F gene this study F-4932f Forward CAACCGCTGCACAGATAA F gene this study F-4954f Forward AGCTGCGGCYCTRATACAA F gene this study F-5042f Forward GAGGTCACYGACGGATTAT F gene this study F-5488f Forward TCAGCACTTGTCCCAAA F gene this study

F-1258-R Reverse ACATTGCATGAWTGTCTRTC F gene (8) F-5566r Reverse CAGTATGAGGTGTCAAGTT F gene this study F-5749f Forward AGACCCTCCAGGYATCA F gene this study F-5888f Forward GGCTCAGTGGGGAAT F gene this study F-6086f Forward GGTACACTTAGCCTGRTHTT F gene this study F-6146r Reverse CTTYTGTTGCGCCTTT F gene this study

F-7979-R Reverse AGRGCCACYTGCTTRTATA HN gene (8)

414 415


.asm.org/

Dow

nloaded from

http://aem.asm.org/

21

Table 2: List of sampled domestic and wild bird species in Luxembourg between 2006 416

and 2010 tested for class I and class II and genotype (G-) classification of positive 417

samples. 418

419

Family No. positives/ No. tested for

class II

No. positives/ No. tested for

class I

Yearly distribution

2006 2007 2008

Phasianidae a 1/125 0/62 1x G-II Anatidae 4/340 0/92 1x G-II 2x G-I 1x G-I

Phalacrocoracidae 1/3 0/1 1x G-II Ardeidae 0/13 0/2

Accipitridae 0/135 0/7 Falconidae 0/26 0/6

Rallidae 0/52 0/4 Laridae 0/8 -

Columbidae 3/59 0/11 2x G-VI 1x G-VI Psittacidae b 0/3 0/3

Strigidae 0/12 0/1 Tytonidae 0/14 0/1 Picidae 0/5 0/1

Corvidae 0/20 0/3 Paridae 0/5 0/2

Hirundinidae 0/9 0/9 Phylloscopidae 0/5 0/2 Acrocephalidae 0/42 0/32 Locustellidae 0/4 0/3

Sylviidae 0/95 0/37 Sturnidae 0/7 - Turdidae 0/21 0/15

Muscicapidae 0/9 0/4 Passeridae 0/42 - Prunellidae 0/2 0/1 Motacillidae 0/4 - Fringillidae 0/1 0/1 Emberizidae 0/4 0/3

Undetermined 0/66 0/42 Total 9/1131 0/345 4/619 4/349 1/84

a domestic species including chicken, turkey, quail, peafowl and pheasant; b exotic species 420


.asm.org/

Dow

nloaded from

http://aem.asm.org/

0 10 205 Kilometers

0

1 to 10

11 to 50

> 50

1

2

3

7

46

5


.asm.org/

Dow

nloaded from

http://aem.asm.org/

VI

II

X

I

Class I

JX844035 pigeon/Finland/17557/2008pigeon/Luxembourg/2657-2/2006

JN986839 pigeon/IE/806/04AJ306304 pigeon/France/99299/1999

JN941997 Pigeon/Florida/2181-43/2008pigeon/Luxembourg/119/2006

GU002430 pigeon/Slovenia/SLO-263/2004AJ306305 pigeon/France/99106/1999AY288996 pigeon/Italy/1166/00GU002440 blackbird/Slovenia/SLO-12/2006HM748948 chicken/China/SD5/2008

JN872162 Rosella/Belgium/4940/08FJ766527 pigeon/China/JS/07/16/Pi/2007

HM063425 pigeon/China/P4/2003EF026584 pigeon/Belgium/248 VB/1998

AY208697 pigeon/China/HLJ-4/2002GU002428 pigeon/Slovenia/SLO-17/2004

pigeon/Luxembourg/3821-1/2007HM625835 duck/China/SS/2008

GU551934 carrier-pigeon/Guangdong/2008JX844036 pigeon/Finland/15475/2009

JN872160 Pigeon/Minnesota/511296/07AY034799 pigeon/Finland/Fin-96c/1996

JN872183 Pigeon/Maryland/2075/1998EU477192 Eurasian collared dove/US/TX4156/2005JN872170 Pigeon/Texas/5254-12/2010

JN638235 dove/Italy/11RS100_104VIR/2011AY734535 Pigeon/Argentina/Tigre 6/99

JN967787 Pigeon/Illinois/37397/1987JN967788 Pigeon/Maryland/11936/1985FJ410145 New York/1984

AB465606 Japan/Ibaraki/85FJ772475 chicken/Niger/2602-605/2008 --- XIV

JN627508 goose/China/GD450/2011 --- XIIAF458011 chicken/China/XJ-2-97/1997 --- XVAF358786 fowl/Taiwan/TW/2000/2000 --- VII

AY865652 Sterna/Astr/2755/2001 --- XIIIAF048763 chicken/Malaysia/AF2240/1960 --- VIII

FJ705462 cormorant/US(WI)/18719-03/2003 --- VFJ436302 chicken/China/F48E8/1946 --- IX

HQ266604 chicken/Madagascar/MG_MEOLA_08/2008 --- XIEF201805 India/Mukteswar --- III

AY741404 Herts/33 --- IVJX482549 seafowl/China/H5/2011

chicken/Luxembourg/2871-18/2007JX482548 seafowl/China/H1/2011DQ227250 penguin/Beijing/QE01/1999AY359876 parrot/India/NDVCUL97JN872150 B1AJ415880 pigeon/France/99143/1999AY845400 LaSotaFJ938171 sparrow/Guangxi/NN10/2007AY727883 flamingo/Argentina/88T.00/2000

great cormorant/Luxembourg/2547/2006duck/Luxembourg/26/2006

GQ901891 parrot/Malaysia/MB061/06/2006AY390314 pigeon/China/PK9910

HM001217 penguin/China/QBJ-00/2000AY130863 yellow nape parrot/U.S.(PA)/22027/96

JN942033 Avian/Chile/37646/1996FJ939313 Chicken/Egypt/1/2005

X04719 BeaudetteGQ288390 mallard/US(MN)/00-32/2000AY727881 duck/Argentina/32C/T.98/1998

AY562991 chicken/N. Ireland/Ulster/1967M24693 QueenslandV4/66

AY427817 Heb02AY935499 I-2

DQ097394 PHY-LMV42/HungaryEF564817 ruddy turnstone/US(DE)/492/2002

AY965077 Anas/FarEast/3658/2002FJ597613 duck/China/D_ZJ_1_04/2004JN872169 Pennsylvania/3167/2009FJ597609 duck/China/D_JS_51_05/2005JX844031 pheasant/Finland/7775/2003

JX844039 mallard/Finland/8803/2009FJ597606 duck/China/D_JS_40_05/2005

HM063424 Rallus aquaticus/China/R8/2005JX844041 teal/Finland/10666/2009

FJ597617 duck/China/D_HN_34_05/2005FJ597615 duck/China/D_ZJ_3_04/2005FJ597604 duck/China/D_AH_6_04/2004

JX844048 mallard/Finland/8768/2010EU256542 Muskovy duck/Ukraine/14/2005

AY972103 Duck/FarEast/2687/2001JX844053 mallard/Finland/9149/2010

AY972101 Anas/FarEast/3652/2002JX844040 Eurasian wigeon/Finland/9067/2009

AY965079 duck/FarEast/2713/2001EU493450 teal/Finland/12074/2006

JX844043 Eurasian_wigeon/Finland/8625/2010JX844058 mallard/Finland/10541/2010

mallard/Luxembourg/4178/2008duck/Luxembourg/3786/2007duck/Luxembourg/3785/2007

JX844056 mallard/Finland/9360/2010EU493453 teal/Finland/12136/2006

AB524405 Goose/Alaska/415/91

98

87

99

61

69

51

6053

58

71

69

8499

54

5283

62

89

7063

67

75

92

64

60

51

86

0.05

Class II


.asm.org/

Dow

nloaded from

http://aem.asm.org/

pigeon/Luxembourg/119/2006

JN872166 Dove/Italy/VIR 24/2008

AY288996 pigeon/Italy/1166/00

JN986839 pigeon/IE/806/04

JN941997 Pigeon/Florida/2181-43/2008

pigeon/Luxembourg/3821-1/2007

EF026584 pigeon/Belgium/248 VB/1998

HM625835 duck/China/SS/2008

HM063425 pigeon/China/P4/2003

HM748948 chicken/China/SD5/2008

GU551934 carrier-pigeon/Guangdong/2008

FJ766527 pigeon/China/JS/07/16/Pi/2007

JN872162 Rosella/Belgium/4940/08

JN872183 Pigeon/Maryland/2075/1998

JN872170 Pigeon/Texas/5254-12/2010

JN872160 Pigeon/Minnesota/511296/07

JN967787 Pigeon/Illinois/37397/1987

AY734535 Pigeon/Argentina/Tigre 6/99

JN967788 Pigeon/Maryland/11936/1985

FJ410145 New York/1984

AY845400 LaSota

X04719 Beaudette

JQ029740 duck/China/SDFC07/2011

AY427817 Heb02

AY935499 I-2

EF564817 ruddy turnstone/US(DE)/492/2002

DQ097394 PHY-LMV42/Hungary

AY562991 chicken/N. Ireland/Ulster/67

JN872169 Pennsylvania/3167/2009

AY965077 Anas/FarEast/3658/2002

FJ597609 duck/China/D_JS_51_05/2005

FJ597617 duck/China/D_HN_34_05/2005

FJ597615 duck/China/D_ZJ_3_04/2005

AY972103 Duck/FarEast/2687/2001

AY965079 duck/FarEast/2713/2001

FJ597604 duck/China/D_AH_6_04/2004

HM063424 Rallus aquaticus/China/R8/2005

mallard/Luxembourg/4178/2007

duck/Luxembourg/3786/2007

duck/Luxembourg/3785/2007

AB524405 Goose/Alaska/415/91

100

9999

98

69

100

8986

82

100

99

10069

99

100

9599

99

94

70

69

81

56

53

94

0.05

I

Class I

Class II

VI

II


.asm.org/

Dow

nloaded from

http://aem.asm.org/

characterization of newcastle disease viruses in wild 2...

Documents