DNA Structure

The Structure of DNAImportant Contributors to the Genetic CodeDNA ReplicationChapter 12: DNA1DNA StructureSection 12.2: The Structure of DNALearn Genetics TutorialDiscovery of DNA (4 min) video clip2Deoxyribonucleic Acid is a polymer formed from units called nucleotides.Each nucleotide monomer is made up of three parts:a) 5-carbon sugar (deoxyribose)b) phosphate groupc) nitrogen base

b.a.c.3There are 4 nitrogenous bases found in DNA:Purines (2 rings)a) Guanine (G)b) Adenine (A)Pyrimidines (one ring)a) Thymine (T)b) Cytosine (C)

4Nucleic Acids and Nucleotides:

5Deoxyribonucleic Acid:The DNA polymer looks like a twisted ladder, with the 5-carbon sugar and phosphate group making up the sides of the ladder and the nitrogen bases are the steps/rungs.

6Nitrogen bases pair according to certain rules:a) Purines pair with pyrimidinesb) Guanine pairs with Cytosine and Thymine pairs with Adenine

The nitrogen bases are held together by hydrogen bonds.

7

Deoxyribonucleic Acid:Check your understandingDNA is a long molecule made up of units called nucleotides. Each nucleotide is made up of three basic parts: __________, __________, &__________. There are 4 kinds of ______________ in DNA. They _______ according to two rules: 1) ________ always pair with ___________ and 2) Guanine pairs with _________ and _________ pairs with adenine.Deoxyribose (5 C sugar)Phosphate groupNitrogenous baseNitrogenous basespairPurinesPyrimidinesCytosineThymine9DNA ReplicationSection 12.3: DNA ReplicationPBS DNA Workshop10DNA ReplicationBecause each of the two strands of the DNA double helix has all of the information to reconstruct the other half, the strands are said to be complementary.Each strand of the double helix serves as a template to make the other strand.11DNA Replication PracticeATCCGATGATTTTTCAGGAAAC12RNA Transcription Practice - Uracil (U) replaces Thymine (T)ATCCGATGATTUUUCAGGAAAC13DNA ReplicationDNA replication is carried out by a series of enzymes.a) They separate (unzip) the two strands of the double helix.b) DNA polymerase adds new nucleotides.

14Illustration of DNA Replication

Learn Genetics TutorialPBS DNA Workshop15DNA Replication:

Short clip of DNA Replication (1 min)16DNA Replication:

17Important Contributors to the Genetic CodeSection 12.1: Identifying the Substance of Genes PBS Episode 1 of 5 - DNA The Secret of Life (54 min)The Secret of Life - The Discovery of DNA (9 min)18The Genetic Code:To truly understand genetics, scientists realized they had to discover the chemical nature of the gene.

If the molecule that carries genetic information could be identified, it might be possible to understand how genes control the inherited characteristics of living things.

19Griffiths Experiments:The discovery of the chemical nature of the gene began in 1928 with British scientist Frederick Griffith, who was trying to figure out how certain types of bacteria produce pneumonia.Griffith isolated two different strains of the same bacterial species.Both strains grew very well in culture plates in Griffiths lab, but only one of the strains caused pneumonia.

20Griffiths Experiments:The disease-causing bacteria (S strain) grew into smooth colonies on culture plates, whereas the harmless bacteria (R strain) produced colonies with rough edges.

21Griffiths Experiments:When Griffith injected mice with disease-causing bacteria, the mice developed pneumonia and died.When he injected mice with harmless bacteria, the mice stayed healthy.Perhaps the S-strain bacteria produced a toxin that made the mice sick? To find out, Griffith ran a series of experiments.

22Griffiths Experiments:First, Griffith took a culture of the S strain, heated the cells to kill them, and then injected the heat-killed bacteria into laboratory mice.The mice survived, suggesting that the cause of pneumonia was not a toxin from these disease-causing bacteria.

23Griffiths Experiments:In Griffiths next experiment, he mixed the heat-killed, S-strain bacteria with live, harmless bacteria from the R strain and injected the mixture into laboratory mice.The injected mice developed pneumonia, and many died.

24Griffiths Experiments:The lungs of these mice were filled with the disease-causing bacteria. How could that happen if the S strain cells were dead?Griffith reasoned that some chemical factor that could change harmless bacteria into disease-causing bacteria was transferred from the heat-killed cells of the S strain into the live cells of the R strain.

25Griffiths Experiments:He called this process transformation, because one type of bacteria had been changed permanently into another. Because the ability to cause disease was inherited by the offspring of the transformed bacteria, Griffith concluded that the transforming factor had to be a gene.

26Avery, McCarty, and MacLeod:A group of scientists at the Rockefeller Institute in New York, led by the Canadian biologist Oswald Avery, wanted to determine which molecule in the heat-killed bacteria was most important for transformation.Avery and his team extracted a mixture of various molecules from the heat-killed bacteria and treated this mixture with enzymes that destroyed proteins, lipids, carbohydrates, and some other molecules, including the nucleic acid RNA.Transformation still occurred.

27Avery, McCarty, and MacLeod:Averys team repeated the experiment using enzymes that would break down DNA.When they destroyed the DNA in the mixture, transformation did not occur.Therefore, DNA was the transforming factor.

28Hershey and Chase:Hershey and Chase studied virusesnonliving particles that can infect living cells.The kind of virus that infects bacteria is known as a bacteriophage, which means bacteria eater.

29Hershey and Chase:When a bacteriophage enters a bacterium, it attaches to the surface of the bacterial cell and injects its genetic information into it.The viral genes act to produce many new bacteriophages, which gradually destroy the bacterium.When the cell splits open, hundreds of new viruses burst out.

30Hershey and Chase:American scientists Alfred Hershey and Martha Chase studied a bacteriophage that was composed of a DNA core and a protein coat. They wanted to determine which part of the virus the protein coat or the DNA core entered the bacterial cell.

31Hershey and Chase: Hershey and Chase grew viruses in cultures containing radioactive isotopes of phosphorus-32 (P-32) sulfur-35 (S-35)

32Hershey and Chase:Since proteins contain almost no phosphorus and DNA contains no sulfur, these radioactive substances could be used as markers, enabling the scientists to tell which molecules actually entered the bacteria and carried the genetic information of the virus.

33Hershey and Chase:If they found radioactivity from S-35 in the bacteria, it would mean that the viruss protein coat had been injected into the bacteria.If they found P-32 then the DNA core had been injected.

34Hershey and Chase:The two scientists mixed the marked viruses with bacterial cells, waited a few minutes for the viruses to inject their genetic material, and then tested the bacteria for radioactivity.

35Hershey and Chase:Nearly all the radioactivity in the bacteria was from phosphorus P-32 , the marker found in DNA.Hershey and Chase concluded that the genetic material of the bacteriophage was DNA, not protein.Hershey and Chases experiment with bacteriophages confirmed Averys results, convincing many scientists that DNA was the genetic material found in genesnot just in viruses and bacteria, but in all living cells.

36Rosalind Franklin:In the 1950s, British scientist Rosalind Franklin used a technique called X-ray diffraction to get information about the structure of the DNA molecule.X-ray diffraction revealed an X-shaped pattern showing that the strands in DNA are twisted around each other like the coils of a spring.The angle of the X-shaped pattern suggested that there are two strands in the structure.Other clues suggest that the nitrogenous bases are near the center of the DNA molecule.

37Watson and Crick:At the same time, James Watson, an American biologist, and Francis Crick, a British physicist, were also trying to understand the structure of DNA.They built three-dimensional models of the molecule.Early in 1953, Watson was shown a copy of Franklins X-ray pattern. The clues in Franklins X-ray pattern enabled Watson and Crick to build a model that explained the specific structure and properties of DNA.

38Watson and Crick:In the double-helix model of DNA, the two strands twist around each other like spiral staircases.The double helix accounted for Franklins X-ray pattern and explains Chargaffs rule of base pairing and how the two strands of DNA are held together.

39Erwin Chargaff:Erwin Chargaff discovered that the percentages of adenine [A] and thymine [T] bases are almost equal in any sample of DNA.The same thing is true for the other two nucleotides, guanine [G] and cytosine [C].The observation that [A] = [T] and [G] = [C] became known as one of Chargaffs rules.

40RNAProtein Synthesis(Transcription and Translation)Chapter 13: RNA and Protein Synthesis41RNA: Ribonucleic Acid Section 13.1: RNA42

Genetic Code (genes)IntermediatesMolecules that express our genesHOW DNA IS USED TO MANUFACTURE PROTEINSRibonucleic AcidConsists of a long chain of macromolecules made up of nucleotides.5-carbon sugar (ribose)phosphate groupnitrogen base443 differences between DNA and RNA:1. RNA is single stranded, DNA is double stranded2. RNA contains uracil in place of thymine 3. 5-carbon sugar is ribose in RNA, deoxyribose in DNA453 main types of RNA:1. Messenger (mRNA)-instructions for making proteins2. Ribosomal (rRNA)-found in ribosomes (where proteins are made)3. Transfer (tRNA)-transfers amino acids to the ribosome

46RNA Synthesis: TranscriptionThe process by which a molecule of DNA is copied into a complementary strand of RNA (mRNA).

47Creating mRNADouble strandedDNARNA polymerase binds to DNA and assembles a single strand of RNA3. Single stranded RNA48RNA Synthesis: TranscriptionAll 3 types of RNA are synthesized from DNA in the nucleus and then used to synthesize proteins in the ribosome. Protein synthesis is a two step process:1) Transcription: DNA mRNA (nucleus)2) Translation: mRNA amino acids proteins (ribosome)

49RNA Synthesis: TranscriptionmRNA must bring the genetic information from DNA in the nucleus to the ribosome in the cytoplasm.An enzyme, RNA polymerase , attaches to the DNA molecule and separates the double helix.The enzyme moves along the DNA molecule and synthesizes a complementary mRNA strand.

50RNA Synthesis: Transcription Transcribe the given DNA sequence into a complementary mRNA:A T G C A A G T C A T T C C A G C T __________________________________

51RNA Synthesis: Transcription

52RNA Editing: The process of transcription takes place in the nucleus.The mRNA must be processed before leaving the nucleus.1) Introns and exons are transcribed from DNA2) Introns are cut out of the mRNA and exons are spliced back together3) A cap and a tail are added to the mRNA

53RNA Editing:Introns: Intervening sequencesExons: Expressed sequences

54Protein SynthesisSection 13.2: Ribosomes and Protein Synthesis55Protein Synthesis: The information that DNA transfers to mRNA is in the form of a code, which is determined by the way in which the four nitrogenous bases are arranged in DNA.DNA directs the formation of proteins.The monomers of proteins are amino acids.There are 20 different amino acids.A peptide bond holds two amino acids together.

56Protein Synthesis:The mRNA produced in the nucleus during transcriptiontravels to the ribosome to begin the process of translation.Once at the ribosome, the mRNA is read 3 nucleotides at a time.A codon is a combination of three sequential nucleotides on mRNA.

57Protein Synthesis: There are 64 different codons.Each codon specifies a particular amino acid that is to be placed in the polypeptide chain.AUG is the initiator codon.There are 3 stop codons.

58Protein Synthesis:Translation involves mRNA, rRNA, and tRNA. Transfer RNA (tRNA) carries the amino acids to the ribosome.(different tRNA for each amino acid)Ribosomal RNA (rRNA)makes up the major part of the ribosome.Three sequential nucleotides on a tRNA molecule are called an anticodon.The anticodon on the tRNA is complementary to the codon of mRNA.

59Protein Synthesis:

60Protein Synthesis:UAG CUGAAU CGCAUC GAC UUA GCG AAU CAG GAU

61Protein Synthesis: Each codon & anticodon bind together, and a peptide bond forms between the two amino acids.The polypeptide chain continues to grow until the ribosome reaches a stop codon.

62Protein Synthesis:

63Protein Synthesis: A stop codon is a codon for which no tRNA molecule exists.The ribosome releases the newly formed polypeptide.

64Protein Synthesis:

65

DNATranscriptionmRNAProtein Made of Amino AcidsTranslation(Ribosome) Central Dogma flow of genetic information from DNA to RNA to ProteinNucleusCytoplasm