Novel Rickettsiella Bacterium in the Leafhopper Orosius albicinctus(Hemiptera: Cicadellidae)

Lilach Iasur-Kruh,a,b Phyllis G. Weintraub,c Netta Mozes-Daube,a Wyatt E. Robinson,d Steve J. Perlman,d Einat Zchori-Feina

Department of Entomology, Newe Ya’ar Research Center, Agricultural Research Organization, Ramat Yishay, Israela; Department of Biology, Technion, Haifa, Israelb;Department of Entomology, Gilat Research Center, Agricultural Research Organization, Negev, Israelc; Department of Biology, University of Victoria, Victoria, BritishColumbia, Canadad

Bacteria in the genus Rickettsiella (Coxiellaceae), which are mainly known as arthropod pathogens, are emerging as excellentmodels to study transitions between mutualism and pathogenicity. The current report characterizes a novel Rickettsiella foundin the leafhopper Orosius albicinctus (Hemiptera: Cicadellidae), a major vector of phytoplasma diseases in Europe and Asia. De-naturing gradient gel electrophoresis (DGGE) and pyrosequencing were used to survey the main symbionts of O. albicinctus,revealing the obligate symbionts Sulcia and Nasuia, and the facultative symbionts Arsenophonus and Wolbachia, in addition toRickettsiella. The leafhopper Rickettsiella is allied with bacteria found in ticks. Screening O. albicinctus from the field showedthat Rickettsiella is highly prevalent, with over 60% of individuals infected. A stable Rickettsiella infection was maintained in aleafhopper laboratory colony for at least 10 generations, and fluorescence microscopy localized bacteria to accessory glands ofthe female reproductive tract, suggesting that the bacterium is vertically transmitted. Future studies will be needed to examinehow Rickettsiella affects host fitess and its ability to vector phytopathogens.

Insects harbor a great diversity of facultative bacterial endosym-bionts, many of which are transmitted primarily from females to

their offspring (1), and it is now clear that these are major playersin the ecology and evolution of their hosts (2). Because they arecryptic and often cannot be cultivated, these endosymbionts wereuntil recently very poorly studied; molecular biology and geno-mics have enabled major advances in this field. Both biased andunbiased surveys of symbionts of arthropods have uncovered 5major facultative bacterial endosymbiont lineages, Wolbachia,Rickettsia, Cardinium, Spiroplasma, and Arsenophonus, which areextremely widespread and successful across terrestrial arthropods(3). However, most insect endosymbionts have not been de-scribed, much less understood, and novel lineages are still beingdiscovered (2).

One of the most important findings that has come from themolecular and genomic study of insect endosymbionts is thatthere are often very close links between mutualists and pathogens.This is reflected in two important ways. First, many lineages ofbacteria, such as Spiroplasma, Serratia, and bacterial endosymbi-ont of the leafhopper Euscelidius variegatus (BEV), are often com-prised of very closely related pathogens and mutualists (4–6). Sec-ond, symbionts and pathogens often use the same machinery toinfect and affect their hosts, with perhaps the best-characterizedexample being the use of type III secretion systems to enter andalter host cells (7, 8). A major unresolved question is what medi-ates transitions between symbiosis and pathogenicity in these lin-eages.

A very promising lineage in which to study evolutionary tran-sitions between symbiosis and pathogenicity is Rickettsiella. Thisgenus comprises a poorly studied group of intracellular bacteria inthe gammaproteobacteria, closely related to Legionella and Cox-iella (9–11). Almost all known Rickettsiella are arthropod patho-gens, including bacteria that cause diseases in beetles, moths, iso-pods, and crickets (as reviewed by Bouchon et al. [12]). Unbiasedmolecular surveys of bacterial associates of diverse arthropodshave also uncovered Rickettsiella (13, 14), suggesting that these

bacteria may be far more widespread and important than previ-ously appreciated. The only nonpathogenic Rickettsiella charac-terized in detail is the one found in Acyrthosiphon pisum peaaphids. This bacterium infects �8% of A. pisum in western Eu-rope and has been shown to change the body color of its hostsfrom red to green (15), a modification that has been hypothesizedto reduce predation, although this has not yet been demonstrated.A recent study also showed that Rickettsiella protects pea aphidsagainst pathogenic fungi by reducing aphid mortality and fungalsporulation (16).

This paper reports the discovery and characterization of a Rick-ettsiella infecting the leafhopper Orosius albicinctus (Hemiptera:Cicadellidae) as part of an effort to identify its bacterial endosym-bionts. This insect is a major agricultural pest, as it is a commonand established vector of phytoplasma in Europe and the MiddleEast, including strains that cause the diseases sesamum phyllody,Lucerne witches’ broom, purple top, and more (17). One of thelong-term goals of this work is to identify symbionts that mightinterfere with the transmission of phytoplasma. To this end, thispaper reports the results of unbiased surveys to characterize thesymbionts of O. albicinctus as well as characterization of Rickettsi-ella through screening of insects in the field, phylogenetic analysis,and tissue localization using fluorescence in situ hybridization(FISH).

MATERIALS AND METHODSInsect origin and maintenance. Individuals of Orosius albicinctus,Anaceratagallia laevis, and Psammotettix (all belonging to the hemipteran

Received 12 March 2013 Accepted 26 April 2013

Published ahead of print 3 May 2013

Address correspondence to Einat Zchori-Fein, einat@agri.gov.il.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.00721-13

4246 aem.asm.org Applied and Environmental Microbiology p. 4246–4252 July 2013 Volume 79 Number 14

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 22

Nov

embe

r 20

21 b

y 1.

245.

225.

3.

family Cicadellidae) were collected from carrot (Daucus carota) fields intwo locations in the Negev desert in Israel (Kibbutz Alumim[31°26=46.00�N, 34°30=37.97�E] and Shoket Junction [31°18=19.92�N,34°53=17.37�E]) by vacuum sampling in October 2008 and April 2009. Alaboratory colony of O. albicinctus was established from about 200 indi-viduals vacuum collected from mint (Mentha spicata) plants at the B’sorResearch and Development farm (31°16=15.17�N, 34°23=12.53�E) in Jan-uary 2011. Leafhoppers were reared using a light/dark regimen of 13 h:11h at 25 � 2°C, with common bean plants (Phaseolus vulgaris) as a food andreproductive source.

Initial unbiased surveys of Orosius albicinctus using DGGE. In orderto determine host bacterial community composition, DGGE was per-formed on 10 individuals collected from the above-mentioned carrotfields using previously described methods (18). Each individual insect wasground in lysis buffer (19) and incubated at 65°C for 15 min and then at95°C for 10 min. DNA was kept at �4°C until further use. PCR wasperformed using general 16S rRNA bacterial primers (B341F and B907R;Table 1), and product separation was conducted on a 6% (wt/vol) acryl-amide gel with a denaturing gradient ranging from 20% to 60% urea-formamide by electrophoresis at 90 V and 60°C for 16 h. After electropho-resis, the gels were incubated in ethidium bromide solution (250 ng/ml)for 10 min, rinsed in distilled water, and photographed under UV illumi-nation. DNA was eluted from the DGGE bands and cloned into the pGEMT-Easy plasmid vector (Promega Corp., Madison, WI) and transformedinto Escherichia coli. For each band, two colonies were randomly pickedand sequenced (ABI 3700 DNA analyzer; Macrogen, Inc., South Korea),and the sequences obtained were compared to known sequences by usingthe BLAST algorithm (24) in the NCBI database. DGGE patterns con-sisted of both dominant and weak bands; the latter could not be sequencedproperly. Therefore, mass sequencing (pyrosequencing) of 16S rRNAPCR products was performed in order to obtain an additional picture ofthe bacteria inhabiting the insect.

454 pyrosequencing. For pyrosequencing, DNA was extracted, as de-scribed by Chen et al. (25), from 20 individual O. albicinctus laboratorycolonies; these had been maintained for at least 10 generations. Briefly,each individual insect was ground in SDS buffer and then incubated at37°C for 1 h with RNase (Applied Biosystems, Carlsbad, CA) and then at50°C for 1 h with proteinase K solution (Sigma). The homogenate wasthen extracted with phenol-chloroform-isoamyl alcohol (25:24:1) andcentrifuged at 12,000 � g for 10 min. To precipitate DNA, 500 �l of chilledabsolute ethanol (EtOH) was added, and the tube was centrifuged at12,000 � g for 15 min. The pellet was washed twice with 500 �l of 70%ethanol and centrifuged, under the conditions described above, for 3 minto remove residual salt. The pellet was dried at 37°C for 30 min andresuspended in double-distilled water. The DNA extracted from all O.albicinctus individuals was pooled, and a 25-�l aliquot (DNA concentra-

tion, 20 ng/�l) was sent to the Research and Testing Laboratory (Lubbock,TX) for mass sequencing. Pyrosequencing was performed using the Roche454 sequencing system as previously described (26) and the primers 27Fand 519R, targeting the bacterial 16S rRNA gene. Retrieved sequenceswere analyzed using mothur software (http://www.mothur.org/). Se-quences shorter than 200 bp, as well as those of low quality (multiple N,chimeras, etc.), were omitted. Sequences were aligned using the Silvacompatible alignment database, and a distance matrix was calculated. Se-quences were grouped into operational taxonomic units (OTUs) at a 97%sequence similarity threshold (i.e., sequences that differ by �3% are clus-tered in the same OTU). Representatives of each OTU were classified withmothur, and their affiliation, down to the genus level, was verified byNCBI GenBank databases.

Prevalence of Rickettsiella and Arsenophonus in the field. Both theDGGE and pyrosequencing analyses revealed the presence of severalknown bacterial symbionts, including Arsenophonus. In order to test for apossible association between that bacterium and Rickettsiella, their prev-alences in 200 O. albicinctus individuals (100 males and 100 females) col-lected from mint screen houses at the Israeli Negev desert in January 2011were determined. In addition, 10 A. laevis and 10 Psammotettix individu-als that were collected at the same time as O. albicinctus from the carrotfields mentioned above were screened. Specimens were preserved in 96%ethanol for DNA extraction with lysis buffer (19) and subsequent screen-ing, using PCR with symbiont-specific diagnostic primers (primer pairRicO F and RicO R and primer pair ArsF and ArsR; Table 1). PCRs werecarried out in 25-�l volumes each containing 3 �l of the template DNAlysate, a 10 pM concentration of each primer, 0.2 mM deoxynucleosidetriphosphates (dNTPs), 1� RedTaq buffer, and 1 U of RedTaq DNA poly-merase (Sigma-Aldrich, Israel). The PCR program was carried out with aninitial denaturation step of 95°C for 4 min followed by 35 cycles of dena-turation at 95°C for 30 s, annealing at the primer-specific temperature(Table 1) for 30 s, and elongation at 72°C for 30 s. The cycle was completedwith a final elongation step at 72°C for 10 min. PCR products were visu-alized on a 1.2% agarose gel containing ethidium bromide. In order toverify the product identity, bands were eluted, cloned into the pGEMT-Easy plasmid vector, and transformed into E. coli. For each clonedproduct, two colonies were randomly picked and sequenced as describedabove. For samples that failed to amplify, an additional PCR was per-formed using primers that target the leafhopper nutritional symbiont Sul-cia and symbiont-specific diagnostic primers (SulO F and SulO R; Table1) as a positive control for DNA quality.

Phylogenetic analysis of leafhopper Rickettsiella. Specific primersfor Rickettsiella, designed based on the sequence obtained from DGGEanalyses and combined with general bacterial primers (primer pair RicO Fand 1513R and primer pair 27F and RicO R; Table 1), were used in orderto sequence nearly the full 16S rRNA gene (�1,500 bp) of the bacterium.

TABLE 1 PCR primers and conditions used in the study

Primername Target gene

Ta

(°C)a

Productsize (bp) Primer sequence Sequence for FISH

Source orreference(s)

RicO F Rickettsiella (16SrRNA)

66 404 GGTGGGGAAGAAAGGTAACG This study

RicO R GCCCCACACCTCACAGCTAG 5=Cy5-CTAGCTGTGAGGTGTGGGGC This studySulO F Sulcia (16S rRNA) 50 418 GAATAAAAAATTCTAATTATGG This studySulO R CACTTTCGCTTAACCACTG 5=Cy3-CAGTGGTTAAGCGAAAGTG 20B341F General Bacteria

(16S rRNA)60 550 CGCCCGCCGCGCCCCGCGCCCGTCCCGCCG

CCCCCGCCCGCCTACGGGAGGCAGCAG21, 22

B907R CCGTCAATTCMTTTGAGTTT 2127F General Bacteria

(16S rRNA)57 1,480 AGAGTTTGATCMTGGCTCAG 23

1513R ACGGYTACCTTGTTACGACTT 23Ars F Arsenophonus (23S) 62 600 CGTTTGATGAATTCATAGTCAAAArs R GGTCCTCCAGTTAGTGTTACCCAAC 50a Ta, annealing temperature.

Rickettsiella in the Leafhopper Orosius albicinctus

July 2013 Volume 79 Number 14 aem.asm.org 4247

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 22

Nov

embe

r 20

21 b

y 1.

245.

225.

3.

Phylogenetic analysis was performed using a data set of 16S rRNA genesequences from diverse allied bacteria, including Rickettsiella, Diplorick-ettsia, and Coxiella, downloaded from the NCBI database. Sequences wereorganized using Geneious v5.5.4 (Biomatters, Auckland, New Zealand)and aligned with the MUSCLE plug-in (27). The alignment was importedinto MEGA v5.0 (28), and Modeltest (29) was used to determine the mostappropriate nucleotide substitution model for phylogeny reconstructionusing maximum likelihood. Node support was assessed using 1,000 boot-strap iterations. Branches with less than 50% bootstrap support were col-lapsed.

Vertical transmission of Rickettsiella. In order to assess the potentialfor vertical transmission of Rickettsiella in O. albicinctus, fluorescence insitu hybridization (FISH) was performed on adult female reproductivetracts, which were dissected in a drop of saline buffer (9 g/liter NaCl) withthe aid of a dissecting microscope. The procedure of FISH generally fol-lowed the method of Sakurai et al. (30), with slight modifications. Thedissected ovaries were transferred into Carnoy’s fixative for 1 h at roomtemperature, transferred to 96% EtOH, and then submerged in hybrid-ization buffer. A 10-pmol volume of either Rickettsiella or Sulcia fluores-cent probes (Table 1) was added to the hybridization buffer for 2 to 4 hbefore material was mounted on microscope slides in the probe-buffersolution. Stained samples were viewed under an IX81 Olympus FluoView500 confocal microscope. Negative controls were performed by using ano-probe sample. Rickettsiella probe specificity was confirmed by the useof primer3 software in combination with the NCBI database. In addition,the sequence of this probe was aligned with sequences of each of the 21most abundant bacterial species identified by the pyrosequencing analy-sis, obtained from the NCBI nr database. With the exception of Diplorick-ettsia, to which a complete match was found, less than a 50% sequencematch to each of these bacteria was determined.

Nucleotide sequence accession numbers. Sequences obtainedfrom DGGE analysis were deposited in GenBank (accession numbersKC764412 to KC764414). All sequences obtained from the 454 analysiswere deposited in the Sequence Read Archive (ERP002360).

RESULTSDGGE and 454 pyrosequencing. Three bacteria were identifiedby DGGE analysis of field-caught O. albicinctus (Fig. 1). There wasone dominant band for all individuals, which corresponded toSulcia and showed 98% similarity to a band corresponding to the16S rRNA gene sequence of Sulcia muelleri originating from theleafhopper Matsumuratettix hiroglyphicus (GenBank accession

no. JQ898318.1). Two additional bands corresponded to Arseno-phonus (99% similar to the 16S rRNA sequence of the symbiont ofthe whitefly Trialeurodes hutchingsi; GenBank accession no.AY587140) and Rickettsiella (99% similar to the 16S rRNA se-quence of the bacterium Diplorickettsia massiliensis and 94% sim-ilar to Rickettsiella sp. clone A03-05G; GenBank accession no.GQ857549 and FJ542836.1, respectively). Rickettsiella and Arseno-phonus were present in 6 of 10 individuals screened by DGGE.

454 pyrosequencing yielded a total of 3,874 high-quality bac-terial 16S rRNA sequences, ranging from 253 to 435 nucleotides inlength, obtained from O. albicinctus that was maintained at thelaboratory colony for 10 generations. These sequences were as-signed to 149 OTUs at 97% sequence similarity. The most abun-dant bacterium in the data set was Rickettsiella (828 reads). Ar-senophonus was the third-most-abundant bacterium (503 reads).Three other known bacterial symbionts were present in the dataset, including the obligate nutritional symbionts of leafhoppers,Sulcia (17 sequences; the 21st-most-abundant bacterium), andNasuia (18 sequences; the 20th-most-abundant bacterium).There were also 53 reads corresponding to Wolbachia (10th mostabundant). Rounding out the remaining six most abundant bac-teria were Kocuria (650 sequence; 2nd most abundant), Bergeyella(391 sequences; 4th most abundant), Hydrogenophaga (340 se-quences; 5th most abundant), and Flavobacterium (179 sequences;6th most abundant).

Prevalence of Rickettsiella and Arsenophonus in the field. Atotal of 64 of 100 field-caught O. albicinctus females and 65 of 100males carried Rickettsiella, while only 21 of 100 females and 18 of100 males were infected with Arsenophonus. Of these, 54% of theinsects were positive only for Rickettsiella, 9% only for Arsenopho-nus, and 9% for both bacteria, suggesting that there is no statisti-cally significant association between these two facultative symbi-onts (P � 0.0874, two-tailed Fisher’s exact test). NeitherRickettsiella nor Arsenophonus could be detected in the two otherleafhopper species tested.

Phylogenetic analysis of leafhopper Rickettsiella. A nearlyfull-length portion (1,530 bp) of leafhopper Rickettsiella 16SrRNA was obtained. Maximum-likelihood phylogenetic analysiswas performed, using a Kimura 2-parameter model with a gamma-distributed heterogeneity rate of nucleotide substitution (Fig. 2).The bacterium is nested within Rickettsiella and allied bacteria andappears to be closely affiliated with bacteria that were recentlyisolated from Ixodes ticks and placed in a new genus calledDiplorickettsia (see Discussion below).

Vertical transmission of Rickettsiella. FISH of O. albicinctusovaries showed that Sulcia is found in bacteriocytes located at theposterior end of the oocyte (Fig. 3D and E). In contrast, Rickettsi-ella was not detected in the oocyte. However, high densities of thissecondary symbiont were seen in the accessory gland of the repro-ductive tract (Fig. 3A to C), where the bacteria seemed to be accu-mulated in vacuoles (Fig. 3C).

DISCUSSION

The discovery of a Rickettsiella infecting O. albicinctus leafhoppersat high frequency is reported. The bacterium appears to be closelyallied to a newly discovered intracellular bacterium infectingIxodes ticks that was recently designated a new genus, Diplorick-ettsia (31). Designation as a new genus was motivated by two mainfindings. First, electron microscopy of Diplorickettsia maintainedin a tick cell line revealed a distinct morphology, with bacteria

FIG 1 DGGE analysis of 16S rRNA gene fragments, showing the bacterialcommunity composition of Orosius albicinctus collected from carrot. Themarked bands exhibited similarity to those of the 16S rRNA genes of Sulcia(98%), Arsenophonus (99%), and Rickettsiella (94%).

Iasur-Kruh et al.

4248 aem.asm.org Applied and Environmental Microbiology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 22

Nov

embe

r 20

21 b

y 1.

245.

225.

3.

being found primarily grouped in pairs. Second, the sequencedetermined for the tick bacterium was only 93% similar to theclosest 16S rRNA sequences in the database (i.e., Rickettsiella).However, although many bacterial genera exhibit a divergence ofgreater than 95% for 16S rRNA, it is difficult to define generabased on definitive cutoff values, and there are many exceptions(as reviewed by Clarridge [32]); the designation of a new genusmay be also premature, as Diplorickettsia may be nested withinRickettsiella (33). The leafhopper symbiont is therefore referred tohere as Rickettsiella, and it will be interesting to determine whetherit is also predominantly found in pairs. Sequencing multiple genesfrom many more Rickettsiella strains, including the one infectingO. albicinctus, will also help resolve the status of Diplorickettsia.

Although Rickettsiella, Arsenophonus, and Sulcia were identi-fied by both DGGE and 454 pyrosequencing methods, Nasuia andWolbachia were found only in the pyrosequencing survey, high-lighting the importance of using multiple methods to describesymbiont communities. Among sap-feeding Hemiptera, virtuallyall Auchenorryncha harbor two lineages of obligate symbionts,termed coprimary symbionts, that complement each other andprovide essential amino acids and vitamins that are missing fromplant sap. One of these coprimary nutritional symbionts is almostalways Sulcia (20), while the second member is more variable andis associated with more recently evolved lineages within Auchen-orryncha. Examples of coprimary symbionts of Sulcia include Vi-dania in planthoppers (34), Hodgkinia in cicadas (35), Zinderia inspittlebugs (36), and Baumannia in sharpshooters and allies (37).The coprimary symbiont in deltocephaline leafhoppers, of whichO. albicinctus is a member, was recently identified as a novel lin-eage in the betaproteobacteria and named Nasuia (38, 39). It is

possible that Nasuia, Wolbachia, and other bacteria which werefound in the pyrosequencing analysis were represented by weakbands in the DGGE gel and, therefore, that we were not able tosequence them. Both the DGGE and pyrosequencing screens alsoidentified Arsenophonus as an abundant symbiont in O. albicinc-tus. Arsenophonus, a very common facultative inherited symbiontof terrestrial arthropods, was found to infect �4% of arthropodspecies in a recent large screening study of 136 species in 15orders (3); Hemiptera, including leafhoppers, are commonlyinfected (3, 40).

Rickettsiella are primarily known as intracellular pathogens ofarthropods, causing visible symptoms, and are lethal to their hosts(12); until now, only one nonpathogenic strain, a symbiont of peaaphids, has been characterized in detail (15, 16). The work pre-sented here serves as a useful comparison of intracellular patho-gens and nonpathogens, which, in addition to differing in theireffects on host fitness, are expected to differ in prevalence in thefield, tissue specificity, growth regulation, and mode of transmis-sion. The prevalence of Rickettsiella in O. albicinctus was surpris-ingly high, with over 60% of individuals from a field sample in-fected. This is much higher than the prevalence of Rickettsiella inpea aphids, which has been reported to be �8% (15). Little isknown about the prevalence of pathogenic Rickettsiella; insectpathogen abundance can be notoriously difficult to quantify in thefield. For example, in a survey of potential pathogens of Agrioteswireworm beetle pests, of 3,420 individuals reared and screenedfor disease, only 1 was identified as harboring a new Rickettsiellapathotype (41). Molecular detection of Rickettsia, Coxiella, andRickettsiella DNA in three native Australian tick species identifiedthe presence of three Rickettsiella genotypes in only three Ixodes

FIG 2 Maximum-likelihood phylogenetic tree constructed using a Kimura 2-parameter � model of nucleotide substitution and a nearly full-length 16S rRNAsequence. Designations of known hosts are presented in parentheses. Only bootstrap values of more than 50% are shown. The scale bar shows 0.05 substitutionsper base.

Rickettsiella in the Leafhopper Orosius albicinctus

July 2013 Volume 79 Number 14 aem.asm.org 4249

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 22

Nov

embe

r 20

21 b

y 1.

245.

225.

3.

tasmani male samples (representing 8 individuals together). Theother 34 I. tasmani individuals sampled, as well as two additionaltick species (Bothriocroton concolor and Bothriocroton aurugin-ans), were negative for Rickettsiella. The virulence factors, if any, ofRickettsiella genotypes detected on the tick host remained un-known in this study (42).

Nonpathogenic intracellular bacteria are also expected to growmuch more slowly in their hosts and to be restricted to specifictissues. Indeed, the FISH analysis showed that within the ovaries,Rickettsiella can be seen only in the accessory glands. More-de-tailed FISH studies will be required to determine if the leafhopperRickettsiella is more restricted in its localization than the pea aphidRickettsiella, which was observed in sheath cells, oenocytes, andspecialized cells, termed secondary bacteriocytes, in ovaries andembryos (15). Additionally, the presence of that symbiont in othertissues may shed more light on possible differences between thebacteria found in various hosts, because the aphid Rickettsiella, for

example, was found to be located both intra- and extracellularlyand is abundant in hemolymph.

The presence of Rickettsiella in pea aphid ovaries and embryoshighlights a key evolutionary transition observed in many benefi-cial insect endosymbionts—the ability to be transmitted frommothers to their offspring with high efficiency. This contrasts withpathogenic Rickettsiella, which is transmitted horizontally, infect-ing new hosts in the soil (12).

In the current study, Rickettsiella bacteria were not observed inO. albicinctus oocytes, so it is not clear whether (and if so, how)they are maternally inherited. Future experiments will be requiredto confirm and quantify vertical transmission. Interestingly, Rick-ettsiella was abundant in ovarian accessory glands. Although sim-ilar accessory glands have been described in other cicadellids (43–45), little is known about them. In other insects, ovarian accessoryglands often provide protective coatings or adhesive secretions foreggs (46, 47). This raises the possibility that Rickettsiella is secreted

FIG 3 Location of Rickettsiella (blue) and Sulcia (red) in Orosius. FISH images of the O. albicinctus reproductive tract, including the accessory gland (ag) at theend of the ovary, which is where oocyte (ooc) production and maturation into eggs take place, are shown. Rickettsiella was detected in the accessory gland of thereproductive tract (A to C), while Sulcia was detected in oocytes (D and E). Bars represent 200 �m (A, B, and E) or 20 �m (C and D) (the average adult body lengthis 3.5 mm).

Iasur-Kruh et al.

4250 aem.asm.org Applied and Environmental Microbiology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 22

Nov

embe

r 20

21 b

y 1.

245.

225.

3.

over the eggs. This has been demonstrated in Arsenophonus na-soniae, an extracellular and cultivable male-killing symbiont ofNasonia parasitic wasps (48). In addition, a number of heterop-teran bugs, such as plataspid stink bugs, harbor in their midgutsnutritional bacterial symbionts that are smeared over eggs duringoviposition and ingested by hatching larvae (49). We are notaware of other studies showing bacteria housed in hemipteranovarian glands.

Much more detailed experimental work will be required tounderstand how Rickettsiella affects the fitness of its leafhopperhosts and how it persists in its host populations. Rickettsiella didnot cause visible symptoms in the leafhopper in this study, andstable infections were maintained for at least a year and a half (10generations); this suggests that this bacterium is nonpathogenic.Further examination is also required to determine the effect ofthese bacteria on the ability of O. albicinctus to function as a vectorof phytopathogens and on interactions between Rickettsiella andother microorganisms infecting O. albicinctus. To this end, therecent finding that Rickettsiella protects pea aphids against viru-lent fungal pathogens (16) suggests a promising path forward.

ACKNOWLEDGMENTS

This research was funded by research grant no. CA-9110-09 from BARD,the United States-Israel Binational Agricultural Research and Develop-ment Fund, to E.Z.-F. and by an NSERC (National Sciences and Engineer-ing Research Council of Canada) Special Research Opportunity Canada-Israel Grant (SROCI-386044-2009) to S.J.P. S.J.P. acknowledges supportfrom the Integrated Microbial Biodiversity Program of the Canadian In-stitute for Advanced Research. L.I.-K. acknowledges support from theLady Davis Fellowship Trust, Technion.

Thanks are extended to Eduard Belausov for technical support and toOded Beja for scientific support.

REFERENCES1. Moran NA, McCutcheon JP, Nakabachi A. 2008. Genomics and evolu-

tion of heritable bacterial symbionts. Annu. Rev. Genet. 42:165–190.2. Zchori-Fein E, Bourtzis K. 2011. Manipulative tenants: bacteria associ-

ated with arthropods. CRC Press, Boca Raton, FL.3. Duron O, Bouchon D, Boutin S, Bellamy L, Zhou L, Engelstädter J,

Hurst GD. 2008. The diversity of reproductive parasites among arthro-pods: Wolbachia do not walk alone. BMC Biol. 6:27. doi:10.1186/1741-7007-6-27.

4. Degnan PH, Bittleston LS, Hansen AK, Sabree ZL, Moran NA, AlmeidaRPP. 2011. Origin and examination of a leafhopper facultative endosym-biont. Curr. Microbiol. 62:1565–1572.

5. Burke GR, Normark BB, Favret C, Moran NA. 2009. Evolution anddiversity of facultative symbionts from the aphid subfamily Lachninae.Appl. Environ. Microbiol. 75:5328 –5335.

6. Regassa LB, Gasparich GE. 2006. Spiroplasmas: evolutionary relation-ships and biodiversity. Front. Biosci. 11:2983–3002.

7. Dale C, Plague GR, Wang B, Ochman H, Moran NA. 2002. Type IIIsecretion systems and the evolution of mutualistic endosymbiosis. Proc.Natl. Acad. Sci. U. S. A. 99:12397–12402.

8. Pontes MH, Smith KL, De Vooght L, Van Den Abbeele J, Dale C. 2011.Attenuation of the sensing capabilities of PhoQ in transition to obligateinsect-bacterial association. PLoS Genet. 7:e1002349. doi:10.1371/journal.pgen.1002349.

9. Fournier PE, Raoult D. 2005. Genus II Rickettsiella, p 241–248. InBrenner DJ, Krieger-Huber S, Stanley JT (ed), Bergey’s manual of system-atic bacteriology. Springer, New York, NY.

10. Roux V, Bergoin M, Lamaze N, Raoult D. 1997. Reassessment of thetaxonomic position of Rickettsiella grylli. Int. J. Syst. Bacteriol. 47:1255–1257.

11. Cordaux R, Paces-Fessy M, Raimond M, Michel-Salzat A, Zimmer M,Bouchon D. 2007. Molecular characterization and evolution of arthro-pod-pathogenic Rickettsiella bacteria. Appl. Environ. Microbiol. 73:5045–5047.

12. Bouchon D, Cordaux R, Grève P. 2011. Rickettsiella, intracellular patho-gens of arthropods, p 127–148. In Zchori-Fein E, Bourtzis K (ed), Manip-ulative tenants: bacteria associated with arthropods. CRC Press, Boca Ra-ton, FL.

13. Reeson AF, Jankovic T, Kasper ML, Rogers S, Austin AD. 2003. Appli-cation of 16S rDNA-DGGE to examine the microbial ecology associatedwith a social wasp Vespula germanica. Insect Mol. Biol. 12:85–91.

14. Spaulding AW, Von Dohlen CD. 2001. Psyllid endosymbionts exhibitpatterns of co-speciation with hosts and destabilizing substitutions in ri-bosomal RNA. Insect Mol. Biol. 10:57– 67.

15. Tsuchida T, Koga R, Horikawa M, Tsunoda T, Maoka T, Matsumoto S,Simon J-C, Fukatsu T. 2010. Symbiotic bacterium modifies aphid bodycolor. Science 330:1102–1104.

16. Łukasik P, van Asch M, Guo H, Ferrari J, Godfray HCJ. 2013. Unrelatedfacultative endosymbionts protect aphids against a fungal pathogen. Ecol.Lett. 16:214 –218.

17. Weintraub PG, Jones P. 2010. Phytoplasmas: genomes, plant hosts andvectors. CABI Publishing, Cambridge, MA.

18. Gottlieb Y, Ghanim M, Chiel E, Gerling D, Portnoy V, Steinberg S,Tzuri G, Horowitz AR, Belausov E, Mozes-Daube N, Kontsedalov S,Gershon M, Gal S, Katzir N, Zchori-Fein E. 2006. Identification andlocalization of a Rickettsia sp. in Bemisia tabaci (Homoptera: Aleyrodidae).Appl. Environ. Microbiol. 72:3646 –3652.

19. Frohlich DR, Torres-Jerez I, Bedford ID, Markham PG, Brown JK.1999. A phylogeographical analysis of the Bemisia tabaci species complexbased on mitochondrial DNA markers. Mol. Ecol. 8:1683–1691.

20. Moran NA, Tran P, Gerardo NM. 2005. Symbiosis and insect diversifi-cation: an ancient symbiont of sap-feeding insects from the bacterial phy-lum Bacteroidetes. Appl. Environ. Microbiol. 71:8802– 8810.

21. Muyzer G, Brinkhoff T, Nübel U, Santegoeds C, Schäfer H, Wawer C.1997. Denaturing gradient gel electrophoresis (DGGE) in microbial ecol-ogy, p 1–27. In Akkermans ADL, Van Elsas JD, De Bruijn FJ (ed), Molec-ular microbial ecology manual. Kluwer Academic Publishers, Dordrecht,The Netherlands.

22. Reference deleted.23. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 1991. 16S ribosomal

DNA amplification for phylogenetic study. J. Bacteriol. 173:697–703.24. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local

alignment search tool. J. Mol. Biol. 215:403– 410.25. Chen H, Rangasamy M, Tan SY, Wang H, Siegfried BD. 2010. Evalua-

tion of five methods for total DNA extraction from Western corn root-worm beetles. PLoS One 5:e11963. doi:10.1371/journal.pone.0011963.

26. Dowd SE, Callaway TR, Wolcott RD, Sun Y, McKeehan T, HagevoortRG, Edrington TS. 2008. Evaluation of the bacterial diversity in the fecesof cattle using 16S rDNA bacterial tag-encoded FLX amplicon pyrose-quencing (bTEFAP). BMC Microbiol. 8:125. doi:10.1186/1471-2180-8-125.

27. Edgar RC. 2004. MUSCLE: a multiple sequence alignment method withreduced time and space complexity. BMC Bioinformatics 5:113.

28. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. 2011.MEGA5: molecular evolutionary genetics analysis using maximum likeli-hood, evolutionary distance, and maximum parsimony methods. Mol.Biol. Evol. 28:2731–2739.

29. Posada D, Crandall KA. 1998. Modeltest: testing the model of DNAsubstitution. Bioinformatics 14:817– 818.

30. Sakurai M, Koga R, Tsuchida T, Meng XY, Fukatsu T. 2005. Rickettsiasymbiont in the pea aphid Acyrthosiphon pisum: novel cellular tropism,effect on host fitness, and interaction with the essential symbiont Buch-nera. Appl. Environ. Microbiol. 71:4069 – 4075.

31. Mediannikov O, Sekeyová Z, Birg ML, Raoult D. 2010. A novel obligateintracellular gamma-proteobacterium associated with ixodid ticks,Diplorickettsia massiliensis, gen. nov., sp. nov. PLoS One 5:e11478. doi:10.1371/journal.pone.0011478.

32. Clarridge JE. 2004. Impact of 16S rRNA gene sequence analysis for iden-tification of bacteria on clinical microbiology and infectious diseases. Clin.Microbiol. Rev. 17:840 – 862.

33. Leclerque A, Kleespies RG. 2012. A Rickettsiella bacterium from the hardtick, Ixodes woodi: molecular taxonomy combining multilocus sequencetyping (MLST) with significance testing. PLoS One 7:e38062. doi:10.1371/journal.pone.0038062.

34. Urban JM, Cryan JR. 2012. Two ancient bacterial endosymbionts havecoevolved with the planthoppers (Insecta: Hemiptera: Fulgoroidea). BMCEvol. Biol. 12:87. doi:10.1186/1471-2148-12-87.

Rickettsiella in the Leafhopper Orosius albicinctus

July 2013 Volume 79 Number 14 aem.asm.org 4251

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 22

Nov

embe

r 20

21 b

y 1.

245.

225.

3.

35. McCutcheon JP, McDonald BR, Moran NA. 2009. Convergent evolutionof metabolic roles in bacterial co-symbionts of insects. Proc. Natl. Acad.Sci. U. S. A. 106:15394 –15399.

36. McCutcheon JP, Moran NA. 2010. Functional convergence in reducedgenomes of bacterial symbionts spanning 200 My of evolution. GenomeBiol. Evol. 2:708 –718.

37. Wu D, Daugherty SC, Van Aken SE, Pai GH, Watkins KL, Khouri H,Tallon LJ, Zaborsky JM, Dunbar HE, Tran PL, Moran NA, Eisen JA.2006. Metabolic complementarity and genomics of the dual bacterial sym-biosis of sharpshooters. PLoS Biol. 4:e188. doi:10.1371/journal.pbio.0040188.

38. Noda H, Watanabe K, Kawai S, Yukuhiro F, Miyoshi T, Tomizawa M,Koizumi Y, Nikoh N, Fukatsu T. 2012. Bacteriome-associated endosym-bionts of the green rice leafhopper Nephotettix cincticeps (Hemiptera: Ci-cadellidae). Appl. Entomol. Zool. 47:217–225.

39. Bennett GM, O’Grady PM. 2012. Host-plants shape insect diversity:phylogeny, origin, and species diversity of native Hawaiian leafhoppers(Cicadellidae: Nesophrosyne). Mol. Phylogenet. Evol. 65:705–717.

40. Russell JA, Funaro CF, Giraldo YM, Goldman-Huertas B, Suh D,Kronauer DJC, Moreau CS, Pierce NE. 2012. A veritable menagerie ofheritable bacteria from ants, butterflies, and beyond: broad molecularsurveys and a systematic review. PLoS One 7:e51027. doi:10.1371/journal.pone.0051027.

41. Kleespies RG, Ritter C, Zimmermann G, Burghause F, Feiertag S,Leclerque A. 2013. A survey of microbial antagonists of Agriotes wire-worms from Germany and Italy. J. Pest Sci. 86:99 –106.

42. Vilcins IME, Old JM, Deane E. 2009. Molecular detection of Rickettsia,Coxiella and Rickettsiella DNA in three native Australian tick species. Exp.Appl. Acarol. 49:229 –242.

43. Tsai JH, Perrier JL. 1996. Morphology of the digestive and reproductivesystems of Dalbulus maidis and Graminella nigrifons (Homoptera: Ci-cadellidae). Fla. Entomol. 79:563–578.

44. Gil-Fernandez C, Black LM. 1965. Some aspects of the internal anatomyof the leafhopper Agallia constricta (Homoptera: Cicadellidae). Ann. En-tomol. Soc. Am. 58:275–284.

45. Hummel NA, Zalom FG, Peng CYS. 2006. Anatomy and histology ofreproductive organs of female Homalodisca coagulata (Hemiptera: Ci-cadellidae: Proconiini), with special emphasis on categorization of vitel-logenic oocytes. Ann. Entomol. Soc. Am. 2:920 –932.

46. Elzinga RJ. 2003. Fundamentals of entomology, 6th ed. Pearson/PrenticeHall, Upper Saddle River, NJ.

47. Triplehorn CA, Johnson NF. 2005. Borror and DeLong’s introduction tothe study of insects, 7th ed. Thomson Brooks/Cole, Belmont, CA.

48. Werren JH, Skinner SW, Huger AM. 1986. Male-killing bacteria in aparasitic wasp. Science 231:990 –992.

49. Fukatsu T, Hosokawa T. 2002. Capsule-transmitted gut symbiotic bac-terium of the Japanese common plataspid stinkbug, Megacopta punctatis-sima. Appl. Environ. Microbiol. 68:389 –396.

50. Thao ML, Baumann P. 2004. Evidence for multiple acquisition of Ar-senophonus by whitefly species (Sternorrhyncha: Aleyrodidae). Curr. Mi-crobiol. 48:140 –144.

Iasur-Kruh et al.

4252 aem.asm.org Applied and Environmental Microbiology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 22

Nov

embe

r 20

21 b

y 1.

245.

225.

3.