chapter 12

26
Chapter 12 Text book Notes

Upload: ajaxe

Post on 17-Mar-2016

42 views

Category:

Documents


0 download

DESCRIPTION

Chapter 12. Text book Notes. 12-1. TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288) How did we find out that this happens…?. 1928 Griffith: British scientist. Prob? How do bacteria make people sick? - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: Chapter 12

Chapter 12

Text book Notes

Page 2: Chapter 12

12-1

• TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288)

• How did we find out that this happens…?

Page 3: Chapter 12

1928 Griffith: British scientist

• Prob? How do bacteria make people sick?– Specifically the bacteria pneumonia…

• Materials: mice, syringe, diseased bacteria(A), healthy bacteria(B)

• Results : (what do you think will happen- which bcateria will kill the mice?)

Page 4: Chapter 12

Harmless bacteria?

Mice lived

Bacteria A Mice dies

Flamed Bacteria A

Mice lived Why?

Flamed Bacteria A and Bacteria B

Mice died Why? The good bacteria picked up the DNA, from the dead disease causing bacteria, and it became disease causing too

Page 5: Chapter 12

12-3 RNA & Protein Synthesis• Synthesis?

– DNA instruction is in code • ATCCGGTTAAAGGTCCCTCTCTGATCC

CGTATTAAAGTCGATTGACGATGCAGTGACGATGAAGTCGAAAACCGGTTGTGTGCCAGTGGCAGTGATG

– Code controls the making of proteins (which control traits: ex blood type, flower color )

– QUESTION OF THE DAY: • How can we decode that message?

Page 6: Chapter 12

Decode Message• Message needs to go from nucleus to

ribosomes….

Page 7: Chapter 12

DNA vs RNA DNA- deoxy, ribo, nucleic, acid

RNA – ribo, nucleic, acid

Double strand Single strand

Deoxyribose (sugar) Ribose (sugar)

Nitogen Bases: ATCG Nitrogen Bases: AUCG

JOB- instructions for all cells JOB: protein synthesis (needed by body for growth and repair)

Page 8: Chapter 12

Meet the RNA family …

• mRNA travels to ribosomes• rRNA is present at the ribosomes• tRNA- transfers the amino acids to the

ribosomes

Page 9: Chapter 12

Transcription

• Step 1: mRNA goes over to the DNA in the nucleus, and finds the original strand

• Step 2: mRNA looks only for the section that it needs to copy

• Step 3: mRNA finds the section and copies it but in its own complementary language

• Step 4: mRNA goes to Ribosome with message

Page 10: Chapter 12

Translation • Step 1: mRNA arrives at the ribosome,

and rRNA is already there waiting….• Step 2: mRNA and rRNA show the section

of the code in codons in (mRNA language) to all the present tRNA’s

• Step 3: the tRNA’s look at their anticodons, and see which codons they match. They will match their corresponding codons with the right amino acid.

• Step 4: After a bunch of amino acids line up- proteins are made….

Page 11: Chapter 12
Page 12: Chapter 12
Page 13: Chapter 12
Page 14: Chapter 12

• http://www.youtube.com/watch?v=983lhh20rGY

• Video transcription and translation

• Video replication• http://www.youtube.com/watch?

v=hfZ8o9D1tus&feature=related

Page 15: Chapter 12

12-4

• Mutations: change in the genetic material • …. Now and again cells make mistakes in

copying DNA

Page 16: Chapter 12

2 types of Mutations

• Gene mutations • Chromosomal mutations

Page 17: Chapter 12

Gene Mutations

• Occur on a single gene • TAC GCA TGG AAT • Code is read in 3 base

codons• Thefatcatandratran- say?

Page 18: Chapter 12

3 types of gene mutations

• Point Mutations occur at 1 spot• TAC GCA TGG AAT – original • Substitution?• Insertion?• Deletion ?

Page 19: Chapter 12

• TAC GCA TGG AAT – original• Substitution

– TAC GGA TGG AAT • Insertion

– TAC GGC ATG GAA T • Deletion

– TAC GAT GGA AT

Page 20: Chapter 12

Which are the 2 worst kinds of point mutations? Why?

• THE FAT CAT RAN – original • Substitution

– THH FAT CAT RAN • Insertion

– THE FAA TCA TRA N • Deletion

– HEF ATC ATR AN

Page 21: Chapter 12

Which are the 2 worst kinds of point mutations? Why?

• Changes message which changes the amino acid that is made- wrong protein made …

Page 22: Chapter 12

Chromosomal Mutations • Changes in the …

– Number of chromosomes• Down’s Syndrome

– Or structure of chromosome• Deletion• Duplication• Inversion• Translocation

Page 23: Chapter 12

See chrom. Mut. Chart

• http://www.pearsonsuccessnet.com/snpapp/iText/products/0-13-181118-5/ch12/sb7015a04.html

Page 24: Chapter 12

• Deletion- 1 section is deleted• Duplication- 1 section is doubled• Inversion- 1 section is reversed• Translocation -part of one

chromosome breaks off and attaches to another.

Page 25: Chapter 12

Mutations are good, bad or neutral

• Neutral• Bad: cause dramatic changes in protein

structure… body cannot function properly• Good.. Can create variability in species,

can be beneficial, if environment– Ex- AIDS resistant gene– Polyploidy (extra chromosomes)

• Banana and citrus fruits are larger and stronger

Page 26: Chapter 12