cell culture and grovvth factor hemangiosarcoma · 2005-02-12 · cell culture and basic fibroblast...
TRANSCRIPT
CELL CULTURE AND BASIC FIBROBLAST GROVVTH FACTOR
EXPRESSION IN CANINE HEMANGIOSARCOMA
A Thesis
Presented to
The Faculty of Graduate Studies
of
The University of Guelph
by
OLIVER ADAM KAMlL TROCHTA
In partial fulfilment of requirements
for the degree of
Master of Science
August, 1998
O Oliver Trochta, 1998
National Library w u ,,",da Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services seMces bibliographiques
395 Wellington Street 395. rue Wellington OttawaON K 1 A W OttawaON KIAON4 Canada Canada
The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/fh, de
reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés - reproduced without the author's ou autrement reproduits sans son permission. autorisation.
Canada
ABSTRACT
CELL CULTURE AND BASIC FlBROBLAST GROVVTH FACTOR EXPRESSION CANINE HEMANGIOSARCOMA
Oliver Adam Trochta, B.Sc. University of Guelph, 1998
Advisor: Robert M. Jacobs
Hemangiosarcoma is a relatively common tumour of middle-aged to old dogs.
Little is known conceming the biology of this tumour. To inliate work in this area, studies
were designed to: 1) culture hemangiosarcoma cells in the hopes of establishing cell
lines to be used in future studies and 2) examine the expression of basic fibroblast
growth factor (FGF-2) in hemangiosarcomas since this growth factor is involved in
angiogenic proliferation in other tumour systems and may function in an autocrine or
paracnne fashion in canine hemangiosarcorna.
von Willebrand factor (vWF), an endothelial marker, was used to identify and
monitor the in vitro growth of normal and malignant endothelial cells. Of the two growth
media used only M l 31 supplemented with a proprietary microvascular growth
supplement facilitated the short-term culture of vWF positive cells frorn m i n e adrenals
and rarely HS tumours.
Reverse transcriptase polymerase chain reaction pnmen based on the human
FGF-2 cDNA amplified a predicted 390 bp cDNA from canine tissues which showed 93%
sequence homology with the human sequence. The cDNA product used as a probe in
Northem blots, was unable to detect FGF-2 expression in RNA from bovine, hurnan and
canine tissues. Southem blot analysis showed that the probe hybridized to bovine,
human and canine cDNA amplification products. FGF-2 antigen was demonstrated in
hernangiosarcoma cells by irnmunohistochemistry. These results demonstrate that
malignant cells in hernangiosarcoma elaborate FGF-2 and FGF-2 can be detected in
RNA extracted frorn dogs by species specific RT-PCR prirners. The presence of FGF-2
may have an important role in the growth of canine hemangiosarcoma.
I would like to thank the lord above and al1 of my family rnembers new and old.
In particular I would like to thank my mother who put up with al1 of my outlandish
schemes. This is for you chief.
Acknowledgements
I would like to thank Robert Jacobs for providing the opportunity to participate in
this work. I would like to thank Jon LaMarre, Allan King and Brenda Coornber for
their input. My lab mates. fellow grad students and Barbara Jefferson provided
stimulating conversation. thoughtful input and enthusiasm for research.
TABLE OF CONTENTS
List of tables ... ... . . . .. . . . . .. . .. . . . . .. . .. . ... . . . . .. .. . .. . .. . ... ... ... .. . .. . ... .. .
List of figures . .. ... . . . . . . ... .. . . .. . .. ... . .. .. . .. . . . . . .. ... ... ... ... .. . . . . . . . . . . ..
Detailed Table of Contents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Generaf Introduction . . . . . . . . . . . . . . . . . . . . . . . . . -. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ..
Literature Review . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . -. . . . -. . . . . . . . . . . . . . . . -
Purpose of study ... ... ... ... ... ... ... ... ... . .. ... ... ... ... ... ... ... ... ... ... ..- ..
References . . , . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . -. . . . . . . . . . . . . . . . . . . . .. . . . . . . -
Isolation and culture of canine endotheliurn.. . . . . . . . . . . .. . .. . . . . . . . .
Molecular experirnents involving Northern hybridization,
Reverse transcriptase polymerase chain reaction and
Southem hybridization .... . . . .. . . . . . . . .. . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . .
lmmunohistochernical experirnents contrasting basic fibroblast
growth factor expression and von Willebrand factor antigen
distribution in splenic hemangiosarcoma . . . . . . . .. . . . .. . . . . ... . ..
General Conclusions. .. . . . . . . . . . . . . . . . . . . . . . . . . . .. .. . . . . .. . . . . . .. . . . . . . . .. . . . ..
Appendices.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
iii
iv
vi
1
2
20
21
31
iii
LIST OF TABLES
Table 1. Isolation of canine endothelial cells and results of culture in medium 131 supplemented wlh 5% FBS and proprietary endothelial cell growth and attachment factor (Cascade
............................................................ B io log ics)
Table 2. Cell culture attempts using M l 99 (Life Technologies) culture In medium supplemented with 10% FBS (Cansera). endothelial cell growth supplement (Sigma) and gelatin
..................................................... coated dis hes.. 47
Table 3. Summary of irnmunohistochernical staining results in canine HS for antibodies directed against vWF and FGF-2.. 93
Table 4. Detailed summary of immunohistochemical staining results in canine HS for antibodies directed against
...................................................... vWF and FGF-2 93
LIST OF FIGURES
Figure 1. Twenty day culture of canine microvascular cells derived from adrenal tissue. .................................................. 48
Figure 2. Twenty-eight day culture of cells derived from canine adrenal
................................................................... tissue..
Figure 3. Cells derived frorn canine splenic hemangiosarcoma.. .....
Figure 4. Immunoparamagnetic bead selection of canine hernangiosarcoma cells.. ...........................................
Figure 5. Complementary DNA reverse transcriptase polymerase chain reaction (RT-PCR) amplification products. .............
Figure 6. Canine FGF-2 cDNA nucleotide sequence within the p ~ ~ @ 2 . 1 -TOPO plasmid vector (Invitrogen)
...................................................... polylinker region..
Figure 7. Comparison of human basic fibroblast growth factor 18 kDa protein mRNA coding region to canine adrenal FGF-2 cDNA.. .........................................................
Figure 8. Northern analysis of canine splenic total RNA .................
Figure 9. Digoxygenin (DIG)-labeled cDNA probing of RT-PCR amplification products and canine genomic
..................................................................... D NA.
Figure 10. Histological appearance of canine splenic
................................................. hemangiosarcoma..
Figure 11. von Willebrand factor antigen distribution in biopsy and
..................................................... control samples
Figure 12 . ........................................ Control tissue appearance 98
Figure 13 . Representative pattern of FGF-2 immunoreactivity in
........................................ splenic hemangiosarcoma 100
Figure 14 . ........... FGF-2 imrnunoreactivity in normal canine spleen 102
Detailed Table of Contents
Abstract
.................................................................. Acknowledgments i
.. .................................................................. Table of contents ..II
... ........................................................................ List of Tables .III
........................................................................ List of Figures iv
General Introduction ............................................................... -1
................................................................... Literature Review -2
.................................................................... Purpose of Study 20
............................................................................ Refe rences 21
Isolation and cell culture of canine endothelium
Abstract ............................................................................. 31
........................................................................ Introduction 32
......................................................... Materials and Methods 33
Results .............................................................................. 39
Discussion ......................................................................... 42
References ........................................................................ 45
Tables 1 and 2 ...................................................................... 47
............................................ Figure legends and figures 1 to 4 48
vii
Molecular experiments involving northem hybridization . reverse
transcriptase polymerase chain reaction and Southem hybridization
............................................................................. Abstract
Introduction ........................................................................
......................................................... Materials and Methods
.............................................................................. Results
Discussion .........................................................................
........................................................................ Referenœs
........................................... Figure legends and figures 5 to 9
Immunohistochernical experiments demonstrating basic fibroblast
growth factor expression and von Willebrand factor antigen
distribution in splenic hemangiosarcoma
Abstract ............................................................................ 82
........................................................................ Introduction 83
........................................................ Materials and Methods 84
Results ............................................................................. 87
Discussion ........................................................................ 89
........................................................................ References 91
.................................................................... Tables 3 and 4 93
Figure legendsandfigures 10 to 14 ......................................... 94
viii
Appendices
Cell culture techniques
primary culture of canine adrenal microvascular
endothelium ................... ... ......................................
primary culture of canine splenic hemangiosarcoma ..........
........................................ Freezing cell culture material
Binding lectins and antibodies to M-450 DynabeadçB .......
....................... Reverse transcriptase polymerase chain reaction
........................................................... Isolation of total RNA
..................................................................... Northern Blot
............... Northern hybridization and cherniluminescent detedion
Mouse 7s Probe Purification and Quantification
.................... Preparation of LB-broth and LB-Agar plates
............................. Transformation of Competent E . coli
Isolation of plasmid DNA using TRlzolTM Reagent ............
Restriction enzyme analysis and insert purification ..........
Random primer extension labeling of cDNA probes .........
............................................ cDNA Probe quantitation
Canine cDNA probe Cloning, Purification and Labeling
...................... Preparation of LB-broth and LB-Agar plates 131
Transformation and selection of competent cells ............. 131
............ Isolation of plasmid DNA using TRlzoP Reagent 131
ix
Restriction enzyme analysis and insert purification ........... 132
DIG Labeling of canine bFGF probe by PCR .................. 133
................................................................... Southem Blot 136
Southem Hybridization and Cherniluminescent detection ........... 138
bFGF immunohistochemistry and immunocytochemistry ............ 141
von Wlllebrand factor immunohistochernistry and
................................................ immunocytochemistry 144
GENERAL INTRODUCTiON
Studies into the basic biology of neoplastic cells identified blood supply
generation and maintenance as necessary for malignant progression. It appears that
an interaction of growth factors. produced by turnour cells or by normal cells
accompanying tumour cells. is pivotal in this process.'
Today's fundamental goal of antiangiogenic therapy focuses on retuming foci
of proliferating microvessels in neoplastic tissue to their normal resting stateS2
Several newly discovered biomolecules, such as angiostatin and endostatin, have
shown promising results in vitro and in vivo, using mode1 systems. and are now
being used in human clinical
One of the most cornmon malignant tumours of companion animals is the
hemangiosarcorna of dogs.= Surprisingly, this tumour is extremely rare in human
beings indicating that dogs have a unique susceptibility which may have a genetic
basis. Hemangiosarcoma is a malignant tumour of endothelial c e k 6 Tumoors most
often arise in the spleen and by the time of diagnosis there is usually widespread
met as ta si^.^ Treatment of these tumours is usually unrewarding; most affected dogs
die within a few weeks of diagno~is.~ Some limited soccess has been achieved with
combination rnodality treatments. It is important to learn more about the biology of
canine hemangiosarcorna because of the relatively high frequency of this tumour in
the canine population, difFiculties in diagnosing the turnour in its early stages, disrnal
results with treatment. At present, only the most basic aspects of
immunophenotyping of canine hemangiosarcoma are known. The work presented
here was to initiate studies in the cell and molecular biology of the canine
hernang iosarcoma cell.
LITERATURE REVIEW
Neoplasia and angiogenesis.
Cancer is defined as a cellular tumor. the natural course of which is fatalmg
This definition implies that cancer cells are malignant. It is common for malignant
cells to display properties of invasion and metastasis (distant implants of the
primary esi ion).'^ Tumor cells that possess these properties are characterized by
anaplasia. or dedifferentiation. Simply. anaplastic cells have stopped expressing
a normal phenotype with respect to their normal neighbours. They express a
morphology and functionality that is more akin to their ancestral progenitors."
Associated with this more primitive phenotype may be the alteration of normal
control mechanisms that regulate such things as. the cell cycle 12, intercellular
communication and cellular signaling.j3
The causes of dedifferentiation leading to malignant neoplasia are
cornplex. Their elucidation has been a major area of research in the field of
cancer biology for decades. Factors that cause tumoun usually influence the cell
at the genetic level through mutations. Cells carrying mutations are recognized
as being inliated or potentially cornmitted to following the pathway to
autonomous growth. Agents that bring about clonal proliferation of initiated cells
are called promoters. The net genetic balance in transformed cells drives
malignant progression. for example. by either increased expression of
oncogenes or decreased expression of tumour suppressor genes.12 In other
words. the cell is no longer responsive to normal genetic regulation with respect
to cell cycle checkpoints and programmed ceIl death (apoptosis). Absence of
normal regulatory function is the hallmark of the malignant phenotype.
The natural history of metastasis can be illustrated using a multi-step
model of carcin~genesis.'~ In its simplest form. the sequence begins with a
genetic transformation that progresses by clonal expansion eventually forming a
heterogenous but monotypic population of cells which comprise a solid tumour.
Neovascularization facilitates the growth of the solid tumour beyond a few
rnillimetres. As malignant cells proliferate unstable clones may be generated.
Local invasion of host stroma, followed by detachment and embolization in
surrounding vasculature provides opportunity for seeding, extravasation. and
proliferation in distant tissue. This assumes that the metastatic cells possess the
capability of surviving the host immune systern and are able to respond to organ
specific growth factors." Once the cell becomes established at a distant site. the
entire process can repeat itself leading to a "metastasis of metastases." "
The proliferation and suwival of any cell, rnalignant or othenrvise. is based
on its ability to respond to growth factors and to remove toxic substances.
Indeed, multicellular organisms are adapted to flow rather than diffusion as the
primary mechanisrn of nutrient transport and removal of metabolites. Fluid flow
through cell layers is essential in creating steep gradients in oxygen and nutrient
concentration. Recent work has compared diffusion rates of fiuid through pre-
ovulatory follicles and avascular tumour spheroids. Water was found to diffuse at
a slower rate through the viable outer layerç as compared to the inner core of
small tumor spheroids. The slower rate indicated intracellular movernent of water
as opposed to the faster extracellular interstitial movement of water around dead
cells. Histological and immunohistochemical follow-up confirrned central necrosis
in the tumour spheroidd6 This work corroborates the earlier observations of
Thomlinson and Gray that tumour cells located as close as 180 Fm to tumour
stroma and vasculature are completely anoxic and undergo necrosis." In fact.
recent mathematical modeling of solid tumour spheroids estimates two distinct
rates of neoplastic proliferation based on vascu~arity.'~ The pioneering work of
Folkman and others in the 1960s and 1970s, has provideci evidence that in vitro
growth of tumour masses beyond 2-3 mm depends on the development of an
adequate blood supply. 1 9-22
it is important to differentiate vasculogenesis and angiogenesis before
beginning a discussion of neovascularization. Vasculogenesis occurs when blood
vessels are formed from differentiating endothelial cells derived from
mesodemal precursors. Embryonic heart and large vesse1 primordia are forrned
by vasculogenic events. Angiogenesis involves the proliferation and migration of
endothelial cells from pre-existing vascular structures into either avascular areas,
such as the brain and cornea, or involves the remodeling of capillary vasculature
to form large and small vessels. Vasculogenesis is known only to occur in
embryogenesis. while angiogenesis is found in a number of instances such as
normal embryonic and postnatal tissue development, adult female reproductive
cycles, and pathologic conditions of wound heaiing repair. rheumatoid disease
and tumorigenesis. 23-25
The importance of neovascularization in neoplasia has been a
serendipitous rea~ization.~~ Early work with canine and rabbit tissue in isolated
glass chambers, demonstrated that these tissues could support the growth of
mouse melanoma cells. However, the tumours only grew to a 1-2 mm diameter
and were not vascularized. As long as the organ cultures were maintained in vitro
the tumours remained alive but could not increase in size. Once the neoplasms
were transplanted inio syngeneic mice, growth was renewed and the tumours
grew to 1 cm3. demonstrating that blood supply was imperative for tumour
growth. Other indirect observations. made by Folkman. have indicated that
tumour types most likely to be infiuenced by a microvascular supply fom a
hierarchy. The growth of parenchymal tumours of the brain appear to be very
dependent on endothelial proliferation, whereas, carcinomas and sarcomas, are
increasingly less dependedg Mitotic rates in carcinoma cells and quiescent
capillary endothelial cells are different. Work by Tannock shows the rnitotic index
for normal mouse capillary endothelia is low (turn over time 50 hr) compared with
C3H mouse mammary tumours (22 hr tum over). This suggests that extension of
the capillary network into the growing tumour is limited by the rate of division of
the microvascular endothelial cells. thereby limiting the growth of the turno~r.'~
Normal human capillary endothelia have a turn over rate measured in the
hundreds of days2* Although most solid turnours are highly vascular, their
vessels differ from normal capillary v e s ~ e l s . ~ ~ lntratumor endothelial cells
proliferate 45 times faster than endothelial cells in adjacent benign tissue.
Microvascular cells from tissues with high turn over rates have doubling times
similar to the endothelia of tissues with slow tum over rates.3o The non-
proliferative capillary endothelial cells surrounding the tumour become altered
phenotypimlly. This change. which facilitates tumour neovascularization, is
known as the switch to the "angiogenic phenotype". The switch to the angiogenic
phenotype constitutes an imbalance in the local equilibrium between positive and
negative endothelial growth regu~ators.~' Discussion of these reg ulaton can be
presented utilizing three broad categories; they are cellular. biochemical and
molecular endothelial mechanisms which promote or restrict the
neovasculalization of turnours.
Cellular Properties
The endothelial cell is the most sensitive of al1 cells to growth control by
~ h a p e . ~ ~ ' ~ ~ Control of mechanical forces in cell culture conditions is necessary to
properly monitor the interaction of growth factors, hormones and cytokines." It
has been demonstrated that mechanical forces generated by the binding of
insoluble molecules such as fibronectin or collagen to integrin receptors allow the
cell to pull against the extracellular matrix. The generated tension across the
cytoskeletal network can confer specificity to integrin receptors that are able to
activate certain signaling pathways that prornote capillary formation.35 These
signaling pathways include upregulation of cyclic adenosine monophospate
(CAMP) or activation of the phosphoinositol-3 kinase system. Further stretching
of the cell's outer membrane can expedite entry into DNA synthesis. When cell
spreading in vitro covers less than 500 endothelial cells remain refractory to
growth factors such as basic fibroblast growth factor (bFGF). If however, the cells
are allowed to spread beyond 500 then a constant concentration of bFGF
leads to upregulateû DNA synthesis and proliferation. lngber has shown that it is
specifically the shape of the nucleus and not necessarily the area or the shape of
the cell membrane that pemits gene expression.36 Experiments involved photo-
etching fibronectin attachment points ont0 a non-adhesive sub- stratum that
allowed the endothelial cells to be stretched into any arrangement. When
stretching of the outer membrane changed the nuclear area beyond 60-70 Fm
(which correlated with increasing nuclear area), DNA synthesis occurred.
Perhaps vasodilation in vivo that precedes angiogenesis and the active migration
of cells in vitro, may function either by changing the nuclear shape or decreasing
the confluence of endothelial cells in order to make them more susceptible to
mitogenic stirnu~i.~' Therefore, the degree of endothelial cell migration and
proliferation in vitro has become a simple and valuable assay for assessing
ang iogen ic potential.
Cell types that associate or interact with the endothelium in vivo are able
to act as angiogenic modifiers. Pericytes are found in close apposition to capillary
endotheliurn in vivo. Pericytes in vitni secrete transforrning growth factor beta
(TGF-P) which binds to endothelial cells and can suppress their pro~iferation.~~
Further study has revealed that when pericytes or endothelial cells are cultured
alone they produce a latent form of TGF-P. In order for suppression of
proliferation to occur, pericytes and endothelial cells must be cultured together. It
has been observed that both cell types produce plasminogen activators (PAS)
that lead to formation of plasmin; an enzyme with a broad trypsin-like specific
activity capable of cleaving the core protein of proteoglycan. Incubation of the CO-
cultures with anti-PA antibody abrogated the inhibition of angiogenesis. Plasmin
rnay therefore play a role in acüvating the latent TGF-pl-like molecule to an
active fom, thereby inhibiting bovine aortic endothelial cell (BAEC)
pro~iferation.~~ Pericytes may also function as guiding structures for propagating
endothelial c e ~ l s . ~ ~
In addition to secreting tumouricidal molecules, macrophages demonstrate
the ability to increase proliferation and induce chernotaxis of bovine aortic
endothelial cells (BAECs) in vitro by secreting turnour necrosis factor* (TNF-a).
40;4' Quantifiable new vesse1 formation occurs in pathological conditions of the
comea, which is nomally an avascular structure. For this reason the cornea
serves to model angiogenic potential of foreign substances implanted into it.
Previous work by Polverini found that turnour associated macrophages isolated
from a 3- methycholanthrene-induced fibrosarcoma were able to induce
neovascularkation in the cornea of syngeneic rats. Significantly decreased
angiogenic potential occurred when whole tumour cell suspensions stripped of
macrophages were implanted into other ~ o r n e a s . ~ ~ Different conditions within the
tumour spheroid itself may modulate macrophage angiogenic activity. It appears
that low oxygen tension and high lactate concentrations stimulate the release of
angiogenic factors from macrophages. Macrophages cultured under hypoxic
conditions secreted an active angiogenesis factor into the medium." Activated
macrophages can promote neovascularkation by secreting such endothelial
chernotactic factors as interleukin-8 (IL-8), TNFu and platelet activating factor
(PAF).";~~ Both TNFa and PAF induced neovascularization are mediated by
nitric oxide (NO) expression which appears to be independent of the angiogenic
effect of ~FGF." Tumor associated macrophages can indirectly in hibit
angiogenesis by secreting an elastase capable of cleaving angiostatin from
circulating plasminogen, permitting the expression of angiostatin a ~ t i v i t y . ~ ~ The
inhibitory effects of angiostatin will be discussed below.
Mast cells also take part in angiogenic pro cesse^.^^^^^ Mast cells are
observed histologically at sites of angiogenesis and f ibr~sis.~* Indirect evidence
for mast cell involvement in angiogenesis cornes from mast-celldeficient mice
injected with tumor cells. These mice demonstrated decreased
neovascularization at the tumor periphery, reduced turnor size relative to control
mice, and an absence of met as ta se^.^' Direct evidence for angiogenic
association came from work which demonstrated that heparin release from
peritoneal mast cells stimulated the in vitro migration of microvascular and large
vesse1 endothel i~rn.~~ In addition to heparin release. tissue culture of mu rine liver
mast cells has revealed secretion of a powerful angiogenic peptide known as
basic fibroblast growth factor (FGF-2). Regulation experiments show that FGF-2
release is modulated by TGF-P in a positive fashion and by TNF-a in a negative
r n a n n e ~ ~ ~ Mast cells are also stimulated by angiogenic factors which include
FGF-2, vascular endothelial growth factor (VEGF), and platelet deriveci growth
factor-AB (PDGF-AB)." Recently, a new angiogenic factor that promotes
vascular tube formation in human dermal microvascular endothelial cells has
been characterized based on tryptase inhibition studies of mast c e l ~ s . ~ ~
Biochemical and Molecular Pmperties
Biomolecules that are part of the extracellular matrix (ECM) play a
significant role in angiogenic modulation. The ECM is acknowledged as a
repository for endothelial growth factors, inhibitors, and their respective
recepton. It is recog nized that growth factors (angiogenic polypeptides and
cytokines), enhance neovascularization by influencing capillary endothelium
directiy. Invasion of rnicrovascular cells into the surrounding tissue by proteolytic
cleavage of stroma1 constituents, chernotactic migration of endothelial cells, and
proliferation of the remaining endothelium typifies the angiogenic process
directed by growth factors.56:" Common growth factors expressed in solid
tumours include epidermal growth factor (EGF), hepatocyte growth factor(HGF) /
scatter factor (SF), PDGF, TGF-f3 in vivo, and the fibroblast growth factors
(FGFS).
lnhibitors of angiogenesis operate by interfering with either invasion,
migration or proliferation of endothelial cells. A brief list includes the two most
powerful angiogenic antagonists known: endostatin; an 18 kDa internal fragment
from collagen type XVlll and anqiostatin; a 38 kDa internal fragment of
plasminogen3;4, interleukin twelve (IL-1 2) 59:60, fhrornbo~pondin-1~~;~~, TGF-PI
plasminogen activator inhibitor-1 (PAI-1)63, platelet factor 464;65,66 and interferon
inducible protein -10 (IP-1 O)?'
Basic fibroblast growth factor belongs to a family of nine related
polypeptides of which three are proto-oncogene products. The family members
are: acidic fibroblast growth factor FGF-1 68, FGF-2 69, FGF-3 (int-~)'~, FGF4
(hst-1 kaposi-FGF) 71, FGFQ". FGF-6 (hst-2)73, FGF-7 (keratinocyte growth
FG F-8 (androgen induced g rowth fact~r)'~. and FGF-9 (g lia-activatirtg
factor).76
Heparin, heparan sulfate proteoglycan (HSPG) and related
polysaccharides are now recognized to play key roles in angiogenesis." The
heparin binding property of FGF-2 has greatly assisted in its isolation and
characterization. The FGF-2 protein was initially isolated as a 16.5 kDa 146
amino acid polypeptide from the bovine pituitary gland.78 When both the human
and the bovine form of FGF-2 were cloned it was discovered that the proper
translation product. arising from a putative AUG start codon, was in fact 155
amino a~ids.~' Larger forms of the protein were subsequently isolated and Î t was
reported that FGF-2 existed in four different rnolecular weights, 18, 22, 22.5 and
24 kilodalton (kDa) (1 55. 196, 201 and 21 0 arnino acids respe~tively).'~
Sequence analysis of the three high molecular weight (HMW) forms of FGF-2
demonstrated alternative initiation sites at separate CUG start codons upstream
from the 18 kDa AUG start codon.80 The size of the 18 kDa protein, previously
believed to a preparation artifact, is not a cleavage product of either high
molecular weight FGF-2 polypeptide. The polymorphism of FGF-2 may prove to
be functionally significant.
Imrnunofluorescence microscopy revealed HMW FGF-2 localization
exclusively to the nucleus of fetal cardiac myocytes 811 as opposed to both
cytoplasmic and nuclear appearance of the 18 kDa form. Indeed. the N-terminal
extension of HMW FGF-2 possesses GRGRGR sequence. that the 18 kDa f o m
does not, which rnay direct it to the nucleus.82 The specific distribution pattern of
the different molecular weight forms may be important from a regulatory
perspective. It has been demonstrated that cells transfected with HMW foms of
FGF-2 grow in low serum cell culture conditions even when expressing fibroblast
growth factor receptor - 2 (FGFR-2) lacking the COOH-terminus (dominant
negative receptors). Conversely, cells producing 18 kDa FGF-2 were unable to
migrate, and growth was suppressed when expressing dominant negative
FGFRs. Growth in low serum may be stimulated by the intracellular action of
HMW bFGF through mechanisms independent of the presence of a cell surface
receptor. lt may be that different molecular foms of bFGF act through distinct but
convergent p a t h ~ a y s . ~ ~
Immunohistochernical studies have indicated FGF-2 protein in a range of
normal tissue, tissues undergoing chronic inflammation and n e o p ~ a s i a . ~ ~ : ~ ~ Other
than localization in the basement membrane of nomial and neoplastic endothelial
cells, expression of FGF-2 has been demonstrated in vascular smooth muscle
cells, cultured skin and lung fibroblasts, and glial ~ e l l s . ~ ~ - ~ ~ Since these cell types
are found most everywhere in normal human tissue, it is assumed that FGF-2
expression is widespread in vivo. Indeed, new assay techniques can detect FGF
in the urine of normal subjects. Elevated levels of FGF-2 protein have been
detected in the urine of a group of cancer patients representing a variety of
tumour types.89 Study of FGF-2 at the genetic level in neoplastic tissue,
illustrates normal gene expression. Aberrant gene copy number of FGF-2 is very
rarely observed in human tumours of the breast, ovary and endometri~rn.~~ This
suggests the angiogenic nature of FGF-2 involved in neovascularization is more
complex than conspicuous mutations in other oncogenic polypeptides which lead
to altered protein expression.
Basic fibroblast growth factor signal transduction occurs through high and
low afinity receptors. Heparan sulphate proteoglycans (HSPGs) are low affinity
(Kd=2 X 10'~ - 2 X 2U7 MM) FGF receptors that are found in abundance in the
€CM and cell surfa~e.~' HSPG have been shown to enhance eficacy by
protecting FGF-2 from heat denaturation, acid treatrnent and frorn the action of
proteases.92~93 In effect, FGF-2 is concentrated near the cell surface making it
available to interact with the high affinity tyrosine kinase receptors. In normal
cells, the distinctive heparin binding nature of FGF-2 permits association with the
basernent membrane of cultured ECs until released by heparitinase and
exposure to heparin-like mole~ules.~' It is postulated that HSPG binding provides
long term storage of FGF-2 in the ECM allowing for brief bursts of secretion
during angiogene~is.~~
HSPG receptors also function by enhancing FGF-2 binding to the high
affinity reœptors. Mutant Chinese hamster ovary cells deficient in
glycosaminoglycan synthesis maintain low extracellular heparan sulphate. These
cells transfected with mouse FGFR-1 demonstrated an inability to bind FGF-~.'~
Initial formation of FGF-2 - heparan sulphate complexes are needed prior to
binding and activation of FGF receptors during conditions of growth factor FGFR-
1 interaction.96 These findings led to the dual receptor hypothesis of Klagsbrun
and Baird. They proposed that FGF-2 interaction with HSPG receptors induces a
conformational change in the ligand thus creating a biolagically active form that is
presented to the high af5nity re~e~ to r .~ ' While this illustrated that HSPG
receptors are necessary for FGF-2 and purified FGFR-1 binding, other
researchers have shown that heparin is not required and may only function to
modulate ligand receptor interactiomg8
Four distinct high affinity tyrosine kinase type receptors (Kd=2-20 X 1 O*
"M) have been isolated and the gene products named fibroblast growth factor
receptor-1 (FGFR-l), FGFR-2, FGFR-3, AND F G F R - ~ . ~ ~ ' ~ ~ AI1 four reœptors
share a cornmon structure which includes a signal peptide, two to three
imrnunoglobulin (19)-like loops with an acidic reg ion between the first set of loops.
The intracellular domain consists of a catalytic tyrosine kinase domain, separated
by a kinase insert. In general FGF-2 binds with higher affinity to FGFR-1 and
FGFR-2 splice variants.'03 Intra-cellular signaling events are activated by
dimerization of the FGFRs. One model specific to FGF-2 proposes that the ligand
is bound to FGFR-1 in a ratio of 12 . Such a ratio is facilitated by binding each
FGFR-1 epitope on opposite faces of the FGF-2 monomer to an FGFR-1
rno~ecule.'~~ Ligand binding and receptor dimerization activate protein tyrosine
kinase activity by autop hosphorylation.
FGF-2 acts through a Ras-dependent signaling pathway. Cellular target
proteins such as phospholipase Cy (PLCy) and Ras GTPase activating protein
becorne phosphorylated when binding to the cytoplasmic portion of tyrosine
autophosphorylation sites in the receptor. Oncogenes of the Ras family are
known for their ability to activate transfoming genetic events. Phosphorylation of
the cellular target proteins leads to activation of a kinase cascade composed of
Raf, mitogen activated protein kinase kinase (MEK), and Map kinase (MAPK).
These proteins in-tum activate transcriptional factors which ultimately induce a
variety of down stream angiogenic events. 'O5 A common transcriptional factor
involved in FGF-2 signaling is the CAMP response element 2 (CRE-2) which
activates cellular pro~iferation.'~ FGF-2 stimulated re-entry into the cell cycle is
also modulated by the homeobox gene, Hox 03. The Hox D3 gene induces
urokinase-type plasminogen activator and alpha v beta 3 (avp3) integrin
expression which are essential for endothelial migration and differentiati~n.'~'
Wth ubiquitous distribution in normal vascular and intima1 cells, how is it
that quiesœnt endothelial cells remain refractory to the latent angiogenic
peptide? Perhaps the fact that FGF-2 lacks a proper EWgolgi secretory signal
sequence, indicates that growth factor release is not straighfforward and may
involve an elaborate mechanisrdg Experiments aimed at forcing FGF-2
secretion used chimeric NIH 3T3 cells that secrete FGF-2 via an EWgolgi
dependent pathway. Transformant cells containing fusion of FGF-2 to an altered
secretory signal peptide demonstrated more biologically active growth factor.
These cells underwent morp holog ical alteration in culture and displayed marked
tumourigenicity when implanted in nude mice. Control NIH 3T3 cells transfected
with FGF-2 lacking a signal sequence proliferated in a controlled manner and did
not have high tumourigenic potential in laboratory Further study into
growth factor secretion indicated an ERIGolgi-independent pathway. Drugs that
block secretion of proteins via the classical secretion pathway did not inhibit
release of FGF-2 from COS4 cells (a transient cell expression sy~tern) . '~~ More
recently, a farnily of related compounds named "cardenolides." which inhibit
FGF-2 export, have been identified by Florkiewicz and colleges. Cardenolides
are known to inhibit ion transport activity mediated by Na+.K+-ATPase and have
no effect on the conventional protein secretion. When this inhibitor was added to
COS-1 cells co-transfected with alpha-subunit of Na+, K+-ATPase and FG F-2
expression vectors, FGF-2 release was effectively in hibited . This suggested that
cardenolides rnay play a role in FGF-2 secretion by inhibiting ion transport
activity mediated by ~ a + , K+-ATP~s~."'
Whatever the secretory mechanism, FGF-2 release and reœptor binding
incite three major components of angiogenesis. The primary phase of
neovascularization, endothelial invasion, involves degradation of the perivascular
ECM."' Plasminogen activators (PA), convert the zyrnogen, plasrninogen, into
plasrnin. Plasmin has a broad trypsin-like specific activity and degrades several
ECM components, including the protein core of proteoglycans. FGF-2 released
from endothelial ECM stimulates the degradative effect of urokinase-type
plasminogen activator (uPA), allowing entry of microvascular cells into the
surrounding matrix.'12 The second phase of neovascularization, endothelial cell
migration, is contingent on a pertussis toxin sensitive pathway. Based on
experiments with vascular endothelial cells, the migratory response to FGF-2 is
due to the release of arachidonic acid. the primary fatty acid product of
phospholipase A~."' Proliferafion of €Cs may be modulated in part by nitric
oxide (NO). The endothelial relaxing factor, NO is a potent antiproliferative
substance that is released by a variety of cytokine stimulated cells. A chernical
donor of NO. S-nitroso-N-acetyl-QL-aœtylpenicillamie (SNAP), was able to
inhibl FGF-2 stimulated proliferation in bovine pulmonary arterial ECs in a dose
dependent n~anner.''~ It seems that many factors and pathways act in concert
with FGF-2 to modulate the angiogenic response of the vasculature.
Numerous studies have dernonstrated that the phases of
neovascularization are intimately associated with FGF-2 expression. ln the final
analysis, the switch to the angiogenic phenotype rnay actually depend on the
interplay of a variety of growth factors. The switch may occur with the cornbined
actions of FGF-2 and endothelial cell specific VEGF. The effect of growth factors
added to bovine microvascular cells in culture is typified by cord formation as an
activated phenotype is upregulated. Proliferation and cord formation of bovine
capillary endothelial cells cultured in collagen gels, in the presence of VEGF and
FGF-2, were increased beyond the sum of their individual effects.'15 In a
separate experiment, upregulation of endogenous FGF-2 or addition of
recombinant FGF-2 to cultured endothelial cetls resulted in increased VEGF
expression. Neutralizing monoclonal antibody to VEGF also inhibited FGF-2-
induced endothelial cell proliferation."6 Many synergistic pathways both
inhibitory and stimulatory to be revealed in future experiments with ECs, will aid
in understanding tumour angiogenesis.
Angiogenesis and Hemangiosarcorna
The neoplastic disorder in dogs known as hemangiosarcoma (HS),
presents an interesting example of neovascularization. To reiterate, solid
tumours cannot grow beyond a few milfimeters without creation of a supportive
blood supply. Once the vascular network has been established. malignant cells
have a chance to proliferate and metastasize. But, what if the lesion already
cornes with its own vascular channels? This implies that a neoplasm would
possess immediate access to metastatic pathways and would not be subject to
the gmwth limitations of insuficient microvasculature. Time and energy would not
have to be expended on traversing nomal tissue boundaries. HS is a fascinating
case of neovascularization because the ECs themselves are neoplastic.
The tumour is most prevalent in large chested dogs such as the Geman
shepherd and retrievers. In a cohort of 302 animals, the breed prevalence of HS
and hemangioma in German shepherds comprised twelve percent of al1 tumour
cases reviewed? There seems to be no sex predilection. Affected dogs are
between five and thirteen years of age.'18 The disease is typified by three
separate primary tumour locations each of which possess distinct biology.
Cutaneous HS usually presents as an easily excised , benig n mass. However,
more infiltrative lesions c m be metastatic. Postoperative survival times Vary,
depending on clinical staging. extensiveness of the lesion and age."' Solar
radiation may play an etiological role.'"
Cardiac HS is an additional fom which usually manifests as a right
auicular mass, although left ventricular lesions do arise.'*' If left unchecked,
dyspnea, chronic fatigue and ultimately heart failure result.'* Sudden death may
result from cardiac tamponade.
Lastly. splenic HS appears to be the most frequent presentation of this
neoplasm in dogs. The splenic turnour is characterized by irregular vascular
channels fonned by cells that are poslive for endothelial markers6 Channels are
lined with immature endothelial cells that appear spindle shaped with plump
hyperchromatic nuclei. Diagnosis can be difficult bemuse splenic HS can present
with associated hematomas that may mask the lesion in the absence of
metastasis. Clinical signs include lethargy, anemia. occasional rupture and
abdominal bleeding. In a study designed to determine the potential benefits of
splenectomy, 83% of dogs with nonneoplastic-related hematomas. and only 31%
of dogs with hemangiosarcoma, with or without associated hematornas, were
alive at two months. The observed twelve month post-operative survival times
dropped even further to 64% and 7%. respective^^.'^^ In addition to surgery,
treatment includes chernotherapy and radiotherapy. however. the prognosis
remains grim. 8; 1 24
Purpose and Objectives of Study
Widespread interest in antiangiogenesis research has generated
potentially effective therapies. Demonstrated expression of an angiogenic
phenotype (adivated rnicrovasculature) detemiines the level of invasiveness in
neoplastic disease."' Certain modulators of growth factors involved in
neovascularkation have proven effective in abrogating the growth of some
tu rnou r~ .~~ As part of the process of understanding angiogenesis in animal
disease, it will be important to characterize growth factor involvement. The
autocrine or paracrine nature of growth factors may be important in the
pathogenesis of canine HS, as it is in other tumour systems.
Studies were designed to culture cells from splenic cases of canine HS for
use in future experiments. To examine the expression of the FGF-2 growth factor
in hemangiosarcomas, nucleic acid samples from normal and tumour bearing
dogs were tested by reverse transcriptase polyrnerase chain reaction and by
membrane hybridization. Imrnunohistochernistry was used to investigate FGF-2
protein expression in HS tissue sections.
References
1. Reif Ml LeJeune S, Scott PA, et al. Expression of the angiogenic factors vascular endothelial cell growth factor, acidic and basic fibroblast gruwth factor, tumor growth factor beta-l , platelet-derived endothelial cell growth factor, placenta growth factor, and pleiotrophin in human primary breast cancer and its relation to angiogenesis. Cancer Res. 1997;57:963-969.
2. Folkman J. Antiangiogenic Therapy. In: DeVÏta Jr VT, Hellman S, Rosenberg SA, eds. Cancer Phciples & Practice in Oncology. 5 Ed. Philadelphia RA: Lippincott-Raven, 1997;3075-3085.
3. O'Reilly MS. Holmgren L, Shing Y, et al. Angiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma [see comments]. Ce11 l994;79:315-328.
4. O'Reilly MS, Boehm T, Shing Y, et al. Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Ce11 1997;88:277-285.
5. Moulton JE. Tumors in domestic animals. In: Anonymous 2 Ed. l978;35-36.
6. von Beust BR, Suter MM, Surnmers BA. Factor VIII-related antigen in canine endothelia1 neoplasms: an immunohistochemical study. Vef. Pathol. l988;25:251-255.
7. Zhao Dl Yamaguchi R, Tateyama S. et al. Canine splenic hemangiosarcoma with abdominal dissemination. J. VetMed. Sci. 1994;56:753-755.
8. Ogilvie GK, Reynolds HA, Richardson RC, et al. Phase II evaluation of doxonibicin for treatment of various canine neoplasms. J.Am. Vet. MedAssoc. 1989; 195: 1580-1 583.
9. AnonymousDorland's lllustrated Medical Dictionary. 27 ed. Philadelphia PA: W.B. Saunders, 1988;261-261.
I O . Fidler IJ, Gersten DM, Hart IR. The biology of cancer invasion and metastasis. Adv. Cancer Res. 1 978;28: 149-250: 149-250.
1 1. Pearson RD. Cellular heterochrony and neoplasia. Med. Hypotheses. 1 982;8:23l- 235.
12. Kastan MB. Molecular Biology of Cancer: The Cell Cycle. In: DeVita Jr VT. Hellman S, Rosenberg SA, eds. Cancer PMciples and Practices of Oncology. 5 Ed. Philadelphia PA: Lippincott-Raven, 1997; 121 -1 34.
13. Waldmann V, Rabes HM. What's new in ras genes? Physiological role of ras genes in signal transduction and significance of ras gene activation in tumorïgenesis. Pathol. Res. Pract. 1996; 192:883-891.
14. Fidler IJ. Critical factors in the biology of human cancer metastasis: twenty- eighth G.H.A. Clowes mernorial award lecture. Cancer Res. 1 990;50:6130-6138.
Fidler IJ. Molecular Biology of Cancer: Invasion and Metastasis. In: DeVita Jr VT, Hellman S. Rosenberg SA. eds. Cancer Pnnciples 8 Practice of Oncology. 5 Ed. Philadelphia PA: Lippincott-Raven, 1 997; 1 35-1 52.
Neeman M, Abramovitch R, Schiffenbauer YS, et al. Regulation of angiogenesis by hypoxic stress: from solid tumoun to the ovarian follicle. /nt. J.Ewp. Pathoi. 1 997;78:57-70.
Thomlinson, R. H. and Gray, L. H. The histological structure of some human lung cancers and the possible implications for radiotherapy. Br.J.Cancer 9, 539. 1955.
Orne ME, Chaplain MA. A mathematical model of the first steps of tumour-related angiogenesis: capillary sprout formation and secondary branching. !MA. J. Math. Appl. Med. Biol. 1 996; 1 3:73-98.
Folkman J. Tumor angiogenesis: therapeutic implications. N. Engl.J.Med. 1971 ;285: 1 4 82-1 186.
Cavallo Tl Sade R, Folkman J, et al. Tumor angiogenesis. Rapid induction of endothelial mitoses dernonstrated by autoradiography. J. Ce11 Biol. 1 972;54:408420.
Gimbrone MAJ, Leapman SB, Cotran RS, et al. Tumor dorrnancy in vivo by prevention of neovascularization. J.Exp. Med. 1972; l36:261-276.
Knighton D, Auspnink Dl Tapper D, et al. Avascular and vascular phases of tumour growth in the chick embryo. 8r.J. Cancer l977:35:347-356.
Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1 995; 1 :27-31.
Hanahan O, Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell 1996;86:353-364.
Suri Cl Jones PF, Patan S, et al. Requisite role of angiopoietin-1, a ligand for the TIE2 receptor, during embryonic angiogenesis [see comments]. Ce11 lW6;87:Il7l-?l8O.
Folkman J, Cole P. Zimmerman S. Tumor behavior in isolated perfused organs: in vitro growth and metastases of biopsy matenal in rabbit thyroid and canine intestinal segment. Ann. Surg. 1966; 'i64:491-502.
Tannock IF. Population kinetics of carcinoma cells, capillary endothelial cells, and fibroblasts in a transplanted mouse mammary tumor. Cancer Res. 1970;30:2470-2476.
Denekarnp J. Review article: angiogenesis. neovascular proliferation and vascular pathophysiology as targets for cancer therapy. 6r.J.Radiol. 1993;66:181- 196.
Folkrnan J, Cotran R- Relation of vascular proliferation to tumor growth. lnt- Rev. Ekp. Pathol. 1 976; I6:207-48:2Oï-Z48.
Hobson B, Denekamp J. Endothelial proliferation in tumours and nomal tissues: continuous labelling studies. Br. J. Cancer 1984;49:405-413.
Folkman J. Angiogenesis and angiogenesis inhibition: an overview. EXS. 1 997;79: 1-8: 1-8.
Folkrnan J, Haudenschild C. Angiogenesis in vitro. Nature 1980;288:551-556.
Wong JY, Langer R, lngber DE. Electrically conducting polymers can noninvasively control the shape and growth of mammalian cells. Proc.Nat1.Acad.Sci.U.S.A. 1994;91:3201-3204.
Sin5Y.i R, Kumar A, Lopez GP, et al. Engineering cell shape and function. Science 1 994;264:696-698.
lngber DE, Folkman J. Mechanochernical switching between growth and differentiation during fibroblast growth factor-stimulated angiogenesis in vitro: role of extracellular matrix. J. Ce11 Biol. 1 989; 1 09:317-330.
lngber DE. Fibronectin controls capillary endothelial ceIl growth by modulating ceII shape. Proc. Natl.Acad. Sci. U. SA. 1 99O;87: 3579-3583.
Antonelli-Orlidge A. Saunders KB, Smith SR, et al. An activated fom of transfoning growth factor beta is produced by cocultures of endothelial cells and pericytes. Proc. Nat/. Acad. Sci. U.S.A. 1 989;86:45444548.
Sato Y, Rifkin DB. Inhibition of endothelial cell rnovement by pericytes and smooth muscle cells: activation of a latent transfoming growth factor-beta 1-like molecule by plasmin during coculture. J. Ce11 Biol. 1989; 109:309-315.
Nehls V, Denzer K, Drenckhahn D. Pencyte involvement in capillary sprouting dunng angiogenesis in situ. Cell Tissue Res 1992;270:469474.
Fidler IJ. Macrophages and metastasis-a biological approach to cancer therapy. Cancer Res 1985;45:47144726.
Leibovich SJ, Polverini PJ, Shepard HM, et al. Macrophage-induced angiogenesis is rnediated by tumour necrosis factor- alpha. Nature 1987;329:630-632.
Polverini PJ, Leibovich SJ. Induction of neovascularkation in vivo and endothelial proliferation in vitro by tumor-associated macrophages. Lab-lnvest. 1 984;51:635-642.
Knighton DR, Hunt TK, Scheuenstuhl H, et al. Oxygen tension regulates the expression of angiogenesis factor by macrophages. Science 1983;221: 1283-1 285.
Camussi G, Montrucchio G, Lupia E, et al. Angiogenesis induced in vivo by hepatocyte growth factor is mediated by platelet-activating factor synthesis fmm macrophages. J.lrnmuno1. 1 997: 158: 1 302-1 309.
Koch AE, Polverini PJ, Kunkel SL, et al. Interleukin-8 as a macrophage-derived rnediator of angiogenesis [see comments]. Science l992;258: l79&l8Ol.
Montrucchio G, Lupia E, de Martino A, et al. Nitric oxide mediates angiogenesis induced in vivo by platelet- activating factor and tumor necrosis factor- alpha. Am. J. Pathol. 1997; 151 557-563-
Dong 2, Kumar R, Yang X, et al. Macrophage-deflved metalloelastase is responsible for the generation of angiostatin in Lewis lung carcinoma. Ce11 l997;88:8Ol-8l O.
Marks RM, Roche WR, Czerniecki M, et al. Mast cell granules cause proliferation of human microvascular endothelial cells. Lab.lnvest- l986;55:289-294.
Roche WR. Mast cells and tumour angiogenesis: the tumor-mediated release of an endothelial growth factor from mast cells. /nt. J. Cancer 1985:36:721-728.
Qu Z, Liebler JM, Powers MR, et al. Mast cells are a major source of basic fibroblast growth factor in chronic infiammation and cutaneous hemangiorna. Am. J. Pathol. 1995; 147:564-573.
Dethlefsen SM, Matsuura N. Zetter BR. Mast cell accumulation at sites of murine tumor implantation: implications for angiogenesis and tumor metastasis. Invasion Metastasis 1 994; 1 4: 395-408-
Azizkhan RG, Azizkhan JC, Zetter BR, et al. Mast cell heparin stimulates migration of capillary endothelial cells in vitro. J. Exp. Med. 1980; 1 52:93l -944.
Qu 2, Huang X, Ahmadi P, et al. Synthesis of basic fibroblast growth factor by murine mast cells. Regulation by transfoming growth factor beta, tumor necrosis factor alpha, and stem cell factor. 1nt.Arch.Allergy Immunol. 1 998; 1 15:47-54.
Gwber BL, Marchese MJ, Kew R. Angiogenic factors stimulate mast-cell migration. Blood 1 995; 8612488-2493.
Blair RJ, Meng H, Marchese MJ, et al. Human mast cells stimulate vascular tube formation. Tryptase is a novel. potent angiogenic factor. J.Clin Invest. 7 997;99:2691-2700.
Gross JL, Moscatelli D, Rifkin DB. Increased capillary endothelial ceil protease activity in response to angiogenic stimuli in vitro. Pmc.Natl.Acad. Sci. U. S.A. 1 983;80:2623-2627.
Herblin WF, Gross JL. Inhibition of angiogenesis as a strategy for tumor growth control. Mol. Chem. Neuropathol. 1 Q94;2l: 329-336.
Larnszus K, Jin L, Fuchs A, et al. Scatter factor stimulates tumor growth and tumor angiogenesis in human breast cancers in the marnmary fat pads of nude mice Lab. lnvest. 1997;76:339-353.
Voest EE, Kenyon BM, O'Reilly MS, et al. Inhibition of angiogenesis in vivo by interleu kin 1 2 [see comments]. J. Nat!. Cancer lnst- 1 995;87: 581 -586.
Watanabe M, McComick KL, Volker K, et al. Regulation of local host-mediated anti-tumor mechanisms by cytokines: direct and indirect effects on leukocyte recruitment and angiogenesis. Am. J. Pathol. 1997; 1 50: 1869- 1880.
Castle VP, Dixit VM, Polverini PJ. Thrombospondin-1 suppresses tumorigenesis and angioçenesis in serum- and anchorage-independent NIH 3T3 cells. Lab-lnvest. l997;77:5l-6l.
Tolsma SS, Volpert OV, Good DJ, et al. Peptides derived frorn two separate domains of the matrix protein thrombospondin-1 have anti-angiogenic activity . J. Ce// Biol. 1 993; 1 22:497-511.
Pepper MS, Ferrara N, Orci L, et al. Vascular endothelial growth factor (VEGF) induces plasminogen activators and plasminogen activator inhibitor-l in microvascular endothelial cells. Biochem. Biophys. Res. Commun. 1991 i l81 1902-906.
Gupta SU, Hassel T, Singh JP. A potent inhibitor of endothelial ce11 proliferation is generated by proteolytic cleavage of the chernokine platelet factor 4. Proc. NatLAcad. Sci. U.S.A. 1 995;92:7799-7803.
Perollet C, Han ZC, Savona C, et al. Platelet factor 4 modulates fibroblast growth factor 2 (FGF-2) activity and inhibits FGF-2 dimerization. Blood 1 998;91:3289-3299.
Strieter RM, Polverini PJ, Arenberg DA. et al. Role of C-X-C chemokines as regulators of angiogenesis in lung cancer. J. Leukoc.Bioi. l995;57:752-762.
Luster AD, Greenberg SM, Leder P. The IP-10 chemokine binds to a specific ce11 surface heparan sulfate site shared with platelet factor 4 and inhibits endothelial ceil proliferation. J.Grp.Med. 1995; l82:219-23I.
Jaye M. Howk R, Burgess W. et al. Human endothelial cell growth factor: cloning, nucleotide sequence. and chromosome localkation. Science .
1 986;233:541-545.
Abraham JA, Whang JL, Tumolo A, et al. Human basic fibroblast growth factor: nucleotide sequence and genomic organization. EMBO J. 1986;5:2523- 2528.
Dickson C, Deed R, Dixon M, et al. The structure and function of the int-2 oncogene. Pmg. Growth Factor. Res. 1 989; 1 : 123-1 32.
Sakamoto Hl Mori M, Taira Ml et al. Transfoming gene from hurnan stomach cancers and a noncancerous portion of stomach rnucosa. Pmc. Natl. Acad. Sci. U. S.A. 1 986;83:3997-4001.
Zhan X, Bates B. Hu XG, et al. The human FGF-5 oncogene encodes a novel protein related to fibroblast growth factors. Mol. Ce11 Biol. 1 988;8:3487- 3495.
Marics 1, Adelaide J, Raybaud F, et al. Characterization of the HST-related FGF.6 gene, a new member of the fibroblast growth factor gene family. Oncogene 1989:4:335-340.
Rubin JS, Osada Hl Finch PW, et al. Purification and characterization of a newly identified growth factor specific for epithelial cells. Proc. Natl. Acad. Sci. U. S.A. 1 989;86:802-806.
Tanaka A, Miyamoto K, Minamino N, et al. Cloning and characterization of an androgen-induced growth factor essential for the androgen-dependent growth of mouse mammary carcinoma cells. Proc.Natl.Acad. Sci. U. S A 1 992;89:8928-8932.
Miyamoto M. Naruo K. Seko C, et al. Molecular cloning of a novel cytokine cDNA encoding the ninth member of the fibroblast growth factor family, which has a unique secretion property. Mol. Cell Biol. 1993; 1 3:4251-4259.
Folkman J, Shing Y. Control of angiogenesis by heparh and other sulfated polysaccharides. Adv. Exp.Med.Bio1. 1 992;313:355-64:3S-364.
Esch F, Baird A, Ling N, et al. Primary structure of bovine pituitary basic fibroblast growth factor (FGF) and cornparison with the amino-terminal sequence of bovine brain acidic FGF. Proc. Nafl.Acad. Sci. U.S.A. I98S;82:65O%65ll.
Florkiewicz RZ, Sommer A. Hurnan basic fibroblast growth factor gene encodes four polypeptides: three initiate translation from non-AUG codons [published erratum appean in Proc Natl Acad Sci U S A 1990 Mar;87(5):2045]. Proc. NatLAcad. Sci U. S.A. 1 989; 86: 3978-398 1.
Prats H, Kaghad M, Prats AC, et al. High molecular mass forms of basic fibroblast growth factor are initiated by alternative CUG codons. Proc.Natl.Acad. Sci. U. S.A. l989;86: 1 836-1 840.
Pasumarthi KB, Doble BW, Kardami El et al. Over-expression of CUG- or AUG- initiated forms of basic fibroblast growth factor in cardiac myocytes results in similar effects on mitosis and protein synthesis but distinct nuclear morphologies. J. Mol. Ce11 Cardiol. l994;26: 1 045-1 060.
Rifkin DB, Moscatelli D, Roghani M, et al. Studies on FGF-2: nuclear localization and function of high molecular weight foms and receptor binding in the absence of heparin. Mol. Reprod-Dev. 1 994;39: 102-1 04.
Bikfalvi A, Klein S, Pintucci G, et al. Differential modulation of cell phenotype by different molecular weight foms of basic fibroblast growth factor: possible intracellular signaling by the high molecular weight foms. J. Ce11 Biol. 1 995; 1 291233-243.
Cordon-Cardo C, Vlodavsky 1. Haimovitr-Friedman A, et al. Expression of basic fibroblast growth factor in normal human tissues. Lab.lnvest. 1990;63:832- 840.
Schulze-Osthoff K, Risau W. Vollrner E, et al. In situ detection of basic fibroblast growth factor by highly specific antibodies. Am. J. Pathol. 1 990; 137:85-92.
Chen HH, Chien CH, Liu HM. Correlation between angiogenesis and basic fibroblast growth factor expression in experimental bratn infarct. Stroke ?994;25:l6Si-l657.
Davis MG, Zhou M. Ali S, et al. Intracrine and autocrine effects of basic fibroblast growth factor in vascular smooth muscle cells. J. Mol. Ce11 Cardiol. 1 997;29: 1 061 -1 072.
Moscatelli Dl Presta M. JosephSilverstein J. et al. Both normal and tumor cells produce basic fibro blast growth factor. J. Ce11 Physiol. 1986; 129:273-276.
Nguyen M. Watanabe H, Budson AE, et al. Elevated levels of an angiogenic peptide, basic fibroblast growth factor, in the urine of patients with a wide spectnim of cancers [see comments]. J. Natl. Cancer Inst. 1994;86:356-361.
Schmitt JF, Susil BJ, Heam MT. Aberrant FGF-2. FGF-3, FGF-4 and Cerb-62 gene copy number in human ovarian, breast and endometrial tumours. Gro wth Factors. 1 996; 1 3: 1 9-35.
Bashkin P. Doctrow S, Klagsbrun M. et al. Basic fibroblast growth factor binds to subendothelial extracellular matrix and is released by heparitinase and hepann-like molecules. Biochemistry 1 989; 28: 1 737-1 743.
Gospodarowicz D, Cheng J. Heparin protects basic and acidic FGF from inactivation. J. Ce11 Physiol. 1986; 128:475-484.
Saksela O, Moscatelli D, Sommer A, et al. Endothelial cell-derived heparan suIfate binds basic fibroblast growth factor and protects it from proteolytic degradation. J. Ce11 Biol. 1988; 107743-751.
Vlodavsky 1, Komer G, Ishai-Michaeli R, et al. Extracellular rnatrix-resident growth factors and enzymes: possible involvement in tumor metastasis and ang iogenesis. Cancer Metastasis Rev. 1 990;9:203-226.
Yayon A, Klagsbnin M. Esko JD. et al. Cell surface. heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Ce11 1 991 ;64:841-848.
96. Omitz DM, Leder P. Ligand specificity and heparin dependence of fibroblast growth factor receptors 1 and 3. J-Biol.. Chem. 1992;267:163O5-I63ll.
97. Klagsbrun M. Baird A. A dual receptor systern is required for basic fibroblast growth factor activity. Cell 1991 ;67:229-231.
98. Roghani M, Mansukhani A, DellfEra P. et al. Heparin increases the affinrty of basic fibroblast growth factor for its receptor but is not required for binding. J. Biol. Chem. 1 994;269:3976-3984.
99. Dionne CA, Crurnley G, Bellot F, et al. Cloning and expression of two distinct high- affinity receptors cross- reacting with acidic and basic fibroblast growth factors. EMBO J. 1990;9:2685-2692.
100. Keegan K, Johnson DE, Williams LT, et al. Isolation of an additional rnember of the fibroblast growth factor receptor family , FGFR-3. Proc.Nat/-Acad. Sci. U.S.A. 1991 ;88:1095-1099.
101. Lee PL, Johnson DE, Cousens LS, et al. Purification and complementary DNA cloning of a receptor for basic fibroblast growth factor. Science 1 989;245: 57-60.
102. Partanen J, Makela TP, Eerola E, et al. FGFR-4, a novel acidic fibroblast growth factor receptor with a distinct expression pattem. EMBO J. 1991 ; 10: 1 347- 1354.
103. Johnson DE, Williams LT. Structural and functional diversity in the FGF receptor multigene family. Adv. Cancer Res. 1993;6O:l4l: 1-41.
104. Springer BA. Pantaliano MW, Barbera FA, et al. Identification and concerted function of two receptor binding surfaces on basic fibroblast growth fador required for mitogenesis. J. Biol. Chem. 1 994;269:2687426884.
105. Schlessinger J, Ullrich A. Growth factor signaling by receptor tyrosine kinases. Neumn 1 992;g: 383-39 1 .
106. Tan Y, Low KG, Boccia C, et al. Fibroblast growth factor and cyclic W P (CAMP) synergistically activate gene expression at a CAMP response element. Mol. Ce// Biol. 1 994; 14: 7546-7556.
107. Boudreau N, Andrews C, Srebrow A, et al. Induction of the angiogenic phenotype by Hox D3. J. Ce// Biol. 1997; 1 39:257-264.
108. Rogelj S, Weinberg RA, Fanning P, et al. Basic fibroblast growth factor fused to a signal peptide transfomis cells. Nature 1988;W: 173-1 75.
109. Florkiewicz RZ, Majack RA, Buechler RD, et al. Quantitative export of FGF-2 occurs through an alternative. energy- dependent, non-ER/Golgi pathway. J. CeIl Physiol. 1 995; 1 62:388-399.
II O. Florkiewicz RZ, Anchin J, Baird A. The inhibition of fibroblast growth factor-2 export by cardenolides implies a novel function for the catalytic subunit of Na+,K+- ATPase. J. Biol. Chem. 1 998;273:5#-55 1 .
1 11. Klein S. Roghani M. Rifkin DB. Fibroblast growth factors as angiogenesis factors: new insights into their mechanism of action. EXS. 1 997;79: 1 59-92: 159- 192.
Il 2. Moscatelli D, Presta M, Rifkin DB. Purification of a factor from human placenta that stimulates capillary endothelial cell protease production, DNA synthesis, and migration. Proc.Nat1. Acad. Sci U.S.A. 1 986;83:2Ogi -2095.
1 13. Sa G. Fox PL. Basic fibroblast growth factor-stimulated endothelial cell movement is mediated by a pertussis toxin-sensitive pathway regulating phospholipase A2 activity. J. Biol. Chem. l994;269:32lMîZS.
1 14. RayChaudhury A, Frischer H, Malik AB. Inhibition of endotheiial cell proliferation and bFGF-induced phenotypic modulation by nitric oxide. J. Ceil Biochem. l996;63: 125-1 34.
11 5. Goto F, Goto K. Weindel K, et al. Synergistic effects of vascular endothelial growth factor and basic fibroblast growth factor on the proliferation and cord formation of bovine capillary endothelial cells within collagen gels [see comments]. Lab.lnvest. 1 993;69:508-517.
1 16. Segheni G, Patel S, Ren CJ, et al. Fibroblast Growth Factor-2 (FGF-2) lnduces Vascular Endotheiial Growth Factor (VEGF) Expression in the Endothelial Cells of Forming Capillaries: An Autocrine Mechanism Contnbuting to Angiogenesis. J. Ceil Biol. 1 998; 141 : 1659-1 673.
117. Srebemik N, Appleby EC. Breed prevalence and sites of haemangioma and haemangiosarcoma in dogs. VetRec. 1991 ; 129:408409.
118. Day MJ, Lucke VM, Pearson H. A review of pathological diagnoses made from 87 canine splenic biopsies. J. Srnail. Anim. Pract. 1 995;36:426433.
119. Ward Hl Fox LE, Calderwood-Mays MB, et al. Cutaneous hemangiosarcoma in 25 dogs: a retrospective study. J. Vet. lntem. Med. 1 994;8:345-348.
120. Hargis AM, lhrke PJ, Spangler WL, et al. A retrospective clinicopathologic study of 212 dogs with cutaneous hernangiomas and hemangiosarcomas. Vet. Pathoi. 1 992;29:316-328.
121. Keene BW, Rush JE, Cooley AJ, et al. Primary ieft ventricuiar hernangiosarcoma diagnosed by endomyocardial biopsy in a dog . J.Am. Vet- Med. Assoc. 1 990; 1 97: 1 SOI -1 503.
122. Dunning D, Monnet E, Orton EC, et al. Analysis of prognostic indicators for dogs with pericardial effusion: 46 cases (1 985-1 996). JAm. Vet.Med.Assoc. l998;Zl2: 1276-1 280.
123. Spangler WL, Kass PH. Pathologie factors affecting postsplenectomy suMval in dogs. J. Vet lntem. Med. 1 997; 1 1 : 1 66-1 7 1 .
124. Minchinton Al, Fryer KH, Wendt KR. et al. The effect of thalidomide on experimental tumon and metastases. Anticancer D ~ g s 1996;7:339-343.
125. Weidner N. lntratumor Microvessel Density as a Prognostic Factor in Cancer. Am-JPathol. 1 995; I47:g-lg.
CHAPTER ONE
Isolation and culture of canine endothelium
A bstract
Initial studies into the biology of canine hemangiosarcoma (HS), a
malignant tumour of the endothelium, commenced with cell culture. Two types of
media and various separation techniques were attempted for endothelial
isolation. Normal canine endothelia from adrenal glands were isolated by
mechanical tissue disruption and collagenase digestion. Adrenal endothelial cells
had an absolute requirement for microvascular growth supplement present in
commercial cell growth media. These normal endothelial cells (ECs) attached
and spread ont0 plastic petri dishes coated with a commercial attachment factor
approxirnately one hour after seeding . Duration to first passage was
approximately one week. Doubling times were 2-3 days. Cells were positively
identified as endothelial cells by with immunoperoxidase staining for von
Willebrand factor antigen (vWF) and typical EC morphology on phase contrast
microscopy. Prirnary splenic explants and collagenase digestion of spleen did
yield celts with similar phase contrast morphology to commercial human
microvascular endothelial cells (HMVECad) on first passage. W~h in a week
these cells were overgrown with cells that were vWF negative. Magnetic beads
coated with Ulex europaeus provided enrichment of cells positive for von
Willebrand antigen from one HS case. These cells remained in culture for three
passages before being overgrown with cells negative for vWF. Normal and
malignant canine microvascular endothelial cells are difficult to culture
Introduction
Hemangiosarcomas (HSs) are a common malignant tumour in dogs.
Conversely. HSs are extremely rare in people. The endothelial nature of the
canine tumour cells has been confirmed by staining for endothelial-specific
membrane and cytoplasmic markers.'" Beyond this, little is known concemirtg
the cell biology of the tumour.
One starting point for initial studies was to set up short and long-terni cell
cultures. or establish ceIl lines derived from HS tumours. In recent years, there
has been an increasing effort to understand normal and abnormal endothelial cell
(EC) function with respect to atherosclerosis and heart di~ease.~;' These studies
have required protocols for the isolation and in vitro maintenance of ECs. As well.
many EC lines from various human and murine sources have been developed
and are commercially available. These celis serve as reference populations in
functional studies.
The purpose of the present study was to apply techniques used in other
species to isolate and grow normal and neoplastic canine endothelial c e ~ l s . ~ ' ~ The
aim was to establish cell lines to be used in future studies of the canine
hemang iosarcoma cell.
Materials and Methods
Over a penod of twenty-two months. cell culture experiments on tissues
obtained from 49 dogs were completed. The experirnents were divided into two
major groups dependent on the cell culture medium utilized. Two different growth
media. medium 199 (Ml 99 Life Technologies, Burlington. Ontario) and medium
131 (Ml 31 Cascade Biolog ics, Portland Oregon. USA) were investigated for their
ability to sustain microvascular ECs. Endothelial cells in culture were positively
identified by irnmunocytochemical detection of von Willebrand factor (vWF).
Isolation protocol for canine adrenal endothelhm
Normal adrenals were obtained from dogs being utilized in a vascular graft
study at the University of Guelph. Dogs were housed according to the Canadian
Council on Animal Care (CCAC) guidelines. Tissues were collected immediately
following euthanasia by barbiturate overdose. (Euthansol. Schering Canada.
Pointe Claire, Quebec). The adrenal glands were collected into chilled
Dulbecco's modified minimal essential medium (DMEM Life Technologies).
Medullary tissue was removed and the cortex was finely rninced using a scalpel
blade and forceps. Tissue fragments were washed three tirnes in phosphate
buffered saline (PBS, pH 7.2, 0.1 5 M) solution containing 1 Ox antibiotics
(amikacin sulphate 500 ug/ml Ayerst, Monteal, Quebec) and then placed in
DMEM containing 0.5% collagenase type 1A (Sigma Chernical Co., St. Louis.
Missouri. USA). The tissue suspension with enzyme was incubated in a 37OC
water bath for 20 minutes with occasional agitation. Pipetting through a large
bore pipette further dispersed larger tissue aggregates. The digested tissue
suspension was passed through rnulti-layered gauze (Nu Gauze 3 x 3 x 4 ply
Johnson & Johnson Medical Inc.. Mississauga. Ontario) and then washed with
DMEM. The cells were pelleted by centrifugation at 950 x g for 5 minutes. Red
cells were lysed by the addlion of double distilled water to the pelleted cells for
15 seconds. This solution was then normalized with addition of hypertonie PBS.
Cells were re-suspended in DMEM (Life Technologies). Sixty millimetre diameter
petri plates (Fisher Scientific, Unionville, Ontario) were pre-coated by the addlion
of 2-3 ml of a proprietary attachment factor (AF Cascade Biologics) and
incubated for 30 minutes at 37OC with aspiration of residual AF prior to plating.
The cells isolated from two canine adrenal glands were resuspended in
2.5 ml of M l 31 (Cascade Biologics). containing a microvascular growth
supplement (MVGS Cascade Biologics). and were plated onto a single pre-
coated petri dish. In separate experiments. adrenal cells from two canine
adrenals were resuspended in 2.5 ml of Ml 99 (Life Technologies) supplemented
with 10% fetal bovine serum (FBS Cansera, Rexdale. Ontario). 1X endothelial
cell growth supplement (ECGS Sigma Chemical Co.). 15 units of hepafin (Sigma
Chemical Co.) per milliliter of Ml99 and plated on plates pre-coated with 1 %
gelatin.
The supernatant from M l 31 (Cascade Biologics) primary cultures was
aspirated 45 minutes post-seeding, and subjected to immunoparamagnetic bead
separation to concentrate remaining endothelial cells (see appendix 1).
Subsequent passages every 2 to 3 days were facilitated with 0.05% trypsin -
EDTA in normal saline (Life Technologies). At the fourth passage the cells were
cryopreserved in liquid nitrogen. following suspension in preservation medium
containing 10% dirnethyl sulfoxide (DOMOSO; Syntex Agribusiness.
Mississauga. Ontario), 10% FBS (Cansera) and with either Ml31 (Cascade
Biologics) or Ml99 (Life Technologies). Cells were thawed and re-plated at
subsequent points to determine cryo-preservation efficacy.
isolation protocol for the canine splenic hernangiosarcoma
Spleens were obtained from suspect cases of HS undergoing
splenecîomy at a number of private veterinary clinics across Ontario. Splenic
tissue was also obtained from Small Animal Surgery, Veterinary Teaching
Hospital, University of Guelph. Spleens were removed surgically and transferred
to the laboratory using aseptic techniques. Splenic fragments were made by
cutting the entire normal spleen or tumour mass into 3 cm3 pieœs followed by
immersion in sterile PBS. As a prophylactic antibacterial measure. the cubes of
tissue were immersed briefly in 70% ethanol. The spleen was then trimmed into
smaller 1 cm3 cubes. The cubes were then washed in 0.15 M PBS (Life
Technologies), for 15 minutes at room temperature using a stir plate. A total of
three washes were perfomied with the spleen fragments being minced into
successively smaller fragments such that by the end of the third wash the
fragments were 1 mm3. For pnmary explant cultures, the fragments were pipetted
onto a single pre-coated 60 mm petri dish (Falcon. Oxnard California. USA). Petri
dishes were precoated with attachment factor (Cascade Biologics) according to
the manufacturer's guidelines. Splenic tissue fragments partially digested with
trypsin EDTA were immened in 7-1 0 ml of M l 31 (Cascade Biologics). Medium
was changed on day three postseeding. Tissue fragments were discarded on the
fourth or seventh day. In separate experiments, partially digested splenic tissue
fragments were irnrnersed in 7-10 ml of M l 99 (Life Technologies) supplemented
with 10% FBS (Cansera, Rexdale, Ontario), 1 X endothelial cell growth
supplement (Sigma Chemical Co.). 15 units of heparin (Sigma Chemical Co.),
per milliliter of Ml99 and plated on plates coated with 1% gelatin. The tissue
culture protocol used subsequently was identical to that described above.
Alternatively, 1 mm3 tissue fragments obtained after the third wash as
described above, were incubated for 20 minutes at 37OC with 0.5% (wlv) type A
collagenase (Sigma Chemical Co.) in DMEM . The resulting tissue suspension
was vigorously pipetted through a large bore pipette to further dislodge cells from
tissue clumps. The digested tissue suspension was passed through multi-layered
gauze (Nu Gauze 3 x 3 x 4 ply Johnson & Johnson Medical Inc.. Mississauga,
Ontario) and then washed with DMEM. The cells were pelleted by centrifugation
ai 950 x g for 5 minutes. Red blood cells were lysed by the addition of double
distilled water to the pelleted cells for 15 seconds. This solution was then
normalized with addition of hypertonie PBS, centrifuged and then washed a third
tirne with DMEM. After the third wash, the pelleted cells were resuspended in 5 -
10 ml of M l 31 (Cascade Biologies) depending upon the size of the pellet.
In order to concentrate endothelial cells. immunoparamagnetic beads
(uncoated M450 Dyna beads; Dynal Inc., Lake Success, New York, USA), were
coated with the lectin Ulex europaeus (Sigma Chemical Co., St. Louis, Missouri.
USA) or anti CD-31 mouse monoclonal antibody (DAKO, Montreal PQ),
according to the manufacturer's instructions. Cells separated by the
immunoparamagnetic protocol were plated on 60 mm petri dishes (Falcon) pre-
coated with attachment factor (Cascade Biologics). The supernatant from the
primary culture was aspirated 45 minutes post-seeding, and replaced with fresh
M l 31 (Cascade Biologics). Tirne to first passage was ten days. Subsequent
passages every 4 to 5 days were facilitated by the addition of 0.05% trypsin -
EDTA in normal saline (Life Technologies). At the fourth passage, the cells were
cryopresewed as previously described.
Detection of von Willebrand factor antigen
Al1 cultured cells were subcukured ont0 8 well slides (Labtek, Nalge Nunc
lntemational Naperville, Illinois, USA). The celis were fixed in -20°C methanol for
5 minutes followed by 2 minutes in -20°C acetone, according to the antibody
manufacturer's guidelines. Penneabilization in 0.1 % Triton X-100 (Fisher
Scientific), was followed by a PBS wash. Endogenous peroxidase activity was
quenched by immersion of the slides in 3% hydrogen peroxide in PBS for 5
minutes followed by a PBS rinse. Non-specific binding of antiserum was
prevented using 5% nomal goat serum in PBS for 30 minutes at room
ternperature followed by a PBS wash. All subsequent incubations were at room
ternperature in a hurnidified chamber.
Slides were incubated for one hour with von Willebrand Factor (vWF)
rabbit antihuman IgG diluted 1 :IO0 in PBS (DAKO Sweden), containing 1 %
normal goat serum. After rinsing, the slides were incubated 30 minutes with the
biotinylated secondary goat antirabbit IgG (Sigma Chernical Co.) diluted 1 :20 in
PBS containing 1 % normal goat serum. Slides were rinsed in PBS. A 1:20
dilution of the avidin-peroxidase (Sigma Chernical Co.) constituted the last 30
minute incubation. The slides were developed for 5 minutes in 3-amino-9-
ethylcarbazole (AEC Sigma Chernical Co.) according to the manufacturer's
instructions. The reaction was teminated in distilled water. Finally, slides were
counter-stained in Mayer's hematoxylin solution (Sigma Chernical Co.), rinsed in
warrn tap water and mounted with an aqueous mounting media.
Positive controls for vVVF were an established bovine aortic endothelial
cell line (courtesy of Dr. Brenda Coomber, University of Guelph, Guelph, Ontario)
and a commercial human microvascular cell line HMVECad (Cascade Biolog ics).
Slides treated with 1% normal goat serum in PBS in the absence of primary
antibody were used as negative controls. Canine fibroblasts (courtesy of Dr. Julie
Yager, University of Guelph, Guelph, Ontario) senred as an alternative negative
control.
Results
Canine adrenal endothelium isolation
The cell culture experiments are summarized in Tables 1 and 2.
Generally, small cells adherent to the dish surface were observed within 45
minutes after plating in cultures in Ml31 medium. The primary cell culture
contained cellular debris. few RBCs, and cells resembling fibroblasts. Aspiration
of the medium at one hou. showed clusters of cells adherent to the surface of
the petri dish. After the first twenty-four hours in culture, two cellular
morphologies were observed. One had the spindle-shape. characteristic of
fibroblastic cells, and the other was polygonal with a prominent centrally located
nucleus. The latter cell type had an appearance at confluence similar to human
demal microvascular endothelium as seen using phase contrast microscopy.
The adherent cells grew in the tightly clustered "cobblestonen pattern which is
characteristic of endothelial cells and distinguishes them from other cell types
(Figure IA). Only spindle-shaped cells were observed in Ml99 medium.
The first doubling of cells occurred after three days with routine Ml31
changes every two to three days. Cultures on petri plates were 70-80% confluent
in approximately seven days. Upon first passage. ten days into culture. cells
were split at a ratio of 1 :2 and were confluent within 48 hours. Cultures up to the
fourth passage still contained viable endothelial cells as detected by
immunocytochemistry (Figure 1B). However within the first two weeks, many
cultures became overgrown with cells that did not stain positively for vWF. All
cultures in Ml31 medium beyond fourth passage became overgrown with
spindle-shaped cells (Figure 2A). Cultures maintained in Ml 99 medium did not
produce cells that were positive for vWF.
Cryopreserved cells yielded cultures with two distinct cellular
morphologies similar to initial culture, described above. Wdhin two passages,
cultures were quickly overgrown with cells that were vWF negative (Figure 2B).
Nomai spleen and spienic hemangiosamma isolation
After 48 hours in culture. primary explant tissues in M l 31 were populated
with outgrowing cells (Figure 3A). One cell type was polygonal with a centrally
located nucleus while the other was spindle-shaped. Seventy-two hours into the
culture, splenic tissue fragments were removed. The cells became confluent on
the tenth day of culture. At first passage the cells were split at a ratio of 113 and
were passaged every five days. Third and fourth passage cells were moved to 4
well slides (Labtek) to permit immunocytochernistry experiments. Nonetheless.
only one cell type was apparent at sixth passage and these did not stain for vWF
(Figure 38).
Enzymatic disruption of canine spleen produced a very dense gelatinous
material. Several washeç with Ml31 were needed to separate cells from debris
and fibrous "plugs", which greatly diminished cellular yield. Plating on pre-coated
petri dishes permitted adhesion of some cells with phase contrast morphology
simiiar to simultaneously cultured commercial human demal rnicrovascular
endothelial cells (HMVECad) (Cascade Biologies). However, there were other
cells present that did not resemble microvascular cells in the splenic
preparations. These spindle-s haped cells proliferated rapidly in M 1 3 1 (Cascade
Biologics) and covered the entire surface within a week. Subsequent staining
revealed that cultures contained only cells that were vWF negative.
Enzyrnatic disruption of HSs followed by immunoparamagnetic bead
selection, required the removal of al1 fibrous debris for effective binding. Sinœ
the percentage of €Cs to the total organ volume is quite srnall, the entire splenic
tumour was often required to produce suitable plating densities. ARer selection,
the primary cultures in Ml 31 (Cascade Biologics) appeared similar to isolations
done using the explant approach described above. Phase contrast microscopy
revealed one cell type resembling HMVECad and another cell type that was
fibroblast like in appearance (Figure 4A). Only one culture experiment showed
vWF positive cells at third passage (Figure 48). Subsequent passages
established a single cell type, which was negative for vWF.
Outgrowing cells also populated primary explant tissue culture maintained
in Ml99 (Life Technologies). However, only one cell type predominated. It was
spindle-shaped and becarne confluent soon after tissue fragments were removed
on day three. Immunocytochemistry revealed that the spindle-shaped ceils were
vWF negative. Enzymatic disruption of splenic tissue and subsequent culture in
Ml99 (Life Technologies) did not yield any cells that had positive vWF
immunoreactivity.
Discussion
Culture of canine microvasculature was ditficult. Isolation and successful
propagation of capillary ECs from HS tumours could not be sustained beyond
third passage under the conditions described here. Normal canine microvascular
endothelial cells were successfully cultured from adrenals. Although routine
culture of canine vascular cells has been reported, it has been with large vessel
jugular and aortic ECS! It has been demondrated that large vessel and
microvascular endothelial cells respond in distinct fashion to growth factors.
implying dissimilar growth req~irements.~ There is a widely accepted
understanding that nutrient rich media provide greater utility in endothelial
c~lture. '~ Supplementing media with exogenous growth factors also increases
the likelihood of cloning suc ces^.'^ In preliminary experirnents reported here,
specialized growth supplements were essential even for the transient growth that
was observed. These results indicated that canine microvascular endothelial
cells are exquisitely fastidious in their growth requirernents.
In general, Ml31 (Cascade Biologies) in combination with a proprietary
microvascular growth supplement (MVGS) and attachment factor, was an
effective medium for the short term culture of canine microvasculature obtained
from adrenals. Prior to its use there was no success in culturing microvascular
cells. The M l 99 (Life Technologies), combined with gelatin substrate. was not
effective for maintaining normal canine microvascular cells. Endothelial cell
growth supplement (Sigma Chernical Co.) enhancernent did not provide any
advantage to non-supplemented cultures.
The adrenal gland possesses a rich capillary network and has been used
as a source of microvascular ECS? The number of ECs compared to the total
number of cells is higher in these glands and exceeds that found in spleen.
Splenic tissue possesses an extensive network of fibrous. rnuscular. and stroma1
components. not seen in adrenals. This lack of extensive stroma in adrenals
likely eased the isolation of microvessels from ad renais and necessitating less
physical and chernical trauma.
Combining more than a single adrenal gland in a preparation enhanced
the yield of €Cs and improved culture results. In Folkman's isolation of
microvascular cells from bovine adrenals, six bovine adrenal glands were
recommended for enrichment pur pose^.^ Increasing the number of glands,
augmented the number of colonies present on the culture surface observed at
primary seeding. A decreased time to confluence resulted. allowing quicker
establishment of the desired ECs with less chance of cornpetitive overgrowth.
Enriching cultures specifically for €Cs was the abject of the immuno-
paramagnetic bead experiment (Dynabeads Dynal Inc.). Ulex europaeus (UEA-1 j
binds to L-Fucose residues on human endotheliurn and malignant, but not normal
animal microvascu lature.*;'* According ly, UEA-1 lectin bound to beads may be
capable of selectively isolating and concentrating malignant endothelial cells from
HS tumours. Likewise, the mouse monoclonal antibody (MAb) anti - CD31. which
recognizes normal and neoplastic canine €Cs could be used to enrich
endothelial cells from tissue homogenate~.'~ This antibody has been previously
used to isolate human endothelial cells and tumour derived capillary endothelial
cells. 7:'4
Unfortunately, when UEA-1 was employed in the magnetic bead
separation protocol. it improved results on only one occasion (Tablel). The anti-
CD31 coated beads did bind to control HMVECad and bound capillary €Cs from
canine adrenal tissue. Phase contrast microscopy revealed clumps of cells
attached to magnetic beads coated either with lectin or monoclonal antibody.
These clumps of cells rnust have contained fibroblasts, since subsequent
cultures did not contain pure populations of endothelial cells as indicated by vWF
negative staining even af€er immuno-paramagnetic selection. Succeeding
passage only favoured the proliferation of vWF negative cells, presumably
fibroblasts.
In conclusion, normal canine microvascular endothelial cells, isolated by
various protocols, could be successfully cultured for up to three passages when
provided with culture medium 131 (Cascade Biologics) supplemented with 5%
FBS and commercially available endothelial growth and attachment factors
(Cascade Biologics). Using the same variety of culture conditions as applied to
normal cells, hemangiosarcoma cells were successfully cultured only once to
passage three. Beyond passage three, cultures of normal endothelial cells and
the one culture from a case of hemangiosarcoma became overgrown with
spindle cells likely of fibroblastic origin. It is apparent that canine endothelial
cells, whether normal or malignant. had fastidious growth requirements under the
described conditions.
References
10.
II.
von Beust BR. Suter MM. Summers BA. Factor VIII-related antigen in canine endothelia! neoplasms: an immunohistochemical study. Vef. Pathol. 1 988;25:251-255.
Augustin-Voss HG. Smith CA, Lewis RM. Phenotypic characterization of normal and neoplastic canine endothelial cells by lectin histochemistry. Vet. Pathol. 1 99O;Z: 103-1 09.
Liu KX, Bird AE, Lenz SD. et al. Antigen expression in normal and neoplastic canine tissues defined by a monoclonal antibody generated against canine mesothelioma cells. Vet Pathol. 1994;31:663-673.
Betz E. Cell culture systems to study progression and inhibition of intima1 proliferations [editorial]. Basic. Res. Cardiol. 1 991 ;86:79-86.
Hultberg B, Andersson A, Isaksson A. The celldamaging effects of low amounts of hornocysteine and copper ions in human cell line cultures are caused by oxidative stress. Toxicology 1 997; 1 23:33-40.
Folkrnan J, Haudenschild CC, Zetter BR. Long-term culture of capillary endothelial cells. Pmc.Natl.Acad.Sci. U.S.A. l979;76:52l7-52Zl.
Alessandri G. Chirivi RG, Castellani Pl et al. Isolation and characterization of human tumorderived capillary endothelial cells: role of oncofetal fibronectin. Lab.lnvest. l998;78:lZ7-lZ8.
Smith JM. Meinkoth JH, Hochstatter T, et al. Differential distribution of von VVi llebrand factor in canine vascular endothelium. Am.J. VetRes. l996;57:750-755.
Bastaki M, Nelli EE, Dell'Era Pl et al. Basic fibroblast growth factor-induced angiogenic phenotype in mouse endothelium. A study of aortic and microvascular endothelial cell lines. Artenoscler. Thmmb. VascBiol. 1997; 1 7:454-464.
Macarak EJ, Howard BV, Kefalides NA. Properties of calf endothelial cells in culture. Lab-lnvest. 1977;36:62-67.
Meinkoth, J. H. Storage and Release of Von Willebrand Factor By Endothelial Cells of Doberman Pinscher Dogs with Type I Von Willebrand Disease. 52-56. 1993. Washington State University. 1 2- 1993.
12. Vinores SA, Herman MM, Perentes E, et al. The growth of two murine hemangioendotheliomas intracranially, subcutaneously, and in culture. and their cornparison with human cerebellar hemangioblastomas: rnorphological and immunohistochemical studies. Acta Neuropathol.(Bed) 1992;84:67-77.
13. Ferrer L, Fondevila D, Rabanal RM, et al. Immunohistochemical detection of CD31 antigen in normal and neoplastic canine endothelial cells. J. Comp. Pathol. 1 995; 1 1 2: 3 1 9-326.
14. Hewett PW, Murray JC. lmmunomagnetic purification of human microvessel endothelial cells using Dynabeads coated with monoclonal antibodies to PECAM-1. Eur. J. Ceil Biol. l993;62:451-454.
Table 1. Isolation of canine endothelial cells and results of culture in medium 131 supplemented with 5% FBS and proprietary endothelial cell growth and attachment factor (Cascade Biologics).
Number of vWFa positive cultures grown in M l 31 (Cascade Biologics)
Method used to obtain cell suspension Sample Explanta Enzymee BeadsT Culture Attempts Normal spleen 0/5 0/5 ND^ 10 Normal adrenal ND^ 511 0 1 13 13 HSC spleens O18 O18 1 13 II
Number of ~ositive cultures vs. total culture attem~ts 7 of 34
Table 2. Cell culture attempts using MA99 (Life Technologies) culture medium supplemented with 10% FBS (Cansera), endothelial cell growth supplement and heparin (Sigma Chernical Co.) on gelatin coated dishes.
Number of vWFa positive cultures grown in Ml99 (Life Technologies)
Method used to obtain cell suspension Sample ExplanP Enzymee Culture Attempts
Nona l spleen O11 5 01'1 5 Normal adrenal ND^ 0/19 HSC spleens 019 019
Number of ~ositive cultures vs. total culture atternpts O of 67
von Willebrand factor antigen not done hemangiosarcoma primary tissue explant protocol described in text. enzymatic disruption using collagenase described in text. includes the use of immunoparamagnetic beads to enrich cultures for endothelial cells see appendix 1.
Figure 1. Twenty day culture of canine microvascular cells derived from adrenal tissue.
I A Phase contrast microscopy of cells 72 hours after primary seeding. Cells were rnaintained in M l 31 (Cascade Biologies). Two cell types were present. Polygonal cells with a central nucleus (small arrow) were surrounded by spindle- shaped cells (large arrow). Magnification 200X.
1 B Demonstration of positive von Willebrand factor antigen (vWF) irnmunoreactivity in ceils cultured in M131. Noticeable rust red cytoplasmic granules were seen in third passage cells with positive vWF immunoreactivity. Magnification 400X.
Figure 2. Twenty-eight day culture of cells derived from canine adrenal tissue. Beyond fourth passage, rapid overgrowth of cells lacking endothelial morphology on phase contrast microscopy or positive von Willebrand factor antigen (vWF) immunoreactivity occurred.
2A Phase contrast microscopy of sixth passage cells cultured in M131. Note the rare polygonal cell (arrow) that resembled cells in Figure 1A . Surrounding spindle-shaped cells did not stain positive for vWF (see figure 2B). Magnification 200X.
2B Cells passaged twice after cryopreservation. Complete absence of cytoplasmic rust red granular pattern indicated negative vWF irnmunoreactivity. Magnification 200X.
*. - Y - -: .- - -a y.. '"
Figure 3. Cells derived from canine splenic hemangiosarcoma. Cells were isolated by enzymatic disruption and grown in Ml 31 (Cascade Biologies). Primary explant tissue was removed on the third day.
3A Two distinct cell types were visible in the third day of culture on phase contrast microscopy. Polygonal cells with a centrally located nucleus grew in a cobblestone morphology (arrow). Spindle shaped cells assumed a sheet-like appearance and overgrew subsequent cultures (arrowhead). Magnification 200X.
3 8 Immunohistochemistiy of sixth passage cells. All cells that rernained in culture did not possess any positive wst red immunoreactivity for von Willebrand factor antigen. Magnification 200X.
Figure 4. Immunoparamagnetic bead selection of canine hemangiosarcoma cells. Cells were selected for the presence of endothelial surface markers.
4A Phase contrast microscopy of primary cultures affer immunoparamagnetic selection with beads coated with UIex europaeus. Two distinct cell morphologies were present among tiny highly refractile beads in plain view. One cell type had a polygonal shape with centrally located nucleus (arrow). the other had a spindle- shape (anowhead). Magnification 200X.
48 A singular occurrence. Three cells with positive cytoplasmic granular staining for von Willebrand factor antigen (vWF) at third passage in a culture derived from splenic hemangiosarcorna (arrows). Cells that were negative for vWF predominated. Mag nification 200X.
CHAPTER TWO
Molecular detection and sequence information of FGF-2 in normal canine spleen
and hernangiosarcoma tissues
Abstract
Molecular techniques were used to investigate the expression of FGF-2 in
canine splenic hernangiosarcoma (HS). Oligonucleotide prirners 914 and 903
were designed to amplify a specific fragment of the human FGF-2 cDNA. The
primers amplified a predicted 390 bp cDNA fragment using RNA derived from
BAEC, HMVECad. normal canine spleen and HS tumours. The cDNA product
was cloned into a p ~ ~ ~ 2 . 1 TOPO vector and the sequence of the cDNA was
detemined. Sequence analysis revealed that the canine cDNA amplification
product had 93% homology with the human FGF-2 cDNA. The canine FGF-2
sequence information was submitted to Genebank. accession number
AF060562. The canine amplification product was digoxygenin (DIG) labeled and
used as a probe in subsequent hybridization experiments. No hybridization signal
was detected in Northern blot experiments aimed at determining FGF-2 mRNA
expression in HS. However, Southem blots revealed that the DIG labeled probe
did hybridize to 390 bp cDNA fragments reverse transcribed from bovine, human
and canine RNA. These findings illustrate the highly conserved nature of the
FGF-2 cDNA across diverse species.
Introduction
Canine hemangiosarcoma (HS) is a malignant endothelial tumour. Little is
known about its cell biology and molecular characteristics Studies on
endothelial-denved neoplasms from people and animal models have provided
strong evidence that the growth of endothelial cells (ECs) in such tumours
appears to depend, at least in part, on the activity of soluble factors.';* These
soluble factors, or growth factors, can stimulate the neovascularization of
tumours in an autocrine (self-stimulating) or paracrine (adjacent ceIl-stimulating)
manner. The growth factor most commonly implicated in EC proliferation in
angiogenesis is basic fibroblast growth factor ( F G F - ~ ) . ~ ' ~
Studies into FGF-2 gene expression have found it to be highly conserved
and ubiquitously e~pressed.~ To determine the presence of FGF-2, unfertilized
human oocytes were tested by reverse transcriptase polymerase chain reaction
(RT-PCR) and Northem hybridi~ation.~ RT-PCR was used to demonstrate
presence of FGF-2 while Northem blot experiments revealed specific transcript
sizes. Similar studies in fetal and postnatal rat tissues combined RT-PCR and
Northern analysis, to investigate antisense RNA transcript expression.7
In order to address the possible involvement of FGF-2 in HS, a reverse
transcriptase polyrnerase chain reaction (RT-PCR) primer set was developed to
detemine mRNA expression of FGF-2 in normal and splenic HS samples.
Materials and Methods
Primer design, cloning and sequence analysis
PCR primen designed to amplify a 480 bp fragment from the human FGF-
2 sequenœ (Genebank accession number JO451 3), between nucleotides 694
and 1174 were provided (courtesy of Dr M. Gagnon Children's Hospital,
Boston. MA). The foward primer, was a 19 mer with the sequence
5'-AGTGTGTGCTAACCGTTAC -3'. The reverse primer, was a 19 mer with the
sequence 5'-TCTAGGTAAGClTCACTGG -3'. Multiple FGF-2 sequences from
chicken. rabbit. human, bovine and marmoset were aligned and analyzed using a
commercial program (DNASIS Windows ver 2.5 Hitachi Software Engineering
Co., LM. Japan). Sequence alignment data predicted a reg ion of greatest
homology based on a 285 bp fragment from the human sequenœ for FGF-2
çpanning a region between bases 572 and 857 (Genebank accession number
JO451 3). Primers (Guelph Molecular Supercentre, Guelph. ON), were
synthesized to amplify a 390 bp fragment between positions 541 and 931. The
fontvard primer (914). was a 20 mer with the sequence 5'-
CTTCAAGGACCCCAAGCGGC-3'. The reverse primer (903). was an 18 mer
with the sequence 5'- GCTCTTAGCAGACATTGG-3'.
A cloning reaction was created by placing one microliter of the fresh
amplification product in a 1.5 ml microfuge tube containing 4 pl of sterile water
and 1 pl of pCR@ -TOPO vector (Invitrogen, Carlsbad, California). Proprietary
topoisomerase contained in the vector diluent facilitated ligation of the vector to
PCR products containing 3' adenosine overhangs at room temperature for 5
rnin~tes.~ The tube was briefly œntrifuged and put on ice. Subsequentiy. 2 pl of
0.5M P-rnercaptoethanol (Invitrogen) was added to a separate via1 containing
One ShotTH competent cells (Invitrogen) and gently mixed. Two microliters of the
cloning reaction was added to a via1 containing the One ShotTM cells (Invitrogen)
and mixed gently. The One Shotm celi (lnvitrogen) mixture was incubated on ice
for 30 minutes. The cells were then heat shocked by placement of the via1 into a
4Z°C water bath for 30 seconds. The via1 was moved to an ice bath for 2
minutes. Two hundred and fiffy microliters of room temperature SOC medium
was added and mixed. The via1 was moved to a horizontal microfuge tube shaker
and incubated for 30 minutes at 37OC. Thirty microliters of the transformation was
spread ont0 a prewamed LB agar plate (see appendix VII), containing ampicillin
(Invitrogen) and incubated overnight at 37OC. The ~ c ~ ~ 2 . 1 TOPO plasrnid
contained the IacZa segment of DNA that permitted colourimetric identification of
recombinant clones. White Escherichia colj colonies denoted clones that were
successfully transfected with one plasmid vector containing amplification product.
Blue bacterial colonies were clones that incorporated a plasmid molecule lacking
the cDNA fragment. Plasmid DNA from the dark blue E. coli colonies foned the
cloning technique controls. Four white colonies and two dark blue bacterial
colonies were selected and grown up in 50 ml of LB-broth. Plasmid DNA was
extracteci from cells using Trizol reagent (Life Technologies) according to the
method of ~niazeva.' The purified pCR@ 2.1 TOPO plasmid vector (Invitrogen)
containing the cDNA insert was sequenœd (Guelph Molecular Supercentre)
using Ml3 forward and Ml3 reverse primers (Invitrogen) confimiing the
sequence information. This novel sequence information for canine FGF-2 cDNA
was submitted to Genebank, accession number AF060562.
Isolation of total RNA from cells and fmzen tissue
RNA was isolated according to the manufacturer's instructions the Trizol
reagent. Briefly a volume of Trizol reagent (Life Technologies, Burlington ON). (1
ml 110 cm2) was added to cell culture flasks. Cells were iysed by vigorously
shaking the flask. The solution was then repeatedly passed through a sterile
plastic pipette and placed in 1.0 ml microfuge tubes. Alternatively. Rash frozen
splenic material from normal control animals or tumour bearing cases was placed
in Iiquid nitrogen and homogenized with a pre-chilled mortar and pestle (Corning
Industries, Corning PA, USA). Pulverized matenal was transferred to a tight-
fÏtting glass homogenizer (Fisher Scientific) filled with a volume of Trizol (Life
Technologies) based on manufacturer's recommendztions. Fifty mg of tissue was
suspended in 1 ml of Trizol reagent. After 20 strokes the solution was pipetted
into 1 .O ml microfuge tubes for further processing.
The microfuge tubes were incubated at room temperature for 5 minutes.
To each tube, 0.2 ml of chlorofom (Fisher Scientific) per 1 ml of Trizol was
added. Tubes were vigorously shaken for 15 seconds. The samples were then
centrifuged at 12 000 x g for 15 minutes at 4OC. The aqueous phase was
removed and transferred into a fresh tube. The chloroform step was repeated.
Total RNA was precipitated from the aqueous phase by adding 0.5 ml of
isopropanol (Fisher Scientific) to each tube. The samples were incubated for 10
minutes at room temperature. The tubes were then centrifuged at 12 000 x g for
10 minutes at 4OC. Following centrifugation, the isopropanol (Fisher Scientific)
was removed and the RNA pellet was washed with 1 .O ml of 75% ethanol. The
pellet was air dried for no more than 10 minutes and resuspended in 20-30 pl of
RNAase free water and stored at -70°C.
Reverse transcriptase polymerase chain reaction (RT-PCR)
Total RNA samples were screened on a 1.2% denaturing gel to assess the
RNA integnty. Samples with distinct and intact 28s and 18s ribosomal subunit
bands were used for further analysis. Spectrophotometric readings at 260 nm were
used to estirnate concentration of total RNA in each sample used for RT-PCR. Purity
of the total RNA sample was assessed by 2601280 ratios.
The RT-PCR was performed according to the manufacturer's directions
(Boehringer Mannheim) with slight modification. Briefly, reagents were blended in
two master mixes to ensure that reagents were properly mked and distributed into
each reaction tube. To each thin walled tube was added a mixture of reagents which
contained, dNTPgs (Pharmacia Biotech), primers, total RNA sample. DTT
(Boehringer Mannheim), brought up to total volume with sterile ddH20. A second
microfuge tube contained reagents which included RT-PCR buffer and enzyme mix
brought up to volume with sterile ddH20. The two preparation mixes were cornbined
in thin walled PCR tubes and placed in a prewarmed (50°C) Perkin Elmer Cetus
thermal cycler (Perkin-Elmer).
Samples of total RNA were incubated in the thermal cycler for 30 minutes,
prior to commencing the PCR profile. Thirty cycles of 30 second melt 94'C, 30
second anneal 55'C, 60 second extension 7Z°C were followed by a final extension of
72OC for 5 minutes. Four microliters of the contents of each (cDNA) product was then
visualized on a 1.5% agarose gel stained with ethidium bromide (Fisher Scientific).
DlG labeling porifed probes
Complementary DNA RT-PCR products were labeled according to
manufacturer's instructions. Briefiy. these products were cloned into pCRB2.1 TOPO
plasrnid vector (Invitrogen). One Shot competent cells (Invitrogen) were transfected
by heat shock method and streaked onto an ampicillin - LB agar plate. After
ovemight incubation at 37'C. white colonies were selected and placed in a nutrient
broth for proliferation of the bacteria. A Trizol (Life Technologies) midi prep isolated
the plasmid DNA from the bacterial DNA. Incubation of 10 pg plasrnid DNA with I O
uni& of EcoRl restriction enzyme at 37OC for one hour extracted the cloned
fragment. The cDNA was subsequently gel purified. The cDNA was subjected to
another round of PCR using identical conditions described above with DIG labeled
dNTPs (Boehringer Mannheim). The probes were then stored at -20°C.
Nofihem Blot
Total RNA samples from fve splenic hemangiosarcomas (HS), two normal
canine spleens. bovine endothelial cells (EC), and human ECs were
eiectrophoresed on a 1.2% agarose denaturing gel containing ethidium bromide and
visualized on an ultraviolet (UV) transilluminator. The ge: was transferred to a gel
blotting apparatus (see appendix IV). overnight at room temperature. Twenty-four
hou= later, the blotting apparatus was dismantled and the nylon membrane
(Boehringer Mannheim) was UV-cross linked in a Stratalinker (Stratagene, La Jolla,
CA, USA). The membrane was air dried and stored at -20°C for subsequent
hybridization and chemilurninescent detection. The Northern blot was repeated twice
to analyze a total of fifteen splenic hemangiosarcomas.
Northem Hybridization and cherniluminescent detection
The UV-cross linked nylon membrane was equilibrated in W sodium
chloride/sodium citrate buffer (SSC) for 10 minutes at room temperature. The
membrane was moved to a heat sealable plastic bag, and then prehybridized with
high cndium dodecyl sulfate (SDS) hybridization buffer (see appendix V) at 37OC for
one hour. Labeled probe was denatured in a boiling water bath. quickly chilled and
added to the high SDS buffer. The prehybridization buffer was removed and high
SDS buffer containing probe (2 pl RT-PCR product/milliliter of hybridization solution)
was added. The northem blot was hybrîdized at 37OC ovemight.
After the hybridization. the membrane was washed twice in W washing
solution for 5 minutes at room temperature. The northern blot was subsequently
washed with 0.5X washing solution three times at 65OC for 10 minutes. See
appendix V for washing solution specifications.
The 0.5X washing solution was removed and the membrane was immersed in
washing buffer for one minute. Twenty rnilliliters of blocking buffer were added to a
fresh plastic bag and incubated for one hour at room temperature. Five minutes
before the incubation was complete, 2 pl of anti-DIG-AP antibody (Boehringer
Mannheim) was added to 20 ml of blocking buffer. After removal of the blocking
buffer, diluted antibody conjugate was added and incubated for 30 minutes at room
temperature.
The membrane was washed three times in washing buffer with gentle
agitation for 15 minutes. The membrane was moved to a new pouch and equilibrated
for 5 minutes in detection buffer. The membrane was covered with 4-methoxy4(-
phosphate-phenyl)-spiro(l.2dioxetane-.2'-adamantane) disodium salt (CSPD)
(Boehringer Mannheim) diluted 1 :IO0 in detection buffer and incubated 15 minutes
at 3?*C to reach steady state enzyme kinetics. The membrane was placed into an X-
ray cassette. Hybridization signals were captured on Hyperfilm ECL X-ray film
(Amersham Pharmacia Biotech).
Southem Blot
Genomic DNA was isolated from bload samples taken from two normal dogs.
Twenty micrograms (pg) of DNA was subjected to restriction enzyme digestion using
3 pl of EcoRl (Pharmacia Biotech) 10 units /pl and 3 pl of Pst I (Pharmacia Biotech)
10 unitsl pl for 24-48 hours at 37OC. One microgram of the plasmid clone containing
the entire human FGF-2 sequence (SK 8.2 a gift from M. Klagsbmn. Children's
Hospital, Boston Massachusetts, USA) was linearized with Pst I for one hour at
37OC and subjected to PCR. Using the primers 914 and 903, a 390 bp PCR product
was generated. The PCR product and genornic DNA samples were electrophoresed
on a 1.2% agarose gel. The gel was blotted onto a nylon membrane (Boehringer
Mannheim) as described in appendix VIII. After overnight capillary transfer. the
blotting apparatus was dismantled and the DNA was crosslinked ont0 the nylon
membrane by a Stratagene crosslinker (Stratagene Products). The nylon membrane
was stored at -20'~ or used immediately in the cherniluminescent detection
described beiow. The Southern blot was run in duplicate.
Cherniluminescent detection
The UV-cross linked nylon membrane was equilibrated in 2X sodium
chloridelsodium citrate buffer (SSC) for 10 minutes at room temperature. The
membrane was moved to a heat sealable plastic bag and then prehybridized with
standard hybridization buffer (see appendix IX) at 37OC for one hour. Labeled probe
was denatured in a boiling water bath, quickly chilled and added to the hybridization
buffer. The prehybridization buffer was removed and standard hybridization buffer
containing probe (2 pl RT-PCR produdlmilliliter of hybridization solution) was added.
The Southem blot was hybridized at 37OC overnight.
After the hybridization the membrane was washed twice in W washing
solution (appendix IX) for 5 minutes at room temperature. The southern blot was
subsequently washed with 0.5X washing solution (appendix IX) three times at 65OC
for 10 minutes per wash. The 0.5X washing solution was removed and the
membrane was immersed in washing buffer for one minute. Twenty milliliters of
blocking buffer were added to a fresh plastic bag and incubated for one hour at room
temperature. Five minutes before the incubation was complete, 2 pl of anti-DIG-AP
antibody (Boehnnger Mannheim) was added to 20 ml of blocking buffer. After
removal of the blocking bufier, diluted antibody conjugate was added and incubated
for 30 minutes at room temperature.
The membrane was washed three times in washing buffer with gentle
agitation for 15 minutes per wash. The membrane was moved to a new bag and
equilibrated for 5 minutes in detection bufFer. The membrane was covered with
CSPD (Boehringer Mannheim) diluted 1 : I O 0 in detection buffer and incubated 15
minutes at 37% to reach steady state enzyme kinetics. The sealed membrane was
placed into an X-ray cassette. Hybridization signals were captured on Hyperfilm ECL
X-ray film (Amersham Phamacia Biotech).
Results
Sequence Analysis and RT-PCR products
Initial experiments with prirners based on the human sequence information
(courtesy of Dr. M Gagnon, Children's Hospital, Boston MA) generated a
predicted 480 base pair (bp) product in wntrol bovine aortic endothelial cell
(BAEC) and human microvascular endothelial (HMVECad) samples. A plasmid
vector containing the entire human FGF-2 sequence (clone SK 8.2, a generous
gift of Dr. M Klagsbrun, Children's Hospital, Boston MA) was also positive.
(Figure 5A). The primers did not yield any product in canine samples.
Subsequent attempts at optimization of the annealing temperature and MgClz
concentration did not generate canine product. (Data not shown).
A conserved region spanning approximately 285 nucleotide bases among
five species was found by comparing FGF-2 sequence data available from an
automated database (Genebank). Primers (914 and 903) designed to amplify a
390 bp fragment at positions 541 and 931 of the human FGF-2 mRNA sequence
generated product in normal canine and splenic HS samples. As well, the
primers generated product of the predicted size in BAEC, HMVECad, and control
plasmid samples (Figure 5B)
Complementary DNA products from canine adrenal samples were cloned
into pCR 2.1 TOPO plasmid (Invitrogen) and sequenced (Figure 6). Foward and
reverse sequencing information disclosed a product of 390 bp. BLAST search
analysis (Genebank) of the 390 bp product revealed sequence homology of 93%
with the human FGF-2 sequence (Genebank accession JO451 3). Cornpanson
between the human coding region and the cDNA canine product, primer sites are
illustrated in Figure 7. Differences in nucleotide bases along the sequence also
appear.
The 390 bp fragment was labeled with digoxygenin (DIG) and used as a
probe in Northem experiments. The cDNA probe produced nonspecific
hybridization signals when probing Northem membranes. Slight signal was
observed at 4.0 kb and a second signal at 1.1 kb in total RNA samples from five
HS lesions, two normal canine spleens, and cell culture matenal from human and
bovine (Figure 8). Bands at corresponding positions were viewed in the ethidiurn
bromide gel.
Labeled cDNA probe was also used in Southem blot experiments to
demonstrate conserved homology among the human. bovine and canine FGF-2
sequences. Complernentary DNA amplification products from bovine aortic
endothelium (BAEC), and hurnan microvascular endothelial cells (HMVECad)
were positive. Genomic canine DNA from two dogs, digested with two restriction
enzymes EcoRl and Pst I, did not show any hybridization. The human SK 8.2
clone subjected to restriction enzyme digestion with Pst I and PCR amplification
was positive giving a hybridization band at 390 bp. DIG labeled SK 8.2
amplification product was used as a technique control (Figure 9)
Discussion
Reverse transcriptase polymerase chain reaction (UT-PCR) experiments using
primers 914 and 903 generated a predided 390 bp amplification product in canine,
human and bovine total RNA samples. These amplification products were important for
two reasons. First. they dernonstrated the ability to amplify FGF-2 message in cell and
tissue homogenates of separate species, indicating a high degree of FGF-2 sequence
homology. Species specific amplfication produds could then be used as probes in
subsequent FGF-2 expression experiments. Second, canine amplification products from
adrenal gland tissue contributed novel FGF-2 sequence information for the dog. This
partial FGF-2 sequence was submitted to Genebank (accession number AF060562).
Experiments have shown normal bovine endotheliai ceIl (EC) expression of FGF-
2." Sequence alignment data indicated little dispanty between bovine and human FGF-2
genes, with a sequence homology of 99% between the two species.12 Accordingly, total
RNA extracted from bovine EC and hurnan EC culture material was used as positive
control material for RT-PCR. Initial RT-PCR expenments with primers designed to
amplify human and bovine FGF-2, based on the human FGF-2 cDNA (Genebank
accession J04513), did yield a predicted 480 bp product from BAEC and HMVECad
samples. These initial experiments confirrned the ability of the RT-PCR test to amplify
complernentary information from FGF-2 mRNA transcripts. However. they did not yield
an amplification produd from any normal or tumour bearing canine samples.
Optirnization procedures based on decreasing RT-PCR stnngency did not improve
product recovery.
The original intent was to use RT-PCR to create a species specific probe to
analyze FGF-2 mRNA expression in canine hemangiosarcoma (HS). Absence of an
amplification product in canine samples precluded the use of human primers in further
experiments. No sequence data were available for the canine FGF-2 gene so FGF-2
68
sequences from five species were compared with the hurnan sequence, which revealed
a region of high homology spanning 285 bp. Primers were designed to amplify a 390 bp
product which incorporated this 285 bp region. Previous work has demonstrated the
presence of FGF-2 in samples derived from brain and adrenal cortical ce11s.'~ Canine
total RNA extracted from normal adrenals, brain cortex, hypothalamus, and cerebellum
al1 showed an amplification product at the predicted size of 390 bp. After the adrenal
cDNA product was cloned. sequencing showed that it shared 93% homology with the
original human FGF-2 gene frorn which the primen were designed.
Northem analysis has contributed information about mRNA transcript size and
expression levels in other tumour systems.14 Cornparison of FGF-2 mRNA levels in
tumour samples relative to normal tissue revealed an increased expression of 7.1 kb,
3.6 kb. 2.0 kb, and 1.2 kb transcripts. Similarly. overexpression of FGF-2 was correlated
15 with advanced tumour staging in pancreatic cancer. Conversely, limited expression of
FGF-2 mRNA was identified in three of four turnour derived human mammary epithelial
cell ine es.'^ Either way, a labeled canine FGF-2 amplification product could be used to
ascertain FGF-2 mRNA expression in canine HS.
Unfortunately, the digoxygenin (DIG) (Boehnnger Mannheim), labeled cDNA
product did not hybridize to total RNA samples in subsequent Northem analyses. This
may be explained in part by the very low message present in whole tissue homogenates.
Only 3-5% of total RNA contains mRNA. Of this fraction. many fewer molecules of FGF-
2 mRNA rnay have been present. Tdzol (Life Technologies) purification of total RNA
from Rash frozen tissue using our method may not have been well-suited to extracting
the maximum amount of FGF-2 mRNA. Perhaps the non-radioactive detection was not
sensitive enough, although it has demonstrated utility in similar experiments.'? An RNA
probe may be better suited to the sensitive requirements in this analysis. A load control
probe able to detect the ribosomal subunit 75 in mice generated ample signal from al1
our samples, showing that RNA was present on the membrane and not degraded.
Subsequent Southern experiments were unable to show probe hybridization to
canine genomic DNA. These findings are consistent with the single gene copy nature of
FGF-z.'"'~ The ability to detect the single copy expression was likely limited by the non-
radioactive detection rnethod used here. PCR can be used to detect expression of single
copy genes but his was not attemptedm20 The presence of the FGF-2 gene in genomic
DNA could have been dernonstrated by using primers 914 and 903 to arnplify cDNA
products fram canine, bovine, and human genomic DNA. Future Southern blot
experiments could help establish a more cornplete understanding of the canine FGF-2
gene sequence. However, cDNA amplification products reverse transcribed from bovine.
human and canine samples confirm the probe's ability to selectively bind to FGF-2 cDNA
amplification products.
In summary, use of species specific primers amplified a product of the predicted
sue, at 390 bp. Although nonquantitative in character. the RT-PCR method was able to
demonstrate FGF-2 in canine samples. More importantly, new sequence information
derived from the cDNA product adds to previous FGF-2 nucleotide data. These findings
illustrate the highly conserved nature of the FGF-2 gene. In future studies the use of
RNA probes, polyadenylated RNA or RNA protection assays may enhance the
probability of quantitatively detecting this low abundance message.
References
1. Ensoli B, Gendelman R, Markham P. et al. Synergy between basic fibroblast growth factor and HIV-1 Tat protein in induction of Kaposi's sarcoma. Nature 1994;371:674-680.
2. Folkman J, Klagsburn M. Angiogenic factors. Science 1 987;235:442-447.
3. Gualandris A, Rusnati M. Belleri M. et al. Basic fibroblast growth factor overexpression in endothelial cells: an autocrine mechanism for ang iogenesis and ang ioproliferative diseases. Cell Growth Differ. l996;7:147-160.
4. Rogelj S, Weinberg RA, Fanning P. et al. Basic fibroblast growth factor fused to a signal peptide transfomis cells. Nature 1988;33I:l73-175.
5. Biro S, Yu ZX, Fu YM, et al. Expression and subcellular distribution of basic fibroblast growth factor are regulated during migration of endothelial cells. Circ. Res. 1 994;74:485-494.
6. Knee RS, Pitcher SE, Murphy PR. Basic fibroblast growth factor sense (FGF) and antisense (gfg) RNA transcripts are expressed in unfertilized human oocytes and in differentiated adult tissues. Biochem. Biophys. Res. Commun. 1 994;205:577-583.
7. Li AW, Seyoum G, Shiu RP, et al. Expression of the rat BFGF antisense RNA transcript is tissue-specific and developmentally regulated. Moi- Ce11 Endocrino/. 1 996; 1 1 8: 1 1 3-1 23.
8. Shuman S. Novel approach to molecular cloning and polynucleotide synthesis using vaccinia DNA topoisornerase. J.Biol. Chem. 1 994;269:32678-32684.
9. Kniazeva, M. TRlzol for plasrnid DNA isolation. Elsevier Trends Joumals TOiO50, 1-2. 3-1 9-1997. 8-19-97.
10. Prats Hl Kaghad M. Prats AC, et al. High molecular mass forms of basic fibroblast growth factor are initiated by alternative CUG codons. Proc.Nat/.Acad.Sci. U.S.A. 1989;86:1836-1840.
11. Moscatelli Dl Presta M. Joseph-Silverstein J, et al. Both normal and tumor cells produce basic fibroblast growth factor. J. Ce11 Physiol. 1 986; 1 291273-276.
12. Abraham JA, Whang JL, Tumolo A, et al. Human basic fibroblast growth factor: nucleotide sequence and genomic organization. EMBO J. 1986;5:2523-2528.
13. Brigstock DR, Klagsbrun M. Sasse JI et al. Species-specific high molecular weight foms of basic fibroblast growth factor. Growth Factors. 1990;4:45-52.
14. Ke Y, Femig DG, Wilkinson MC, et al. The expression of basic fibroblast growth factor and its receptor in cell lines derived from normal human mammary gland and a benign mammary lesion. J.Cell Sci. 1993; 10611 35-143.
15. Yamanaka Y, Friess H, Buchler M. et al. Overexpression of acidic and basic fibroblast growth factors in human pancreatic cancer correlates with advanced tumor stage. Cancer Res. 1993;53:5289-5296.
16. Li S, Shipley GD. Expression of multiple species of basic fibroblast growth factor rnRNA and protein in normal and tumorderived mammary epithelial cells in culture. Ce11 Gmwfh Differ. 1991 ;2: 195-202.
17. Holtke HJ, Ankenbauer W, Muhlegger K. et al. The digoxigenin (DIG) system for non-radioactive labelling and detection of nucleic acids- an overview. Cell Mol. Biol. 7 995141 :883-905.
18. Florkiewicz RZ. Baird A, Gonzalez AM. Multiple forms of bFGF: differential nuclear and cell surface localization. Growth Factors. 1991 ;4:265- 275,
19. Gualandris A. Urbinati Cl Rusnati M. et al. Interaction of high-molecular- weight basic fibroblast growth factor with endothelium: biological activity and intracellular fate of human recombinant M(r) 24,000 bFGF. J.CeIlPhysio1. 1994;161:149-159.
20. Sorenson GD. Pribish DM. Valone FH, et al. Soluble normal and mutated DNA sequences from single-copy genes in hurnan blood. Cancer Epidemiol. Biornarke~s~Prev. 1 994;3:67-7 1 .
Figure 5. Complementary DNA reverse transcriptase polymerase chain reaction (RT-PCR) amplification products.
SA Bovine and human FGF-2 complementary DNA amplification products resolved on 1 .O% agarose stained with 40 pg of ethidium bromide. Primen bas& on human FGF-2 sequenœ from M. Gagnon (Children's hospital. Boston MA) were used to amplify product from total RNA extracts of various tissues. Digoxygenin (DIG) labeled nucleotides were used. Even lanes tested with RT- PCR. Odd lanes tested with ?CR to detemine the presence of DNA in the total RNA sample. Negative results in odd lanes indicated no DNA contamination. Lane 1 : 100 bp ladder molecular weight marker. lane 2: bovine aortic endothelial cell (BAEC) RNA DIG labeled, lane 3: BAEC PCR control. lane 4: human microvascular endothelial cell (HMVECad) DIG labeled, lane 5: HMVEC PCR control. lane 6: normal canine spleen. lane 7: canine spleen PCR control. lane 8: hemangiosarcoma (HS) spleen, lane 9: HS spleen ?CR control. lane 10: canine endothelial cells, lane 1 1 : canine endothelial cell PCR control. lane 12: canine fibroblast cells, lane 13: canine fibroblast PCR control. lane 14: human SK 8.2 plasmid, lane 15: PCR reagent control.
SB Cornplementary DNA amplification products using RT-PCR primers 914 (5'- CTTCAAGGACCCCAAGCGGC-3') and 903 (5'- GCTCTTAGCAGACATTGG-3'). A positive RT-PCR test resolved on a 2.0% agarose gel. Bovine aortic endothelial cell (BAEC), human microvascular endothelial cell (HMVECad), and human SK 8.2 plasmid control samples are positive. Note position of the product relative to 100 bp ladder, reagent wntrols are negative. Lane 1 : 100 bp molecular weig ht marker, lane 2: BAEC cDNA product. lane 3: HMVECad product, lane 4: canine adrenal homogenate, lane 5: canine brain cortex. lane 6: canine hypothalamus, lane 7: canine cerebellurn, lane 8: RT-?CR reagent control, lane 9: human SK 8.2 plasmid. lane 10: PCR reagent control..
Figure 6. Canine FGF-2 cDNA nucleotide sequence within the p ~ ~ @ 2 . 1 - ~ ~ ~ ~ plasmid vector (Invitrogen) polylinker region. Single deoxyadenosine (A) are added to the 3' ends of PCR products by the nontemplate-dependent terminai transferase activity of Taq polymerase. The linearized plasrnid vector has overhanging 3' deoxythymidine (T) residues which allow PCR inserts to ligate efficiently when proprietary topoisornerase (Invitrogen) is used. Nucleotides highlighted in reverse belong to the canine FGF-2 cDNA sequence. Nucleotides surrounded by a box indicate binding sites for Ml 3 reverse and Ml 3 forward primers which are used for sequencing. Underlined bases correspond to restriction enzyme cleavage sites. lacZa ATG start codon indicated in bold.
EcoRI EcoRV N o t I XbaI ApaI GAATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGCA GGGCCCAATTCGCCTATA CTTAAGACGTCTATAGGTAGTGTGACCGCCGGCGAGCTCGCT CCCGGGTTAAGCGGATAT
GTGAGTCGTATTACAATTC CACTCAGCATAATGTTAAG
Figure 7. Cornparison of Human basic fibroblast growth factor (bFGF) 18 kDa protein mRNA, coding region (Genebank accession number 504513) ta canine adrenal FGF-2 cDNA (Genebank accession number AF060562). The canine sequence is aligned to the corresponding hurnan sequence appearing above it. Differences in nucleotide bases between the two aiding regions are highlighted in black.
GGGCCCCGCA GGGACCATGG CAGCCGGGAG CATCACCACG CTGCCCGCCT
TGGCGGCAGC GGCGCCTTCC CGCCCGGCCA 1
CT TCAAGGAC CTTCAAGGAC
TGCCCGAGGA Canine FGF-2
TCCACCC TCCACCC
AAACGGGGGC AAACGGGGGC
TTCTTCCTGC TTCTTCCTGC
CCCAAGCGGC TGTACTGCAA TGTACTGCAA CCCAAGCGGC
GAGCG GAGcGEl CAC CA%C C CGACGGCCG CGACGGCCG8 TCCGGGAGAA TCCGGGAGAA
AGC GAG AGC GAG AGAGG TTG AGAGGBTTG
GAAGGAAGAT GAAGGAAGAT
GGAAGATTAC GGAAGATTAC
TGGCTTCTAA TGGCTTCTAA
ATGTGTTAC ATGTGTTAC
TCTTTTTTGA TCTTTTTTGA
ACGATTGGAA ACGATTGGAA
TCTAATAACT TCTAATAACT
AAATAC AIVLTACIJCCA CCA CCGGTCAAGG CCGGTCAAGG
GTTGGTATGT GTTGGTATGT
GGCACTGAAA GGCACTGAAA
ACAATACTTA ACAATACTTA
TGG ACAGGACCTG ACAGGACCTG
GGCAGAAAGC CGAACTGGGC CGAACTGGGC
AGTATAAACT AGTATAAACT GGCAGAAAGC
CTGATTTTAA TGGCCACATC TATACTTTTT TATACTTTTT
CTT CCAATGT CTGCTAAGAG
TAATCTCATT
ATG start codon for human 18 kDa FGF-2 protein TGA stop codon for human FGF9 proteins CTTCAA primer hybridization site based on human sequence analysis.
rnismatch between the two sequences
Figure 8. Northern analysis of canine splenic total RNA. Canine RT-PCR amplification product from adrenal RNA (Figure 1 B, lane 4) was digoxygenin (DIG) labeled and used to probe canine samples.
8A Representative total RNA samples resolved on an ethidiurn bromide stained 1.2% agarose denaturing gel. Lane 1 : RNA molecular weight marker (Boehringer Mannheim), lane 2: bovine aortic endothelial cell RNA. lane 3: canine adrenal extract. lane 4: normal canine spleen from dog 1. lane 5: nomal canine spleen from dog 2, lane 6-1 0: total RNA extracted from five separate splenic hemangiosarcoma cases. Marken indicate ribosomal subunit position. This experiment was repeated twice.
8B Nylon membrane illustrating weak signal after chemiluminescent detection and four hour X-ray film exposure. Hybridization signal is visualized as dark regions of intensity. Molecular weight markings indicate size in kilobase pairs.
8C The content of total RNA loaded into each lane is cornpared by probing for a ribosomal subunit message that is constitutively expressed among cell types. A mouse 7s cDNA probe is used to determine relative load quantities among the lanes.
Figure 9. Digoxygenin (DIG)-labeled cDNA probing of RT-PCR amplification products and canine genomic DNA. Unlabeled cDNA from RT-?CR reactions. together with canine genomic DNA and human SU 8.2 plasmid were subjected to Southem hybridization using a cDNA probe synthesized from canine adrenal tissue.
9A Representative complementary DNA and genomic DNA samples electrophoresed on a 1.2% agarose gel stained with 40 pg of ethidium bromide. Lane 1 : contains the PCR reagent control. lane 2: contains the 100 bp ladder (Phamacia Biotech), lane 3: 390 bp bovine aortic endothelial cell cDNA amplification product (see Figure 18 lane 2). lane 4: human microvascular endothelial ceIl amplification 390 bp product, lane 5: canine adrenal cDNA 390 bp. lane 6: a 20 pg canine genomic DNA digested with 30 units of Pst I and 30 units Eco RI dog 1, lane 7: 20 pg canine genomic DNA digested with 30 units of Pst I and 30 units Eco RI dog 2, lane 8: cDNA amplification product from human SK 8.2 linearized with Pst I and subjected to PCR with 914 and 903 prirners, lane 9: human SK 8.2 linearized with Pst 1, lane 10: cDNA amplification product from human SK 8.2 linearized with Pst 1 and subjected to PCR with 914 and 903 primers using DIG labeled nucleotides. This experiment was run in duplicate with the same result.
9% Cherniluminescent detection of Southem membrane. Hybridization product is visualized as dark regions of intensity. No signal is seen in either the reagent control in lane 1 or the lanes 6 and 7 which contain canine genomic DNA. Lane 8 and 10 wntain a signal corresponding to the amplification product seen in the ethidium bromide agarose gel. Lane 9 contains a signal band that is larger than 1.6 kilo base pairs in size.
CHAPTER THREE
lrnmunohistochemical detection of FGF-2 and von Willebrand factor antigen in
canine hemang iosarcoma
Abstract
lmmunohistochemistry was used to demonstrate the expression of von
Willebrand factor antigen and FGF-2 in canine splenic hernangiosarcoma.
Tissues were collected frorn 22 cases of confimed splenic hernangiosarcoma
(HS). Positive control material came from human microvascular endothelial cells.
Tissues were processed for routine histology by fomalin fixation and embedding
in paraffin. Three tumours stained intensely, four tumours less so, five stained
weakly and ten did not stain for FGF-2 antigen. Conversely, one turnour stained
intensely, six tumours less so, ten weakly and five did not stain for von
Willebrand factor antigen. Results indicate that HS cells are capable of
expressing both FGF-2 and von Willebrand factor (vWF), however, there was no
significant association between the two proteins. FGF-2 may play an important
role in the growVi of canine HS since some HS tumours had much greater
amounts of FGF-2 compared with normal canine spleen.
Introduction
Hemangiosarcoma is a common cancer of dogs. lt represented the
second most frequent sofi-tissue neoplasm from a compilation of 17 000
microscopically confimed canine neoplasms derived from records of veterinary
schools in Canada and the United tat tes.' Presently, demographics. rudimentary
aspects of the tumour biology and general resistance to treatment are kn~wn.~" j
Most hernangiosarcomas do express von Willebrand factor antigen (vWF)
confiming their endothelial origin 6, but beyond this, nothing has been done to
further understand the cell biology of the hernangiosarcoma cell.
Capillary endothelium stimulated by growth factors and cytokines released
from turnour cells acquire an angiogenic phen~type.~ As the endothelial cells
acquire this phenotype, many physiological processes that influence invasion,
migration, and proliferation are upregu~ated.~ One growth factor prorninent in this
process is F G F - ~ . ~ ' ' ~ A role for FGF-2 has been established in other tumour
systems." Expression of FGF-2 could play a dual role in canine
hernangiosarcoma by stimulating the growth of normal blood vessels and the
malignant endothelial cells.
The purpose of the present study was to attempt to demonstrate the
expression of FGF-2 antigen irnmunohistochemically in canine
hemangiosarcomas and to correlate this expression with the expression of VWF.
Materials and Methods
Twenty-two dogs with hemangiosarcoma (HS) were included for study.
The diagnosis of HS was based on tissue biopsy or necropsy. Only those dogs
with confirmed splenic HS were included. Tumour sections were batch stained
for either FGF-2 or vWF. Eleven tumoun were run on each day with wntrol
tissues which included one ocular infiammatory lesion, one canine ciliary body
tumour and pelleted human microvascular endothelial cells paraffin embedded
and fixed in formalin. Hemangiosarcomas from 22 dogs were stained for vWF
over two days; likewise, al1 were stained for FGF-2 over two days. Slides were
coded and then read in a randomized, blinded fashion.
Each HS section was run with a negative control in which normal goat
serum was substituted for the primary antibody. Normal vessels, present in ali
sections examined. served as internai positive controls for vWF experiments.
Expression of von Willebrand factor antigen and FGF-2 protein was graded
according to staining intensity. Most intense was assigned (+++) which had 25 or
more positive cells in every 40X field. Less intense staining was assigned (++),
and had 10-1 5 positive cells in every field 40X field. Weak staining (+) was
defined as fewer than 5 positive cells in every 40X field. Negative staining was
marked (-) with no cells staining positive.
Five micron tissue sections were cut from fornalin fixed paraffin
embedded tissues. The sections were hydrated in a standard fashion using 3 x 2
minute changes of xylene. 2 x 2 minute changes of 100% ethanol, 2 x 2 minute
changes in 75% ethanol followed by a 2 minute rinse in ddH20. Slides were dried
and immersed in 3% hydrogen peroxide in methanol for 5 minutes to quench
endogenous peroxidase activity. Preliminary studies showed that a 12 minute
incubation at 37OC with 0.1 % trypsin followed by a 5 minute room temperature
incubation with soybean trypsin inhibitor resulted in optimal antigen exposure.
lmmunohistochemical staining for von Willebrand factor antigen
Non-specific binding of antiserum was blocked by incubation with 5%
normal goat serum in phosphate buffer saline (PBS), for 30 minutes followed by
a PBS wash. Optimal dilutions for von Willebrand factor antibody were made
using normal canine splenic tissue and formalin fixed endothelial cells (ECs).
Slides were incubated for one hour with von VVillebrand factor antiserum diluted
1:100 in PBS containing 1 % normal goat serurn. After rinsing, the slides were
incubated 30 minutes with the secondary antibody consisting of biotinylated goat
antirabbit IgG (Sigma Chemical Co.) diluted 1 :20 in PBS containing 1 % normal
goat serurn. A 1 :20 dilution of the avidin-peroxidase conjugate (Sigma Chernical
Co.) constituted the last 30-minute incubation. The slides were developed for 5
minutes in 3-amino-9-ethylcarbazole (AEC) (Sigma Chemical Co.) according to
the manufacturef s instructions. The reaction was terminated in a distilled water
bath. Finally. slides were counter-stained in Mayer's hematoxylin solution (Sigma
Chemical Co.), rinsed in wam tap water and rnounted with an aqueous mounting
media. All incubations were carried out in hurnidified chamber at room
temperature.
lmmunohistochemical staining for FGF-2 antigen
After antigen unmasking described above. sections were Rooded with
undiluted normal goat serum containing 1 % triton X-100 (Fisher Biotech) for 30
minutes at room temperature. in a humidified chamber. Subsequent incubations
occurred in humidified chamber.
Optimal concentrations for anti-FGF-2 were detemined using fomalin fixed
endothelial cells and reactive microvessels in ocu lar lesions. Positive reactions were
typified by rose coloured cytoplasmic staining. A consistent staining pattern was also
seen in nomal tissue. The polyclonal rabbit anti-human FGF-2 IgG (Cedarlane,
Homby, ON) was diluted 1 :12 as determined in preliminary experiments. The final
dilution contained Bpg/ml of antibody 1 % normal goat serum and 0.1 % Triton X-100
(Fisher Biotech). The slide was incubated with the prÎmary antiserum for one and
half hours at room temperature. Slides were washed twice with PBS for 5 minutes
per wash. After rinsing, the slides were incubated 30 minutes with the secondary
antibody consisting of biotinylated goat antirabbit IgG (Sigma Chernical Co.) diluted
1 :20 in PBS containing 1 % normal goat serum. A 1 :20 dilution of the avidin-
peroxidase (Sigma Chemical Co.) constituted the last 30-minute incubation. The
slides were developed for 5 minutes in 3-amino-9-ethylcarbazole (AEC) (Sigma
Chemical Co.) according to the manufacturer's instructions. The reaction was
teminated in a distilled water bath. Finally. slides were counter-stained in Mayer's
hematoxylin solution (Sigma Chemical Co.), rinsed in wam tap water and mounted
with an aqueous mounting media.
The Chi-squared test of independence was used to test for an association
between expression of FGF-2 and vWF.
Results
Canine HS consists of a spongy mass of anastomosing channels Iined by
endothelial cells with varying degrees of atypia (Figure IO ) . Hematoxylin and
eosin sections revealed malignant cells with hyperchromasia, plump nuclei and
prominent nucleoli. A large number of red blood cells gave lesions a congested
appearance. Certain areas within each lesion were necrotic, these areas were
avoided.
Seventeen tumours were considered positive and five tumours were
negative for vWF (Table 3). In the majority of positive cases. interpretation was
effortless since typical neoplastic cells demonstrated a characteristic cytoplasmic
nist red granular reaction product. Tumours showed varying degrees of vascular
differentiation, ranging from the characteristic islands of collagenous stroma lin&
with flattened to plump. rotund ECs foming irregular vascular channels. There
was a consistent rust red granular pattern in the cytoplasm of positive human
microvascular endothelial cells (HMVECad) used to determine the specificity of
the antibody (Figure 1 1 B). Vessels within each section served as interna1
wntrols (Figure 1 IA). Reaction product was not seen in negative control sections
of normal and neoplastic tissue (Figure 12A and 128).
Twelve tumours were considered positive for FGF-2. Positive cases had a
rose coloured cytoplasmic staining that was present in malignant cells (Figure
13A and 138). Numerous other cell types also stained positive. They included
cells of the red pulp, keratinocytes, hepatocytes, trabecular smooth muscle cells,
and normal endothelial cells. Cells that did not stain positively for FGF-2 were red
cells and large endothelial cells. Since FGF-2 is a ubiquitous protein in
mammalian cells, a consistent pattern was also seen in normal tissue (Figure
14A and 14B). In general, staining for FGF-2 was more intense in positive HS
tumours than in normal spleens.
There was no significant association between the two proteins studied
(Table 3 and table 4). However, there were 17 of 22 tumours that were positive
for vWF and 12 of 22 tumours positive for FGF-2. There were 10 cases of HS
that concurrently stained positive for bath proteins and three cases of HS that did
not stain for either protein. Two cases of HS were vWF negative but stained
positively for FGF-2. Conversely, seven HS cases were vWF positive but stained
negatively for FGF-2.
Discussion
lmmunohistochemical staining for factor vWF and FGF-2 was
dernonstrated in canine splenic hemangiosarcoma tissues. Here. 77% of the
tumours stained positively for vWF which is similar to prior reports6 As a
neoplastic cell reverts to a more juvenile phenotype it rnay lose the ability to
express biomolecules ordinarily present in more differentiated ce11s.'~ The lack of
positive vWF staining in HS may be explained by a more anaplastic phenotype. It
appears that staining for vWF can be helpful in supporting a histological
diagnosis of HS but cannot be used to rule out the diagnosis.
Limited immunohistochemical studies of FGF-2 have been reported in
normal and malignant tissue^.'^ They describe widespread distribution of FGF-2
in normal human tissues and suggest that FGF-2 represents a constitutive
component of the vascular basement membrane.l4 In human spleen. FGF-2 is
seen faintly distributed through the red pulp and some blood vessels. especially
central arterioles of the white pulp.'5 (Figure 13A and 13B). Malignant spindle
cells in Kaposi's sarcoma have been characterized by simultaneous staining for
FGF-2 and VWF."
There was no significant association between the two proteins suggesting
that if they play a role in pathogenesis they do so independently. Perhaps the
degree of positive FGF-2 staining intensity may have some prognostic merit. It
may be conceivable that those cases with the greatest expression of FGF-2 had
a shorter survival, due to larger tumours or more rapid growth of malignant cells.
The retrospective nature of this study does not permit the analysis of such
associations. It seems worth-while to direct future studies in this area since there
is a great diversity in expression of FGF-2 among HS tumours.
References
1. Pnester WA, McKay FW. The occurrence of tumors in domestic animals. Natl. Cancer lnst- Monogr. 1 980; 1 -2 1 0.
2. Spangler W. Culbertson MR. Prevalence, type. and importance of splenic diseases in dogs: 1,480 cases (1 985-1 989). J.Am. Vet. MedAssoc. 1992;200:829-834.
3. Spangler WL. Kass PH. Pathologic factors affecting postsplenectomy survival in dogs. J.Vetlntem.Med. 1997;11:166-171.
4. Ogilvie GK, Reynolds HA. Richardson RC, et al. Phase II evaluation of doxorubicin for treatment of various canine neoplasrns. J.Am. Vet. Med.Assoc. 1989; 195: 1580-1 583.
5. Sorenmo KU. Jeglum KA, Helfand SC. Chemotherapy of canine hernangiosarcoma with doxorubicin and cyclophosphamide. J- Vet. lnlem. Med. 1 993;7:370-376.
6. von Beust BR. Suter MM, Summers BA. Factor VIII-related antigen in canine endothelial neoplasms: an immunohistochemical study. Vet. Pathol. l988;25:251-255.
7. Folkman J. The role of angiogenesis in tumor growth. Semincancer Biol. 1992;3:65-71.
8. Gualandris A, Rusnati M. Belleri M. et al. Basic fibroblast growth factor overexpression in endothelial cells: an autocrine mechanism for angiogenesis and angioproliferative diseases. Cell Growth Differ. l996;7:l47-l6O.
9. Kandel J. Bossy-Wetzel E, Radvanyi F, et al. Neovascularization is associated with a switch to the export of bFGF in the multistep development of fibrosarcoma. Ce11 1991 ;66:1095-1104.
10. Griffioen AW. Coenen MJ. Damen CA, et al. CD44 is involved in turnor angiogenesis; an activation antigen on human endothelial cells. BIood i997;QO:ll5O-ll59.
11. Ensoli B. Gendelman R, Markham P, et al. Synergy between basic fibroblast growth factor and HIV-1 Tat protein in induction of Kaposi's sarcorna. Nature 1994;371:674-680.
12. Pearson RD. Cellular heterochrony and neoplasia. MedHypotheses. l982;8:23l-Z35.
13. Burton PB, Quirke P. Sorensen CM, et al. Growth factor expression during rat development: a comparison of TGF- beta 3, TGF-alpha. bFGF, PDGF and PDGF-R. Int. J. Exp. Pathol. 1993;74:87-96.
14. Cordon-Cardo C, Vlodavsky 1, Haimovitz-Friedman A, et al. Expression of basic fibroblast growth factor in normal human tissues. Lab. invest. l990;63:832-840.
15. Schulze-Osthoff K. Risau W. Vollmer E. et al. In situ detection of basic fibroblast growth factor by hig hly specific antibodies. Am. J. Pathol. IWO; 1 37:85-92.
Table 3. Sumrnary of immunohistochemical staining results in canine HS for antibodies directed against vWF and FGF-2. Numbers indicate the slide count for each staining level. The Chi-squared statistic tested at a=0.05 with one degree of freedom is not significant. n=22
Chi-squared statistic x2=0.46
FGF-2
lrnrnunoreactivity
Table 4. Detailed surnmary of immunohistochemical staining results in canine HS for antibodies directed against vWF and FGF-2. Numbers indicate the slide count for each staining level. The Chi-squared statistic tested at a=0.05 wlh nine degrees of freedom is not significant. n=22
vWF lmrnunoreactivity
v W lmrnunoreactivity
+++ ++ + - 1 Total
Chi-squared statistic x2= 0.52
Total
12
10
22
Neg ative
2
3
5
Positive
Neg ative
Total
Positive
10
7
17
Figure 10. Histolog ical appearance of a representative canine splenic hemangiosarcoma. Hematoxylin and eosin staining of spleen biopsies taken from dogs. Vascular channel formation typical of splenic hemangiosarcoma. Magnification 400X.
Figure 11. von Willebrand factor antigen distribution in biopsy and control samples.
I I A A tumour sample illustrating the positive nature of malignant cells lining the vascular channel (arrowhead). A normal large vessel (arrow) serves as an intemal control with positive staining of the endothelium lining the large vessel. Magnification 200X.
11 B Human microvascular endothelial cells (HMVECad) (Cascade Biologies) were pelleted, forrnalin fixed and paraffin embedded. They serve as positive controls. Magnification 400X
Figure 12. Control tissue appearance. Replacement of primary antibody with 5% nomal goat serum in phosphate buffered saline served as negative control for factor VI l l experiments.
12A A splenic tumour with no rust red granular pattern. Magnification 100X.
i 26 Normal spleen control with no staining apparent. Magnification 100X.
Figure 13. Representative pattern of FGF-2 immunoreactivity in splenic hemangiosarcorna.
13A Strong FGF-2 irnmunoreactivity is seen in malignant cells. Positive cells appear red. Magnification 100X.
13B FGF-2 positive spindle-shaped cells. Magnification 400X.
Figure 14. FGF-2 immunoreactivity in normal canine spleen. Positive staining indicated by rose coloured cytoplasm.
14A FGF-2 irnmunoreactivity appears through the red pulp and the central vesse1 of the white pulp. Magnification 400X
148 Section shows positive cells of the red pulp and trabecular cords. Mag nification 400X.
GENERAL CONCLUSIONS
Vanous techniques for the isolation of endothelial cells (ECs) were used to
attempt culture of canine hernangiosarcoma (HS) cells. This is the first report of
short-term culture of endothelial cells from either adrenal glands or splenic HS. It
is apparent that canine endothelial cells, whether normal or malignant, have
more fastidious growth requirements than endothelial cells of other species. On
six occasions, the technique was successful in short-terni culture of canine
rnicrovascular cells derived from adrenals. These adrenal cultures were
passaged up to five times but subsequent cultures were overgrown with cells of
fibroblastic morphology. On one occasion. isolation and short-term culture (three
passages) of von Willebrand factor antigen (vWF) positive cells from a HS spleen
was facilitated by immunoparamagnetic beads coated with Ulex europaeus. The
endothelial nature of al1 cell Iines was confimed on phase contrast microscopy
and immunohistochemical staining for vWF. However, there are limitations to
using a rnarker present in various amounts on differentiated microvascular
endothelial cells but not al1 HS tumour celis. It may have been possible that some
positive HS tumour cultures were disregarded because malignant microvascular
cells were vWF negative. Moreover, previous immunohistochemical studies have
used Ulex europaeus to distinguish malignant cells from normal endothelial cells
in mammals. It humans, Ulex europaeus lectin marked both malignant and
normal rnicrovascular cells. It is appealing to think of this lectin as being able to
selectively mark neoplastic cells over normal cells in dogs. Our study cannot rule
out the possibility that normal microvascuiar endothelial cells were also selected
when cells from HS spleens were isolated with beads coated wlh Ulex
europaeus.
Derivation of the canine sequenœ for FGF-2 based on alignment of
known sequences did show that selection of primers within the protein cuding
region was accurate. A cDNA amplification product of the predicted 390 bp size
was sequenced. Cornparison to the human FGF-2 gene revealed 93% homology,
in contrast to 99% homology between the bovine and human sequences. This is
the first description of the canine FGF-2 sequence (Genebank accession number
AF060562). Probes generated from the canine cDNA amplification product failed
to demonstrate the presence of FGF-2 mRNA transcripts in total RNA samples
extracteci from HS spleens and normal canine. human and bovine tissues. Our
studies were limited by the reduced sensitivity of cDNA probes with respect to
RNA probes of the same sequence. However. the DIG labeled probes did bind to
amplified canine, bovine and human FGF9 cDNA indicating that the F GF-2
mRNA message may be present in exceedingly small quantities.
Splenic hemangiosarcoma sections were stained with antibodies to FGF-2
and von Willebrand factor antigen. Statistical analysis revealed that there was no
association between the expression of the two antigens. FGF-2 irnmunoreactivity
in normal canine splenic samples was less intense than that observed in HS
sections. It is possible that HS cells are stimulated to proliferate by an autocrine
or paracrine manner with respect to FGF-2. However, some HS tumoun were
negative for FGF-2 immunoreactivity indicating that FGF-2 protein may not be
expressed in al1 tumoun. If this was the case. it may be suggested that additional
growth factors are involved in the malignant progression of HS or neoplastic cells
carry mutations in which FGF receptors are constitutively activated precluding
the need for increased growth factor protein expression. Combined in situ
hybridization and western blotting expenments can provide more sensitive FGF-2
expression information over irnrnunohistochemical studies discussed here.
Stimulation of quiesœnt endothelial cells is often the product of multiple
growth factors and it would be naïve to believe that any single agent or event is
responsible for tumour formation. Recent studies have dernonsttated
relationships between growth factors involved in tumour pathogenesis. It would
be useful to determine the expression of several growth factors and their
receptors with respect to HS. Perhaps expression data gathered from these
studies would reveal a mechanistic relationship arnong growth factors involved in
the pathogenesis of canine hernangiosarcorna.
APPENDICES
Protocol for cell culture experiments
Mate rials
Phosphate buffered saline (PBS) Zx Sambrook et al. 0.1 3 M NaCl 0.0027 M KCI 0.010 M Na2HP04 0.002KH2P04 pH 7.2
PBS plus 10x antibiotics Amig lyde-V Fungizone
Iscove's modified Dulbecco's modified Eag le's media (DMEM) IDMEM pH7.5 (Gibco Life Technologies, Burlington ON) Sodium bicarbonate (Fisher Scientific, Unionville, ON) 3.024 g/L
IDMEM plus 1 x antibiotics Amig lyde-V (Ayerst Laboratories) Fungizone (Gibco Life Technologies)
M l 31 Cascade Biologicç (Portland Oregon, USA) Added to this 5 ml of 20X Microvascular gro supplement
Ml99 pH 7.5 (Gibco Life Technologies, Burlington ON) Sodium bicarbonate (Fisher Scientific, Unionville, ON) 2.4 1 g/L
Endothelial cell growth supplement (1 00X) 1 OOX (Sigma Chernical Co., St. Louis, Missouri, USA) Diluted to 1 ml growth supplement per 100 ml of medium 199
Heparin Sodium salt - porcine (Sigma Chernical Co.) Diluted to 15 units per 1 ml of medium 199 I O 000 units
Trypsin-EDTA 10x stock (Gibco Life Technologies) 0.5% trypsin Oiluted from 10x to l x in PBS 5.3 mM EDTA pH 7.2
Amiglyde-V amikacin sulfate (Ayerst Laboratories. Montreal PQ)
Fungizone (Gibco Life Technologies)
Collagenase Type 1A (Sigma Chernical Co.) diluted 0.5% wlv in IDMEM working solution
Fetal bovine serum (FBS) (Cansera, Rexdale, Ontario)
Borate buffer Bon'c acid (H3BO3) (Fisher Scientific) ddHzO pH 8.5
PBS/BSA buffer NaCl Na3P04 Bovine senim albumin (BSA) pH 7.4
Product No. C 9891 436 unitslmg solid
Dynabeadsm M450 uncoated (Dynal Inc. Lake Success, New York)
Ulex Europaeus lectin (Sigma)
Anti-Human endothelial cell CD31 mouse monoclonal antibody (DAKO.
Methods Pnmary culture of canine adrenal micravascular endothehum
The adrenals frorn adult dogs approximately 2-3 cm in length were obtained from Small Animal Surgery through Debbie Kingston ext. 4096 University of Guelph.
The adrenals are transported from the surgical suite to the laboratory in PBS containing 1 Ox antibiotics.
The PBS was carefully poured off, and the adrenals were sprayed with 70% ethanol. The glands were then rnoved to a sterile 60 mm petri dish. The fibrous tunic was removed with scalpel and forceps.
The tissue was then minced as finely as possible. Meduliary tissue was removed and the cortex was finely minced and carefully scooped into a sterile 500 ml bottle containing a stir bar.
350 ml of PBS plus 10X antibiotics was added and the mixture was stirred for 10 minutes, then allowed to briefly setîle. The supematant waç then poured off. This wash was repeated twice.
The minced tissue sections were moved into a 50 ml conical polyethylene tube. The tube was topped up to 40 ml with IDMEM plus 1X antibiotics and the cells and debris were pelleted by centrifuging at 950 x g for 5 minutes.
The supematant was carefully poured off. A fresh solution of IDMEM and 0.5% collagenase (wjv) was added. This mixture was incubated a 37OC for 20 minutes.
The resulting homogenous suspension was pipetted vigorously through a large bore pipette to fumer dissociate the cells. The digested tissue suspension was passed through sterile multi-layered gauze and collected in another 50 ml conical centrifuge tube.
The cells and micro-vesse1 fragments were pelleted by centrifugation for 5 minutes at 950 x g. The cells were washed in IDMEM twice. On the second last wash the red cells were lysed by the addition of double distilled water to the pelleted cells for 15 seconds. This solution was then nonalized with addition of hypertonie PBS.
10.After the final wash, the cells from two adrenal glands were resuspended in 2.5 ml of Ml31 or Ml99 and plated ont0 a pre-coated 60 mm petri dish. The supernatant of Ml31 cultures was aspirated 45 minutes after plating and subjected to immunoparamagnetic enrichment according to manufacturer's directions. The cells were grown to confluence and spll at a ratio of 2:l on subculture. At the fourth passage the cells were cryopreserved.
Primary culture of canine splenic hemangiosarcorna
The spleens from dogs undergoing surgical treatment were obtained with owner's consent, from Small Animal Surgery care of Dr. Anne Sylvestre.
The spleen was removed in small animal surgery and transferred to the laboratory using a sterile stainless dish covered with sterile dressings.
After transfer to laminar flow condlions, the spleen was briefiy immersed in 70% ethanol then moved to PBS with 1OX antibiotics.
The spleen was minced into 1 cm' tissue pieces and placed into 500 ml bottles with stir bars containing 400 ml of PBS plus 10X antibiotics.
The cell suspension mixture was stirred for 10 minutes, then allowed to briefly settle. The supematant was then poured off. This wash was repeated twice.
After the third wash the tissue was further minced into the smallest fragments possible.
The minced tissue sections were moved into a 50 ml conical poiyethylene tube. The tube was topped up to 40 ml with IDMEM plus 1X antibiotics and the cells and debris were pelleted by centrifuging at 950 x g for 5 minutes.
The supematant was carefully poured off. Tissue chunks for primary explant culture were subjected to a 10 minute 0.5X trypsin-EDTA 37OC incubation and p lated on dishes precoated with attachment factor for M 1 3 1 experiments or dishes precoated with 1 % gelatin for M l 99 expenrnents.
A fresh solution of IDMEM and 0.5% collagenase (w/v) was added to remaining tissue fragments. This mixture was incubated a 37OC for 20 minutes.
10. The resulting homogenous suspension was pipetted vigorously through a large bore pipette to further dissociate the cells. The digested tissue suspension was passed through sterile multi-layered gauze and collected in another 50 ml conical centrifuge tube.
1 1. The cells and micro-vesse1 fragments were pelleted by centrifugation for 5 minutes at 950 x g. The cells were washed in IDMEM twice. On the second last wash the red cells were lysed by the addition of double distilled water to the pelleted cells for 15 seconds. This solution was then nomalized with addition of hypertonie PBS.
1Z.After the final wash in IDMEM, the supernatant was removed and the cells were resuspended in either Ml 31 or M l 99. Altematively, the supematant was resuspended in M l 31 and subjected to immuno-paramagnetic isolation according to the manufacturer's directions. Cells bound to beads were resuspended in M131. The suspension was piated onto a pre-coated 60 mm petri dish. The cells were grown to confluence and split at a ratio of 23 on subculture.
Freezing ceil culture material
1. Supernatant was aspirated off of the culture and the cells washed and trypsinized as for cell culture.
2. Ml31 was added to the trypsinized cells in a 1:l ratio
3. The cell suspension was transferred to a 15 ml centrifuge tube and the cells centrifuged at 950 x g for 5 minutes.
The cells were resuspended in 800 pl IDMEM and transferred to a cryovial (Nunc).
100 pl of FBS and 100 pl DMSO were added to the vial. which was placed in a styrofoam holder and immediately transferred to a -70°C freezer.
ARer 2 days the cells were transferred to liquid nitrogen for long term storage.
When the cells were required. the suspension was thawed rapidly and transferred to 25 cm2 Rask containing pre-warrned M l 31 and incubated at 37OC. 5% COz. When the cells were confluent they were subcultured as previously described.
Binding lectins and anfibodies to dynabeads@ M-450 uncoated
Two mg of UEA 1 was resuspended in 2.0 ml of 0.5 M borate solution (pH 8.5 - 9.5) to a ccncentration of 1 mg lectin/ml. For anti-PECAM-1 350 pg of CD- 31 was resuspended in 700 pl of 0.5 M borate solution (pH 8.5 - 9.5) to a concentration of 100 pg anti CD-31 antibodylml.
A unifom suspension of Dynabeads M-450 uncoated was made by agitating the vial. It was vortexed briefly.
A volume of 100 pl of beads was put into a 1.5 ml centrifuge tube. The beads were washed 2 times in 1.0 ml of 0.5 M Borate buffer. pH 9.5. The tube was placed in a Dynal MPC E-1 magnet for 1-2 minutes. The supernatant was removed with gentle aspiration while the tube remained in the magnet.
After removing the supernatant from the last wash, 200 pl of the lectin or the anti CD31 solution was added to the dynabeads.
The solution was incubated for 24 hours at 4OC with slow bi-directional mixing on a bidirectional mixer.
The protein coated dynabeads were collected with the Dynal magnet.
While in the magnet the supernatant was discarded.
The dynabeads were washed 3 separate times at 4OC while on a bi- directional mixer. Once for 10 minutes, then again for 30 minutes, then a third time overnight for 20 hours.
Again, the dynabeads were collected with the Dynal magnet. and the supernatant was discarded. The coated dynabeads were resuspended to original concentration in a PBSIBSA buffer.
Protocol for Reverse Transcriptase Polymerase Chain Reaction (RT-?CR)
Materials
Titanm One Tube RT-PCR System (Boehringer Mannheim, Montreal Quebec)
Storage and dilution buffer: Tri's-HCI 20mM KCI 1 OOrnM EDTA 0.1 mM dithiothretiol (DTT) 1 mM TweenB20 0.5% (vlv) 0.5% Nonidet@P40 (vlv), 50°!4 glycerol(v1v). pH 7.5 (24OC)
Enzyme mix: ExpandTM High Fidelity enzyme mix, reverse transcriptase, AMV, in storage buffer.
RT-PCR reaction buffer (5x concentration) MgCl2 Dimethyl sulfoxide (DMSO)
MgCl* solution
Dithiothreitol solution
d NTP mixture: dATP (Pharmacia Biotech) dCTP
dGTP dl-rP
Fonivard Primer
Reverse Primer
Light mineral oil (Fisher Scientific, Unionville, Ontario)
5x TBE buffer Sambrook et al. Tris base (Boehringer Mannheim) Boric acid (Fisher Scientific) 0.5M EDTA
7.5 mM 1 .O ml
25mM (1 .O ml)
100 MM (1 -0 ml)
10 mM 10 mM 10 mM 10 mM
20 pM
20 pM
This stock solution was diluted to a 0.5~ strength for agarose gel electrophoresiç.
Nusieve agarose (Mandel Scientific) 1.5 g1100 ml of TBE
Sterile double distilled H20
Methods
1. The total RNA from canine, bovine aorüc, and human microvascular samples was quantitated using the absorbante reading at the ultraviolet wavelength of 260 nm. Purity was assessed by comparing the reading at ultraviolet wavelength 260 nm to ultraviolet wavelength 280 nm.
2. Two master mixes were created to ensure that reagents were properly rnixed and distributed, into each reaction tube.
3. To each thin walled 200 pl PCR reaction tube was added master mix 1 which contained, sterile ddHzO. 1 pl of dNTP's, 2 pl of each primer, the template total RNA, 2.5 pl of OTT for a total of 25 pl.
4. To a second 1.5 ml rnicrofuge tube on ice, was added the master mix 2 which contained 10 ul5x RT-PCR buffer with ~ g ~ + , 1 pl enzyme rnix. and sterile ddHzO to a total of 25 pl. This reaction mixture was scaled up depending upon the number of reactions to be run.
5. The two master mixes were combined in the 200 pl PCR reaction tube and overlaid with 30 pl of light mineral oil (Fisher Scientific, Unionville, Ontario).
6. The samples were then placed in a pre-wamed (to 50°C) Perkin-Elmer Cetus Thermal Cycler.
7. The reverse transcriptase reaction continued for 30 minutes at 50°C. The reaction tubes were then subjected to a 2 min 94OC denaturing temperature.
8. A 30 cycle program of 94OC for 1 minute. 55OC for 30 seconds, 74OC for 30 seconds, followed by a final 74OC extension for 5 minutes constituted the polymerase chah reaction portion.
9. The samples were removed from the thermal cycler and 4 pl of the RT-PCR products were visualized on a 1.5% or 2.0% agarose gel. stained with ethidium bromide.
APPENDIX III Isolation of total RNA
Materials
TRlzolm Reagent -Total RNA Isolation reagent- (Life Technologies) 1 ml per 50-1 00 mg of tissue
Chloroform (Fisher Scientific) -RNAase Free-
lsoamyl Alcohol - isopropanol (Fisher Scientific)
75% Ethanol 100% ethanol DEPC ddH20
Diethyl pyrocarbonate (DEPC) (ICN Biomedicals Inc., Montreal, PQ)
ddH20 pre-treated with DEPC
Methods
Isolation of total RNA using TRlzol reagent
Canine tissue samples snap frozen in liquid nitrogen were homogenized using a mortar and pestle under cold conditions.
Tissue was weighted out and transferred to a tight-fitting Eve rjelm tissue homogenizer. One milliliter of TRlzol per 100 mg of tissue was immediately added. Tissue was disrupted by 10 up and down strokes.
O n e milliliter aliquots of the resulting suspension were pipetted into 1.5 ml microfuge tubes. The tubes were allowed to incubate at room temperature for 5 minutes to permit complete dissociation of nucleoprotein complexes.
To each tube was added 0.2 ml of chloroform. The tubes were shaken vigorously by hand for 15 seconds and incubated at room ternperature for 2 to 3 minutes.
The tubes were centrifuged at 12 000 x g for 15 minutes at 4OC.
The supernatant was transferred to a fresh 1.5 ml microfuge tube. A second chloroform extraction was performed on samples with a high protein content.
7. RNA was precipitated by adding 0.5 ml of isopropanol to each microfuge tube and incubating at room ternperature for 10 minutes and centrifuged at 12 000 x g for 10 minutes at 4 O C .
8. The RNA precipitate fonned a gei-iike pellet on the side and bottom of the tube. The supernatant was removed and the pellet was washed with 1.0 ml 75% ethanol. The sample was mixed by vortexing and centrifuged at 7500 x g for 5 minutes at 4OC.
9. The ethanol supernatant was removed and the pellet was air-dried for 10 minutes at room ternperature. The RNA pellet was re-dissolved in 20-30 pl of RNAase free ddHzO and incubated in a 60°C water bath for 10 minutes.
APPENDIX IV Protocol for the Northern blot
Materials
DEPC treated ddHzO Diethyl pyrocarbonate (ICN Biomedicals Inc., Montreal. PQ) 0.1 %
RNA loading gel loading buffer: Formamide Fomialdehyde 37% 1 OX MOPS buffer Bromphenol blue Glycerol DEPC H20 Ethidium bromide (20 mglml)
add 4 parts loading buffer :l RNA
Northem Probe Stripping Solution Fornamide -redistilled ultra pure- (Life Technologies) 50% vlv Tris-HCI (ICN Biomedicals I nc.) 50mM SDS (Boehringer Mannheim) 1 % wlv PH 8
10X MOPS morpholinopropansulfonic acid (ICN Biomedicals Inc.) 200 rnM sodium acetate (Sigma Chernical Co.) 50 mM EDTA (ethylenediarnine tetraacetic acid, Fisher Scientific) 1 0 mM pH 7.0
Maleic acid buffer Maleic acid (Sigma Chemical Co.) NaCl (Fisher Scientific) pH 7.5 dissolved in DEPC ddHzO
Washing buffer TweenB 20 (Fisher Scientific) Maleic acid buffer
0.3% (wlv) 99.7%
Blocking Reagent stock solution Blocking reagent (Boehringer Mannheim) 10 9 Maleic acid buffer 100 ml Blocking buffer working solution is diluted 1 : I O in maleic acid buffer
Detection buffer
Tris-HCI (ICN Biomedicals Inc) NaCl pH 9.5
TE buffer Tris-HCI EDTA (Fisher Scientific) pH 8.0
20X SSC NaCl Sodium citrate (Fisher Scientific) pH 7.0
1 OOmM 1 OOmM
N-lauroy lsarcosine 10% (wlv) filtered through a 0.2 pm membrane
SDS 10% (wlv) filtered through a 0.2 pm membrane
Agarose ultra pure (Life Technologies)
Whatman 3MM paper ma tman International Ltd., Maidstone, United Kingdom)
Sarano wrap
Methods
Northem Blot procedure
Agarose was dissolved of in 72 ml water to rnake a 1.2% gel and cooled to 60°C in a water bath.
When flask was cooled to 60°C it was placed into a fume hood and 10 ml of 10X MOPS running buffer and 19 ml of 12.3 M formaldehyde (37% w/w) were added.
The formaldehydelagarose gel was poured into a plastic gel tank and allowed to set. After setting the comb was removed and the gel was submerged in 1X MOPS running buffer to cover the gel to a depth of 1 cm.
The samples were prepared by adding 8 pl of the gel loading buffer to 2 pg of total RNA or mRNA sample and denatured by incubating 10 minutes in a 65OC water bath.
After the incubation, the loading buffer mixture was loaded into each lane of the gel. An RNA molecular weight rnarker (Boehringer Mannheim) was loaded into the first lane of each gel.
The gel was electrophoresed at 5 V/cm until the bromophenol blue dye had migrated Mo-thirds the length of the gel.
The gel was exarnined on a UV transilluminator to visualize the RNA and photographed with a ruler laid alongside the gel. This facilitated later identification of band positions on the nylon membrane and subsequent X-ray film.
Transfer of RNA from Gel to Membrane; The target portion of the gel was placed in an RNAase free glass dish and rinsed wlh several changes of RNAase free ddHIO to cover the gel.
The gel was rinsed in 10 volumes of 20X SSC prior to the transfer to further remove formaldehyde.
10.A glass plate was mounted over a glass dish. Whatman 3MM paper was cut to be approximately 3x the width of the gel. The Whatman paper was submerged in 20X SSC and then spread across the glass plate with a sterile pipette. This formed the wick for the capillary transfer of the RNA.
1 1 .The gel was inverted and placed on top of the wetted wick.
12.The nylon membrane (Boehringer Mannheim) was pre-soaked in RNAase free water for 5 minutes then in 20X SSC for 5 minutes. A piece cut the same size as the gel was positioned over the gel. Air bubbles were removed by rolling a sterile pipette over the surface of the nylon membrane covering the denaturing gel.
13. Four strips of parafilm were cut and placed over the edges of the gel. completely covering the Whatman 3MM paper. This prevented any contact of the paper towels to the wet glass and wick.
14.Two pieces of Whatman 3MM paper were cut to the same size as the gel and pre-soaked in H20 for 5 minutes, then placed over the nylon membrane. Bubbles were removed by rolling the surface with a sterile pipette.
15. Cut paper towels the size of the gel were stacked on top of the Whatman 3MM paper to a height of 25 cm.
16.A fiat weighted surface was placed on top this transfer apparatus and left to transfer ovemight.
17.After the transfer, the apparatus was dismantled and the transferred RNA samples were crosslinked to the nylon membrane using a UV crosslinker set to optimum crosslink. 120 mJ (Stratagene Products).
18.The nylon membrane was then allowed to dry and was rapped in Saran@ wrap.
19. UV cross linked membranes were stored at -20 C if not immediately incubated with the prehybridization buffer.
Northern Hybridization and Cherniluminescent detection
Materials
High SDS buffer Sodium dodecyl Sulfate(SDS)(Boehringer Mannheim) 7% Formamide-ultrapure-(Life Technologies) 50% 5x SSC blocking buffer 2% Sodium-phosphate (Fisher Scientific) 50mM N-lauroylsarcosine 0.1%
Anti-DIG-AP anti 4igoxygenin FAA fragments conjugated to alkaline phosphates (Boehringer Mannheim) 1 : 4 O 000 dilution
diluted in blocking buRer
CSPD [4methoxy-4-(-phosphate-phenyl)-spira(l ,Z-dioxetane-,2'-adamantane) disodium salt]. 1 : 1 00 dilution
diluted in detection buffer.
IOX MOPS [3-(N-Morpholino) - propanesulfonic acid] buffer (MOPS)
0.2M Sodium acetate 0.05M EDTA 0.01 M diluted in sterile RNAase free water
20X ssc Sodium chloride (NaCI) 3 M Sodium citrate 0.3M pH 7.0 diluted in sterile RNAase free water
Maleic acid buffer Maleic acid (Fisher Scientific) NaCl (Fisher Scientific) pH 7.5
Washing solution 2X SSC SDS
Washing solution 0.5X SSC SDS
Washing buffer Ma leic acid buffer Tween 20 (Fisher Scientific)
Detection buffer Tris HCI (Fisher Scientific) NaCl (Fisher Scientific)
10X blocking reagent (Boehnnger Mannheim) Diluted to 1 X Blocking buffer in maleic acid Northern Probe
Stripping solution Formamide (Life Technologies) Tris HCI (Fisher Scientific) SDS (Boehringer Mannheim)
Bovine bFGF cDNA probe 10 nglml
Human bFGF cDNA probe 10 ngfml
Canine bFGF cDNA probe 2 pl PCR productlml
Mouse 7s ribosomal subunit probe (Courtesy Alan Balmain)
Nylon membrane - positively charged (Boehringer Mannheim)
Whatman 3MM paper (Whatman International Ltd.. Maidstone. United Kingdom)
Parafilm (Amencan National Can. Greenwich. CT, USA)
Saran@ Wrap
Hyperfilm ECL (Nycorned Amersham, Oakville, ON)
Methods
Northem Hybridization and cherniluminescent deteetion.
UV crosslinked nylon membranes were placed into an RNAase free hybridization bag. Twenty milliliten of prehybfldization buffer were added. The blot was prehybridized for 1 hr at 37'C.
The labeled probe was boiled in a foil-covered microfuge tube for 10 minutes. The microfuge tube was chilled quickly on ice and spun down briefly.
The probe was diluted into 10-15 ml of prehybridization buffer to a final concentration of 10 nglml for the random labeled cDNA (7s) probe for the hybridization. For the RT-PCR labeled probe (HUMAN or BOVINE), 2.0 pi of the product mixture was blended with each ml of hybridization buffer.
The prehybridization solution was poured out and discarded by cutting the bag on one corner. A sufficient volume of hybridization buffer was added to cover the membrane. The bag was sealed, making sure not to trap any large air bubbles.
The Northem blot was hybridized ovemight at 37OC.
After the hybridization was wmplete, the hybridization buffer was removed and stored for later probing experiments. A volume of 2x SSC/O.l % SDS was added to the bag. The bag was re-sealed and incubated with agitation at room temperature for 5 minutes.
The 2x SSCIO.l % SDS solution was discarded and the wash was repeated with fresh solution.
The 2x wash solution was removed and the 0.5~ wash was added. This wash was carried out for 10 minutes at 65OC with gentle agitation.
Repeat twice.
Cherniluminescent Defecfion of the membrane
1. The 0.5~ wash was drained and replaced with washing buffer. The filters were washed for I minute by manually rocking the bag.
2. The membrane moved into a clean hybridization bag and 20 ml of Blocking Buffer was used. The bag was sealed and incubated for 1 hour at room temperature with gentle agitation.
3. The antibody (Anti-DIG-AP) was spun down bnefly and then 2 pl of the antibody conjugate were added to 20 ml of Blocking Buffer. This represented a 1 110 000 dilution.
4. The Blocking buffer was poured out from the bag and replaced w lh the diluted antibody conjugate. Roorn temperature incubation was continued with gentle mixing for 30 minutes.
5. The antibody was separated. Washing buffer was added to the bag and swirled to achieve a quick wash.
6. The membrane was moved to a new bag and fresh Washing buffer was added. Gentle agitation for 15 minutes. Repeat. The switching of bags prevented cany over of antibody eiid reduced the potential for background.
7. The washing buffer was replaced with 15 ml of detection buffer. The membrane and buffer were equilibrated for 5 minutes.
8. The membrane was placed in a heat sealable plastic bag. The top s heet was lifted and 0.5 pl of luminescent substrate diluted in 495 pl of detection buffer was added to the membrane and spread over.
9. The membrane was incubated at 37OC for 15 minutes. then exposed to X-ray film (Nycomed Amersham) for visualization. Exposures times for membranes were measured in minutes.
Mouse 7s Probe Purification and Quantification
Materials
Gift courtesy Allan Balmain.
100 ng of mouse 7s purified insert. Cloned into pBluescript II US (+/-) phagemid
LBroth for 2 L volume Bacto-Yeast Extrad (Difco laboratories Detroit MI) 10 9 Bacto-Tryptone (Difco laboratories) 20 g NaCl (Fisher Scientific) 10 g am picillin (Invitrogen, Carlsbad. CA. USA) 50 pglrnl tetracycline (Invlrogen) 12.5 pglml ddH20 2000 ml
LB-Agar 1.5% (solid media) Bacto Agar 1 500 ml LBroth (Difco laboratories) 7.5 g X Gal (dissolved in 5 ml of dimethyl formamide) 200 mg Ampicillin (Invitrogen) 50 V g
SOC medium for 1 litre volume Bacto-Trypto ne Bacto-Yeast Extract NaCl (Fisher Scientific) KCI (Fisher Scientific) MgCI2 (Fisher Scientific) MgS04 (Fisher Scientific) Glucose (Sigma Cell Culture)
Autoclave pH can be adjusted to 7.0 with 5N NaOH
TRlzolw Reagent (Gibco BRL, Burlington, ON)
TBE buiTer
NuSieve GTG Agarose (FMC Bioproducts, Rockland, ME, USA) 1 .O% W/V in 50 ml of TBE buffer
PhenoVchloroform (Mandel Scientific)
Dialysis tubing (Phannacia Biotech)
100 mm petri dishes (Fisher Scientific)
Ethanol (Fisher Scientific)
Sodium acetate (Fisher Scientifc)
Method
Preparation of LBmth and LB-Agar plates
1. The reagents for the LBroth were rnixed together in a 2 L flask without the addition of the antibiotics. This solution was autoclaved for 25 minutes and then cooled to below 50°C. The ampicillin (200 pl) and tetracycline (200 pl) were added to the cooled broth. LBroth was left tightly capped at room temperature.
2. The solid media (LBroth agar) was first autoclaved to dissolve the bacto agar and when cooled to below 50°C, ampicillin was added.
3. Petri dishes 100 mm in diameter were filled to a depth of 10 mm with the solid media. The plates were allowed to solidify ovemight at room temperature. Un-used plates were stored tightly sealed with parafilm. refrigerated in their original bags.
Transformation of Competent E. coii
Competent XL1 Blue bacteria were transfected with the rnouse 7s insert by the following procedure.
Five pl of containing 20 ng of 7s purified insert were overlaid ont0 60 PI of XL1 Blue competent bacteria (quickly thawed).
The 20 ng of insert and bacteria were pipetted to mix and then incubated on ice for 30 minutes.
The resulting solution was incubated in a water bath at 37OC for 2 minutes.
The microfuge tube containing the bacteria was then moved to ice for 2 minutes.
A pre-warrned (37OC) aliquot of 800 pl SOC medium was added to the bacteria mixture and incubated at 3f°C for 30 minutes.
Glass Pasteur pipettes were fiamed and shaped. An aliquot of 100 pl of bacteria was streaked ont0 pre-warmed LB-Agar plates.
8. The streaked LB-Agar plates were place upside down in the oven and incubated ovemight at 37OC.
9. The next moming a single colony was selected using a sterile tooth pick. The toothpick was swished in 50 ml LB in a sterile Erlenmeyer flask. The flask was covered with tinfoil and incubated ovemight in a shaking water bath at 37OC.
isolation of plasmid DNA using TRlzoi Reagent
ARer an ovemight incubation of the bacteria in 50 ml of LBroth the volume was split into two Oakridge tubes and spun at 5000 x g in a JA-20 Rotor at 4OC for 15 minutes.
The supernatant was removed and the bacterial cells were lysed by adding 2 ml of TRlzol reagent. The lysate was sheared by passing it three times through a 5 ml syringe fitted with a 21 gauge needle.
The lysate was transferred into two microcentrifuge tubes. The samples were incubated for 5 minutes at room temperature.
To these samples was added 0.2 ml of chloroform per 1 ml of TRlzol reagent used in the initial lysis. The tubes were vigorously shaken for 15 seconds and incubated at room temperature for a further 2 minutes.
The samples were œntrifuged at maximum speed in a bench top microcentrifuge for 15 minutes at 4%. The aqueous phase was transferred to fresh microfuge tubes and DNAase-free RNAase was added to a final concentration of 25 pglml and incubated for 30 minutes at 37OC.
A 0.5 ml volume of Isopropanol was added to each of the samples. The samples were then incubated at room temperature for 10 minutes and centrifuged at maximum speed for 10 minutes at 4OC.
The DNA pellet was washed once with 75% ethanol and centrifuged at maximum speed in a bench top microcentrifuge for 5 minutes.
The pellet was air dried for 10 minutes at room temperature and then re- dissolved in RNAase-free dd H20.
The plasmid DNA was then visualized on a 1 .O% agarose gel prior to restriction enzyme analysis.
Restriction enzyme analysis and gel purification of the cDNA inserts
1. Purified mouse 7s insert was pipetted into a 1.5 ml microfuge tube.
A reaction mixture was generated by adding a 10X 'One4Al11 restriction enzyme buffer, 4 pl BamHl (12 UIpI) restriction enzyme, and 36 pl of ddHzO.
This reaction mixture was incubated at 37OC for one hour, with no agitation.
After the incubation was complete, the entire volume of the reaction mixture was electrophoresed on a native 2.0% agarose gel. The gel bands corresponding to 192 bp was excised and put into dialysis tubing (Phamacia BioTech). containing 1 .O ml of TB€ running buffer.
The dialysis tubing was submerged in an electrophoresis tank near the negative teminals and a current of 75V was applied for 1 hr. The leads were revened and a current of 100 V was applied for 60 seconds.
The TB€ buffer was pipetted off while vigorously rinsing the sides of the tubing to suspend the cDNA. The TBE buffer was moved to 1.5 ml microfuge tubes.
The DNA was extracted by adding an equal volume of phenol~chlorofom. The mixture was vortexed briefiy to emulsify the phases and stored on ice for 2 mins.
The tubes were centrifuged for 5 minutes at 12 000 x g.
The top aqueous phase was transferred to a sterile 1.5 ml microfuge tube and an equal volume of chloroform was added. This mixture was briefly vortexed.
10. The phases were separated by centrifugation at 12 000 x g for 5 minutes.
11 .The top phase was transferred to a sterile 1.5 ml microfuge tube. To this tube were added 0.1 volumes of 3 M NaOAc and 2.0 volumes of 100% ethanol and the tube was incubated at -20°C for at least one hour.
12. The tubes were then spun at 12 000 x g for 5 minutes to precipitate the DNA.
13.The DNA pellet was resuspended in 20- 30 pl of ddH20.
Random primer extension labeling of cDNA probes
Boehringer Mannheim DIG DNA Labeling and Detection Kit
1. The template DNA (0.5 pg - 3 pg) was diluted to a total volume of 15 pl and denatured by heating for 10 minutes in a boiling water bath and quickly chilling on ice.
2. While on ice, 2 pl of hexanucleotide mix, 2 pl of dNTP mixture, and 1 pl of Klenow enzyme are added to the DNA.
3. The reaction components are mixed gently and b~ef iy centrifuged. The tubes are then incubated for one hour at 37OC.
4. To stop the reaction 2 pl of 0.2 M EDTA, pH 8.0 is added.
cDNA Probe quantitation.
An aliquot of the labeling reaction was diluted to a concentration of roughly 1 pglml.
The DIG-labeled control DNA was diluted 1 5 to a concentration of 1 pglmi.
A dilution series was prepared in dilution buffer of both the labeled probe and the DIG-labeled control DNA.
A series of the dilutions ranging from 0.1 pg to 1 ng (1 -0 pl aliquot) were spotted ont0 a positively charged nylon membrane (Boehringer Mannheim).
The spots of DNA were crosslinked ont0 the membrane using a UV transilluminator for a duration of 7 minutes.
The fixed membrane was placed in a 100 mm petri dish and wetted in 20 ml of maleic acid buffer.
The maleic acid buffer was poured off and replaced with 20 ml of blocking buffer. It was gently agitated for 10 minutes on a rocking plate.
After 10 minutes the blocking buffer was poured off. Twenty millilitres of blocking buffer containing a 1 :7500 dilution of Anti-DIG-AP conjugate was added and incubated for 10 minutes.
The membrane was then washed in 20 ml of washing buffer and incubated at room temperature for 10 minutes. The wash was repeated. The washing buffer was poured off and the membrane was equilibrated in detection buffer.
10.200 pl of the NBT and X-phosphate (BCIP) was added to 20 ml of fresh detection buffer to make a colour development solution that was added to the nylon membrane. The membrane was developed in the dark for 1-3 hours.
11 .The spot intensities were compared between the probe dilutions and the labeled control DNA dilutions.
Canine cDNA probe Cloning, Purification and Labeling
Materials
TOPO TA cloning kit (Invitrogen, Carlsbad. California. USA)
LBroth for 2 L volume Bacto-Yeast Extract (Difco laboratones Detroit MI) Bacto-Tryptone (Difco laboratories) NaCl (Fisher Scientific) ampicillin (1 nvitrogen) tetracycline (Sigma Chernical Co.) ddHzO
LB-Agar 1.5% (solid media) Bacto Agar 1 500 ml LBroth (Difco) X Gal (dissolved in 5 ml of dimethyl formamide) Ampicillin (Invitrogen) Isopropylthio-P-D-galactoside (IPTG)
SOC medium for 1 litre volume Bacto-Tryptone Bacto-Yeast Extract NaCl (Fisher Scientific) KCI (Fisher Scientific) MgCI2 (Fisher Scientific) MgS04 (Fisher Scientific) Glucose (Sigma Cell Culture)
Autoclave pH c m be adjusted to 7.0 with 5N NaOH
TRlzolTU Reagent (Gibco BRL, Burlington, ON)
TBE bmer
NuSieve GTG Agarose (FMC Bioproducts, Rockland. ME, USA) 1.0% W/V in 50 ml of TB€ buffer
100 mm petri dishes (Fisher Scientific)
Method
Preparation of LBmth and LB-Agar plates
4. The reagents for the LBroth were mixed together in a 2 L flask without the addition of the antibiotics. This solution was autociaved for 25 minutes and then cooled to below 50°C. The ampicillin (200 pl) and tetracycline (200 pl) were added to the cooled broth. LBroth was left tightly capped at room temperature.
5. The solid media (LBroth agar) was first autoclaved to dissolve the bacto agar and when cooled to below 50°C, ampicillin (Invitrogen) was added.
6. Petri dishes 100 mm in diameter were filled to a depth of 10 mm with the solid media. The plates were allowed to solidify ovemight at room temperature. Un-used plates were stored tightly sealed with parafilm, refngerated in their original bags.
Transformation and selection of competent cells (TOPO TA cloning kit)
1 . The manufacturers instructions were followed for the cloning and One shot transformation.
2. Analysis of positive clones was facilitated by overnight culturing 4 white clones and one blue clone frorn a control agar dish.
Isolation of plasmid DNA using TRholTM Reagent
After an overnight incubation of the bacteria in 50 ml of LBroth the volume was split into two Oakridge tubes and spun at 5000 x g in a JA-20 Rotor at 4OC for 15 minutes.
The supernatant was rernoved and the bacterial cells were lysed by adding 2 ml of TRlzol reagent. The lysate was sheared by passing it three times through a 5 ml syringe fÏtted with a 21 gauge needle.
The lysate was transferred into two microcentrifuge tubes. The samples were incubated for 5 minutes at room temperature.
To these samples was added 0.2 ml of chloroform per 1 ml of TRlzol reagent used in the initial lysis. The tubes were vigorously shaken for 15 seconds and incubated at room temperature for a further 2 minutes.
The samples were centrifuged at maximum speed in a bench top microcentrifuge for 15 minutes at 4OC. The aqueous phase was transferred to
fresh microfuge tubes and DNAase-free RNAase was added to a final concentration of 25 pg/ml and incubated for 30 minutes at 37OC.
6. A 0.5 ml volume of lsopropanol was added to each of the samples. The samples were then incubated at room temperature for 10 minutes and centrifuged at maximum speed for 10 minutes at 4OC.
7. The DNA pellet was washed once with 75% ethanol and centrifuged at maximum speed in a bench top microcentrifuge for 5 minutes.
8. The pellet was air dried for 10 minutes at room temperature and then re- dissolved in RNAase-free ddH20.
9. The plasmid DNA was then visualized on a 1.0% agarose gel prior to restriction enzyme analysis.
Rest&tion enzyme analysis and gel purification of the cDNA inserts
A volume containing 20 pg of Purified TOPO plasmid with the canine bFGF insert was pipetted into a 1.5 ml microfuge tube.
A reaction mixture was generated by adding a 10 x buffer H restriction enzyme buffer, 2 pl EcoRl (10 UIpI) restriction enzyme. and 36 pl of ddHzO.
This reaction mixture waç incubated at 37OC for one hour, with no agitation.
After the incubation was complete. the entire volume of the reaction mixture was electrophoresed on a native 2.0% agarose gel. The gel bands corresponding to 407 bp was excised and put into dialysis tubing (Phannacia BioTech), containing 1 .O ml of TBE running buffer.
The dialysis tubing was submerged in an electrophoresis tank near the negative terminals and a current of 75V was applied for 1 hr. The leads were reversed and a current of 100 V was applied for 60 seconds.
The TBE buffer was pipetted off while vigorously rinsing the sides of the tubing to suspend the cDNA. The TBE buffer was moved to 1.5 ml microfuge tubes.
The DNA was extracted by adding an equal volume of phenol/chloroform. The mixture was vortexed briefly to emulsify the phases and stored on ice for 2 mins.
The tubes were centrifuged for 5 minutes at 12 000 x g.
9. The top aqueous phase was transfened to a sterile 1.5 ml microfuge tube and an equal volume of chlorofon was added. This mixture was briefly vortexed.
10.The phases were separated by centrifugation at 12 000 x g for 5 minutes.
11 .The top phase was transfened to a sterile 1.5 ml microfuge tube. To this tube were added 0.1 volumes of 3 M NaOAc and 2.0 volumes of 00% ethanol and the tube was incubated at -20°C for at least one hour.
12.The tubes were then spun at 12 000 x g for 5 minutes to perciptate the DNA.
13.The DNA pellet was resuspended in 20- 30 pl of ddH20.
DIG Labeling of canine bFGF probe by PCR
A reaction mixture was made containing the following: 2.5 pl of IOX PCR buffer, 1 pl 0.2 M DIG-11-dUTPs. 2 pl of 914 forward primer, 2 pl of 903 reverse primer, 2.5 pl 15 mM MgCh, 2 pl of purified insert cDNA. 12 pl of ddHzO and 1 pl of Taq polymerase. All of the samples were overlaid with 30 pl of mineral oil
The tubes were placed in a thermal cycler (Perkin Elmer Cetus. Norwalk CT USA) that was prewanned to 72OC.
A 30 cycle program of 94OC for 1 minute, 55OC for 30 seconds. 74OC for 30 seconds, followed by a final 74OC extension for 5 minutes constituted the polymerase chain reaction.
The samples were removed from the thermal cycler and 4 pl of the RT-PCR products were visualized on a 1.5% agarose gel. stained with ethidium brornide.
Two microliters of each PCR product was added per millilitre of the High SDS hybridization buffer (Boehringer Mannheim).
Protocol for Southern Blot
Materials
Standard hybridization buffer Sodium chloridelsodium citrate (SSC) N-lauroylsarcosine Sodium dodecyl sulphate (SDS) Blocking reagent
Nylon membrane positive charged (Boehringer Mannheim)
Anti-DIGAP anti 4igoxigenin Fab fragments conjugaied to alkaline phosphatase (Boehringer Mannheim) 1 : 10 000 dilution
diluted in blocking buffer
CSPD [4-rnethoxy4-(-phosphate-phenyl)-spiro(1,2-dioxetane-,2'-adarnantane) disodiurn salt]. 10 mglml 1 : 100 dilution
diluted in detection buffer.
20X SSC Sodium chloride (NaCI) Sodium citrate pH 7.0 diluted in sterile double distilled water
Dnaturation solution 1 NaOH (Fisher Scientific) NaCl (Fisher Scientific)
Neutralization solution 1 Tris-HCI (ICN Biomedicals NaCl pH 7.5
Maleic acid buffer Maleic acid NaCl pH 7.5
Washing buffer Maleic acid Tween 20 (Fisher Scientific)
Detection buffer Tris HCI A00 mM NaCl 100 mM
10X blocking reagent (Boehringer Mannheim) Diluted to 1X Blocking buffer in maleic acid Northem Probe
Nusieve agarose (Mandel Scientific Company Ltd.. Guelph, ON)
Whatman 3MM paper (Whatman International Ltd., Maidstone, United Kingdom)
Parafilm (American National Can Greenwich CT USA)
Saran Wrap@
Method
Southem BIot Pmcedure
Agarose (Mandel Scientific) was dissolved in 50 ml of TBE to make a 1.2% gel and cooled to 50°C in a water bath. 2 pl of ethidium bromide (20 rng/ml) was added and stirred in.
The gel was poured into a plastic gel mould. When solidified the gel mould was placed into a mini-Sub (Bio-Rad Laboratones Ltd. Mississauga ON). The plastic comb was rernoved. DNA samples were mixed with 8 pl of loading buffer and loaded into each lane.
A potential difference of 120 V was placed across the gel foi 5 minutes then tumed down to 5 V/cm until the blue dye front had migrated threequarters of the length of the gel.
The gel was examined on a UV transilluminator to visualize the DNA and photographed with a ruler laid alongside the gel. This facilitated later identification of band positions on the nylon membrane and subsequent X-ray film.
Transfer of DNA from agarose gel to nylon membrane (Boehringer Mannheim); The gel was submerged in 250 mM HCI, with gentle shaking for 10 minutes. The gel was rinsed in distilled water (ddH20).
The gel was submerged in denaturation solution for 2 X 15 minutes at room temperature, with shaking. followed by a ddHzO rinse. The agarose was placed in neutralization solution for 2 X 15 minutes.
7. The gel was rinsed in 10 volumes of 20X SSC prior to the transfer to remove formaldehyde.
8. A glass plate was mounted over a glass dish. Whatman 3MM paper was cut to be approximately 3X the width of the gel. The Whatman paper was submerged in 20X SSC and then spread across the glass plate with a sterile pipette. This fomed the wick for the capillary transfer of the DNA.
9. The gel was inverted and place on top of the wetted wick.
10.The nylon membrane (Boehnnger Mannheim) was pre-soaked in ddHzO for 5 minutes then in 20X SSC for 5 minutes. A pieœ cut the same size as the gel was positioned over the gel. Corners were marked. Air bubbles were removed by rolling a sterile pipette over the surface of the nylon membrane covering the gel.
11. Four strips of parafilm ere cut and place over the edges of the gel. completely covering the Whatman 3MM paper. This prevented any contact of the paper towels to the wet glass and wick.
12.Two pieces of Whatman 3MM paper were cut to the same size as the gel and pre-soaked in H20 for 5 minutes, then placed over the nylon membrane. Bubbles were removed by rolling the surface with a sterile pipette.
13. Cut paper towels the size of the gel were stacked on top of the Whatman 3MM paper to a height of 25 cm.
14.A Rat weig hted surface was placed on top this transfer apparatus and left to transfer overnight.
15.After the transfer, the apparatus was dismantled and the transferred RNA samples were crosslinked to the nylon membrane using a UV crosslinker set to optimum crosslink. 120 mJ (Stratagene Products).
16.The nylon membrane was then allowed to dry and was rapped in SaranG9 wrap.
17. UV cross linked membranes were stored at -20 C if not irnmediately incubated with the prehybridization buffer.
Southem Hybridizaüon and Cherniluminescent detection protocol
Materials
Standard hybridization buffer Sodium ch loride/sodium citrate (SSC) 5% Sodium dodecyl Sulfate(SDS)(Boehringer Mannheim) 0.02% N-lauroylsarcosine 0.1 % Blocking reagent 1%
Anti-DIG-AP anti 4igoxigenin Fab fragments conjugated to alkaline phosphatase (Boehringer Mannheim) 1 : 1 O 000 dilution
diluted in blocking buffer
CSPD [4-methoxy-4-(-phosphate-phenyl)-spiro(l,2-dioxetane-.2'-adarnantane) disodium salt]. diluted in detection buffer. 1 : 100 dilution
20X SSC Sodium chloride (NaCI) Sodium citrate pH 7.0 diluted in sterile free water
Maleic acid buffer Maleic acid (Fisher Scientific) NaCl (Fisher Scientific) pH 7.5
Washing solution 2X SSC SDS
Washing solution 0.5X SSC SDS
Washing buffer Maleic acid buffer Tween 20 (Fisher Scientific)
Detection buffer Tris HCI (Fisher Scientific) NaCl (Fisher Scientific)
10X blocking reagent (Boehringer Mannheim) Diluted to 1X Blocking buffer in maleic acid
Canine bFGF cDNA probe 2 pl PCR productlml
Nylon membrane - positively charged (Boehringer Mannheim)
Whatman 3MM paper m a t m a n International Ltd.. Maidstone, United Kingdom)
Parafilm (American National Can, Greenwich, CT. USA)
Sarand Wrap
Hyperfilm ECL (Nycomed Amersham. Oakville, ON)
Southem Hybridizafion and chemilominescent detection.
10. W crosslinked nylon membranes were placed into a hybridization bag. Twenty milliliters of prehybridization buffer were added. The blot was prehybridized for 1 hr at 65OC.
1 1. The labeled probe was boiled in a foil-covered rnicrofuge tube for 10 minutes. The microfuge tube was chilled quickly on ice and spun down briefly.
1 2. The probe was diluted into 1 0-1 5 ml of prehybridization buffer to a final concentration of 2.0 p1 of the RT-PCR product mixture was blended with each ml of hybridization buffer.
13.The prehybridization solution was poured out and discarded by cutting the bag on one corner. A sufficient volume of hybridization buffer was added to cover the membrane. The bag was sealed. making sure not to trap any large air bubbles.
14.The Southern blot was hybridized ovemight at 65%.
i5.After the hybridization was complete, the hybridization buffer was removed and stored for later probing experiments. A volume of 2x SSCIO.1 % SDS was added to the bag. The bag was re-sealed and incubated with agitation at room temperature for 5 minutes.
16.The 2x SSC/0.1 % SOS solution was discarded and the wash was repeated with fresh solution.
17.The 2x wash solution was removed and the 0.5~ wash was added. This wash was camed out for 10 minutes at 65OC with gentle agitation.
18. Repeat twice.
Cherniluminescent Detecfion of the membrane
10.The 0 . 5 ~ wash was drained and replaced with washing buffer. The filters were washed for 1 minute by manually rocking the bag.
11 .The membrane moved into a clean hybridization bag and 20 ml of Blocking Buffer was used. The bag was sealed and incubated for 1 hour at room temperature with gentle agitation.
12. The antibody (Anti-DIG-AP) was spun down briefiy and then 2 pl of the antibody conjugate were added to 20 ml of Blocking Buffer. This represented a 1 : 10 000 dilution.
13.The Blocking buffer was poured out from the bag and replaced with the diluted antibody conjugate. Room temperature incubation was continued with gentle rnixing for 30 minutes.
14.The antibody was separated. Washing buffer was added to the bag and swirled to achieve a quick wash.
15.The membrane was moved to a new bag and fresh Washing buffer was added. Gentle agitation for 15 minutes. Repeat. The switching of bags prevented cany over of antibody and reduced the potential for background.
16.The washing buffer was replaced with 15 ml of detection buffer. The membrane and buffer were equilibrated for 5 minutes.
17.The membrane was placed in a heat sealable plastic bag. The top sheet was lifted and 0.5 pl of luminescent substrate diluted in 495 pl of detection buffer was added to the membrane and spread over.
18.The membrane was incubated at 37OC for 15 minutes, then exposed to X-ray film (Amersham Pharmacia Biotech) for visualkation. Exposures tirnes for membranes were measured in minutes.
APPENDIX X
bFGF antibody staining of paraffin embedded and tissue culture material
Materials
Basic FGF (Ab-2) Cat#PC-16 (Oncogene Research Products Cambridge MA)
distilled H20
Dewaxing solutions Xylene Ethanoi
30% Hydrogen peroxide (Fisher) diluted in methanol (vlv)
Methanol (Fisher)
Phosphate buffered saline (PBS) l x Sambrook et al.
Trypsin-EDTA 1 0x stock (Gibco Life Technologies)
Diluted 1 :5 in PBS
Triton X-100 (Fisher Scientific)
Goat Serum (Cedarlane Homby ON)
Rabbit Extravidin Staining Kit (Sigma Chemical Co.)
AEC Staining Kit (Sigma Chemical Co.)
Mayers Hematoxylin (Sigma Chemical Co.)
Superfrost Slides (Fisher Scientific)
Glycergel (DAKO. Montreal)
150 mm petri dish (Fisher Scientific)
Cover slips (Fisher Scientific)
0.13 M NaCl 0.0027 M KCI 0.010 M Na2HP04 0.002KH2P04 pH 7.2
0.5% trypsin 5.3 mM EDTA pH 7.2
Method
The paraffin embedded formalin fixed sections were dewaxed by a standard method for xylene and dilutions of ethanol. Slides were washed twice in each bath of xylene. 100% ethanol, 70% ethanol for a duration of 2 minutes.
After the final wash in 70% ethanol the slides were briefly rinsed in distilled water for 2 minutes.
Endogenous peroxidase activity was quenched by treating the slides with rnethanol containing 3% hydrogen peroxide. The slides were incu bated 5-7 minutes at room temperature. Slides were then briefly rinsed in distilled water.
To help unmask the antigen, the slides were incubated 12 minutes at 37OC in PBS containing 0.1 % trypsin EDTA. After a brief rinse in distilled water slides were then covered with 0.1 pglml soybean trypsin inhibitor (Sigma Chernical Co.) for 5 minutes at room temperature. A brief rinse in PBS followed.
Sections were then Rooded with 0.1 % Triton X-100 (Sigma Chernical Co.) in goat senim (Cedarlane Hornby ON) and incubated for 30 minutes at room temperature. followed by a brief rinse in PBS.
The primary anti-bFGF antibody at a concentration of 8 pg/ml is applied to the slides in a solution containing 0.1 % Triton X-100, 1 % goat serum in PBS. The slides are incubated 1.5 hrs at room temperature in a humidified chamber. Negative control slides were incubated with 5% goat serum and 0.1 % Triton X-100.
The primary incubation is followed by 2 x 5 minute washes in PBS.
The secondary antibody is diluted 1 :20 in 1% goat serum PBS, applied to the slides then incubated for 30 minutes at room temperature in a hurnidified cham ber.
The secondary incubation is followed by 2 x 5 minute wash in PBS.
10. The Extra Avidin - Peroxidase diluted 1 :20 in 1 % goat serum is applied to the slides then incubated for 30 minutes at room temperature in a humidified chamber.
11 .The peroxidase incubation is followed by 2 x 5 minute wash in PBS.
12. The AEC chromagen is added to slides and incubated for 15 minutes at room temperature while monitoring the colour development with a microscope.
13.The colour reaction is teminated in a distilled H20 bath.
14.The slides are then immersed in Mayer's hematoxylin for 1 minute to develop the counter-stain.
15.The slides are washed under ~ n n i n g tap water for 5 minutes.
16. The slides are dried around the edges and mounted in Glycergel and cover slipped.
APPENDIX XI
von Willebrand staining of paraffin embedded and cell culture material
Materials
Rabbit Anti-Human Von Willebrand Factor (DAKO Denmark)
Dewaxing solutions Xylene Ethanol
30% hydrogen peroxide (Fisher Scientific) difuted in methanol (viv)
acetone (Fisher Scientific)
distilled H20
Phosphate buffered saline (PBS) l x Sambrook et al.
Trypsin-EDTA 1 0x stock (Gibco Life Technologies)
Diluted 1:5 in PBS
Triton X-100 (Fisher Scientific)
Goat Senirn (Cedarlane)
Rabbit Extravidin Staining Kit (Sigma Chemical Co.)
AEC Staining Kit (Sigma Chemical Co.)
Mayers Hematoxylin (Sigma Chemical Co.)
Superfrost Slides and coverslips (Fisher Scientific)
Labtek tissue culture slides (Nunc)
Glycergel (DAKO, Montreal)
150 mm petri dish (Fisher Scientific)
0.13 M NaCl 0.0027 M KCI 0.010 M Na2HP04 0.002KH2P04 pH 7.2
0.5% trypsin 5.3 mM EDTA pH 7.2
Method
The paraffin ernbedded formalin fked sections were dewaxed by a standard method for xylene and dilutions of ethanol. Slides were washed twice in each bath of xylene, 100% ethanol. 70% ethanol for a duration of 2 minutes.
ARer the final wash in 70% ethanol the slides were briefly rinsed in distilled water for 2 minutes.
Cell culture material was fixed in -20°C rnethanol 5 minutes followed by 2 minutes in -20°C acetone. The Labtek slides were air-dried. Endogenous peroxidase activity was quenched with 3% hydrogen peroxide in PBS.
Endogenous peroxidase activity waç quenched by treating the slides with methanol containing 3% hydrogen peroxide. The slides were incubated 5-7 minutes at room temperature. Slides were then briefly rinsed in distilled water.
To help unmask the antigen, the slides were incubated 12 minutes at 37OC in PBS containing 0.1 % trypsin EDTA. After a brief rinse in distilled water slides were then covered with 0.1 pg/ml soybean trypsin inhibitor (Sigma Chernical Co.) for 5 minutes at room temperature. A brief rinse in PBS followed.
Sections were then flooded with 5% goat serum (Cedarlane Hornby ON), incubated for 30 minutes at room temperature, followed by a brief rinse in PBS.
The primary anti-Von Willebrand antibody diluted 1 :IO0 in PBS is applied to the slides in a solution containing 1% goat serum in PBS. The slides are incubated 1 hour at room temperature in a humidified chamber. Negative control slides were incubated with 5% goat serum.
The prirnary incubation is followed by 2 x 5 minute washes in PBS.
The secondary antibody is diluted 1 :20 in 1 % goat serum PBS, applied to the slides then incubated for 30 minutes at room temperature in a humidified chamber.
10.The secondary incubation is followed by 2 x 5 minute wash in PBS.
1 -l .The Extra Avidin - Peroxidase diluted 1 :20 in 1 % goat senirn is applied to the slides then incubated for 30 minutes at room temperature in a humidified chamber.
12.The peroxidase incubation is followed by 2 x 5 minute wash in PBS.
13.The AEC chromagen is added to slides and incubated for 15 minutes at room temperature while monitoring the colour development wlh a microscope.
14.The colour reaction is terminated in a distilled H20 bath.
15. The slides are then immened in Mayers' hematoxylin for 1 minute to develop the counter-stain.
16.The slides are washed under running tap water for 5 minutes.
17.The slides are dried around the edges and rnounted in Glycergel and cover slipped.
IMAGE EVALUATION TEST TARGET
APPLIED IMAGE. lnc - = 1653 East Main Street - ,--: Rochester. NY 14609 USA I --- Phone: i l 6/48MKUMl =-= Fa: 71 6/288-5989