chapter 6 polymerase chain reaction - introduction - processes involved - applications - dna...
TRANSCRIPT
CHAPTER 6
POLYMERASE CHAIN REACTION- INTRODUCTION
- PROCESSES INVOLVED- APPLICATIONS
- DNA FINGERPRINTING- R-T PCR
MISS NUR SHALENA SOFIAN
INTRODUCTION TO PCR• PCR was invented in 1984 by ( Kary Mullis ) & he received the
Nobel Prize in chemistry in 1993, for his invention• It revolutionized biological methods specially in molecular
cloning in a way that it has became an inseparable & irreplaceable part of molecular investigations.
PCR: What is it?
• Polymerase chain reaction: a means of amplifying relatively short pieces of DNA
• Advantages: - very small amounts of DNA- Wide array of sample- Ease of extraction- specifically target particular DNA sequences of varying length
The PCR Process: Components of the Reaction
• Template DNA• Primers• dNTPs – building blocks of DNA• Thermostable DNA polymerase (Taq
polymerase)• Buffer and salts (KCl, MgCl2)• Optional: BSA, DMSO, formamide
• There are three basic steps which are in common with all type of PCR
1. Thermal denaturation :• In this step DNAs are denatured mostly by temperature about
94˚C & single stranded DNAs are made • ( in some cases It’s done by helicase )2. Primer annealing :• In this step primers are attached to ssDNA by their
complementary regions.3. Extension or polymerization :• This is done by a temperature resistance polymerase named
Taq polymerase which is extracted from Thermus aquaticus.
PROCESSES INVOLVE
Breaks the hydrogen bonds between the
two strands
Alleviates supercoiling
Keep the parental strands apart
Synthesizes an RNA primer
Synthesizes daughter DNA strands
III
Covalently links DNA fragments together
DNA REPLICATION PROCESS
PCR phases
Exponential◦ If 100% efficiency – exact
doubling of products. Specific and precise
Linear◦ High variability. Reaction
components are being consumed and PCR products are starting to degrade.
Plateau◦ End-point analysis. The
reaction has stopped and if left for long – degradation of PCR products.
PCR phases in linear view
Cycle #
[DNA]
Advantages & Disadvantages
• The most accurate & feasible technique to determine the amount & concentration of products.
• Rapid cycling (30 minutes to 2 hours).• Specific & sensitive.• Not much more expensive.
* * * * *• Pollution.• Poor precision.• Hard to get quantitative data.
Example
• Target sequence (priming sites are underlined)
5’TATAAGCCATAACGATATTGCTGAGTCAAGTCCACATATCATATGGATGAGAAATGCTTGTGGAGCTGATGTTGATTTGGAGAGACTCTCTCTCTCTCTCTCTCTCTCTAAACCAGTTAAAGAGTGTGCCAGTAGAG3’
Forward primer: 5’ ATG GAT GAG AAA TGC TTG TG 3’Reverse primer: 5’ACT GGC ACA CTC TTT AAC TGG 3’
APPLICATIONS
• Amplify a sample of chromosomal DNA – used in DNA fingerprinting analysis
• Nonspecific PCR is used to increase total amount of DNA in very small samples e.g. blood stains found at crime scene
• To detect and quantitate amount of specific RNAs in living cells – used in RT-PCR
• Other applications such as fluorescent labeling, mutation detection
DNA FINGERPRINTING IN PCR
• Automated DNA fingerprinting whereby a sample DNA is amplified utilizing primers that recognizes end of microsatellites
• Microsatellite fragments are fluorescently labeled and separated by gel electrophoresis
• The fluorescent molecules excited with laser and measured via fluorescent detector
Reverse Transcriptase PCR
• One of the most useful applied molecular genetics method
• RNA needs to be purified and stored at low temperature to prevent degradation
• Two steps:1. Biochemical separation of total RNA from DNA and protein using protein denaturant2. Isolation of poly-A and mRNA using oligo dT affinity matrix
Reverse Transcriptase PCR
First strand cDNA synthesis• mRNa copied into cDNA by reverse
transcriptase using oligo dT primersSecond strand cDNA synthesis• Requires artificial primer to initiate synthesis• Addition of small amounts of RNaseH resulted
in production of short RNA primers – promoting DNA synthesis at multiple sites along cDNA template
The reaction• PCR mix – Taq polymerase, specific primers, dNTPs
and buffers• cDNA is denatured >900C; temperature lowers to 50-
600C to allow annealing of primers (600 bp apart)• Temperature rises to 720C and Taq polymerase
extends the DNA from the primers• The cycle is repeated• The reaction products of cDNA are anaylzed by
agarose gel electrophoresis• EtBr is insensitive and does not allow accurate
quantitation of cDNA. Alternative is to use SYBR green dye (more fluorescent)
• SYBR green binds to ds DNA (reverse transcriptase PCR) and ss DNA (real-time PCR)
RT-PCR can be used for cloning
• Restriction enzyme sites can be added to the cDNA of interest
• Able to generate sticky ends for ligation into vector of choice
• 2 sticky ends permits directional cloning
Real-Time PCR• The reverse transcriptase has an endo H activity which
removes the mRNA allowing second strand of DNA to be formed
• Real time PCR is developed to:- quantitate differences in mRNA expression- availability of small amounts of mRNA e.g. cells obtained by laser capture micro-dissection, small amounts of tissue, primary cells, precious reagents
• To quantitate mRNA:- Northern blotting- Ribonuclease protection assays (RPA)- in situ hybridization- PCR
Real-Time chemistries allow for the detection of PCR amplification duringthe early phases of the reaction. Measuring the kinetics of the reaction inthe early phases of PCR provides a distinct advantage over traditionalPCR detection.
Real Time PCR - Diagnosis• Quantitatively measurement of Human Immunodeficiency Virus
(HIV).• Detection of Thalassemia, hemophilia, sickle cell anemia &
fauvism by real time PCR.• Cystic fibrosis.• Phenyl ketonuria.• Use in forensic medicine.• Non-invasive Prenatal Diagnosis by Analysis of Fetal DNA in
Maternal Plasma.• Detection and Quantitation of Circulating Plasmodium falciparum
DNA.• Effect of antimicrobial peptides on host cells
Conclusion
• PCR has proved to be a useful tool in research and diagnosis.
• Its use has also brought new challenges to research in terms of interpreting the results due to sensitivity and quantitative measurement
• In medicine, PCR-based diagnostics are just becoming widely used and because of the increased cost-effectiveness of the newer assays, knowledge for their interpretation will soon become available