chapter 5- dna modifying enzymes
TRANSCRIPT
![Page 1: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/1.jpg)
Enzymes that modify DNA are useful because they
allow the investigator to manipulate DNA in defined
ways
- Polymerases elongate DNA molecules by adding
free nucleotides to the 3’ ends (usually according to
an opposite template strand)
- Endonucleases cut DNA fragments in the middle
of the molecule
- Exonucleases degrade DNA from the ends
- Ligases join loose ends of DNA together
DNA modifying enzymes
![Page 2: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/2.jpg)
![Page 3: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/3.jpg)
DNA polymerases exonuclease activities:
- Activity 3→5 exonuclease. ( proofreading activity)
allows the polymerase to correct errors by
removing a nucleotide that has been inserted
incorrectly.
- Activity 5→3 exonuclease activity is possessed by
some DNA polymerases.
DNA polymerases
![Page 4: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/4.jpg)
Proof reading activity
of the 3’ to 5’ exonuclease.
DNAPI stalls if the incorrect
ntd is added - it can’t add the
next ntd in the chain
Proof reading activity is slow
compared to polymerizing
activity, but the stalling of
DNAP I after insertion of an
incorrect base allows the
proofreading activity to
catch up with the polymerizing
activity and remove the
incorrect base.
![Page 5: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/5.jpg)
The types of DNA polymerases used in research:
DNA polymerase I: Unmodified E. coli enzyme .
Use: DNA labeling .
Klenow polymerase: Modified version of E.coli
DNA polymerase I
Use: DNA labeling
![Page 6: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/6.jpg)
The Enzymology
• In 1957, Arthur Kornberg demonstrated the
existence of a DNA polymerase - DNA
polymerase I
• DNA Polymerase I has THREE different
enzymatic activities in a single polypeptide:
• a 5’ to 3’ DNA polymerizing activity
• a 3’ to 5’ exonuclease activity
• a 5’ to 3’ exonuclease activity
of DNA Replication
![Page 7: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/7.jpg)
Functional domains in the Klenow Fragment (left) and DNA Polymerase I (right).
![Page 8: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/8.jpg)
DNA polymerase I
![Page 9: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/9.jpg)
Nick Translation
![Page 10: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/10.jpg)
Nucleases
![Page 11: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/11.jpg)
Exonucleases
![Page 12: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/12.jpg)
Figure 1. Prepare single-stranded template with Lambda Exonuclease.
![Page 13: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/13.jpg)
Figure. 1 Lambda
Exonuclease
selectively digests the
strand of a PCR
product produced
using a PCR primer
with a 5´-phosphate.
The resulting single-
stranded PCR product
can be used for SSCP
analysis or
sequencing.
![Page 14: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/14.jpg)
Nucleases
Endonucleases
![Page 15: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/15.jpg)
Endonucleases
I. Non specificII. Specific
e.g. S1 nuclease, from the fungus
Aspergillus oryzae
And Deoxyribonuclease I
(DNaseI), from Escherichia coli
e.g. Restriction endonucleases,
from many sources
![Page 16: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/16.jpg)
Endonucleases
I. Non specific
- S1 nuclease (Endonuclease specific for single-
stranded DNA and RNA, from the fungus Aspergillus
oryzae
� Use:Transcript mapping
- Deoxyribonuclease I (DNaseI) Endonuclease specific
for double stranded DNA and RNA, from Escherichia
coli
� Use:Nuclease footprinting
![Page 17: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/17.jpg)
![Page 18: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/18.jpg)
S1 nuclease protection
• digests only single-stranded RNA and DNA
Find introns:
genomic DNA
intron
Digest with S1
Run gel
exon 1 exon 2
antisense probe
exon 1
exon 2
![Page 19: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/19.jpg)
Endonucleases
II. Specific
e.g. Restriction
endonucleases: Sequence-
specific DNA endonucleases,
from many sources
� Use:Many applications
![Page 20: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/20.jpg)
Restriction Endonucleases
- Also called restriction enzymes
- Recognize, bind to, and cleave DNA molecules
at specific sequences (usually 4-6 base pairs in
length) but there are some that are 5, 8, or longer
- The double strand breaks can create ends that
are:
* Blunt, cutting both strands in the same place
* Sticky, with overhanging nucleotides on the 5’
or 3’ ends
Restriction endonuclease
![Page 21: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/21.jpg)
Restriction enzymes
• Over 10,000 bacteria species have been
screened for restriction enzymes
• Over 2,500 restriction enzymes have been found
• Over 250 distinct specificities
• Occasionally enzymes with novel DNA sequence
specificities are still found while most now prove
to be duplicates (isoschizomers) of already
discovered specificities.
Restriction endonuclease
![Page 22: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/22.jpg)
There are three types of restriction enzymes.
With Types I and III there is no strict control over the
position of the cut relative to the specific sequence in the
DNA molecule that is recognized by the enzyme. These
enzymes are therefore less useful .
Type II enzymes do not suffer from this disadvantage
because the cut is always at the same place, either within
the recognition sequence or very close to it
Restriction endonuclease
![Page 23: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/23.jpg)
Type II Restriction enzymes are endonucleases that
cut DNA at specific sites, and are most useful for
molecular biology research
![Page 24: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/24.jpg)
Restriction enzymes are
molecular scissors
Restriction enzymes
![Page 25: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/25.jpg)
• Restriction Enzymes scan the DNA code
• Find a very specific set of nucleotides
• Make a specific cut
Restriction enzymes
![Page 26: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/26.jpg)
Picking a palindromeWords that read the same forwards as backwards
Hannah
Level
Madam
hannaH
leveL
madaM
Restriction enzymes
Restriction enzymes recognize and make a cut within
specific palindromic sequences, known as restriction sites,
in the genetic code. This is usually a 4- or 6 base pair
sequence.
![Page 27: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/27.jpg)
Restriction Enzyme Recognition Sites
Restriction sites are general palindromic:
“Able was I, ere, I saw Elba”
Bam H1 site:5’-GGATCC-3’
3’-CCTAGG-5’
Restriction enzymes
![Page 28: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/28.jpg)
HaeIIIHaeIII is a restriction enzyme that searches the
DNA molecule until it finds this sequence of
four nitrogen bases.
5’ TGACGGGTTCGAGGCCAG 3’
3’ ACTGCCCAAGGTCCGGTC 5’
5’ TGACGGGTTCGAGGCCAG 3’
3’ ACTGCCCAAGGTCCGGTC 5’
![Page 29: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/29.jpg)
Once the recognition site was found
HaeIII could go to work cutting
(cleaving) the DNA
5’ TGACGGGTTCGAGGCCAG 3’
3’ ACTGCCCAAGGTCCGGTC 5’
![Page 30: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/30.jpg)
These cuts produce what scientists call
“blunt ends”
5’ TGACGGGTTCGAGG CCAG 3’
3’ ACTGCCCAAGGTCC GGTC 5’
![Page 31: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/31.jpg)
Restriction enzymes are named based on the bacteria in
which they are isolated in the following example for the
enzyme EcoRI:
E Escherichia (genus)
co coli (species)
R RY13 (strain)
I First identified Order ID'd in bacterium
Restriction enzymes
![Page 32: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/32.jpg)
Nomenclature of Restriction Enzymes
The 1st letter (in capital and italics) = first initial of
Genus name (from which the enzyme was isolated
• The 2nd and 3rd (in italics) = the first 2 letters of
the species name
e.g. Hin = Haemophilus influenzae
• The 4th letter (sometimes in italics) = strain or type
e.g. Hind = Haemophilus influenzae Rd
• The roman number followed is given to distinguish
different restriction and modification system in the
same strain
e.g. HindIII
Restriction enzymes
![Page 33: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/33.jpg)
5’ G AATTC 3’
3’ CTTAA G 5’EcoRI
EcoRII .....CCWGG
GGWCC.....
W=A or T
![Page 34: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/34.jpg)
“blunt ends” and “sticky ends”
Remember how HaeIII produced a “blunt end”?
EcoRI, for instance, makes a staggered cut and
produces a “sticky end”
5’ GAATTC 3’
3’ CTTAAG 5’
5’ GAATTC 3’
3’ CTTAAG 5’
5’ G AATTC 3’
3’ CTTAA G 5’
![Page 35: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/35.jpg)
Eco RI Restriction Enzyme
Single stranded “nick”
Restriction enzymes
![Page 36: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/36.jpg)
Some more examples of restriction sites of
restriction enzymes with their cut sites:
HindIII: 5’ AAGCTT 3’
3’ TTCGAA 5’
BamHI: 5’ GGATCC 3’
3’ CCTAGG 5’
AluI: 5’ AGCT 3’
3’ TCGA 5’
![Page 37: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/37.jpg)
Restriction Enzyme Recognition Sites
BglII 5’ A-G-A-T-C-T
T-C-T-A-G-A 5’
Sau3A 5’ G-A-T-C
C-T-A-G 5’
BamHI 5’ G-G-A-T-C-C
C-C-T-A-G-G 5’
All these sticky ends
are compatible
Isoschizomers: In certain cases, two or more different enzymes may
recognize identical sites. (e.g. MboI also cleaves at GATC, and so is an
isochizomer of Sau3A.)
![Page 38: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/38.jpg)
Frequency of cutting of recognition enzymes
Sau 3A (GATC) cuts (¼)(¼)(¼)(¼) = once every 256 base
pairs (assuming G/C = A/T, which is often does not)
BamH1 (GGATCC) cuts (¼)(¼)(¼)(¼)(¼)(¼) = once every
~4Kb
HindII (GTPyPuAC) cuts (¼)(¼)(½)(½)(¼)(¼) = once
every ~1Kb
Restriction enzymes
http://tools.neb.com/NEBcutter2/index.php
![Page 39: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/39.jpg)
Human DNA cleaved with EcoRI Corn DNA cleaved with EcoRI
5’-C-G-G-T-A-C-T-A-G-OH
3’-G-C-C-A-T-G-A-T-C-T-T-A-A-PO4
PO4-A-A-T-T-C-A-G-C-T-A-C-G-3’
HO-G-T-C-G-A-T-G-C-5’
Ligation of compatible sticky ends
+
5’-A-C-G-G-T-A-C-T-A-G A-A-T-T-C-A-G-C-T-A-C-G-3’
3’-T-G-C-C-A-T-G-A-T-C-T-T-A-A G-T-C-G-A-T-G-C-5’
Complementary base pairing
+ DNA Ligase, + rATP
recombinant DNA molecule
5’-A-C-G-G-T-A-C-T-A-G-A-A-T-T-C-A-G-C-T-A-C-G-3’
3’-T-G-C-C-A-T-G-A-T-C-T-T-A-A-G-T-C-G-A-T-G-C-5’
![Page 40: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/40.jpg)
YIP M
EcoRI 5660
HindIII 1/ 6160
Eagl 542
Apal 2035
SmaI 2860PvuII 3547
PvuII 5116
SmaI 5’ ccc ggg 3’
Exercise1
How many base pairs in this plasmid?How mamy fragments will be produced if this plasmid is digested with PvuII?
![Page 41: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/41.jpg)
Agarose Gel Electrophoresis
_
+
DNA is negatively
charged from the
phosphate backbone
Visualize DNA with ethidium
bromide – fluoresces orange
ONLY when bound to DNA
Agarose mesh
![Page 42: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/42.jpg)
Gel Electrophoresis of DNA
![Page 43: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/43.jpg)
What is Gel Electrophoresis?
• Electro = flow of electricity, phoresis, from the Greek
= to carry across
• A gel is a colloid, a suspension of tiny particles in a
medium, occurring in a solid form, like gelatin
• Gel electrophoresis refers to the separation of charged
particles located in a gel when an electric current is
applied
• Charged particles can include DNA, amino acids,
peptides, etc
![Page 44: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/44.jpg)
Gel electrophoresis is a widely used technique for the
analysis of nucleic acids and proteins. Agarose gel
electrophoresis is routinely used for the preparation and
analysis of DNA.
Gel electrophoresis is a procedure that separates
molecules on the basis of their rate of movement through
a gel under the influence of an electrical field.
Gel electrophoresis
![Page 45: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/45.jpg)
Why do gel electrophoresis?
• When DNA is cut by restriction enzymes, the
result is a mix of pieces of DNA of different
lengths
• It is useful to be able to separate the pieces - i.e.
for recovering particular pieces of DNA, for
forensic work or for sequencing
![Page 46: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/46.jpg)
46
Gel with molecular weight marker
![Page 47: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/47.jpg)
Summary
• Restriction endonucleases recognize specific sequences in
DNA molecules and make cuts in both strands
• This allows very specific cutting of DNAs 4-7
• The cuts in the two strands are frequently staggered, so
restriction enzymes can create sticky ends that help to link
together 2 DNAs to form a recombinant DNA in vitro
![Page 48: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/48.jpg)
Plasmid vectors containing a polylinker
(a) Sequence of a polylinker that includes one copy of the recognition
site, indicated by brackets, for each of the 10 restriction enzymes
indicated. Polylinkers are chemically synthesized and then are inserted
into a plasmid vector. Only one strand is shown
Exercise
![Page 49: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/49.jpg)
1. The nucleotide sequence of a polylinker in a particular
plasmid vector is
GAATTCCCGGGGATCCTCTAGAGTCGACCTGCAGG
CATGC-
This polylinker contains restriction sites for BamHI , EcoRI ,
PstI , SalI , SmaI , SphI , and XbaI . Indicate the location of
each restriction site in this sequence.
2. A vector has a polylinker containing restriction sites in
the following order: HindIII , SacI , XhoI , BglII , XbaI , and
ClaI .
- Give a possible nucleotide sequence for the polylinker .
![Page 50: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/50.jpg)
C¯ CCGGGXmaI
T¯ CTAGAXbaI
GCATG¯ CSphI
CCC¯ GGGSmaI
G¯ TCGACSalI
GAGCT¯ CSacI
CTGCA¯ GPstI
G¯ AATTCEcoRI
G¯ GATCCBamHI
Recognition
SequenceEnzyme
![Page 51: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/51.jpg)
Nucleases
What is difference between DNase and RNase?
DNase cut DNARNases cut RNA
![Page 52: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/52.jpg)
RNases
![Page 53: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/53.jpg)
Ribonuclease H (RNase H)
![Page 54: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/54.jpg)
Replacement
Synthesis
![Page 55: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/55.jpg)
DNA fragments that have been generated by
treatment with a restriction endonuclease can be
joined back together again, or attached to a new
partner, by a DNA ligase. The reaction requires
energy, which is provided by adding either ATP or
NAD to the reaction mixture, depending on the
type of ligase that is being used.
DNA ligases
![Page 56: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/56.jpg)
DNA replication requires many
enzymes and protein factors
- Replisome
- Helicases
- Topoisomerases
- DNA-binding proteins
- Primases
- DNA ligases
![Page 57: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/57.jpg)
DNA ligases
![Page 58: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/58.jpg)
Application of DNA ligase
![Page 59: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/59.jpg)
Role of Phosphatase in DNA ligation
![Page 60: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/60.jpg)
Phosphotases & Kinases
![Page 61: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/61.jpg)
Flow of Genetic Information :
The Central Dogma of Molecular Biology
Alberts et al, 2002, p. 301
Reverse
transcriptase
DNA polymerase
![Page 62: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/62.jpg)
![Page 63: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/63.jpg)
- An enzyme that catalyses the synthesis of a
DNA strand from an RNA template.
- The produced DNA called complementry
DNA (cDNA)
* Present in retro virus & other RNA viruses
* Application: Used in RT-PCR (e.g.
detection of HCV-Ag)
Reverse transcriptase
![Page 64: Chapter 5- DNA Modifying Enzymes](https://reader031.vdocuments.site/reader031/viewer/2022012304/5450025faf7959f7088b4904/html5/thumbnails/64.jpg)
Reverse transcriptase