chapter 5: dna, gene expression, and biotechnology what is the genetic code, and how is it...

Chapter 5: DNA, Gene Expression, and Biotechnology

What is the genetic code, and how is it harnessed?

Lectures by Mark Manteuffel, St. Louis Community College

Learning Objectives

Describe what DNA is and what it does. Explain the process of gene expression

and the collaboration of nature and nurture.

Explain the causes and effects of damage to the genetic code.

Discuss biotechnology in agriculture. Describe biotechnology and its

implications for human health.

5.1–5.5

DNA: what is it, and

what does it do?

5.1 “The DNA 200”

Knowledge about DNA is increasing justice in the world.

Take-home message 5.1

DNA is a molecule that all living organisms carry in every cell in their body.


Unique in virtually every person, DNA can serve as an individual identifier, left behind us as we go about our lives.

This is a fact that is used increasingly to ensure greater justice in our society, such as through establishing the innocence of individuals wrongly convicted of crimes.

5.2 The DNA molecule contains instructions for the development and functioning of all living organisms.

DNA “Double Helix”

Nucleic acids and nucleotides

Sugars, Phosphates, and Bases

A, T, C, and GBase pairs

Which component of a DNA macromolecule will dictate instructions to the cell?

1. The order of sugars (ribose) in the DNA.

2. The order of phosphates in the DNA.3. The order of bases (A,G,T,C) in a DNA.4. All of the above

Which answer below will base pair with the DNA sequence below?TATTAGTAGGTTA

1. ATAATCATCCAAT2. AUAAUCAUCCAAU3. ATTGGATGATTAT4. TATTAGTAGGTTA


DNA is a nucleic acid, a macromolecule that stores information.

It consists of individual units called nucleotides: a sugar, a phosphate group, and a nitrogen-containing base.


DNA’s structure resembles a twisted ladder, with the sugar and phosphate groups serving as the backbones of the molecule and base pairs serving as the rungs.

5.3 Genes are sections of DNA that contain instructions for making proteins.

Why is DNA considered the universal code for all

life on earth?

Genes

A sequence of bases in a DNA molecule that carries the information necessary for producing a functional product, usually a protein molecule or RNA


DNA is a universal language that provides the instructions for building all the structures of all living organisms.

The full set of DNA an organism carries is called its genome.


In prokaryotes, the DNA occurs in circular pieces.

In eukaryotes, the genome is divided among smaller, linear strands of DNA called chromosomes.


A gene is a sequence of bases in a DNA molecule that carries the information necessary for producing a functional product, usually a protein molecule or RNA.

5.4 Not all DNA contains instructions for making proteins.

Insert figure 5-8

An onion has five times as much DNA as a human.

Why doesn’t that make them more complex than us?

The proportion of the DNA that codes for genes

Introns

Non-coding regions of DNA

May take the form of short (or long) sequences that are repeated thousands of times

May also consist of gene fragments, duplicate versions of genes, and pseudogenes


Only a small fraction of the DNA in eukaryotic species codes for genes.

• The function of the rest is still a mystery, although it may play a role in gene regulation.

5.5 How do genes work?

An overview

Genotype•all of the genes contained in an

organism

Phenotype•the physical manifestations of the

instructions


The genes in strands of DNA are a storehouse of information, an instruction book.


The process by which this information is used to build an organism occurs in two main steps:

transcription, in which a copy of the gene’s base sequence is made, and

translation, in which that copy is used to direct the production of a protein.

5.6–5.8

Building organisms:

information in DNA

directs the production of

the molecules that make

up an organism.

5.6 Transcription: Reading the information coded in DNA

Which answer below represents the mRNA strand copied from the DNA strand below?TATTAGTAGGTTA

1. UAUUACUACCUUA2. AUAAUCAUCCAAU3. ATTGGATGATTAT4. ATAATCATCCAAT


Transcription is the first step in the two-step process by which DNA directs the synthesis of proteins.

In transcription, a single copy of one specific gene within the DNA is made, in the form of a molecule of mRNA, which moves where it can be translated into a protein.

5.7 In translation, the mRNA copy of the information from DNA is used to build functional molecules.

Several ingredients must be present in the cytoplasm for translation to occur.

Free amino acids

Ribosomal units

Transfer RNA

The Genetic Code

Insert figure 5-14

Insert figure 5-15

Translate the following mRNA sequence using the codon table from your book. AGGGAUGGCGAAACAACCA

1. Arginine-aspartate-glycine-glutamate-threonine -threonine

2. Methionine-alanine-lysine-glutamine-proline3. Threonine-asparigine-lysine-alanine-valine-

glycine4. Methionine-alanine-lysine-histidine-proline


Translation is the second step in the two-step process by which DNA directs the synthesis of proteins.

In translation, the information from a gene that has been carried by the nucleotide sequence of an mRNA is read, and ingredients present in the cell’s cytoplasm are used to produce a protein.

Insert section 5.11-5.13 opener photo

5.11–5.13

Biotechnology is

producing

improvements in

agriculture.

Genetic Engineering

Adding, deleting, or transplanting genes from one organism to another, to alter the organisms in useful ways

5.11 What is biotechnology?

Insert figure 5-24

Insert figure 5-25

Insert figure 5-26

Insert figure 5-27

Insert figure 5-28

Insert figure 5-29

Which DNA probe below could be used for isolating bacteria that carry the following gene from a gene library?TTGACGTATTGCCTTGGAAGCGTA

1. TGCCTT2. ATGCGA3. ACTGCA4. TGACGT


Biotechnology is the use of technology to modify organisms, cells, and their molecules to achieve practical benefits.


Modern molecular methods make it possible to cut and copy DNA from one organism and deliver it to another.


The methods rely on naturally occurring restriction enzymes for cutting DNA, the polymerase chain reaction for amplifying small amounts of DNA, inserting the DNA into bacterial or viral vectors, and cloning and identifying the cells with the transferred DNA of interest.

5.12 Biotechnology can improve food nutrition and make farming more efficient and eco-friendly.

Insert figure 5-30

How might a genetically modified plant help 500 million malnourished people?

Nutrient-rich “golden rice”

Almost everyone in the United States consumes genetically modified foods regularly without knowing it.

What foods are responsible for this?

Is there more genetically modified corn or genetically modified cotton produced in the United States?1. There is more genetically

modified cotton grown in the United States.

2. There is more genetically modified corn grown in the United States.

3. I don’t know the absolute amount of corn and cotton grown in the United States.

4. I don’t know because it is not clear how they calculated the percentages in the graph.

Insect Resistance

Insert figure 5-33

How can genetically modified plants lead to reduced pesticide use by farmers?

Herbicide Resistance

Faster Growth and Bigger Bodies

When making Bt corn, the scientists inserted the Bt gene from ________ into the corn plant’s _______.

1. carrots……cells2. bacteria….genome3. carrots…..genome4. bacteria….cells


Biotechnology has led to important improvements in agriculture by using transgenic plants and animals to produce more nutritious food.


Even more significant is the extent to which biotechnology has reduced the environmental and financial costs of producing food through the creation of herbicide-

resistant and insect-resistant crops


The ecological and health risks of such widespread use of transgenic species are not fully understood and are potentially great.

5.13 Fears and risks: Are genetically modified foods safe?

Fear #1: Organisms that we want to kill may become invincible.

Fear #2: Organisms that we don’t want to kill may be killed inadvertently.

Fear #3: Genetically modified crops are not tested or regulated adequately.

Fear #4: Eating genetically modified foods is dangerous.

Fear #5: Loss of genetic diversity among crop plants is risky.

Fear #6: Hidden costs may reduce the financial advantages of genetically modified crops.

We should continue to develop genetically modified organisms.1. Strongly agree2. Agree3. Neutral4. Disagree5. Strongly

disagree

Take-home message 5.13 More and more genetically modified foods

are being created using modern methods of recombinant DNA technology.

Some legitimate fears among the public remain, however, about the safety of these foods given that their development relies on such new technology and about the long-term financial advantages they offer.

5.14–5.17

Biotechnology

has the potential

for improving human

health (and criminal

justice)

5.14 The treatment of diseases and production of medicines are improved with biotechnology

Prevent diseases

Cure diseases

Treating diseases

• The treatment of diabetes

Insert figure 5-39

Why do some bacteria produce human insulin?

Recombinant DNA technology


Biotechnology has led to some notable successes in treating diseases, usually by producing medicines more efficiently and more effectively than they can be produced with traditional methods.

5.16 Cloning—ranging from genes to organs to individuals—offers both promise and perils

Are there any medical justifications for cloning?

We should pursue cloning in animals but not humans.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80

81 82 83 84 85 86 87

1. Strongly agree2. Agree3. Neutral4. Disagree5. Strongly

disagree

We should pursue cloning in humans for the purpose of developing or performing medical treatments.1. Strongly agree2. Agree3. Neutral4. Disagree5. Strongly disagree

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80

81 82 83 84 85 86 87 88


Cloning of individuals has potential benefits in agriculture and medicine, but ethical questions linger.

5.17 DNA as an individual identifier: the uses and abuses of DNA fingerprinting

Insert figure 5-45c

Insert figure 5-46

DNA samples were collected from a crime scene and from three suspects. DNA fragments were analyzed using electrophoresis. Using the DNA fingerprint information below, determine which suspect was present at the crime scene.

1. Suspect #12. Suspect #23. Suspect #34. All of the

above.

CrimeScene

Suspect #1

Suspect #2

Suspect #3

What is a DNA fingerprint?


Comparisons of highly variable DNA regions have forensic value in identifying tissue specimens and determining the individual from whom they came.

chapter 5: dna, gene expression, and biotechnology what is the genetic code, and how is it...

Documents

dna molecule

dna sequence

dna macromolecule

sections of dna

set of dna

linear strands of dna

pseudogenes takehome

protein molecule