Cell Communications decisive for the Type of Immune Responses

to Dietary Antigens

Doctoral thesis at the Medical University of Vienna

for obtaining the academic degree

Doctor of Philosophy

Submitted by

Durga Krishnamurthy, M.Sc

Supervisor:

Prof. Erika Jensen-Jarolim, MD

Comparative Medicine, Messerli Research Institute, c/o Department of Pathophysiology and Allergy Research

Center of Pathophysiology, Infectiology & Immunology

Medical University of Vienna

Vienna, date of submission (format: 03/2013)

2

TABLE OF CONTENTS

1 PREFACE ........................................................................................................... 4

1.1 ACKNOWLEDGEMENTS....................................................................................... 4

1.2 DISCLAIMER...................................................................................................... 5

1.3 SUMMARY......................................................................................................... 6

1.4 ZUSAMMENFASSUNG ......................................................................................... 8

1.5 ABBREVIATIONS/SYMBOLS .............................................................................. 10 2 CHAPTER 1. THESIS INTRODUCTION ........................................................... 13

2.1 MILESTONES OF ALLERGY AND ANAPHYLAXIS .................................................... 13

2.2 DEFINITION OF HYPERSENSITIVITY AND ALLERGY ............................................... 14

2.3 EPIDEMIOLOGY AND RISK FACTORS OF ALLERGY & ANAPHYLAXIS ................... 15

2.4 FOOD ALLERGY MODELS .................................................................................. 20

2.5 MECHANISMS OF ALLERGIC INFLAMMATION ....................................................... 23

2.6 CURRENT MANAGEMENT OF FOOD ALLERGY & FUTURE THERAPIES OF FOOD ALLERGY

…………………………………………………………………………………… 26

2.7 REFERENCES .................................................................................................. 28 3 SCOPE AND OUTLINE OF THE THESIS ........................................................ 36

4 ANTI-ACID MEDICATIONS INTERACT WITH ENDOTOXIN TO INDUCE FOOD ALLERGY TO MILK ALLERGEN CASEIN IN BALB/C MICE............................... 37

4.1 ABSTRACT....................................................................................................... 38

4.2 INTRODUCTION ................................................................................................. 39

4.3 RESULTS ......................................................................................................... 40

4.4 DISCUSSION..................................................................................................... 46

4.5 MATERIALS AND METHODS ............................................................................... 49

4.6 ACKNOWLEDGEMENTS...................................................................................... 53

4.7 AUTHOR CONTRIBUTIONS .................................................................................. 53

4.8 REFERENCES ................................................................................................... 54

4.9 SUPPLEMENTARY INFORMATION ........................................................................ 56

5 MONITORING NEUTROPHILS AND PLATELETS DURING CASEIN- INDUCED ANAPHYLAXIS IN AN EXPERIMENTAL BALB/C MOUSE MODEL………………………………………………………………………………… 59

3

5.1 ABSTRACT……………………………………………………………………….. 59

5.2 INTRODUCTION…………………………………………………………………… 59

5.3 MATERIALS AND METHODS………………………………………………………. 60

5.4 RESULTS…………………………………………………………………………. 61

5.5 DISCUSSION……………………………………………………………………… 63

5.6 ACKNOWLEDGEMENTS…………………………………………………………... 65

5.7 REFERENCES…………………………………………………………………….. 66

5.8 AUTHOR CONTRIBUTIONS………………………………………………………... 68

5.9 SUPPLEMENTARY INFORMATION…………………………………………………. 69 6 AN UNFOLDED VARIANT OF THE MAJOR PEANUT ALLERGEN ARA H 2

WITH DECREASED ANAPHYLACTIC POTENTIAL………………………………. 73

6.1 ABSTRACT………………………………………………………………………... 73

6.2 INTRODUCTION…………………………………………………………………… 73

6.3 MATERIALS AND METHODS............................................................................. 74

6.4 RESULTS…………………………………………………………………………. 77

6.5 DISCUSSION……………………………………………………………………… 80

6.6 ACKNOWLEDGEMENTS…………………………………………………………... 82

6.7 REFERENCES…………………………………………………………………….. 82

6.8 AUTHOR CONTRIBUTIONS………………………………………………………... 85

6.9 SUPPLEMENTARY INFORMATION…………………………………………………. 86 7 DISCUSSION…………………………………………………………………....... 96

8 CURRICULUM VITAE………………………………………………………....... 110

9 LIST OF PUBLICATIONS……………………………………………………..... 112

4

1 PREFACE 1.1 Acknowledgements

First and foremost I would like to thank my project supervisor Prof. Erika Jensen-

Jarolim for providing a homely environment in her lab. I thank her for the supervision,

training, reviewing support during the thesis period. I want to convey her “Meinen

Herzlichen Dank”.

I am blessed to have lovable parents, Shanti Perima, sisters Sangi & Dolly, brothers

Atal Badri, Shiva and Satish for their great support and motivation.

I am thankful to Eva Untersmayr, Isabella Pali-Schoell and Susanne Diesner for

introducing me to the animal work in the very early stage of my thesis period.

I also want to thank my friend Senthil for cheering up and energizing me during the

thesis period.

I would like to say “Vielen Dank” to my friends Gaja, Philipp, Krisztina Szalai, Anna

Lukschal for their cheerful support.

Nevertheless, I thank Julia Wallman, Thomas Nittke, Panos Karagiannis, Josef

Singer, Caroline Stremnitzer, Anna Willensdorfer, Erika Bajna, Theresia

Thalhammer, friends and colleagues at the Division-1, at Dept of Pathophysiology

and Allergy Research for their wonderful support and showing me the Aroma of

Viennese culture.

I would also like to thank Albert Duschl from University of Salzburg for being in my

thesis committee and for providing the fruitful suggestions.

Finally, I thank our collaborators Donstscho Kerjaschki from Medical University of

Vienna, Fred D. Finkelman, Marat V. Khodoun from University of Cincinnati, USA.

Last, but not the least I thank all the members of the CCHD program for their

companionship.

5

1.2 Disclaimer General Acknowledgements

Origin of Data: Durga Krishnamurthy was supported by the Austrian Science Fund

FWF project, CCHD #APW01205FW. Data and the method section presented in this thesis comprise from the major parts

of the work published in the following papers: ANTI-ACID MEDICATIONS INTERACT WITH ENDOTOXIN TO INDUCE FOOD ALLERGY TO MILK ALLERGEN CASEIN IN BALB/C MICE

Durga Krishnamurthy, Anna Lukschal, Philipp Starkl, Caroline Stremnitzer, Anna

Willensdorfer, Susanne C Diesner, Martina Mittlboeck, Isabella Pali-Schöll, Eva

Untersmayr and Erika Jensen-Jarolim.

Manuscript in Revision MONITORING NEUTROPHILS AND PLATELETS DURING CASEIN-INDUCED ANAPHYLAXIS IN AN EXPERIMENTAL BALB/C MOUSE MODEL. Durga Krishnamurthy, Philipp Starkl, Krisztina Szalai, Franzciska Roth-Walter,

Susanne C. Diesner, Martina Mittlboeck, Christine Mannhalter, Eva Untersmayr and

Erika Jensen-Jarolim

Published in Clinical and Experimental Allergy. 2012 Jul;42(7):1119-28. AN UNFOLDED VARIANT OF THE MAJOR PEANUT ALLERGEN ARA H 2 WITH DECREASED ANAPHYLACTIC POTENTIAL

Philipp Starkl, Ferdinand Felix, Durga Krishnamurthy, Sara Prickett, Astrid

Voskamp, Caroline Stremnitzer, Marlene Weichselbaumer, Franziska Roth-Walter,

Robin O’Hehir, Erika Jensen-Jarolim

Published in Clinical and Experimental Allergy. 2012 Dec;42(12):1801-12.

6

1.3 Summary Food allergy and anaphylaxis is one of the leading cause of anaphylactic episodes

treated at the emergency clinics. As outlined in chapter 1, it affects 3-4 % adult

population and 5% of the young children in westernized countries. From the last

decade numerous studies have contributed to delineate the mechanisms leading to

pathogenesis of allergic diseases. In chapter 2 of this PhD thesis, we studied how the

different anti-acid medications, sucralfate and proton pump inhibitor together

endotoxin influences the sensitization in BALB/c mice. We took milk protein, casein

as our model allergen. Mice were fed casein with and without endotoxin together with

either sucralfate or proton pump inhibitor and subjected to oral provocation tests and

type I skin hypersensitivity. From these studies, we showed anti-acid/anti-ulcer

medication interact with endotoxin to induce sensitization, by showing casein-specific

IgG1, IgE antibodies. Furthermore, in oral provocation tests, anti-acid/anti-ulcer

prompted the highest allergic response, by inducing either diarrheal or drop of body

temperature or type I skin hypersensitivity.

Mast cells and basophils have been repeatedly studied for their role in allergen-

induced anaphylaxis. In chapter 3, however, we have investigated the yet less

unaddressed cell types, neutrophils and platelets in an experimental mouse model of

antigen-induced anaphylaxis. Mice were intraperitoneally sensitized and showed

anaphylactic symptoms upon allergen challenge. Further, total blood counts revealed

that upon specific allergen challenge, neutrophils, platelets and red blood cells (RBC)

count dropped in total blood. Adding to this, we showed reduction of fibrinogen levels

in a similar set up of anaphylaxis, showing that platelet activation correlate with the

platelet reduction. We next investigated different organs, spleen, lung, liver, heart and

kidney by immunohistochemistry. We observed influx of Gr-1+ neutrophils in the

pulmonary interstitium. Therefore, from our data we proposed that, in addition to mast

cells and basophils, neutrophils and platelets might play a role in excerbating the

effects of anaphylaxis.

Specific immunotherapy (SIT) is a gold standard therapy to treat allergic patients.

Nevertheless, it has been shown that SIT has adverse effects. Therefore, in chapter

4 of this PhD thesis, we attempted to design a hypoallergenic variant, taking peanut

allergen, Ara h 2 as our model allergen. Unfolded variant of Ara h 2 was prepared by

reduction/alkylation and subjected to structural analysis by circular dichroism (CD).

Unfolded Ara h 2 was studied for IgE binding capacity by ELISA, in vitro mast cell

7

degranulation assay, T-cell proliferative response in vitro. Furthermore, anaphylactic

capacity of the unfolded molecule was studied in a mouse model and splenocytes

were studied for metabolic capacity and proliferative potential. In addition, human T

cell proliferative capacity was assayed in vitro with native and unfolded Ara h 2.

Unfolded Ara h 2 was shown to have reduced IgE binding capacity, reduced mast cell

degranulation in vitro and a comparable response in human T cell proliferative

capacity with similar levels of IL-4, IL-13 and IFN-γ. Immunotherapy with unfolded

Ara h 2 might be a safer strategy with less or no adverse effects. Together, the

results in this thesis provide novel insights on the safety of food allergens in terms of

natural exposure and during allergen immunotherapy.

8

1.4 Zusammenfassung Allergische Reaktionen auf Lebensmittel, bis hin zum anaphylaktischen Schock,

gehören zu den am häufigsten behandelten klinischen Notfällen. Wie in Kapitel 1

dieser Doktorarbeit beschrieben, sind etwa 3-4 % der Erwachsenen und 5% aller

Kinder in entwickelten Ländern von Lebensmittelallergien betroffen. Zahlreiche

Studien der letzten Jahren haben zur Erforschung der Faktoren, die für die

Enstehung von Allergien mitverantwortlich sind, beigetragen.

Das zweite Kapitel beschreibt unsere Studien über den Einfluss der

Magensäurehemmer Sukralfat und Protonenpumpenhemmer kombiniert mit

bakteriellem Endotoxin auf die allergische Sensibilisierung in einem Mausmodell

basierend auf dem Milchallergen Casein. Dabei fütterten wir BALB/c Mäuse mit

Casein kombiniert mit Magensäurehemmer(n) und/oder Endotoxin und führten

anschließend Orale Provokations- und Hauttests durch. Im Rahmen dieser

Untersuchungen konnten wir zeigen dass Magensäurehemmer mit Endotoxin

interagieren, dabei Casein-spezifische IgG1 und IgE Antikörper induzieren und so zu

allergischer Sensibilisierung beitragen können. Außerdem entwickelten Mäuse, die

mit Magensäurehemmern behandelt wurden, die stärksten allergischen Reaktionen

in Form von Diarrhoe, Hypothermie, und Typ-1 Hautreaktionen.

Mastzellen und Basophile spielen bekanntermaßen wichtige Rollen in Allergen-

induzierten anaphylaktischen Reaktionen. Das dritte Kapitel dieser Arbeit handelt von

unseren Untersuchen zu den Beiträgen von Neurtrophilen, Thrombozyten, und

Erythrozyten zum anaphylaktischen Schock in einem expermintellen Mausmodell für

Allergen-induzierte Anaphylaxie. Dabei wurden Mäuse über die intra-peritoneale

Route sensiblisiert. Verabreichung des Allergens verursachte eine anaphylaktische

Reaktion. Anschließende Blutanalysen zeigten eine verringerte Zahl von

Neutrophilen, Thrombozyten und Erythrozyten im Blut. Der Rückgang von Fibrinogen

im Blut deutet darauf hin, dass der Rückgang der Thrombozytenzahl mit deren

Aktivierung einher geht. Immunohistochemische Analysen von Milz, Lunge, Leber,

Herz, und Niere zeigte eine Einwanderung von Gr-1+ Neutrophilen im pulmonären

Insterstitium der Lunge. Die Ergebnisse dieser Studie deuten an, dass abgesehen

von Mastzellen und Basophilen, auch Neutrophile und Thrombozyten eine wichtige

Rolle in anaphylaktischen Reaktion spielen.

Trotz diverser potentieller Nebenwirkungen ist spezifische Immuntherapie (SIT)

momentan die wichtigste Therapiemöglichket für die Behandlung von Allergien. Im

9

vierten Kapitel dieser Doktorarbeit werden unsere Experimente für die Entwicklung

einer hypoallergenen Variante des Erdnussallergens Ara h 2 beschrieben. Dafür

haben wir eine stabil-denaturierte Variante von Ara h 2 mittels chemischer Reduktion

und anschließender Alkylierung hergestellt. Nach struktureller Analyse des

modifizierten Allergens durch Zirkulardichroismus Analyse untersuchten wir

außerdem dessen Potenzial zur Bindung von Serum IgE-Antikörpern mittels ELISA,

zur Induktion von Mastzell Degranulation in vitro und zur Induktion von T-Zell

Proliferation in vitro. Weiters verglichen wir das anaphylaktische Potential von

denaturiertem Ara h 2 mit dem von unbehandeltem Ara h 2 in einem Mausmodell.

Diese Experimente zeigten, dass denaturiertes Ara h 2 – verglichen mit dem

unbehandelten Allergen – in vitro eine reduzierte IgE-Bindung aufwiest und geringere

Mastzell Degranulation verursacht. Gleichzeitig stimulierte denaturiertes Ara h 2 in

humanen T-Zellen die Produktion vergleichbarer Mengen von IL-4, IL-13 und

Interferon-gamma wie unbehandeltes Ara h 2. Diese Ergebnisse lassen den Schluss

zu, dass denaturiertes Ara h 2 ein vielversprechender Kandidat für die

Immuntherapie von Erdnussallergie sein könnte.

Alles in allem liefert die vorliegende Doktorarbeit neue Erkenntnisse zu Entstehung,

Ablauf und Therapie von Nahrungsmittelallergien.

10

1.5 Abbreviations/Symbols Ab Antibody

ADCC Antibody dependent cellular cytotoxicity

ADP Adenosine di-phosphate

AEC 3-amino-9-ethylcarbazole

Ag Antigen

Ara h Arachis hypogea

APC Antigen Presenting Cell

A23187 Calcium ionophore

Bet v Betula verrucosa

BSA Bovine Serum Albumin

CaCl2 Calcium Chloride

CAS Casein

CD Circular Dichroism

CD4 Cluster of Differentiation 4

CD8 Cluster of Differentiation 8

CDC Center for Disease and Control

CD154 Cluster of Differentiation 154

CT Cholera toxin

Der p Dermatophagoides pteronissinus

ECP Eosinophil cationic protein

ELISA Enzyme Linked Immunosorbent Assay

FcεRI Fc epsilon receptor -1

FcγRIII Fc gamma receptor-3

FcγRIV Fc gamma receptor-4

GAWS Genome-wide association study

GM-CSF Granulocyte monocyte colony stimulating factor

GM-CSFR Granulocyte monocyte-colony stimulating factor receptor

HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

HSA Human Serum Albumin

IFN Interferon

Ig Immunoglobulin

i.g. Intragastric feeding

IL Interleukin

11

i.p. Intraperitoneal injection

IT Immunotherapy

i.v. Intravenous injection

KCl Potassium Chloride

LTB4 Leukotriene B4

LTC4 Leukotriene C4

MBP Eosinophil, major basic protein

mMCP-1 Mouse Mast Cell Protease-1

MIP-1a Macrophage inflammatory protein-1 alpha

MgCl2 Magnesium Chloride

NaCl Sodium Chloride

NCHS National Center for Health Statisitics

NIAD National Institute of Allergy and Infectious Diseases

O.D. Optical Density

OVA Egg allergen, Ovalbumin

OVO Ovomucoid

PR-10 Pathogenesis-related group-10

PAF Platelet Activating Factor

PBMC Peripheral blood mononuclear cells

PBS Phosphate Buffered Saline

PMA Phorbol myrisate acetate

PPI Proton Pump Inhibitor

Pru p Prunus persica

RBC Red Blood Cell

RPMI Rosewell Park Memorial Institute Medium

SDS-PAGE Sodium Dodecyl Sulphate-Polyacrylamide Gel

Electrophoresis

SIT Sublingual Immunotherapy

SUC Sucralfate

TBST Tris-buffered Saline, Tween-20

TCL T-cell line

TGF Transforming Growth Factor

Thelper T helper cell

Th1 T- helper 1

12

Th2 T-helper 2

TNF Tumour Necrosis Factor

Tregs T regulatory cell

TSLP Thymic stromal lymphopoietin

XTT (2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-5-

|(phenylamino)carbonyl]-2//-tetrazolium hydroxide)

β-hexosaminidase Beta-hexosaminidase

(θ) theta, ellipticity

Compound 48/80 Histamine liberator

13

2 CHAPTER 1. THESIS INTRODUCTION 2.1 Milestones of allergy and anaphylaxis

The knowledge of allergic diseases such as asthma, urticaria and eczema was

described and came into light of the medical literature of Chinese, Egypt and Greece

(1-3). The very first, not convincing report on a fatal sting reaction comes from the

Egyptian era, in 2641 BC, from the King of Menses who was stung by a wasp (4).

The first family history of atopy syndrome can be found in the family Julian-Claudian

family of Augustus, Claudius and Britannicus (5). According to Shakespeare, King

Richard III (1452-1485) was allergic to strawberries. The modern era of allergy was

started in early 1800, when John Bostock as the first described hay fever clinically

(6). Magendie performed studies with egg albumin in rabbits in the year 1839 (7).

Later on, in 1873 C.H. Blackley demonstrated that by self-administering pollen in the

injured skin, that this is the cause of hay fever (8). Behring studied hypersensitivity

using diphtheria toxin in guinea pigs in 1893 (9). Flexner studied hypersensitivity by

using dog serum in rabbits in 1894 (10). In 1896, Gottstein reported the human

fatalities to the therapeutic antitoxin to diphtheria from horse-derived antisera (11).

Later, Richet performed hypersensitivity studies using toxic eel serum in dogs in

1898(12). Charles R. Richet (1850-1935) and Paul Portier (1866-1962) invented the

term “anaphylaxis” in 1902, even earlier than the term “allergy” was introduced by the

Viennese Pediatrician Clemens von Pirquet in 1906 to distinguish between protective

and noxious immunity (13).

In 1911, Leonard Noon and John Freeman proposed the concept of allergen-specific

immunotherapy, also called desensitization, hyposensitization. Therapy is done by

application of gradually increasing doses of allergen, tolerizing the patient towards

the applied allergen over time, leading to decreased signs of clinical symptoms of

allergy (14). In 1921, Prausnitz and Küstner, without the knowledge of immunoglobulins, identified the “reagin”, later termed “reaginic antibody”, which was

defined as a transferable serum factor from an individual to the other (15).

Kimishige and Teruko Ishizaka finally demonstrated the reaginic antibody

“immunoglobulin E” as the product of an atypical myeloma being a critical mediator of

allergic reactions (16). Simultaneously, another group identified another IgE

myeloma. Both references are milestones of allergy history today (17).

14

2.2 Definition of hypersensitivity and allergy The word hypersensitivity implies a state of the host’s adaptive immune system to

respond towards re-exposure of infectious agents effectively and hypersensitive,

despite that fact that, such immune responses could lead to tissue injury and disease

in the host. Philip Gell and Robert Coombs classified hypersensitivity reactions into

four types in 1963.

Figure 1. Classification of Hypersensitivity Reactions. (from Reference (13)) TYPE I/IMMEDIATE HYPERSENSITIVITY REACTIONS (IGE-MEDIATED)

Hay fever, anaphylaxis, allergic asthma are classical examples of Type I

hypersensitivity or immediate type hypersensitivity. The reaction is driven

predominantly driven by IgE and mast cells. IgE can be bound to mast cells through

their high affinity IgE receptor (FcεRI); when its specific antigen crosslinks the IgE,

mast cell degranulation occurs and releases histamine, leukotrienes and vasoactive

mediators leading to typical allergic symptoms within minutes (18, 19).

15

TYPE II HYPERSENSITIVITY REACTIONS (ANTIBODY-MEDIATED)

Type II reactions are characterized by antigen-antibody interactions mediated by

cytotoxic antibodies, IgM or IgG antibodies against cell surface or extracellular matrix

antigens on target cells, which may directly activate complement or recruit the

effector cells, neutrophils and macrophages leading to opsonization & phagocytosis

of cells (ADCC). On the other hand, such Ag-Ab interactions activate leukocytes,

through complement and Fc receptors (18, 19). TYPE III HYPERSENSITIVITY REACTIONS (IMMUNE COMPLEX MEDIATED)

Type III hypersensitivity reactions occur when precipitating antibodies (IgM or IgG

antibodies) and soluble antigens forms antigen-antibody immune complexes in the

blood. These soluble immune complexes are deposited in the glomerular basement

membrane and/or pulmonary basement membrane. These complexes activate

complement system by the classical way, further leading tissue damage through

opsonisation and lysis or activation of leukocytes (macrophages and neutrophils) (18,

19). TYPE IV/DELAYED TYPE HYPERSENSITIVITY REACTIONS (T-CELL MEDIATED)

The above mentioned three hypersensitivity reactions are mediated through antigen

and antibodies. In contrast to these reactions, type IV is a cell-mediated

hypersensitivity reaction. The reactions are elicited by CD4 T cells of the Th1 subset

and CD8 T cells, which proliferate and secrete cytokines, activate macrophages and

induce inflammation (18, 19). 2.3 Epidemiology and Risk factors of Allergy & Anaphylaxis

EPIDEMIOLOGY OF FOOD ALLERGY AND ANAPHYLAXIS

Food allergy poses a considerable health burden to the society, which is rising in

industrialized countries. Although it is reported that 20-30% of the population suffers

from food intolerances, only 6-8% of the children and 3-4% of the adult population

were shown to have true food allergy (20-23). It is thus important to distinguish

between food allergies from non-immunologic adverse reactions to food. According to

the NIAD recent report, food allergy is defined as “an adverse health effect arising

from a specific immune response that occurs reproducibly on exposure to a given

16

food” (21). Classical examples of nonimmunologic reactions to food are host-specific

metabolic disorders (eg. lactose intolerance), response to pharmacologically active

food component (eg. Scombroid poisoning), toxic reactions (eg. Fungal toxin,

aflatoxin), physcological reactions (eg. Food aversions, food phobias) and neurologic

reactions (eg. Gustatory rhinitis) (22). Almost 90% of all food-allergic reactions are

elicited by eight major food allergens such as milk, egg, peanut, tree nuts, shellfish,

soy and wheat (24). According to the National Center for Health Statisitics (NCHS),

2008 report, approximately 27% of children with food allergy more often reported to

have eczema or skin allergy, in comparison to children without food allergy showing

8% of eczematic or skin allergic status (25). In addition, over 30% of children with

food allergy are also reported to have respiratory allergy, compared to 9% of children

without food allergy (25) (Figure 2). It is estimated that 30,000 food induced

anaphylaxis are treated in the emergency departments of United States with 2000

hospitalizations and 150 deaths annually (26).

Figure 2. Percentage of children with reported asthma, eczema or skin allergy or respiratory allergy under 18 years (from Reference (20)).

17

RISK FACTORS INFLUENCING FOOD ALLERGY

The intestine is the largest interface between the body and the environment through

food and nutrients. The intestine harbours 1014 commensal microbiota, being thus the

most densely populated organ in the human body. It is exposed to various

pathogens, commensal flora and dietary antigens. Therefore, maintaining an immune

homeostasis is a critical process to induce tolerance to food proteins and protect the

host from invading pathogens by immune mechanisms. So far, many risk factors

have been described in the literature which contributes for the development of food

allergy.

Those studies showed that genetic predisposition (atopy), environmental factors,

characteristics of the allergen, dose, route and timing of exposure, including dietary

habits contributes to food allergy pathogenesis (27). GENETIC PREDISPOSITION (ATOPY)

“Atopy” was coined by Coca and Cooke in the year 1923. It is a state of

predisposition to produce IgE against environmental antigens and to develop

immediate type hypersensitivity upon subsequent exposure with the same antigen.

The atopic state arises from a complex interaction of genetic elements in the patient

with the environmental triggers. Recent studies show that there are several genes

identified as susceptibility factors of allergic diseases. Genetic variations in the

susceptible gene cluster seem to associate with the increased risk of allergic

disorders. A classical example of such gene cluster is chromosome 5 cytokine gene

cluster has been linked to allergies and asthma, in which the genes encoding for IL-3,

IL-4, IL-9, IL-13, GM-CSF and leukotriene C4 synthase reside (28). In addition, a

recent study using Genome-wide association study (GWAS) and meta-analyses of

GWAS shows an association in the variations in the genes encoding epithelial cell-

derived cytokine, IL-33 (Interleukin-33) and thymic stromal lymphopoietin (TSLP),

promoting Th2 cells in the pathogenesis of both asthma and allergic diseases (29). CHARACTERISTICS OF ALLERGENS

Though there are numerous food proteins in the diet, only a few families of food

proteins contribute to adverse reactions to food, especially food allergy. Major food

allergens share a number of common features; relatively smaller in size ranging from

10-70 kDa, resistant to acid, heat and proteases, water-soluble glycoproteins. Major

18

allergens are derived from mites, animal dander, pollen, insects and foods. The

allergens possess diverse biological functions summarized as 1) Indoor allergens

(enzymes, ligand-binding proteins, tropomyosins, albumins, calcium-binding proteins)

(30). These allergens have direct effects on IgE response and proinflammatory

responses. Classical examples of indoor allergens are mite allergens, Der p 1, Der p

3, Der p 6 and Der p 9, cysteine and serine proteases. Der p 1 can cleave low affinity

IgE receptor and enhance IgE response (30-32). 2) Pollen allergens (pathogenesis-

related proteins, calcium-binding proteins, pectate lyases, β-expansins, trypsin-

inhibitors). Birch pollen allergen Bet v 1, Bet v 1 homologues (pathogenesis-related

group-10 (PR-10), profilins are classical examples of pollen allergens (30), but

profilins and Bet v 1 are also indirectly responsible for crossreactive oral food allergy

syndrome (33). 3) plant and animal food allergens (lipid transfer proteins, seed

storage proteins and tropomyosins). Ara h 1 from peanut and Jug r 2 from walnut are

examples of plant food allergens. α-lactalbumim, ovomucoid, parvalbumin are

examples of animal food allergens (30). In addition to the above characteristics, nature of the antibody binding sites of

allergens (epitopes) and their binding pattern and affinity to IgE are critical on priming

and effector phases of food allergy. The term “epitope”, an antigenic determinant

recognized by an antibody, was coined by Niels Jerne in 1960. The three

dimensional structure of the allergens determines the surface accessible

recognizable sites by the antibody. Identification of linear epitopes was possible

using epitope mapping by overlapping synthetic peptides, recombinant allergenic

fragments or unfolded allergens. The stability of the molecular fold has an implication

on the stability and digestibility of food allergens. Major IgE binding sites regions

were already identified for major allergens such as ovalbumin, shrimp allergen,

tropomyosin, peanut allergens and cherry allergen (34, 35). Patients with persistent

milk allergy, show more IgE binding to linear epitopes compared to patients who

outgrew the allergic reactions. This shows that the conformation is critical in the

priming the host whereas linear epitopes show clinical reactivity in the later phase

(35). Therefore structural epitopes have the potential to induce sensitization and IgE

production. Reports from our group, showed persistence of dietary antigenic epitopes

by hindering gastric digestion by pharmacological agents, ie., anti-ulcer drugs

represents a risk factor of food allergy (35) (Figure 3). Intestinal administration of

19

intact dietary proteins with conserved structural epitopes was found to break the oral

tolerance established previously (36, 37).

Figure 3. Structural features of dietary allergens in the priming and effector phase of food allergy. (from Reference (30))

T-cell epitopes are small, linear, HLA-restricted and distributed throughout the

primary structure of the allergen, whereas the B-cell epitopes are either linear or

conformational, found on the surface of the allergen, important for the

immunoglobulin production. Crosslinking polyvalent antigens have the potential to

crosslink IgE crosslinking efficiently and such crosslinking also is essential for B-cell

receptor crosslinking and signalling by repetitive display of epitopes during priming

phase. Therefore repetitive display of allergens, such as di-, tri-, polymerization of

small allergens is important on both priming as well as effector phase (38).

20

2.4 Food allergy models Needless to say that due to ethical reasons, sensitization studies in humans are

impossible. Therefore, animal models are being widely used to assess the

mechanisms leading IgE-mediated diseases and to assess the allergenicity of novel

proteins and distinguish them from non-allergenic proteins. Mouse, rat, guinea pig,

dog models have provided information for understanding important mechanisms of

IgE-mediated diseases (39). Few parameters should be considered, namely,

concentration of the allergen (high dose is known to induce tolerance and low dose to

induce sensitization), allergen in context with the food source, route and timing of the

allergen exposure and age of the animal. In addition, genetic predisposition (high and

low IgE responders, eg. BALB/c mouse strains and Brown Norway rats are known to

be good IgE responders), use of adjuvants (eg. cholera toxin, a selective IgE

adjuvant), isotype specificity response (e.g. anaphylacogenic antibodies: IgG1 and

IgE in mouse strain, IgG2a in rats, IgG1 and IgE in guinea pigs, IgE in dogs, IgE in

pigs), Th1/Th2 polarization (mouse strains possess a highly delineated Th1/Th2

polarization, whereas in humans polarization is more discrete. For instance, IL-10 is a

Th2 cytokine in mice, whereas IL-10 is secreted by both Th1 and Th2 cells in humans

(39, 40). Several rodent models of experimental food allergy are being developed

and investigated to elucidate the mechanisms of food allergy. Rat models are

attractive as they are used for toxicological studies and known to produce IgE against

dietary antigens (39). Though the allergenicity of cow’s milk proteins has been

studied in the guinea pig model, this model needs consideration as the immune

system of guinea pigs has not been completely characterized (39). Mouse models

are very attractive to study IgE-mediated food allergy due to availability of a great

panel of reagents for mouse studies, available on multiple inbred strains harboring

deletion or over-expression of specific genes important for IgE-mediated

mechanisms. Furthermore, mice have less space requirements and are easy to

manipulate with (41). A more detailed section has been described later pointing out

few considerations of using mouse models. Several models have been proposed and

demonstrated to study food allergy mechanisms in mouse experimental models (42). RAT EXPERIMENTAL MODELS OF FOOD ALLERGY

Rat models are known to mount strong IgE responses against dietary antigens. They

are attractive due to the still compatible size of the species; it is further possible to

21

perform kinetics of serum antibody responses. Additionally, oral challenge-induced

responses in previously sensitized animals provide a model to assess changes in gut

permeability, respiratory function and blood pressure. Oral gavage of dietary proteins

without an adjuvant could be applied daily making them attractive models in a more

physiological manner (43-46). Despite these advantages, rat models pose a few

disadvantages; a gender bias has been shown in rats, male Brown Norway rats being

13-38% IgE responders and female Brown Norway rats being 38-80% IgE

responders (44). Brown Norway rats seem inherently variable in showing IgE

responses, influencing factors due to environmental conditions, age and sub-clinical

infection status (47). Therefore, it is suggested to use concurrent positive allergens

while investigating novel dietary antigens (48). Egg allergen ovalbumin (OVA), cow

milk allergen and peanut allergens are the few investigated model allergens in rats

(48). DOG EXPERIMENTAL MODELS OF FOOD ALLERGY

Dog is one of the less commonly used species as experimental models to assess

protein allergenicity. However, as dogs spontaneously develop atopic allergies, they

are often reported to have IgE-mediated food hypersensitivity in the veterinary clinic

(48). Gut anatomy, physiology and nutritional requirements are similar to humans,

makes the model more advantageous (49). An additional feature of using dog as

experimental models is the possibility to immunize the same animal with multiple

allergens. However dog experimental models pose a disadvantage, as the

immunization is done subcutaneously using alum as an adjuvant. Cow’s milk, beef,

ragweed and wheat are the allergens which have been used in dog models. Oral

challenge with the sensitizing allergen demonstrated the clinical manifestations of

food allergy, consistent to food allergy in infant, adolescents and in humans (49). As

skin sensitization is known to mount a strong IgE response to most applied proteins,

the above discussed oral food models may not mimic the true situation, leading to

false positive results (48). SWINE MODELS OF FOOD ALLERGY

The less commonly used model for food allergy is the neonatal pig model. They are

extensively used to investigate the pathogenesis and immune response to allergens,

as they closely resemble humans in gastrointestinal physiology and in the

22

development of mucosal immunity (48). Egg white allergen, ovomucoid and peanut

proteins have been used as model allergens being intraperitoneally applied with

cholera toxin (CT) and immune response has been determined (50, 51). MOUSE MODELS OF FOOD ALLERGY

It is known that mice and humans share common mechanisms of immune regulation

(48). It has been extensively used to investigate cellular and molecular mechanisms

of atopic diseases, food allergy, asthma, atopic dermatitis. Availability of inbred and

congenic high IgE responder mouse strains is the major advantage of using mouse

models. As they are analogous to susceptible (atopic) human phenotype, they are

more likely to develop IgE-mediated diseases leading to the identification of

allergenicity of novel dietary proteins. Experimental Th2 adjuvants namely, cholera

toxin subunit B (CTB), or staphylococcal enterotoxin B (SEB) were used to achieve

Th2 sensitization and study the mechanisms determining the allergic inflammation.

Cholera toxin is the widely used mucosal adjuvant for oral sensitization with co-

administration of food proteins, egg allergen ovalbumin (OVA) (52), hen egg

lysozyme (52), buckwheat (53), lupin proteins (54), milk and individual milk proteins

such as alpha-lactalbumin, beta-lactoglobulin etc (55-58), peanut or peanut allergens

(ie, Ara h 1, Ara h 2) (59-63). Staphylococcal enterotoxin B (SEB) is also used as an

adjuvant by applying both orally and systemically to induce gastrointestinal allergy

(64). There are few important points to be considered in the experimental models.

The route of allergen exposure is an important consideration, as the oral route is the

preferred route to apply the food allergens, even though most published food allergy

mouse models in fact use i.p or s.c. priming with then antigen before oral challenges.

It seems that few rodent models, fail to induce robust IgE response, though they are

known to be high IgE responders (48). In addition to above mentioned experimental

adjuvants, it is observed that oral administration of allergen under anti-acid

medication induces a type 2 response, assessed by IgE serum titres, oral

provocation tests and morphological changes in the intestine (65, 66).

23

2.5 Mechanisms of allergic inflammation Mast cells, eosinophils and basophils are the key effector cells which play an

important role in the allergic inflammation. IgE, the thermolabile reaginic antibody

class, not activating complement by the classical pathway, plays a crucial role in

perpetuating the allergic inflammation. IgE constitutes of about 0.0004% of the total

serum immunoglobulin concentration (67). About 50% of the IgE is present in the

intravascular compartment, with the half life of 1-5 days in the peripheral blood (67)..

Two signals are required for the IgE synthesis for the IgE isotype switching. The

process is initiated by antigen presenting cells (APC), primarily dendritic cells,

including the allergen-specific B cells (sensitized host), allergen is taken up,

processed and presented to naïve T cell or Th2 cells. T cells upon activation,

expresses IL-4, and or IL-13 (signal 1) and CD154 (signal 2), providing both the

signals to induce IgE secretion (68). Secreted IgE binds with high affinity to FcεRI

expressed on mast cells and basophils. FcεRI exists in two forms, trimeric (αγ2) form

and tetrameric form (αβγ2). The tetrameric form contains an alpha chain, a beta chain

and a gamma chain as homodimer. In mice the tetrameric form is expressed on

mast cells and basophils and in humans tetrameric form is expressed on mast cells

and basophils (69, 70). Mice do no express the trimeric form of the IgE receptor. In

humans the trimeric form is expressed on Langerhans cells (71, 72), dendritic cells

(73, 74), monocytes (75), eosinophils (76), platelets (77) and intestinal epithelia (78).

In addition to high affinity receptor, low affinity receptor, CD23 binds IgE and is,

expressed by B cells and also by Langerhans cells, monocytes, macrophages and

eosinophils (68, 79-81). Mast cells are derived from hematopoietic cells, ovoid or irregularly elongated with

ovoid nucleus and contain metachromatic cytoplasmic granules. Mast cells have the

ability to release immediate and delayed release of inflammatory mediatory

mediators from the signals of innate and adaptive immunity. Aggregation of high

affinity IgE receptors on mast cells by polyvalent antigens, activates these cells and

elicits the symptoms of anaphylaxis and other allergic diseases through their

inflammatory mediator release (68) on gastrointestinal tract, respiratory tract and

vasculature (82) (Table II).

24

Table I. Secreted products of Basophils and Mast Cells (from Reference (45)) Basophils are granulocytes of hematopoietic origin, shares many common features

with mast cells, such as surface expression of FcεRI, metachromatic staining,

expression of IL-4 and IL-13 and immediate histamine release. They are located in

intravascular compartments in contrast to mast cells (83). Basophils account less

than 1% of the peripheral blood leukocytes. They were less recognized until the

discovery that they are the rich producers of IL-4 upon FcεRI activation, both in

humans and in mice. They play important role in Th2 differentiation through IL-4

production, initiation of chronic inflammation (84). They also participate in the effector

mechanisms of parasite expulsion (85). In addition, recent report showed that

basophils support the humoral memory immune response (84).

25

Figure 5. Clinical Signs elicited by Mast cell Activation (from Reference (13)) Eosinophils are of hematopoietic origin, staining with acidic aniline dye, eosin. IL-3,

IL-5 and GM-CSF promote the development and differentiation of eosinophils from

hematopoietic cells, of which IL-5 plays a critical role in blood and tissue eosinophilia,

showing a hallmark signs of parasite infection, asthma, allergy and eosinophilic

gastrointestinal disorders. Eosinophils express receptors for IgG and IgA, cytokine

receptors (IL-3R, IL-5R and GM-CSFR). Expression of high affinity IgE receptor is

still a controversial subject. Majority of the eosinophils are located in the mucosal

surfaces of gastrointestinal tract and Th2-mediated inflammatory sites. Eosinophils

release proinflammatory mediators such as granule-stored cationic proteins (MBP

and ECP), cytokines and eicosanoids, lipid-derived mediators (LTC4, PGE2,

thromboxane and PAF) (Figure 6). Granular proteins are the major effector cells of

the eosinophils, implicated in the immediate immune response against parasites (68).

26

Figure 6. Mediators secreted by Eosinophils (from Reference (13)).

2.6 Current management of food allergy and future therapies of

food allergy Allergen encounter may lead to severe manifestation in food allergic patients

potentially resulting in fatal anaphylaxis. Due to the great risk there is no causative

treatment to food allergies available today and avoidance remains the safest way to

prevent any potentially life-threatening events. Food allergy has become a most

common cause of anaphylactic condition treated in the emergency departments and

has increased the number of hospitalizations in United States and United Kingdom in

the past decade (86-88). Currently, management of food allergy is dietary avoidance,

nutritional counseling and emergency treatments in case of mild to severe adverse

reactions. However, several approaches are under investigation to treat food

27

allergies. Approaches to treat food allergies may be dietary allergen-specific and non-

specific. Allergen-specific approaches include subcutaneous, sub-lingual, oral and

epicutaneous immunotherapy by application of specific allergens. To avoid the risk of

immunotherapy-mediated immediate adverse effects can be reduced by modifying

the IgE-binding sites using modified allergens (eg. Mannoside conjugated-BSA used

for immunotherapy in mice model) (89). Allergen non-specific immunotherapy

approaches include humanised monoclonal anti-IgE antibody, Traditional Chinese

Medicine (TCM), Lactococccus lactis expressing IL-10 and IL-12, use of probiotics,

Toll-like receptor agonist (TLR-9 agonist), Trichuris suis ova therapy, anti-IL-5

antibody, Chinese herbal formula FAHF-2 (Figure 7). Although numerous approaches

have been made, Chinese formula FAHF-2 and oral immunotherapy alone or in

combination with anti-IL-5 antibody are more likely to enter the clinical practice. In

addition, extensively heated milk and egg formulas are few alternatives to food oral

immunotherapy (89).

Figure 7. Therapies for food allergy (from Reference (89)).

28

2.7 References (1) De Weck A. A short history of allergological diseases and concepts. . In:Kay B

(ed) Allergy Blackwell, Oxford. 1997:pp 3-22.

(2) Schadewaldt H. Geschichte der Allergie (4 vols) Dustri, München-

Deisenhofen. 1980-1984.

(3) Simons E. Ancestors in allergy. Global Med Com, New York. (ed) (1994).

(4) Avenberg K, Harper DS, Larsson BL. Footnotes on allergy. Pharmacia,

Uppsala. 1986.

(5) Ring J. Erstbeschreibung einer “atopischen Familien-Anamnese” im Julisch-

Claudischen Kaiserhaus: Augustus, Claudius, Britannicus. . Hautarzt 1985;36:470-4.

(6) Bostock J. Case of a periodical affection of the eyes and chest. Med-Chir

Trans 1819(10):161.

(7) Magendie F. Lectures on the blood. Philadelphia: Harrington,Barrington, and

Haswell; . 1839:p. 244.

(8) Blackley C. Experimental researches on the cause and nature of hay fever.

Ballière, Tindall & Cox, London. 1873.

(9) Behring E. Gesammelte Abhandlungen Zur Atiologischen

Therapie con Anstekenden Krankherten. Leipzig: Thieme. 1893.

(10) Flexner S. The pathologic changes caused by so called toxalbumens. Med

News 1894;65:116-24.

(11) Gottstein A. Über Toderfälle, welch bei der Anwhidung des

Diphtheriaheilserums beobachter warden sind. . Ther Mh. 1896;10:269-72.

(12) Héricourt J, Richet C. Effects lointains des injections de serum. CR Séances

Soc Biol 1898;50:137.

(13) Pirquet C. Allergie. Münch Med Wochenschr. 1906(30):1457.

(14) Noon L. PROPHYLACTIC INOCULATION AGAINST HAY FEVER. The

Lancet. 1911;177(4580):1572-3.

(15) Prausnitz C KH. Studien über die Ükerempfindlickkeit. Zentralb Bakteriol.

1921;86:160-8.

(16) Ishizaka K, Ishizaka T. Identification of gamma-E-antibodies as a carrier of

reaginic activity. J Immunol. 1967 Dec;99(6):1187-98.

(17) Johansson SG, Bennich H, Wide L. A new class of immunoglobulin in human

serum. Immunology. 1968 Feb;14(2):265-72.

29

(18) Janeway C, Murphy K, Travers P, Walport M, Janeway C. Janeway's immuno

biology. Garland Science. 2008.

(19) Rajan TV. The Gell-Coombs classification of hypersensitivity reactions: a re-

interpretation. Trends Immunol. 2003 Jul;24(7):376-9.

(20) Sicherer SH. Epidemiology of food allergy. J Allergy Clin Immunol. 2011

Mar;127(3):594-602.

(21) Boyce JA, Assa'ad A, Burks AW, Jones SM, Sampson HA, Wood RA, et al.

Guidelines for the diagnosis and management of food allergy in the United States:

summary of the NIAID-Sponsored Expert Panel report. J Am Acad Dermatol. 2011

Jan;64(1):175-92.

(22) Mansoor DK, Sharma HP. Clinical presentations of food allergy. Pediatr Clin

North Am. 2011 Apr;58(2):315-26, ix.

(23) Chafen JJ, Newberry SJ, Riedl MA, Bravata DM, Maglione M, Suttorp MJ, et

al. Diagnosing and managing common food allergies: a systematic review. JAMA.

2010 May 12;303(18):1848-56.

(24) Boyce JA, Assa'ad A, Burks AW, Jones SM, Sampson HA, Wood RA, et al.

Guidelines for the diagnosis and management of food allergy in the United States:

report of the NIAID-sponsored expert panel. J Allergy Clin Immunol. 2010 Dec;126(6

Suppl):S1-58.

(25) Amy M. Branum MSPHaSLL, D.O., M.S.P.H. Food Allergy Among U.S.

Children: Trends in Prevalence and Hospitalizations

NCHS Data Brief. 2008;10.

(26) Arias K, Waserman S, Jordana M. Management of food-induced anaphylaxis:

unsolved challenges. Curr Clin Pharmacol. 2009 May;4(2):113-25.

(27) Bischoff S, Crowe SE. Gastrointestinal food allergy: new insights into

pathophysiology and clinical perspectives. Gastroenterology. 2005 Apr;128(4):1089-

113.

(28) Steinke JW, Rich SS, Borish L. 5. Genetics of allergic disease. The Journal of

allergy and clinical immunology. 2008 Feb;121(2 Suppl):S384-7; quiz S416.

(29) Ober C, Yao TC. The genetics of asthma and allergic disease: a 21st century

perspective. Immunol Rev. 2011 Jul;242(1):10-30.

(30) Chapman MD, Pomes A, Breiteneder H, Ferreira F. Nomenclature and

structural biology of allergens. J Allergy Clin Immunol. 2007 Feb;119(2):414-20.

30

(31) Comoy EE, Pestel J, Duez C, Stewart GA, Vendeville C, Fournier C, et al. The

house dust mite allergen, Dermatophagoides pteronyssinus, promotes type 2

responses by modulating the balance between IL-4 and IFN-gamma. J Immunol.

1998 Mar 1;160(5):2456-62.

(32) Gough L, Schulz O, Sewell HF, Shakib F. The cysteine protease activity of the

major dust mite allergen Der p 1 selectively enhances the immunoglobulin E antibody

response. J Exp Med. 1999 Dec 20;190(12):1897-902.

(33) Vieths S, Scheurer S, Ballmer-Weber B. Current understanding of cross-

reactivity of food allergens and pollen. Ann N Y Acad Sci. 2002 May;964:47-68.

(34) Pomes A. Relevant B cell epitopes in allergic disease. Int Arch Allergy

Immunol. 2010;152(1):1-11.

(35) Untersmayr E, Jensen-Jarolim E. Mechanisms of type I food allergy.

Pharmacol Ther. 2006 Dec;112(3):787-98.

(36) Barone KS, Reilly MR, Flanagan MP, Michael JG. Abrogation of oral tolerance

by feeding encapsulated antigen. Cell Immunol. 2000 Feb 1;199(2):65-72.

(37) Michael JG. The role of digestive enzymes in orally induced immune tolerance.

Immunol Invest. 1989 Nov-Dec;18(9-10):1049-54.

(38) Erika Jensen-Jarolim, Diana Mechtcheriakova, Pali-Schoell. I. The Targets of

IgE: Allergen-Associated and Tumor-Associated Molecular Patterns. Cancer and IgE,

Introducing the Concept of AllergoOncology. 2010:231-54.

(39) Helm RM. Food allergy animal models: an overview. Ann N Y Acad Sci. 2002

May;964:139-50.

(40) Del Prete G, De Carli M, Almerigogna F, Giudizi MG, Biagiotti R, Romagnani

S. Human IL-10 is produced by both type 1 helper (Th1) and type 2 helper (Th2) T

cell clones and inhibits their antigen-specific proliferation and cytokine production. J

Immunol. 1993 Jan 15;150(2):353-60.

(41) Finkelman FD. IgE-Dependent and Independent Effector Mechanisms in

Human and Murine Anaphylaxis

Anaphylaxis and Hypersensitivity Reactions. In: Castells MC, editor.: Humana Press;

2011. p. 127-44.

(42) McClain S, Bannon GA. Animal models of food allergy: opportunities and

barriers. Curr Allergy Asthma Rep. 2006 Mar;6(2):141-4.

31

(43) Akiyama H, Teshima R, Sakushima JI, Okunuki H, Goda Y, Sawada JI, et al.

Examination of oral sensitization with ovalbumin in Brown Norway rats and three

strains of mice. Immunology letters. 2001 Aug 1;78(1):1-5.

(44) Pilegaard K, Madsen C. An oral Brown Norway rat model for food allergy:

comparison of age, sex, dosing volume, and allergen preparation. Toxicology. 2004

Mar 15;196(3):247-57.

(45) Jia XD, Li N, Wu YN, Yang XG. Studies on BN rats model to determine the

potential allergenicity of proteins from genetically modified foods. World J

Gastroenterol. 2005 Sep 14;11(34):5381-4.

(46) Knippels LM, Penninks AH. Assessment of the allergic potential of food protein

extracts and proteins on oral application using the brown Norway rat model. Environ

Health Perspect. 2003 Feb;111(2):233-8.

(47) Knippels LM, Penninks AH, Houben GF. Continued expression of anti-soy

protein antibodies in rats bred on a soy protein-free diet for one generation: the

importance of dietary control in oral sensitization research. The Journal of allergy and

clinical immunology. 1998 Jun;101(6 Pt 1):815-20.

(48) Dearman RJ, Kimber I. Animal models of protein allergenicity: potential

benefits, pitfalls and challenges. Clin Exp Allergy. 2009 Apr;39(4):458-68.

(49) Helm RM, Ermel RW, Frick OL. Nonmurine animal models of food allergy.

Environ Health Perspect. 2003 Feb;111(2):239-44.

(50) Helm RM, Furuta GT, Stanley JS, Ye J, Cockrell G, Connaughton C, et al. A

neonatal swine model for peanut allergy. J Allergy Clin Immunol. 2002

Jan;109(1):136-42.

(51) Rupa P, Hamilton K, Cirinna M, Wilkie BN. A neonatal swine model of allergy

induced by the major food allergen chicken ovomucoid (Gal d 1). Int Arch Allergy

Immunol. 2008;146(1):11-8.

(52) Snider DP, Marshall JS, Perdue MH, Liang H. Production of IgE antibody and

allergic sensitization of intestinal and peripheral tissues after oral immunization with

protein Ag and cholera toxin. J Immunol. 1994 Jul 15;153(2):647-57.

(53) Lee SY, Oh S, Lee K, Jang YJ, Sohn MH, Lee KE, et al. Murine model of

buckwheat allergy by intragastric sensitization with fresh buckwheat flour extract. J

Korean Med Sci. 2005 Aug;20(4):566-72.

32

(54) Foss N, Duranti M, Magni C, Frokiaer H. Assessment of lupin allergenicity in

the cholera toxin model: induction of IgE response depends on the intrinsic properties

of the conglutins and matrix effects. Int Arch Allergy Immunol. 2006;141(2):141-50.

(55) Adel-Patient K, Ah-Leung S, Creminon C, Nouaille S, Chatel JM, Langella P,

et al. Oral administration of recombinant Lactococcus lactis expressing bovine beta-

lactoglobulin partially prevents mice from sensitization. Clin Exp Allergy. 2005

Apr;35(4):539-46.

(56) Berin MC, Zheng Y, Domaradzki M, Li XM, Sampson HA. Role of TLR4 in

allergic sensitization to food proteins in mice. Allergy. 2006 Jan;61(1):64-71.

(57) Frossard CP, Hauser C, Eigenmann PA. Oral carrageenan induces antigen-

dependent oral tolerance: prevention of anaphylaxis and induction of lymphocyte

anergy in a murine model of food allergy. Pediatr Res. 2001 Mar;49(3):417-22.

(58) Li XM, Schofield BH, Huang CK, Kleiner GI, Sampson HA. A murine model of

IgE-mediated cow's milk hypersensitivity. The Journal of allergy and clinical

immunology. 1999 Feb;103(2 Pt 1):206-14.

(59) Bashir ME, Louie S, Shi HN, Nagler-Anderson C. Toll-like receptor 4 signaling

by intestinal microbes influences susceptibility to food allergy. J Immunol. 2004 Jun

1;172(11):6978-87.

(60) Bashir ME, Andersen P, Fuss IJ, Shi HN, Nagler-Anderson C. An enteric

helminth infection protects against an allergic response to dietary antigen. J Immunol.

2002 Sep 15;169(6):3284-92.

(61) Li XM, Serebrisky D, Lee SY, Huang CK, Bardina L, Schofield BH, et al. A

murine model of peanut anaphylaxis: T- and B-cell responses to a major peanut

allergen mimic human responses. The Journal of allergy and clinical immunology.

2000 Jul;106(1 Pt 1):150-8.

(62) Sun J, Arias K, Alvarez D, Fattouh R, Walker T, Goncharova S, et al. Impact of

CD40 ligand, B cells, and mast cells in peanut-induced anaphylactic responses. J

Immunol. 2007 Nov 15;179(10):6696-703.

(63) van Wijk F, Hoeks S, Nierkens S, Koppelman SJ, van Kooten P, Boon L, et al.

CTLA-4 signaling regulates the intensity of hypersensitivity responses to food

antigens, but is not decisive in the induction of sensitization. J Immunol. 2005 Jan

1;174(1):174-9.

(64) Berin MC, Shreffler WG. T(H)2 adjuvants: implications for food allergy. The

Journal of allergy and clinical immunology. 2008 Jun;121(6):1311-20; quiz 21-2.

33

(65) Untersmayr E, Scholl I, Swoboda I, Beil WJ, Forster-Waldl E, Walter F, et al.

Antacid medication inhibits digestion of dietary proteins and causes food allergy: a

fish allergy model in BALB/c mice. The Journal of allergy and clinical immunology.

2003 Sep;112(3):616-23.

(66) Pali-Scholl I, Yildirim AO, Ackermann U, Knauer T, Becker C, Garn H, et al.

Anti-acids lead to immunological and morphological changes in the intestine of

BALB/c mice similar to human food allergy. Exp Toxicol Pathol. 2008 Aug;60(4-

5):337-45.

(67) Prussin C, Metcalfe DD. 4. IgE, mast cells, basophils, and eosinophils. The

Journal of allergy and clinical immunology. 2003 Feb;111(2 Suppl):S486-94.

(68) Stone KD, Prussin C, Metcalfe DD. IgE, mast cells, basophils, and eosinophils.

J Allergy Clin Immunol. 2010 Feb;125(2 Suppl 2):S73-80.

(69) Ravetch JV, Kinet JP. Fc receptors. Annual review of immunology.

1991;9:457-92.

(70) Metzger H. The high affinity receptor for IgE on mast cells. Clin Exp Allergy.

1991 May;21(3):269-79.

(71) Bieber T, de la Salle H, Wollenberg A, Hakimi J, Chizzonite R, Ring J, et al.

Human epidermal Langerhans cells express the high affinity receptor for

immunoglobulin E (Fc epsilon RI). J Exp Med. 1992 May 1;175(5):1285-90.

(72) Wang B, Rieger A, Kilgus O, Ochiai K, Maurer D, Fodinger D, et al. Epidermal

Langerhans cells from normal human skin bind monomeric IgE via Fc epsilon RI. J

Exp Med. 1992 May 1;175(5):1353-65.

(73) Maurer D, Fiebiger S, Ebner C, Reininger B, Fischer GF, Wichlas S, et al.

Peripheral blood dendritic cells express Fc epsilon RI as a complex composed of Fc

epsilon RI alpha- and Fc epsilon RI gamma-chains and can use this receptor for IgE-

mediated allergen presentation. J Immunol. 1996 Jul 15;157(2):607-16.

(74) Osterhoff B, Rappersberger K, Wang B, Koszik F, Ochiai K, Kinet JP, et al.

Immunomorphologic characterization of Fc epsilon RI-bearing cells within the human

dermis. J Invest Dermatol. 1994 Mar;102(3):315-20.

(75) Maurer D, Fiebiger E, Reininger B, Wolff-Winiski B, Jouvin MH, Kilgus O, et al.

Expression of functional high affinity immunoglobulin E receptors (Fc epsilon RI) on

monocytes of atopic individuals. J Exp Med. 1994 Feb 1;179(2):745-50.

34

(76) Gounni AS, Lamkhioued B, Ochiai K, Tanaka Y, Delaporte E, Capron A, et al.

High-affinity IgE receptor on eosinophils is involved in defence against parasites.

Nature. 1994 Jan 13;367(6459):183-6.

(77) Joseph M, Gounni AS, Kusnierz JP, Vorng H, Sarfati M, Kinet JP, et al.

Expression and functions of the high-affinity IgE receptor on human platelets and

megakaryocyte precursors. Eur J Immunol. 1997 Sep;27(9):2212-8.

(78) Untersmayr E, Bises G, Starkl P, Bevins CL, Scheiner O, Boltz-Nitulescu G, et

al. The high affinity IgE receptor Fc epsilonRI is expressed by human intestinal

epithelial cells. PLoS One. 2010;5(2):e9023.

(79) Conrad DH. Fc epsilon RII/CD23: the low affinity receptor for IgE. Annu Rev

Immunol. 1990;8:623-45.

(80) Boltz-Nitulescu G, Bazin H, Spiegelberg HL. Specificity of fc receptors for

IgG2a, IgG1/IgG2b, and IgE on rat macrophages. J Exp Med. 1981 Aug

1;154(2):374-84.

(81) Grangette C, Gruart V, Ouaissi MA, Rizvi F, Delespesse G, Capron A, et al.

IgE receptor on human eosinophils (FcERII). Comparison with B cell CD23 and

association with an adhesion molecule. J Immunol. 1989 Dec 1;143(11):3580-8.

(82) Galli SJ, Kalesnikoff J, Grimbaldeston MA, Piliponsky AM, Williams CM, Tsai

M. Mast cells as "tunable" effector and immunoregulatory cells: recent advances.

Annual review of immunology. 2005;23:749-86.

(83) Prussin C, Metcalfe DD. 5. IgE, mast cells, basophils, and eosinophils. J

Allergy Clin Immunol. 2006 Feb;117(2 Suppl Mini-Primer):S450-6.

(84) Karasuyama H, Mukai K, Tsujimura Y, Obata K. Newly discovered roles for

basophils: a neglected minority gains new respect. Nat Rev Immunol. 2009

Jan;9(1):9-13.

(85) Ohnmacht C, Voehringer D. Basophil effector function and homeostasis during

helminth infection. Blood. 2009 Mar 19;113(12):2816-25.

(86) Branum AM, Lukacs SL. Food allergy among children in the United States.

Pediatrics. 2009 Dec;124(6):1549-55.

(87) Sicherer SH, Munoz-Furlong A, Godbold JH, Sampson HA. US prevalence of

self-reported peanut, tree nut, and sesame allergy: 11-year follow-up. J Allergy Clin

Immunol. 2010 Jun;125(6):1322-6.

(88) Gupta R, Sheikh A, Strachan DP, Anderson HR. Time trends in allergic

disorders in the UK. Thorax. 2007 Jan;62(1):91-6.

35

(89) Nowak-Wegrzyn A, Sampson HA. Future therapies for food allergies. The

Journal of allergy and clinical immunology. 2011 Mar;127(3):558-73; quiz 74-5.

36

3 SCOPE AND OUTLINE OF THE THESIS The aim of this PhD thesis was to approach the phenomenon of food allergy starting

from primary mechanisms during sensitization up to questions of food safety in

sensitized organisms. We address to develop a true casein food allergy mouse

model. Whereas most food allergy models are based on a parenteral prime with the

allergen followed by intestinal challenges, most often using mucosal adjuvants like

cholera toxin B (CTB), Staphylacocccus enterotoxin B (SEB), we aimed here to

develop a true food allergy model, using casein as a model.

We have primed the mice under anti-acid medication by oral application of cow milk

allergen, casein (CAS) as model allergen. In addition, we aimed to address the

potential adjuvant effects of endotoxin (LPS) contamination of this regimen to food

allergen sensitization.

In chapter 4, we therefore addressed the adjuvant effect of different anti-acid

medications proton-pump inhibitor (LOSEC, Omeprazole) alone or in combination

with Ulcogant (Sucralfate). In addition we have investigated the potential effect of

endotoxin (LPS) presence on food allergen sensitization.

The next main aim of the thesis was to look yet less addressed cellular population

during anaphylaxis in the experimental mouse models of food allergy and food-

induced anaphylaxis.In chapter 5, we thus addressed the cellular participation of

neutrophils and platelets in casein-induced anaphylaxis. In accordance with the

recent reports and with our novel data we show that neutrophils and platelets

significantly drop and thus participate in the pathophysiology of anaphylaxis.

Finally, in chapter 6, we aimed to provide a solution to the problems of food allergy by

developing a novel, safe immunotherapy: We propose a novel strategy to inhibit

peanut allergy hypoallergenic reduced & alkylated Ara h 2 variant and demonstrate

its safety in a mouse model of anaphylaxis.

37

4 ANTI-ACID MEDICATIONS INTERACT WITH ENDOTOXIN TO INDUCE FOOD ALLERGY TO MILK ALLERGEN CASEIN IN BALB/C MICE

Durga Krishnamurthy1, Anna Lukschal1, Philipp Starkl1, Caroline Stremnitzer1, Anna

Willensdorfer2, Susanne C Diesner1,3, Martina Mittlboeck4, Isabella Pali-Schöll1, Eva

Untersmayr1 and Erika Jensen-Jarolim§1,2

1Division of Comparative Immunology and Oncology, Department of Pathophysiology

and Allergy Research, Center of Pathophysiology, Infectiology and Immunology, 2Comparative Medicine, Messerli Research Institute of the University of Veterinary

Medicine Vienna, Medical University Vienna, University Vienna, Austria, 3Pediatrics

and Adolescent Medicine, 4Center for Medical Statistics, Informatics and Intelligent Systems, Section of Clinical Biometrics, Medical University of Vienna, Austria.

§ Correspondence: Prof. Erika Jensen-Jarolim, MD,

Comparative Medicine, Messerli Research Institute,

University of Veterinary Medicine Vienna, Medical University Vienna, and University

Vienna,

Laboratory of Comparative Immunology and Oncology,

c/o Department of Pathophysiology and Allergy Research,

Center of Pathophysiology, Infectiology and Immunology

Medical University of Vienna,

Währinger Gürtel 18-20,

1090 Vienna, Austria.

Email: erika.jensen-jarolim@meduniwien.ac.at,

Tel: +43-1-40400-5120,

Fax: +43-1-40400-6188.

(In Revision)

38

4.1 Abstract Background It has been shown in mouse models that under anti-ulcer medications

could develop allergy to orally applied food allergens, such as egg, hazelnut, or fish.

The influence of anti-ulcer medications with endotoxin contaminations in food has not

been addressed yet. We aimed to investigate this for the important milk allergen

casein.

Objective The aims of this study were thus to investigate i) whether the anti-acid

medications sucralfate (SUC) and Omeprazole (Proton-pump inhibitor; PPI) would

promote allergy to orally applied casein and ii) whether this could be enhanced or

inhibited by co-application of endotoxin (lipopolysaccharide, LPS).

Methods Mice were fed casein 9 times with or without anti-acid drugs SUC or PPI

alone or in combination with or without LPS in 2-weekly intervals. Antibody levels

were examined after 9 feedings. To investigate the in vivo relevance, mice were

challenged orally and then subjected to symptom scoring, monitoring , type I skin test

and cytokine measurements from stimulated splenocytes.

Results Our data suggest that immunizations under anti-ulcer medications synergize

with endotoxin by promoting allergen-specific IgE/IgG1 antibody titres, while the

allergen-LPS fed group resulted in IgG2b production. Among the two different anti-

medications used, PPI together with casein induced the highest food allergic

symptoms with respect to diarrhea and drop of body temperature, but no significant

skin hypersensitivity reactions. In contrast, the groups treated with both anti-acid

medications in the presence of endotoxin showed positive skin hypersensitivity, but

less anaphylactic symptoms.

Conclusions Anti-ulcer medications synergize with endotoxin on milk allergen

sensitization. However, the type of applied acid-suppression drug preferentially

induced anaphylaxis or skin hypersensitivity.

Key words food allergy, anti-acid drugs, endotoxin, sensitization, antibodies

39

4.2 Introduction Anti-acid medications are known to increase the risk of food allergy both in humans

and experimental mouse models (1-4). These anti-acids belong since long to the

most often prescribed medications for adult and infant human patients worldwide, as

well as for veterinarian patients (5), and can in the US and other countries also be

purchased over-the-counter (6). Cow’s milk allergy is one of the most common

allergy affecting 2-3% of infants and young children (7). Also in veterinarian medicine,

cow´s milk is an important problem (8). The majority of infants outgrow their cow’s

milk allergy until the age of 3 years (9). Fresh cow’s milk contains soluble whey

proteins alpha-lactalbumin, beta-lactoglobulin, and casein as major allergens.

Pasteurisation of milk leads to aggregation of alpha-lactalbumin and beta-

lactoglobulin which then are more easily taken up by Peyers´ patches and induce

specific sensitization; the same accounts for casein which already naturally exists in

micellar form (10). Anti-ulcer drugs may protect casein in an immunologically intact

form from intestinal enzyme degradation. In addition to this, presence of endotoxin

may influence allergen sensitization through the oral route (11). Similar as for

respiratory allergens, the effects of environmental endotoxin on oral sensitization may

depend on dose, timing and period of exposure (12, 13).

We hypothesized that the immunological effects of anti-ulcer drugs on oral milk

allergens might be additionally modified by endotoxin-exposure. Introducing thus a

further level of complexity, we studied the influence of the most abundantly used anti-

acid medications SUC and PPI in a setting of endotoxin co-encounter on allergic

sensitization to milk allergen casein.

40

4.3 Results Endotoxin quantification

Endotoxin content of casein was found to be 1.01 EU/ml in casein. Anti-acid medications increase casein-specific antibody titres

We tested whether the different anti-acid drugs, SUC and PPI would support oral

sensitization to milk allergen casein. Additionally, potential effects of LPS

contamination were assessed by co-application of the endotoxin with anti-acid drugs

and casein. 6-8 week old female BALB/c mice were gavaged with casein and anti-

acid drugs sucralfate (CAS/SUC), or PPI (CAS/PPI), or both drugs combined

(CAS/PPI/SUC), alternatively all combinations were gavaged with LPS

(CAS/LPS/SUC; CAS/LPS/PPI; CAS/LPS/PPI/SUC). Control groups were given

antigen alone (CAS), PPI only (PPI i.v./PBS i.g.), or SUC alone (SUC/PBS i.g.), or

were left naïve (no treatment) (Table 1); the immunization scheme is depicted in

Figure 1.

Table 1

Group Treatments with 300µl total volume/gavage;

Dosages: 1mg casein; Sucralfate 1g/5ml; LPS 20μg/mouse;

PPI 40mg (i.v. pre-treatment);

Naïve -

CAS Casein i.g.

SUC/PBS SUC, PBS i.g.

PPI/PBS PPI i.v. ,PBS i.g.

CAS/LPS Casein, LPS i.g.

CAS/PPI Casein i.g., PPI i.v.

CAS/SUC Casein, SUC i.g.

CAS/LPS/PPI Casein, LPS i.g., PPI i.v.

CAS/LPS/SUC Casein, LPS, SUC i.g.

CAS/PPI/SUC Casein, SUC i.g., PPI i.v.

CAS/LPS/PPI/SUC Casein, LPS, SUC i.g., PPI i.v.

41

Figure 1

Feeding 1mg casein/animal

Oral gavage 50mg casein/animal

day 0 14 28 42 55 70 77 84 91 113 120 127

Blood collection

Figure 1: Immunisation and sacrifice time point of BALB/c mice. Feeding

constituents and animal groups are given in Table 1. Anti-acid drugs treated groups CAS/PPI, CAS/SUC showed neither significant

formation of antigen-specific Th2 antibodies (IgG1 and IgE) nor Th1 antibodies IgG2a

and IgG2b compared to the naïve group (Fig. 2). Mice treated with CAS/LPS showed

increased values compared to naïve groups, but only IgG2b showed a statistical

significant increase (p=0.0447), whereas IgG1, IgE and IgG2a remained non

significant (p=0.0582, p=0.0983 and p=0.0679). However, mice treated with allergen

and SUC or PPI in the presence of LPS (CAS/LPS/SUC or CAS/LPS/PPI) showed

significantly elevated casein-specific IgG1 (p=0.0020; p=0.0272) and IgE (p=0.0083;

p=0.0287), IgG2a (p=0.0029; p=0.0164), IgG2b (p=0.0052; 0.0026). A combination of

all (CAS/LPS/PPI/SUC) could not further enhance this effect. Least square means

(LS-means) for the measured values and 95% confidence intervals are given in the

supplementary table 1. Measurement of casein-specific IgA levels in serum and

intestinal lavage revealed a non-significant trend of decreased IgA levels in intestinal

lavage and increased levels in serum (Fig. S1) in CAS/LPS/SUC and CAS/LPS/PPI

versus CAS mice. Remarkably, only treatment in the presence of LPS induced

specific serum IgA. When serum samples were assayed for the in vitro mast cell

degranulation capacity using beta-hexosaminidase as a degranulation marker, no

significant levels of the enzyme were measured in any of the groups (Fig. S2). Also

mMCP-1 levels did not reveal any differences (data not shown).

42

Figure 2. Allergen-specific antibody titres

Figure 2. CAS/LPS/PPI and CAS/LPS/SUC treated mouse groups show the highest allergen-specific antibody responses in ELISA. (A,B) Animals (n=6-7/group) fed with CAS/LPS/ PPI and CAS/LPS/SUC showed significant Th2 antibodies IgG1 and IgE ( P value * 0.0272, ** 0.0020, * 0.0287, ** 0.0083 respectively) as well as Th1 antibodies IgG2a and IgG2b (P value * 0.0164, 0.0293 and ** 0.0026, 0.0052)) (C, D). In contrast, groups treated with both anti-acids and LPS (CAS/LPS/PPI/SUC) did not show a further enhancement of any allergen-specific antibody levels.

43

PPI induces hypothermia associated with intestinal hypersensitivity

symptoms We further assessed the biological relevance of the antibody levels by oral

provocation tests with 50mg of casein. We monitored intestinal hypersensitivity and

hypothermic symptoms. In the CAS/PPI treated group, antigen-challenge showed

mild hypothermia and watery diarrhea 30 minutes post challenge (Fig. 3), though the

antibody levels were not significant. Groups treated with CAS/LPS, CAS/LPS/PPI

and CAS/LPS/SUC showed hypothermia. Among these groups, approximately 70%

of CAS/PPI and 40% of CAS/LPS, CAS/LPS/PPI, and CAS/LPS/SUC mice exhibited

either hypothermia or diarrhea. All groups remained unresponsive to control protein

BSA-challenge (data not shown). Myeloperoxidase (MPO) levels did not show any

significant differences between the groups showing intestinal symptoms or specific

skin reactivity, except a 2-3 fold increase in the CAS/LPS/PPI treated group (Fig S3). Figure 3. Anaphylaxis readouts

Figure 3. CAS/PPI treatments elicit highest anaphylactic symptoms after oral challenge with 50mg of casein. a) Body temperature was measured before, and at 30 & 60 minutes after the challenge. Data from the 30 minute timepoint are given. b) After the challenge, anaphylactic response was assessed by taking the following parameters: reduction in body temperature or diarrheal response. Bars indicate the relative percentage of response for each group. CAS/PPI treated group showed most confident symptoms either by diarrheal response or drop of body temperature. Milder allergic reactions were seen in groups treated with CAS/LPS, CAS/LPS/PPI, CAS/LPS/SUC. Oral challenge with control protein BSA did neither show diarrheal symptoms nor drop of body temperature in any of the groups.

44

Feeding of Casein and LPS under anti-acid drugs induces higher

skin reactivity As 50-60% of cow milk allergic patients show cutaneous reactions, we assessed the

skin sensitivity by intradermal exposure of casein and monitored for type I skin

reactivity (Fig 4). Mice treated with CAS/LPS/SUC showed statistically significant

positive skin reactions to intradermal skin challenge with casein. Despite the low

antibody levels and absence of systemic hypersensitivity reactions, CAS/LPS fed

mice showed positive skin reactions. The remaining groups showed no or minor skin

reactivity upon intradermal challenge with casein. Figure 4. Skin test

Figure 4. Skin hypersensitivity reactions to milk allergen casein evaluated by Type I skin test using Evans Blue. Animals (n= 5-7/group) were sensitized as described in M&M and intradermally challenged with stimulants (CAS/casein; OVO/Ovomucoid; phosphate buffered saline/PBS, or histamine releasing compound 48/80, as indicated

45

in the cross in the right corner) and the reaction evaluated after 20 min. A) Representative skins are shown from each group. CAS/LPS/SUC shows the highest percentage of positive skin reactions. Still significant but milder skin hypersensitivity reactions to casein were observed in CAS/LPS and CAS/LPS/PPI treated, but none of the other groups and no reactivity was observed to OVO as control allergen. B) Skin reactivity index based on colour intensity and diameter of reaction for individuals of each group was calculated as described in the material section. (P value * 0.0491 & 0.0238, ** <0.0001).

Upregulation of the Th2 cytokine IL-13 in CAS/LPS/PPI fed groups

To assess the participation of T-cell derived cytokines in the observed immune

reactions, isolated splenocytes were stimulated with casein and IL-13 and IFN-γ

levels were quantified in splenocyte supernatants (Fig. 5). IL-13 levels were

significantly increased in splenocyte supernatants of the CAS/LPS/PPI group

(p=0.0357) when compared to the other anti-acid drug treated group CAS/LPS/SUC.

IFN-γ levels were unchanged between medium and casein-stimulated splenocytes in

all groups (Fig S4). Figure 5. Splenocyte stimulation

Fig 5. IL-13 levels from splenocytes stimulated with casein were elavulated by commercial ELISA. Significant differences in IL-13 production upon casein stimulation compared to naïve group were only observed in the CAS/LPS/PPI group (P value * 0.0357).

46

4.4 Discussion It has been shown in previous studies, that anti-acid medication, sucralfate and

proton pump inhibitor increase the risk of food allergy in experimental mouse models

(2, 4, 14). Although the effect could be clearly documented, the extent of reactions so

far varied depending on the nature of antigen for unknown reasons. Our study

hypothesis was that endotoxin contamination could contribute to the capacity of food

allergens to sensitize and elicit anaphylactic and other food-allergic reactions.

Anti-acid drugs, SUC and PPI are known to elevate the gastric pH of BALB/c mouse

to pH 5.3 (2-4, 15). In this setting, the gastric enzyme pepsin is no longer activated

and proteins remain undigested. Further, acidic pH is also responsible for the release

of pancreatic enzymes such as trypsin. Therefore, the gastric pH has a decisive role

for protein degradation. We demonstrate here that this is a relevant mechanism for

transforming the digestion labile milk allergen casein into an oral allergen. Different

anti-acid drugs SUC and PPI were compared. Sucralfate previously induced Th2

responses in an OVA food allergy model (4), partly due to inhibition of digestion, but

also because of its adjuvant function being an aluminium compound (4). In addition

PPI supported Th2 responses against various allergens such as hazelnut, fish or

ovalbumin (2-4). So far, milk allergens have not been addressed in this respect.

Casein constitutes about 80% of bovine milk proteins (30g/L) (16). Casein is more

susceptible to pepsin and trypsin digestion than the soluble whey proteins, α-

lactalbumin and β-lactoglobulin. Casein exists as micellar structure in milk and

aggregated micellar structured casein is actively taken up M-cells in the peyer’s

patches (10). An observational study indicated that sensitization to milk during anti-

acid intake occurs in human patients (1). For these reasons we selected casein as a

relevant model allergen for this study.

Endotoxin is ubiquitous. The role of endotoxins on truly oral food allergen

sensitization is a controversial subject, despite the fact that systemic administration of

LPS administration prior to systemic OVA application induced a reduced an OVA-IgE

response (17). In contrast to this study, another study showed that lipopolysaccharide

(LPS) enhances Th2 response to an inhaled antigen in a TLR4-dependent manner

(13). In a food allergy model, the TLR-4 status seems to influence the Th2 response

dependent on nature of the antigen and genetic background (11). In our study, LPS

had a clear synergistic effect on casein sensitization as evaluated by formation of

allergen-specific antibodies (Fig. 2). Supportive to our study, beta-lactoglobuin, a

47

whey protein, while orally given as an emulsified protein, prevented the induction of

oral tolerance only when contaminated with LPS (18). We propose that anti-acid

medications protect the allergen degradation rendering it immunologically intact to

induce sensitization, whereas LPS acts as adjuvant.

Further, our oral provocation studies showed that the casein / anti-acid groups (SUC

and PPI) with LPS being co-applied, experienced moderate intestinal hypersensitivity

reactions, diarrheal response or drop of body temperature (Fig. 3). However, the

CAS/LPS/SUC and CAS/LPS/PPI groups showed positive skin reactions while the

CAS/LPS alone showed mild skin reaction only (Fig. 4). This seems important as

approximately 50-60% of cow’s milk allergic patients elicit cutaneous reactions (9). In

contrast, the Casein/PPI group showed the most pronounced intestinal

hypersensitivity reactions; notably, their antibody titres did not correlate with the

symptom scores (Fig. 2 and 3). To address the mechanism of anaphylaxis, also

mouse mast cell protease-1 levels (data not shown) and β-hexosaminidase release

(Fig. S2) were determined, but revealed no correlation with the intestinal

hypersensitivity reactions or skin reactivity in any of the different groups. This may

point towards a minor relevance of mast cells in the observed anaphylactic events.

In addition to IgG and IgE titres in serum, there was a trend towards elevated titres of

casein-IgA in intestinal lavage and serum samples of CAS, SUC/PBS, PPI/PBS and

CAS/LPS, CAS/LPS/SUC, CAS/LPS/PPI, CAS/LPS/PPI/SUC respectively, a pattern

opposite to IgG and IgE titres (Fig. S1). It is tempting to speculate that casein-IgA

titres in the intestinal milieu might neutralize the allergens before intercepting to the

mucosal mast cells. A recent study demonstrated that ingested allergens can be

neutralized by serum IgG and IgA antibodies and in addition, systemic IgA protects

from mast cell degranulation to ingested allergens (19).

Another recent study showed both human and mouse neutrophils induce active

systemic anaphylaxis in an FcγRIII & FcγRIV dependent manner (20). Additionally we

demonstrated recently that neutrophils participate in anaphylactic events in a mouse

model (21). When we assayed neutrophil degranulation marker MPO in this study,

we found its levels mostly insignificant (Fig. S3); however, in group CAS/LPS/PPI a

trend towards a 2-3 fold increase of MPO could be quantified when the challenge

was performed with the specific allergen, pointing towards a possible but not

dominant participation of neutrophils.

48

IL-4, IL-13, IFN-γ levels were assessed from stimulated splenocytes. Surprisingly,

none of the cytokines showed significant secretion levels, except a significant

production of IL-13 by the CAS/LPS/PPI group (Fig. 5). In groups treated with a

combination of both anti-acid drugs and LPS with casein, the levels of Th2 cytokines

were insignificant, still, diarrheal response, drop of body temperature, skin tests were

positive upon oral challenge with the specific allergen. The combination, however, did

not have any further synergistic effect. Conclusion

Our data suggest that anti-acid drugs synergize with LPS to induce an allergen-

specific antibody response to the orally given milk allergen, casein. In particular, SUC

had the strongest synergizing effect with LPS with respect to antibody levels; these

mice showed less intestinal and anaphylactic response and higher skin

hypersensitivity reactions. The highest and most reliable potential (70%) for inducing

systemic anaphylactic responses to casein had, however, treatments using casein

and PPI only, followed by synergies between LPS with SUC or PPI treatments (40%).

This is the first experimental mouse model showing a milk allergen specific-antibody

response, positive skin hypersensitivity reactions without using any mucosal

adjuvants. We propose that anti-acids together with LPS have an adjuvant potential

for oral allergens. Besides the model allergen casein, this effect may also account for

other milk proteins, especially in settings of gastrointestinal bacterial infections or

encounter of endotoxin/LPS contaminated milk products.

49

4.5 Materials and Methods Animals

6-8 week old female BALB/c mice were purchased from the Institute for Laboratory

Animal Science and Genetics (Medical University of Vienna) and treated according to

European Community rules of animal care with the permission of the Austrian

Ministry of Science (BWMF-66.009/01870-II/10b/2009). Endotoxin quantification

Endotoxin concentration in casein was assayed using Endosafe®-PTSTM (Charles

River, Germany) according to the manufacturer’s protocol. Immunization protocol of mice

Animals were grouped as described in Table 1. Animals were pre-treated with the

PPI Losec® (Astrazeneca, GmbH, Wedel, Germany) (11.6μg/mouse i.v., 24 hours, 1

hour and 15 min prior to oral feeding of the casein (Sigma, C6554).

Lipopolysaccharide (LPS, 20μg/mouse) was purchased from Sigma (L6529-1mg).

Control animals received saline.1mg of casein was absorbed on (10mg/ml in sterile

PBS solution and 100μl from this is used) sucralfate (1g/5ml suspension,Ulcogant ®,

Merck, Vienna, Austria), for 1 hour prior to oral immunization on a gel shaker, and

2mg applied per mouse per gavage using feeding needles. Immunizations were

performed in 2 weeks intervals (scheme shown in Figure 1). Measurement of antibody titers

Casein-specific IgG1, IgG2a, IgG2b, IgA and IgE serum levels were measured by

ELISA. 50µg/ml of casein was coated overnight at 4ºC blocked with TBS (Tris

buffered saline)/0.05% Tween 20 (TBST) with 1% BSA (Bovine serum albumin). The

plates were washed with TBST. Serum samples were diluted 1:10 for IgE, 1:100 for

IgG1, IgG2a, IgG2b, IgA in buffer containing 10% blocking buffer and incubated in

respective wells for 1 h at 4ºC, followed by 1 h at room temperature. Plates were

again washed and incubated with detection antibody, rat anti-mouse antibody (1:500

diluted in TBST, BD Biosciences, Vienna, Austria) for 2 hours at room temperature.

Plates were then washed again and incubated with peroxidase labelled anti-rat

50

antibody (GE Healthcare, Vienna, Austria) for 1 h at room temperature. Reaction was

developed using TMB substrate (BD Pharmingen, Vienna, Austria) and read at

optical density 450nm / 630nm.

Intestinal lavage samples were prepared to assay casein-IgA titres as described (19,

22). Oral challenges and in vivo read-out

Mice were orally challenged with 50mg of casein and anaphylactic symptoms

recorded using standard symptoms and scores. Rectal temperature was measured

before and after the challenge using digital thermometer until 60 minutes.

Anaphylaxis was assessed according to the standard symptom scores (21).

Temperature measurements, diarrheal response were monitored in a blinded fashion. Skin test

The abdomen of the mice was shaved 24 hours prior to the sacrifice. 100µl of Evans

blue (5mg/ml in saline) was injected into the tail vein of mice. Immediately after the

injection, 30µl of casein (50µg/ml in PBS), 30µl of ovomucoid (50µg/ml in PBS) as

control allergen, 30µl of PBS as negative control and 30µl of compound 48/80

(20µg/ml in PBS) as positive control were intradermally applied. After the 20 min of

monitoring, mice were killed and inner skin samples subjected to densitometric

analysis using a hand-held reflection densitometer (Vipdens, Brixen, Italy). Skin

reactivity index was calculated using the formula: densitometrical signal

intensity*(number of reactive mice/number of tested mice). Splenocyte isolation and proliferation assay

Single cell suspension was prepared from spleens of control and allergen-sensitized

mice, as previously described (21). by RBC lysis method using 70µm cell strainer

and resuspended in RPMI 1640 supplemented with 10% FBS, 1% L-glutamine, 1%

penicillin/streptomycin. 4Χ105 cells were incubated in U-bottomed 96 well plate in

duplicates and stimulated with 50µg/well in-house prepared peanut extract, medium

and 5µg/ml of Concanavalin A used as positive control. After 74 hours of incubation,

cell culture supernatants were harvested and stored at -80ºC until use.

51

Mast cell granular enzyme mMCP-1 and myeloperoxidase (MPO)

levels

Sera samples collected 1 hour after the oral gavage were stored at -80 C until use.

Mouse mast cell protease-1, a mast cell degranulation marker was assayed by

ELISA kit using sera samples collected from 1 hour time point after the oral

challenge, sera samples from eBioscience (Catalog Number: 88-7503, Vienna,

Austria). Mouse MPO levels were measured using the ELISA kit from Hycult Biotech

(Catalog Number: HK210-02). These assays were performed according to the

manufacturer’s recommendations. ß-hexosaminidase assay

To assess the degree of mast cell degranulation, β-hexosaminidase release of serum

sensitized RBL-2H3 cells was performed with sera samples, as described previously

(4). RBL-2H3 cells were cultured in RPMI supplemented with 10% fetal calf serum,

4mM L-glutamine, 2mM sodium pyruvate,10mM HEPES, 100μM β-mercaptoethanol,

1% penicillin/streptomycin at 37°C with 5% CO2. 4х104 cells/wells were plated in 96-

well round bottom plate and left for overnight incubation. Cells were sensitized with

pooled mice sera for 2 h at 37°C with 5% CO2. Cells were washed twiceusing

Tyrode’s buffer (137 mM NaCl, 2.68 mM KCl, 1.4 mM CaCl2, 1.7 mM MgCl2, 5mM D-

glucose, 10 mM HEPES, 0.42 mM Na2HPO4, 12 mM NaHCO3) at pH 7.2 and

supplemented with 0.1% BSA. Casein (100μg/ml), irrelevant control allergen,

ovomucoid and a combination of 50ng/ml PMA & 10µM A23187, as positive control

were diluted in Tyrode’s buffer and added to the wells and incubated for 30 minutes.

Tyrode’s buffer without any allergens were used as a negative control. Supernatants

were collected by centrifugation at 1000 rpm for 5 min. Cells were lysed with 0.5%

Triton X-100 for 5 min to calculate the 100% release. Supernatants were collected by

centrifugation as described earlier. Supernatants were mixed substrate buffer

containing 14.29g Na2HPO4 , 0.1M citric acid, pH 4.5 adjusted with NaOH and mixed

with the substrate 4mM p-NAG (p-Nitrophenyl-N-acetyl-β-D-glucosaminidine, Sigma)

and left for incubation for 1 h at 37°C. The reaction was stopped with glycine buffer

(200mM glycine, 200mM NaCl, pH 10.7). Then the plates were read at 405nm. The

results were calculated as percentage of total release (% degranulation =

O.D.supernatant/[O.D.supernatant + O.D.lysate]).

52

Data analysis

Data are graphically shown by scatterplots of single values within groups. A linear

mixed model was estimated, to test differences with the naive group. As every

method was applied on samples from the same mouse, the mouse factor was

included as block factor with a compound symmetry variance-covariance matrix for

repeated measurements. For multiple pairwise tests with the naive group as control a

Dunnett correction was applied. If the residuals had a right skew distribution a

logarithmic transformation was applied to the measured values plus one (as log(zero)

does not exist). Effects are described by back-transformed least square means and

corresponding 95% confidence intervals (95%CI). Heterogeneous variance

estimations are allowed and a Kenward-Roger adjustment to the degrees of freedom

was applied. Statistical calculations are performed with the statistical software SAS®

(Version 9.3; SAS Institute Inc., Cary, NC, USA). All p-values are two-sided and

P≤0.05 was considered statistically significant.

53

4.6 Acknowledgements The authors thank Sylvia Knapp and Karin Stich from the Department of Internal

Medicine 1, Division of Infectious Diseases & Tropical Medicine, Medical University

Vienna for endotoxin quantification in the allergen samples. This work was supported

by the Austrian Science Fund FWF projects, CCHD #APW01205FW (DK, CS, PS),

and SFB F4606-B19 (PS, IP-S, AL) and further by Biomed Int. R&D, Vienna. EU was

supported by the Austrian Science Fund FWF projects P21577 and P21884. The

authors declare no conflict of interests. 4.7 Author contributions

Conceived and designed the experiments: DK, AL, PS and EJJ. Performed the

experiments: DK, PS, AL, AW, CS, IP-S. Analyzed the data: DK, AL, PS, MM. Wrote

the paper: DK, EJJ. All authors reviewed and contributed to the final manuscript

version.

54

4.8 References (1) Untersmayr E, Bakos N, Scholl I, Kundi M, Roth-Walter F, Szalai K, et al. Anti-

ulcer drugs promote IgE formation toward dietary antigens in adult patients. FASEB

J. 2005 Apr;19(6):656-8.

(2) Scholl I, Untersmayr E, Bakos N, Roth-Walter F, Gleiss A, Boltz-Nitulescu G,

et al. Antiulcer drugs promote oral sensitization and hypersensitivity to hazelnut

allergens in BALB/c mice and humans. Am J Clin Nutr. 2005 Jan;81(1):154-60.

(3) Diesner SC, Knittelfelder R, Krishnamurthy D, Pali-Scholl I, Gajdzik L, Jensen-

Jarolim E, et al. Dose-dependent food allergy induction against ovalbumin under

acid-suppression: a murine food allergy model. Immunol Lett. 2008 Nov

16;121(1):45-51.

(4) Brunner R, Wallmann J, Szalai K, Karagiannis P, Altmeppen H, Riemer AB, et

al. Aluminium per se and in the anti-acid drug sucralfate promotes sensitization via

the oral route. Allergy. 2009 Jun;64(6):890-7.

(5) Papich MG. Antiulcer therapy. Vet Clin North Am Small Anim Pract. 1993

May;23(3):497-512.

(6) Anonymous. Over-the-counter omeprazole (prilosec OTC). Med Lett Drugs

Ther. 2003 Aug 4;45(1162):61-2.

(7) Kneepkens CM, Meijer Y. Clinical practice. Diagnosis and treatment of cow's

milk allergy. Eur J Pediatr. 2009 Aug;168(8):891-6.

(8) Zimmer A, Bexley J, Halliwell RE, Mueller RS. Food allergen-specific serum

IgG and IgE before and after elimination diets in allergic dogs. Vet Immunol

Immunopathol. 2011 Dec 15;144(3-4):442-7.

(9) Host A. Frequency of cow's milk allergy in childhood. Ann Allergy Asthma

Immunol. 2002 Dec;89(6 Suppl 1):33-7.

(10) Roth-Walter F, Berin MC, Arnaboldi P, Escalante CR, Dahan S, Rauch J, et al.

Pasteurization of milk proteins promotes allergic sensitization by enhancing uptake

through Peyer's patches. Allergy. 2008 Jul;63(7):882-90.

(11) Berin MC, Zheng Y, Domaradzki M, Li XM, Sampson HA. Role of TLR4 in

allergic sensitization to food proteins in mice. Allergy. 2006 Jan;61(1):64-71.

(12) Liu AH. Endotoxin exposure in allergy and asthma: reconciling a paradox. J

Allergy Clin Immunol. 2002 Mar;109(3):379-92.

55

(13) Eisenbarth SC, Piggott DA, Huleatt JW, Visintin I, Herrick CA, Bottomly K.

Lipopolysaccharide-enhanced, toll-like receptor 4-dependent T helper cell type 2

responses to inhaled antigen. J Exp Med. 2002 Dec 16;196(12):1645-51.

(14) Pali-Scholl I, Herzog R, Wallmann J, Szalai K, Brunner R, Lukschal A, et al.

Antacids and dietary supplements with an influence on the gastric pH increase the

risk for food sensitization. Clin Exp Allergy. 2010 Jul;40(7):1091-8.

(15) Untersmayr E, Scholl I, Swoboda I, Beil WJ, Forster-Waldl E, Walter F, et al.

Antacid medication inhibits digestion of dietary proteins and causes food allergy: a

fish allergy model in BALB/c mice. J Allergy Clin Immunol. 2003 Sep;112(3):616-23.

(16) Monaci LT, V. van Hengel, AJ. Anklam, E. Milk allergens, their characteristics

and their detection in food: A review. Eur Food Res Technol 2006;223:149–79.

(17) Gerhold K, Blumchen K, Bock A, Seib C, Stock P, Kallinich T, et al. Endotoxins

prevent murine IgE production, T(H)2 immune responses, and development of airway

eosinophilia but not airway hyperreactivity. J Allergy Clin Immunol. 2002

Jul;110(1):110-6.

(18) Brix S, Bovetto L, Fritsche R, Barkholt V, Frokiaer H. Immunostimulatory

potential of beta-lactoglobulin preparations: effects caused by endotoxin

contamination. J Allergy Clin Immunol. 2003 Dec;112(6):1216-22.

(19) Strait RT, Mahler A, Hogan S, Khodoun M, Shibuya A, Finkelman FD.

Ingested allergens must be absorbed systemically to induce systemic anaphylaxis. J

Allergy Clin Immunol. 2011 Apr;127(4):982-9 e1.

(20) Jonsson F, Mancardi DA, Kita Y, Karasuyama H, Iannascoli B, Van Rooijen N,

et al. Mouse and human neutrophils induce anaphylaxis. J Clin Invest. 2011

Apr;121(4):1484-96.

(21) Krishnamurthy D, Starkl P, Szalai K, Roth-Walter F, Diesner SC, Mittlboeck M,

et al. Monitoring neutrophils and platelets during casein-induced anaphylaxis in an

experimental BALB/c mouse model. Clin Exp Allergy. 2012 Jul;42(7):1119-28.

(22) Grewal HM, Karlsen TH, Vetvik H, Ahren C, Gjessing HK, Sommerfelt H, et al.

Measurement of specific IgA in faecal extracts and intestinal lavage fluid for

monitoring of mucosal immune responses. J Immunol Methods. 2000 May 26;239(1-

2):53-62.

56

% o

f Deg

ranu

latio

n

4.9 Supplementary information Figure S1. Casein-IgA levels in intestinal lavage and serum samples

Fig. S1. Intestinal lavages (a) and sera of immunized mice (b) were measured for casein-specific IgA titres by ELISA. Groups treated with CAS/LPS/PPI, CAS/LPS/SUC, CAS/PPI/SUC and CAS/LPS/PPI/SUC have decreased levels of IgA in intestinal lavage compared to other groups. In contrast, they show increased levels of IgA in serum.

Figure S2. β-hexosaminidase release assay

RBL assay

80

60

40

20

0

Fig S2. ELISA result of β-hexosaminidase release assay using serum pools of mice treated as given at the x-axis, for sensitizing RBL cells. Casein was used as a specific allergen for triggering. Y-axis indicates the relative amounts of β- hexosaminidase released by cells. Results were calculated in relation to the percentage of total release (% degranulation = O.D.supernatant/[O.D.supernatant + O.D.lysate]).

57

pg/m

l

pg/m

l

Figure S3. Quantification of myeloperoxidase (MPO) in mouse sera.

Fig. S3. MPO levels in individual sera of mice determined by ELISA, without significant differences between the groups. Mice were treated as given at the x-axis.

Figure S4. IFNγ levels from stimulated mouse splenocytes.

IFNγ

100γ0 Medium stimulated splenocytes

1500 Casein stimulated splenocytes

800

600

1000

400

200

500

0 0

Fig S4. IFNγ levels determined in supernatants from stimulated splenocytes of mouse groups. Casein stimulation of splenocytes induces no significant IFNγ levels comparing between medium and casein stimulation.

58

Supplementary table 1

Parameter Group LS-means 95% confidence interval

IgG1 Cas LPS 0.4088 0.16646 0.9417

IgG1 Cas LPS PPI 0.6031 0.3015 1.5667

IgG1 Cas LPS PPI Suc 0.4543 0.1596 1.1395

IgG1 Cas LPS Suc 0.5897 0.41481 1.2988

IgG1 Cas PPI 0.04708 -0.00688 0.1064

IgG1 Cas PPI Suc 0.1245 -0.0027 0.2858

IgG1 Cas Suc 0.0648 -0.03368 0.1781

IgG1 Casein 0.1068 0.08087 0.3472

IgG1 Naïve 0.01764 0.01322 0.0224

IgE Cas LPS 0.1232 0.04164 0.2282

IgE Cas LPS PPI 0.2264 0.104 0.4246

IgE Cas LPS PPI Suc 0.1235 0.04658 0.2231

IgE Cas LPS Suc 0.1916 0.10575 0.3266

IgE Cas PPI 0.01833 0.00237 0.0349

IgE Cas PPI Suc 0.05066 0.00051 0.1061

IgE Cas Suc 0.04017 -0.00718 0.0915

IgE Casein 0.0613 -0.03277 0.1687

IgE Naïve 0.007536 0.00579 0.0093

IgG2a Cas LPS 0.3622 0.11701 0.8473

IgG2a Cas LPS PPI 0.4397 0.20704 0.9961

IgG2a Cas LPS PPI Suc 0.4416 0.18165 1.0468

IgG2a Cas LPS Suc 0.4089 0.17044 0.9356

IgG2a Cas PPI 0.08855 0.03445 0.154

IgG2a Cas PPI Suc 0.04321 -0.01141 0.1028

IgG2a Cas Suc 0.07598 0.02153 0.1396

IgG2a Casein 0.00801 -0.04995 0.0696

IgG2a Naïve -0.00096 -0.05843 0.0600

IgG2b Cas LPS 0.5026 0.22196 1.2363

IgG2b Cas LPS PPI 0.694 0.47971 1.708

IgG2b Cas LPS PPI Suc 0.6167 0.33239 1.5765

IgG2b Cas LPS Suc 0.6502 0.41619 1.5918

IgG2b Cas PPI 0.1665 0.0302 0.3543

IgG2b Cas PPI Suc 0.02757 -0.10344 0.1786

IgG2b Cas Suc 0.1607 0.02419 0.3464

IgG2b Casein 0.01331 -0.1261 0.1752

IgG2b Naïve 0.002878 -0.13517 0.1630

59

doi: 10.1111/j.1365-2222.2012.04012.x Clinical & Experimental Allergy, 42, 1119–1128 © 2012 Blackwell Publishing Ltd

ORIGINAL ARTICLE Experimental Models of Allergic Disease

Monitoring neutrophils and platelets during casein-induced anaphylaxis in an experimental BALB/c mouse model D. Krishnamurthy1, P. Starkl1, K. Szalai2, F. Roth-Walter2, S. C. Diesner1,3, M. Mittlboeck4, C. Mannhalter5, E. Untersmayr1 and E. Jensen-Jarolim1,2 1Division of Comparative Immunology and Oncology, Department of Pathophysiology and Allergy Research, Center of Pathophysiology, Infectiology and Immunology, Vienna, Austria, 2Messerli Research Institute of the University of Veterinary Medicine, Vienna, Medical University Vienna, and University Vienna, Austria, 3Pediatrics and Adolescent Medicine, Medical University of Vienna, Vienna, Austria, 4Center for Medical Statistics, Informatics and Intelligent Systems, Section of Clinical Biometrics, Medical University of Vienna, Vienna, Austria and 5Department for Laboratory Medicine, Medical University of Vienna, and University of Vienna, Austria

Clinical & Experimental

Allergy

Correspondence: Prof. Erika Jensen-Jarolim, Messerli Research Institute of the University of Veterinary Medicine, Vienna, Medical University Vienna, and University Vienna, Austria, Office and Lab: Division of Comparative Immunology and Oncology, Department of Pathophysiology and Allergy Research, Center of Pathophysiology, Infectiology and Immunology Medical University of Vienna, Wa hringer Gu rtel 18-20, Vienna 1090, Austria. E-mail: erika.jensen-jarolim@ meduniwien.ac.at Cite this as: D. Krishnamurthy, P. Starkl, K. Szalai, F. Roth-Walter, S. C. Diesner, M. Mittlboeck, C. Mannhalter, E. Untersmayr and E. Jensen-Jarolim, Clinical & Experimental Allergy, 2012 (42) 1119–1128.

Summary Background With respect to the cellular players, mast cells and basophils have been well studied in experimental murine systemic anaphylaxis models, but the role of neutrophils and platelets is not fully understood today. Objective We tested the hypothesis that neutrophils and platelets might participate in an antigen-induced anaphylaxis model. Methods BALB/c mice were sensitized intraperitoneally with alum-adsorbed casein. A per- iod of 2 weeks later, mice were challenged with 100 lg casein intravenously and immedi- ate hypersensitivity reactions were assessed by rectal temperature measurements and monitoring the physical activity. Subsequently, leucocytes were counted in the peripheral blood as well as quantified in situ in typical shock organs like lung, liver and spleen, heart and kidney. Results Mice sensitized with casein showed casein-specific IgG1, IgE, and IgG2a. When sensitized mice were specifically challenged with casein they developed immediate hyper- sensitivity reactions including drop of temperature and reduced activity. Furthermore, pronounced peripheral neutropenia and reduced platelet counts correlated with the sever- ity of the hypersensitivity reactions. In the histological analyses of collected tissues we observed lung interstitial neutrophilia using Gr-1 staining. These events occurred specifi- cally in mice sensitized and challenged with casein, in contrast to control groups. Conclusions On the basis of our data we suggest that in addition to mast cells and basophils, neutrophils and platelets participate in the anaphylactic response in this BALB/ c mouse model. Platelet and neutrophils expressing relevant immunoglobulin receptors may therefore have a synergistic effect with allergen specific IgE as well as IgG antibodies in food-induced anaphylaxis. We suggest that management of these cells could be of clinical importance to handle anaphylaxis.

Keywords anaphylaxis, casein, food allergy, IgE-independent mechanism, inflammation, neutrophils platelets Submitted 10 June 2011; revised 03 February 2012; accepted 06 February 2012

Introduction

Immunological anaphylaxis may occur in highly sensi- tive individuals when exposed to the specific allergens [1]. In mice, immune-mediated anaphylaxis has been explained by two different mechanisms [2]. The classi- cal pathway involves IgE-sensitized mast cells releasing the vasoactive mediator histamine, and granular

enzymes such as mucosal mouse mast cell protease-1 and ß-chymase upon allergen cross-linking of the sur- face bound IgE [3–6]. Similar clinical symptoms have been also described in association with the alternative pathway of mouse systemic anaphylaxis, being medi- ated through platelet activating factor (PAF), secretion by macrophages and/or basophils expressing low-affin- ity IgG receptor FccRIII [7–9].

60

1120 D. Krishnamurthy et al

The involvement of mast cells, macrophages and ba-

sophils in systemic anaphylaxis has thus been studied intensively in both active and passive mouse models. Important for our study, recent work demonstrated that mouse and human neutrophils induce anaphylaxis in a mouse strain lacking all activating receptors for IgG and IgE. The mechanism was shown to be dependent on PAF, FccRIII and newly reported FccRIV [10]. This could par- tially explain why in some types of allergen-induced anaphylaxis, such as in severe drug adverse reactions, IgE diagnosis is extremely difficult, leading the classifi- cation of these reactions in ‘idiopathic anaphylaxis’ [11]. Much focus was put on platelets in earlier work, suggest- ing that they play a key role in anaphylaxis. In active systemic anaphylaxis for instance, it is well known that disseminated intravascular coagulation (DIC syndrome) leads to thrombocytopenia, and activation of the coagu- lation cascade with massive congestion; further, cellular infiltration in pulmonary interstitium and haemorrhagia in renal medullae as well as congestion in spleen and liver were observed [12]. Platelets express the high-affin- ity-IgE receptor FceRI. Allergen-specific-IgE cross-link- ing causes cytoxicity and active anaphylaxis in a rat model, was shown to be associated with IgE-dependent, antigen-mediated aggregation in microvasculature [13]. Platelets express various receptors that are of interest for pharmacological targeting with respect to allergic reac- tions, among them are alpha-adreno receptors, beta-ad- reno receptors and receptors for histamine, serotonin, prostacyclin and ADP [14]. Vice versa, the effects of ana- phylaxis on platelet function have been described [15].

In accordance with these numerous arguments for the participation of neutrophils and platelets in anaphy- laxis, we addressed the role of these non-classical effec- tor cells in this study in a typical BALB/c mouse model using casein as paradigm for an important food aller- gen. Our hypothesis is that the compilation of knowl- edge about the participation of neutrophils and platelets could impact the management of anaphylaxis.

Materials and methods

2 weeks interval, with 100 lg of alum-adsorbed Casein (Sigma, Vienna, Austria) per mouse, as depicted in the scheme (supplementary Fig. S1a). All groups contained eight animals each. A control group received phosphate- buffered saline (PBS). Anaphylaxis was induced by i.v. injecting 100 lg casein/mouse and rectal temperature was assessed using digital thermometer 20 min after the challenge. Anaphylaxis was classified according to the standard symptom scores as previously described [16]. Temperature measurements and symptom scoring were performed in a blinded fashion. All experiments were per- formed twice for reproducibility. Analysis on end-time point includes allergen challenge, rectal temperature mea- surements, monitoring the physical activity, peripheral leucocyte counts, in vitro splenocyte stimulation and his- tological analysis of lung, spleen, liver, heart and kidney. Measurement of allergen-specific antibodies

Casein-specific IgG1, IgG2a, and IgE serum levels were measured using ELISA. Microtitre plates (Maxisorp, Nunc, Roskilde, Denmark) were coated with casein (5 lg/ well in 100 ll) in 50 mM NaHCO3 pH 9.6) overnight at 4° C, blocked with Tris-buffered saline with 0.05% Tween 20 (TBST) and 1% Bovine serum albumin (BSA) at room temperature. The plates were washed with TBST. Serum samples were diluted 1 : 10 for IgE, 1 : 100 for IgG1 and IgG2a and incubated in respective wells for 1 h at 4°C. Isotype standard antibodies (BD Pharmingen, Schwechat, Austria) were diluted in series. Isotype-specific rat anti- mouse antibodies (BD Pharmingen) were 1 : 1000 diluted in TBST/0.1% BSA (RT, 2 h). Plates were again washed and incubated with peroxidase labelled rat anti-mouse IgG1, IgG2a and IgE (GE Healthcare, Buckinghamshire, UK) 1 : 2000 (RT, 2 h). Plates were developed using 3,3′,5,5′-Tetramethylbenzidine (TMB, BD Bioscience, Vienna, Austria) substrate and optical density was measured at 450–630 nm using microplate reader. Total blood cell counts

Peripheral leucocyte counts were performed using ®

Animals CELL-DYN (Abbott Diagn, Wiesbaden, Germany) 3500

For this study, 6 to 8-week-old female BALB/c mice were obtained from the Institute for Laboratory Animal Science and Genetics (Medical University of Vienna) and treated according to European Community rules of animal care with the permission of the Austrian Minis- try of Science (BWMF-66009/0123-II/10b/2008).

Casein-induced systemic anaphylaxis model

A casein-specific BALB/c mouse anaphylaxis model was established by intraperitoneally injecting twice, in

at the Institute of Biomedical Research, Medical Univer- sity of Vienna. Mice blood was collected in potassium EDTA-tubes and subjected to automated peripheral leu- cocyte cell counts. Baseline leucocyte counts were acquired 1 week before the anaphylaxis experiments and compared with blood collected 40 min after the allergen challenge. Spleen cell culture and cytokine measurements

Control groups or allergen-sensitized mouse groups (each n = 8) were divided and mice were either in vivo

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1119–1128

61

Platelets and neutrophils in anaphylaxis 1121 allergen-challenged (n = 4). Spleens wer

(n = 4)

e excised

or

under

saline-challenged sterile conditions

lar Devices). The results were calculated as percentage of total release [% degranulation = O.D.supernatant/(O.

from all mice. Single cell suspension was prepared by RBC lysis method and stimulated as previously described [17]. Following 72 h of incubation, cell cul- ture supernatants were harvested and stored at -80°C until use.

The harvested splenocyte supernatants were subjected to the quantification of mouse IL-4, IL-5, IL-10 and IFN-c using ELISA kit (Bendermed, Vienna, Austria) according to the manufacturer’s protocol.

Immunohistochemistry

Spleen, liver, kidney, heart and lung were excised and fixed in buffered 4% paraformaldehyde following par- affin embedding using a standard protocol. Spleen, lung, and liver sections from control and allergic mice were deparafinised, rehydrated and Haematoxylin and Eosin stained. Moreover, they were also stained for CD41 (clone ebioMwreg30; ebioscience, Vienna, Aus- tria) and Gr-1 (Vienna, Austria, clone RB6-8C5; BD PharmingenTM). Briefly 5 lm sections were deparafin- ised using xylol and rehydrated using ethanol descend- ing gradient. Deparafinised lung sections were fixed and endogenous tissue peroxidase activity was quenched by 3% hydrogen peroxide and Gr-1 stained as previously described [18]. The sections were analysed using light microscope and staining quantification was performed using HistoQuest version 2.02.0252, tissue analysis software from TissueGnostics, Vienna, Austria.

ß-hexosaminidase assay

C1.MC/C57.1 (C57) mouse mast cells were kindly pro- vided by Prof. Stephen Galli, Stanford University School of Medicine [19]. C57 cells were washed twice with PBS and seeded in 96well plates, 2 9 104 cells/ well. Mast cells were sensitized overnight with 1 : 10 diluted, pooled mouse sera. Excess IgE was removed by washing twice with Tyrode’s buffer (100 mM HEPES, 130 mM NaCl, 1.8 mM CaCl2, 5 mM KCl, 2 mM MgCl2, 5.5 mM Glucose, 1 g/L BSA; pH 7.4). Next, cells were stimulated with 10 lg/mL of casein. A combination of 25 ng/mL PMA and 5 lM compound A23187 (both from Sigma) diluted in Tyrode’s buffer and incubated for 1 h at 37°C. Supernatants of cells and lysates of the corresponding centrifuged cells (by 0.1% Triton X-100 in Tyrode’s buffer) were harvested and incubated with 4 mM p-Nitrophenyl-N-acetyl-ß-D-glucosaminide (Sigma) in Na-phosphate/citrate buffer, pH 4.5 for 1 h at 37°C. The reaction was stopped by addition of 0.2 mM Glycine pH 10.7. ß-hexosaminidase content was then analysed by absorbance measurement at 405 nm using a SpectraMax microplate reader (Molecu-

D.supernatant + O.D.lysate)]. Quantification of fibrinogen levels

Sera samples were analysed for fibrinogen levels according to the manufacturer protocol using the kit AssayMax Mouse fibrinogen (FBG) ELISA kit from LOXO GmbH, Dossenheim, Germany. The sensitivity of the assay is 0.625 lg/mL. Data analysis

Data are graphically shown by scatterplots of single values within groups. This gives full information about the distribution of data (mean/median, spread and potential outliers) for small groups and enables easy visual comparison. Data were expressed as mean ± sem in case of normally distributed data. Group differences for normally distributed data were modelled by analysis of variance taking repetitions into account. Heterogene- ity was addressed by a degrees-of-freedom adjustment by Kenward and Roger. For mIL-4 CAS2 was compared to the two CAS1 groups and an adjustment for multiple comparisons was made by Dunnett’s method. Statistical comparisons between groups in mouse experiments with non-normally distributed data were performed by the non-parametric Wilcoxon’s rank-sum test for exper- iments without repetitions and by vanElteren’s test for experiments with a repetition of the experiment, that is a stratified version of the Wilcoxon rank-sum test. Cor- relations between continuous data were assessed by Spearman’s rank order correlation coefficient. All statis- tical calculations and graphs were made by the software GraphPad Prism 4 (La Jolla, California) and SAS (©SAS Institute Inc., Version 9.2, Cary, NC, USA). All P-values given are two-sided and P-values < 0.05 were consid- ered statistically significant. Results Assessment of the specific and functional sensitization

Mice systemically immunized with casein according to the protocol given in supplementary Fig. S1b-d showed higher levels of allergen specific-IgG1 (mean ± sem: 41.5 ± 1.1 lg/mL), IgE (mean ± sem: 7.3 ± 0.32 lg/mL) and IgG2a (mean ± sem: 0.024 ± 0.001 lg/mL) in ELISA than control groups, which did not develop casein specific antibodies. IgG1 was the predominant is- otype. To assess the biological relevance of the anti- body titres in the sensitized groups, we performed a degranulation assay using C57 mouse mast cells and monitored the ß-hexosaminidase release in vitro. Casein

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1119–1128

62

1122 D. Krishnamurthy et al

stimulation induced enhanced ß-hexosaminidase release when C57 cells were sensitized with pooled sera from casein-sensitized animals as compared to control group sera (supplementary Fig. S1e).

Furthermore, we assessed the effector potential of the induced casein-specific antibodies. All groups were challenged i.v. using 100 lg casein and monitored for anaphylactic symptoms (physical activity and rectal temperature) for 20 min. All casein-immunized mice developed hypothermia and symptoms such as scratch- ing, mouth swelling and laboured respiration upon allergen challenge (Fig. 1).

Anaphylactic mice display acute peripheral neutropenia and neutrophil influx into lungs

Peripheral leucocyte cells were counted 1 week before and 40 min after the allergen challenge and compared to baseline peripheral counts in na ıve mice. In casein- sensitized mice (CAS), neutrophils in the circulation were significantly decreased in casein-challenged (CAS2) compared to saline (CAS1) challenged group. In contrast, non-allergic control animals (PBS2) showed increased peripheral neutrophil counts 40 min after i.v. allergen challenge compared to PBS1 (PBS-sensitized and saline-challenged) (Fig. 2a).

Migration of animals neutrophils to peripheral organs would explain the neutropenia observed in specifically challenged mice. We investigated different organs by analysis and could observe an accumulation of Gr-1+

neutrophils in lung interstitium of the casein-chal- lenged immunized mice (Fig. 3a) accompanied by pul- monary congestion. Gr-1 staining on lung sections was quantified by HistoQuest analysis. In anaphylactic mice (CAS2), a significant increase in Gr-1 staining com-

pared to the controls was observed (Fig. 3b) (P-value 0.0079).

Furthermore, we observed significant thrombocytope- nia in casein-challenged immunized mice (CAS2) com- pared to non-allergic control groups (CAS1; Fig. 2b) along with reduced body temperature. Basophil num- bers were not statistically significant between CAS1 and CAS2 (Fig. 2d). Levels of casein-specific IgG1, IgE, and IgG2a did not correlate with neutrophil and platelet numbers analysed using Spearman correlation test.

In addition to the lower peripheral neutrophil and platelet numbers we also observed a statistically signifi- cant decrease in peripheral red blood cells in anaphy- lactic mice (CAS2) compared with PBS-challenged animals (CAS1); (Fig. 2c). Thrombi in lung, liver, and heart could be visualized by H&E staining only in the severely affected mice (supplementary Fig. S2), but not in control animals. Splenocytes of allergen-sensitized, allergen-challenged anaphylactic mice release large amounts of cytokines

To assess possible cytokine participation during the anaphylactic reaction we allergen-challenged 4/8 of the casein allergic mice with allergen and kept 4/8 of each group with saline and analysed the response of isolated spleen cells. We characterized the T cell cytokine response from cultured splenocytes after 72 h of in vi- tro stimulation with casein, Concanavalin A or culture medium. Spleen cells of casein-challenged immunized mice released increased levels of IL-4, IL-5, IFN-c and IL-10 as compared to saline-challenged casein-immu- nized mice, which resembled or surmounted the levels detected after stimulation with non-specific mitogen ConA (Fig. 4). There were relatively lower amounts of

Fig. 1. Assessing the allergic symptoms and body temperature. Mice were sensitized with casein (100 lg per dose) or phosphate-buffered saline (PBS) 2 times at biweekly intervals using Alum as Th2 adjuvant to induce specific hypersensitivity. On day 42 mice were challenged by intrave- nous injection of specific allergen or saline and typical anaphylaxis readouts were taken. (a) Rectal thermometry. i.v. casein challenge induces hypothermia in casein-sensitized mice, whereas the saline challenged mice remain unchanged. Casein-immunized and casein-challenged (CAS2) mice elicited anaphylactic symptoms assessed by blinded observer and by measuring rectal temperature. (b) Anaphylactic symptom score. Groups were assessed in a blinded fashion for anaphylactic symptoms by observing standard hypersensitivity scores. Casein sensitized and challenged (CAS2) mice showed allergic symptoms indicating the effector potential of allergen specific antibody titres. PBS1: PBS-sensitized and saline- challenged; PBS2: PBS-sensitized and casein-challenged; CAS1: Casein-sensitized and saline-challenged.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1119–1128

63

Platelets and neutrophils in anaphylaxis 1123

Fig. 2. Neutrophils, platelets and RBC counts significantly decreases from circulation. Mice sensitized with casein or phosphate-buffered saline (PBS) using Alum as Th2 adjuvant, were challenged by intravenous injection of specific allergen or saline. Blood was collected 40 min after the challenge from the tail vein in potassium EDTA-tubes and subjected to automated peripheral leucocyte cell counts. Leucocyte counts were com- pared to baseline levels acquired 1 week before the anaphylaxis experiments. (a) Neutrophil numbers in peripheral blood decrease during anaphy- laxis: Casein-sensitized & casein i.v. (CAS2) challenged mice show a statistically significant reduction (P = 0.0080). (b) Allergen challenge reduces platelet numbers in circulation of immunized mice: Casein sensitized (CAS1) and casein i.v. (CAS2) challenged mice show a statistically significant reduction (P = 0.0011). (c) RBC numbers decreased from anaphylactic mice: Casein sensitized (CAS1) and casein i.v. challenged (CAS2) mice show a statistically significant reduction (P = 0.0011). (d) No differences in basophil numbers are seen between the groups: Casein sensitized (CAS1) and casein i.v. challenged (CAS2) mice do not show a statistically significant difference (P = 1.0000). VanElteren test was used for Casein group comparisons. PBS1: PBS-sensitized and saline-challenged; PBS2: PBS-sensitized and casein-challenged.

IL-4 and IFN-c detectable in splenocyte supernatants from saline-challenged casein-immunized mice. Spleno- cytes from control mice being in vivo challenged with casein showed some, but significantly less production of cytokines in vitro.

Discussion

In addition to the well defined IgE associated mecha- nisms, the consideration of potential roles for non-clas- sical allergy effector cells and IgE-independent mechanisms in systemic anaphylaxis may be important. IgG-dependent anaphylaxis usually requires higher doses of antigen as compared with IgE mediated reac- tions [5], but a recent study using a passive model of anaphylaxis showed that IgG1-dependent anaphylaxis can be induced by limited amounts of complexed anti- gen and antibody [20]. In our study, we show that besides specific IgE, predominantly antigen-specific IgG1 was induced in BALB/c mice upon i.p. allergen sensitization. We further observed that peripheral plate- let and neutrophil numbers become significantly reduced in the systemic reaction. This might be the key observation associated with anaphylaxis in our model as the reports on the contributions of neutrophils and platelets to anaphylaxis steadily increase. Circulating

IgG1 may form immune complexes with the antigen upon challenge and act on FccRIII expressed by various circulating leucocytes including neutrophils or tissue resident mast cells, thereby rendering the release of inflammatory mediators [21]. It was recently demon- strated in mice lacking all activating receptors of IgG and IgE that anaphylaxis could still be induced in a neutrophil-derived PAF and FccRIV dependent pathway [10]. Notably, FccRIV binds not only IgG, but also acts as low-affinity IgE receptor in mice [22], whereas on human neutrophils the expression of the high affinity receptor FceRI itself has been demonstrated [23].

The decrease in neutrophils and platelets from blood was accompanied by an accumulation of neutrophils in pulmonary interstitium. These observations are new and to the best of our knowledge no evidence for correla- tion of neutrophils cooperating with thrombocytes in anaphylaxis in human subjects has been reported so far. It was surprising to note that i.v. casein-injection into non-immunized mice was sufficient enough to induce twofold increase in neutrophil numbers. This observation is supported by reports on casein as chemo- tactic factor for neutrophils [24, 25]. The direct partici- pation of platelets in systemic anaphylaxis has been shown in human subjects as well as in rabbit and rat models [4, 13, 26, 27]. Despite reports on support of

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1119–1128

64

1124 D. Krishnamurthy et al

Fig. 3. (a) Lung Neutrophilia in anaphylactic mice. Lungs were collected from mice being challenged with specific allergen or control. After stain- ing, numbers of Gr-1+ neutrophils were evaluated using the TissueFAXs technology. Neutropenia was associated with lung neutrophilia only in anaphylactic mice associated with congested lung capillaries, whereas saline and casein-challenged saline group remain unchanged and showed no characteristic anaphylactic symptoms. (1) phosphate-buffered saline (PBS)-sensitized and saline-challenged (PBS1), (2) PBS-sensitized and casein-challenged (PBS2), (3) Casein-sensitized and saline-challenged (CAS1), (4) Casein-sensitized and casein-challenged mice (CAS2), and (5) Higher magnification of the Gr-1 staining of the lung section 4 (b) Tissue FAXs- Histogram analysis. Lung neutrophilia was quantified using TissueFAXs, by Histoquest software. Lung tissue of anaphylactic mice (CAS2) showed remarkable infiltration of Gr-1+ neutrophils compared to saline challenged casein-immunized mice (CAS1) (P = 0.0079; Wilcoxon’s rank sum test).

induction and maintenance of inflammatory immune responses by platelets, a direct role of platelets in mouse anaphylaxis has not been shown so far [28–32]. In contrast to the previous mouse model of anaphy- laxis, we observed an accumulation of platelets in lungs and liver upon specific allergen challenge. Interestingly, platelet degranulation was reported to occur even before that of mast cells or basophils and might there- fore contribute to the very early-phase of anaphylaxis [33]. It is known that fibrinogen levels are significantly reduced during DIC in an active systemic anaphylaxis mouse model [12]. Taking this parameter into consider- ation, we observed reduction of serum fibrinogen levels at time point 60 min in an independent, but similar mouse model of anaphylaxis using peanut allergen Ara

h 2 [data not shown], pointing indeed towards DIC occurrence. The late measurement time point of 40 min after allergen restricts our data interpretation as we cannot exclude that drop of platelets could be a sec- ondary effect caused by the inflammatory and vasoac- tive mediators.

Both IL-4 and IL-13 enhance vascular permeability and anaphylaxis in mice [34]. In accordance, we observed dramatically higher production of IL-4, IFN-c, IL-5, and IL-10 by in vitro stimulated splenocytes of casein-sensitized mice. This cytokine pattern is neither biased towards Th1 nor Th2 and resembles a cytokine storm which may cause endothelial injury and is asso- ciated with multiple organ dysfunction syndrome, espe- cially in the early-phase of systemic inflammation [35].

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1119–1128

65

Platelets and neutrophils in anaphylaxis 1125

Fig. 4. Allergen stimulated splenocytes shows dominant Th2 phenotype with associated Th1 cytokine production. The in vitro cytokine production of splenocytes from mice being hypersensitized and challenged by specific allergen or controls was evaluated. In vitro with casein (Cas) stimulated splenocytes, derived from casein-sensitized/casein challenged (CAS2) mice, showed significantly higher levels of (a) IL-4, (b) IL-5, (d) IL-10, and (c) IFN-c as compared to casein stimulated splenocytes derived from casein-sensitized/saline-challenged (CAS1) mice (P < 0.0001 for all 4 cyto- kines). Although being remarkably increased as compared to splenocytes derived from phosphate-buffered saline (PBS) sensitized/saline challenged (PBS1) mice, the release of IL-4 by saline stimulated splenocytes of CAS1 mice was still significantly lower than by casein stimulated splenocytes derived from CAS2 mice (P < 0.0001, Dunnett adjustment for multiple comparisons). X-axis labels indicate the sensitization and in vivo challenge regimen, the substances used for in vitro stimulation of splenocytes are shown below the axis. The statistical calculations are based on an analysis of variance. PBS2: PBS-sensitized and casein-challenged. Con A: Concanavalin A.

Interestingly, we observed substantially reduced RBC counts upon anaphylaxis in mice. RBCs have been recently demonstrated to cause lung leucocyte infiltra- tion by producing hydrogen peroxide, thereby partially contributing to hypoxia-induced inflammation and impairment of the organ function [36]. We show in our anaphylactic mouse model that Gr-1+ neutrophils infil- trate in lung associated with thrombi, possibly contrib- uting to RBC-induced hypoxemia associated symptoms. Furthermore, RBC adhesion to activated platelets and activated neutrophils has been previously reported to cause thrombosis in settings of lowered blood flow [37], especially in hypoxia [38] and increased haematocrit [34]. This effect was specifically dependent on interac- tion via glycoprotein VI expressed by activated throm- bocytes, and it was further pronounced by fibrin.

Conclusion

On the basis of the collected histological evidence com- bined with the observed lowered blood cell counts we assume that the thrombi observed in the anaphylactic state consist of aggregated leucocytes, platelets and

erythrocytes. Figure 5 illustrates the concept of the inter- play between platelets, neutrophils, RBCs and soluble factors in allergen-induced anaphylaxis based on the literature and our own data. However, because of the restriction of our experimental study, we are not able to draw a conclusion whether these cells play an active role or possibly represent a secondary effect.

We demonstrate in this study that besides clotting phenomena, neutrophils and platelets redistribute dur- ing anaphylaxis, adhere to the vasculature, associated with significant reduction of these cells from the circu- lation. On the basis of the presented data we propose that monitoring of neutrophil and platelet activation during the systemic inflammatory episodes as well as indirect measurement of their accumulation in different organs might be worth monitoring to improve management of anaphylaxis. Acknowledgements

The authors thank Thomas Perkman from the Depart- ment of Medical and Chemical Laboratory Diagnostics, Ingrid Raab from Department of Clinical Pathology and

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1119–1128

66

1126 D. Krishnamurthy et al

(a) (b)

(c)

Fig. 5. Proposed model of molecular and cellular mechanisms during acute inflammation. (a) Human and/or mouse neutrophils express a panel of immune receptors including FccRIII (binds complexed IgG1), FccRIV (binds IgG2 and IgG-complexed IgE), FceRI (IgE), CD23 (IgE), and P-selectin glycoprotein ligand-1 (PSGL-1). Upon encounter of the specific antigen, IgG and IgE antibodies bound to the respective receptors trigger neu- trophils to release myeloperoxidase (MPO) and platelet activating factor (PAF). In parallel, anaphylaxis-associated hypoxia leads to H2O2 release by erythrocytes which acts as chemoattractant for neutrophils [38]. (b) Platelets constitutively express FceRI and CD23 (associated with IgE endo- cytosis and storage). Neutrophil-derived MPO and PAF pre-activate platelets. Allergen cross-linking of FceRI bound IgE on platelets this leads to release of mediators, such as 5-hydroxytryptamine (5-HT) antigen complexes may activate and aggregate platelets as well as induce the subse- quent release of 5-HT [33]. (c) The anaphylaxis-associated hypoxic condition leads to P-selectin (P-sel) exposure by activated endothelial cells, leading to platelet aggregation via PSGL-1 which is further stabilized by von Willebrand factor (vWF) on activated endothelial cells [39]. [The par- ticipation of vWF and CD41 platelets in thrombi observed in shock-organs lung and liver in our anaphylactic mice is illustrated in supplementary Fig. S3.] Further, also highly activated, aggregated platelets express P-selectin, vice versa enabling interaction with neutrophils via PSGL-1. In addition, hypoxia associated low shear rate [38], fibrin formation [37] and increased haematocrit [34] enhance specific erythrocyte-platelet-aggre- gation via glycoprotein VI (GPVI). These mechanisms ultimately lead to formation of large vascular thrombi consisting of platelets, neutrophils and erythrocytes.

Marianne Leisser from Center for Brain Research for their technical guidance and Maria Wies-Pro bstl from Institute of Biomedical Research for the blood cell counts, Radu Rogojanu from TissueGnostics, Sarah Schwarz from the Department of Clinical Urology for tissue analysis using HistoQuest software and Prof. Sylvia Knapp for sharing the Gr-1 staining protocol. We further would like to thank Prof. Stephen J. Galli for providing C57 mast cells, Erika Bajna for assisting in imaging the histology slides and members of the

Division 1 at the Department of Pathophysiology and Allergy Research for helpful discussions. This work was supported by the CCHD PhD programme of the Austrian Science Fund FWF, project #APW01205FW and #SFB F 4606-B19. PS was supported by SFB F1808-B013. KS was supported by Biomedical International R+D, Vienna, Austria.

Conflict of interest: The authors declare no conflict of interests.

References

1 Johansson SG, Bieber T, Dahl R et al. Revised nomenclature for allergy for global use: Report of the Nomenclature Review Committee of the World Allergy Organization, October 2003. J Allergy Clin Immunol 2004; 113:832– 6.

2 Finkelman FD. Anaphylaxis: lessons from mouse models. J Allergy Clin Immunol; 2007;120: 506–15.quiz 16–7

3 Wastling JM, Knight P, Ure J et al. Histochemical and ultrastructural mod- ification of mucosal mast cell granules in parasitized mice lacking the beta- chymase, mouse mast cell protease-1. Am J Pathol 1998; 153:491–504.

4 Strait RT, Morris SC, Yang M, Qu XW, Finkelman FD. Pathways of anaphy- laxis in the mouse. J Allergy Clin Immunol 2002; 109:658–68.

5 Akei HS, Brandt EB, Mishra A et al. Epicutaneous aeroallergen exposure induces systemic TH2 immunity that predisposes to allergic nasal responses. J Allergy Clin Immunol 2006; 118:62–9.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1119–1128

67

Platelets and neutrophils in anaphylaxis 1127

6 Ishizaka T, Conrad DH. Binding char- acteristics of human IgE receptors and initial triggering events in human mast cells for histamine release. Monogr Allergy 1983; 18:14–24.

7 Terashita Z, Imura Y, Shino A, Nishik- awa K. A lethal role of platelet activat- ing factor in anaphylactic shock in mice. J Pharmacol Exp Ther 1987; 243:378–83.

8 Tsujimura Y, Obata K, Mukai K et al. Basophils play a pivotal role in immu- noglobulin-G-mediated but not immu- noglobulin-E-mediated systemic anaphylaxis. Immunity 2008; 28:581– 9.

9 Hazenbos WL, Gessner JE, Hofhuis FM et al. Impaired IgG-dependent anaphy- laxis and Arthus reaction in Fc gamma RIII (CD16) deficient mice. Immunity 1996; 5:181–8.

10 Jonsson F, Mancardi DA, Kita Y et al. Mouse and human neutrophils induce anaphylaxis. J Clin Invest 2011; 121:1484–96.

11 Ring J, Darsow U. Idiopathic anaphy- laxis. Curr Allergy Asthma Rep 2002; 2:40–5.

12 Choi IH, Ha TY, Lee DG et al. Occur- rence of disseminated intravascular coagulation (DIC) in active systemic anaphylaxis: role of platelet-activating factor. Clin Exp Immunol 1995; 100:390–4.

13 Joseph M, Gounni AS, Kusnierz JP et al. Expression and functions of the high-affinity IgE receptor on human platelets and megakaryocyte precur- sors. Eur J Immunol 1997; 27:2212–8.

14 Oxholm P, Winther K. Thrombocyte involvement in immune inflammatory reactions. Allergy 1986; 41:1–10.

15 Kasperska-Zajac A, Rogala B. Platelet function in anaphylaxis. J Investig Al- lergol Clin Immunol 2006; 16:1–4.

16 Roth-Walter F, Berin MC, Arnaboldi P et al. Pasteurization of milk proteins promotes allergic sensitization by enhancing uptake through Peyer’s patches. Allergy 2008; 63:882–90.

17 Diesner SC, Knittelfelder R, Krishna- murthy D et al. Dose-dependent food allergy induction against ovalbumin under acid-suppression: a murine food allergy model. Immunol Lett 2008; 121:45–51.

18 Schabbauer G, Matt U, Gunzl P et al. Myeloid PTEN promotes inflammation but impairs bactericidal activities dur-

ing murine pneumococcal pneumonia. J Immunol 2010; 185:468–76.

19 Young JD, Liu CC, Butler G, Cohn ZA, Galli SJ. Identification, purification, and characterization of a mast cell- associated cytolytic factor related to tumor necrosis factor. Proc Natl Acad Sci U S A 1987; 84:9175–9.

20 Ishikawa R, Tsujimura Y, Obata K, Kawano Y, Minegishi Y, Karasuyama H. IgG-mediated systemic anaphylaxis to protein antigen can be induced even under conditions of limited amounts of antibody and antigen. Biochem Bio- phys Res Commun 2010; 402:742–6.

21 Shashidharamurthy R, Hennigar RA, Fuchs S, Palaniswami P, Sherman M, Selvaraj P. Extravasations and emigra- tion of neutrophils to the inflammatory site depend on the interaction of immune-complex with Fcgamma receptors and can be effectively blocked by decoy Fcgamma receptors. Blood 2008; 111:894–904.

22 Mancardi DA, Iannascoli B, Hoos S, England P, Daeron M, Bruhns P. FcgammaRIV is a mouse IgE receptor that resembles macrophage FcepsilonRI in humans and promotes IgE-induced lung inflammation. J Clin Invest 2008; 118:3738–50.

23 Dehlink E, Baker AH, Yen E, Nurko S, Fiebiger E. Relationships between lev- els of serum IgE, cell-bound IgE, and IgE-receptors on peripheral blood cells in a pediatric population. PLoS ONE 2010; 5:e12204.

24 Van Epps DE, Bankhurst AD, Williams RC Jr. Casein-mediated neutrophil che- motaxis: a parallel between surface binding and chemotaxis. Inflammation 1977; 2:115–23.

25 Watt SM, Burgess AW, Metcalf D. Iso- lation and surface labeling of murine polymorphonuclear neutrophils. J Cell Physiol 1979; 100:1–21.

26 Pinckard RN, Halonen M, Palmer JD, Butler C, Shaw JO, Henson PM. Intra- vascular aggregation and pulmonary sequestration of platelets during IgE- induced systemic anaphylaxis in the rabbit: abrogation of lethal anaphylac- tic shock by platelet depletion. J Immunol 1977; 119:2185–93.

27 Withers GD, Kubes P, Ibbotson G, Scott RB. Anaphylaxis-induced mesenteric vascular permeability, granulocyte adhesion, and platelet aggregates in rat. Am J Physiol 1998; 275:H274–84.

28 Pitchford SC, Yano H, Lever R et al. Platelets are essential for leukocyte recruitment in allergic inflammation. J Allergy Clin Immunol 2003; 112:109– 18.

29 Pitchford SC, Riffo-Vasquez Y, Sousa A et al. Platelets are necessary for air- way wall remodeling in a murine model of chronic allergic inflamma- tion. Blood 2004; 103:639–47.

30 Pitchford SC, Momi S, Giannini S et al. Platelet P-selectin is required for pul- monary eosinophil and lymphocyte recruitment in a murine model of allergic inflammation. Blood 2005; 105:2074–81.

31 Hara T, Shimizu K, Ogawa F et al. Platelets control leukocyte recruitment in a murine model of cutaneous arthus reaction. Am J Pathol 2010; 176:259– 69.

32 Pitchford SC, Momi S, Baglioni S et al. Allergen induces the migration of platelets to lung tissue in allergic asthma. Am J Respir Crit Care Med 2008; 177:604–12.

33 Yoshida A, Ohba M, Wu X, Sasano T, Nakamura M, Endo Y. Accumulation of platelets in the lung and liver and their degranulation following antigen- challenge in sensitized mice. Br J Pharmacol 2002; 137:146–52.

34 Strait RT, Morris SC, Smiley K, Urban JF Jr. Finkelman FD, IL-4 exacerbates anaphylaxis. J Immunol 2003; 170:3835–42.

35 Wang H, Ma S. The cytokine storm and factors determining the sequence and severity of organ dysfunction in multiple organ dysfunction syndrome. Am J Emerg Med 2008; 26:711–5.

36 Kiefmann R, Rifkind JM, Nagababu E, Bhattacharya J. Red blood cells induce hypoxic lung inflammation. Blood 2008; 111:5205–14.

37 Goel MS, Diamond SL. Adhesion of normal erythrocytes at depressed venous shear rates to activated neu- trophils, activated platelets, and fibrin polymerized from plasma. Blood 2002; 100:3797–803.

38 Zimmerman GA. Hypoxic erythrocytes spark lung leukocyte adhesion. Blood 2008; 111:4831–2.

39 Zarbock A, Polanowska-Grabowska RK, Ley K. Platelet-neutrophil-interac- tions: linking hemostasis and inflam- mation. Blood Rev 2007; 21:99–111.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1119–1128

68

Author contributions

Conceived and designed the experiments: DK, PS, KS and EJJ. Performed the

experiments: DK, PS and KS. Analyzed the data: DK, PS, MM. Wrote the paper: DK,

EJJ. All authors reviewed and contributed to the final manuscript version. We thank Blackwell Publishing Ltd for providing the license to use the published

content as a part of this thesis (license number : 3082331003956).

69

1128 D. Krishnamurthy et al

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Figure S1. Characterization of the anaphylaxis mouse

model. Figure S2. Mice sensitized with casein using Alum. Figure S3. CD41 and von Willebrand factor (vWF)

staining in shock organs of anaphylactic mice.

Please note: Wiley-Blackwell are not responsible for

the content or functionality of any supporting materials supplied by the authors. Any queries (other than miss- ing material) should be directed to the corresponding author for the article.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1119–1128

70

Supplementary information Figure S1

Fig. S1 Characterization of the anaphylaxis mouse model (a) shows the experimental scheme of the active systemic anaphylaxis model which is explained in detail in the materials and methods section. Sera were collected as indicated and antibody levels were analyzed by ELISA. Casein-sensitized mice showed specific (b) IgG1, IgG2a (c) and IgE titres (d), in comparison to controls. (e) ß-hexosaminidase assay. Sensitized groups showed a significant mast degranulation compared to control group. C57 cells were assessed for ß-hexosaminidase release with the casein-sensitized and non-sensitized sera samples. X axis indicates stimuli and y axis the percentage of degranulation.

71

Figure S2

Fig. S2 Mice sensitized with casein using Alum as Th2 adjuvant were challenged by intravenous injection of specific allergen as compared to control. Lung, heart and liver were collected and tissue sections were stained by Hematoxylin and Eosin. Thrombi were found in (a) lung, (b) heart and (c) liver of severe anaphylactic mice.

72

Figure S3

Fig. S3 CD41 and von Willebrand Factor (vWF) staining in shock organs of anaphylactic mice. Casein sensitized mice were challenged with saline [left panels: (a), (c), (e)] or the specific allergen, casein [right panels: (b), (d), (f)]. CD41 distribution on lung [(a) and (b)] and spleen sections [(c) and (d)] and the presence of vWF [(e) and (f)] on liver sections was analyzed by immunohistochemistry.

73

doi: 10.1111/cea.12031 Clinical & Experimental Allergy, 42, 1801–1812 © 2012 Blackwell Publishing Ltd

ORIGINAL ARTICLE Allergens

An unfolded variant of the major peanut allergen Ara h 2 with decreased anaphylactic potential P. Starkl1, F. Felix1, D. Krishnamurthy1, C. Stremnitzer1, F. Roth-Walter1,2, S. R. Prickett3,4, A. L. Voskamp3,4, A. Willensdorfer1,2, K. Szalai2, M. Weichselbaumer1, R. E. O’Hehir3,4 and E. Jensen-Jarolim1,2 1Department of Pathophysiology and Allergy Research, Medical University of Vienna, Vienna, Austria, 2Messerli Research Institute of the University of Veterinary Medicine Vienna, Medical University of Vienna and University of Vienna, Austria, 3Department of Immunology, Monash University, Melbourne, Australia and 4Department of Allergy, Immunology and Respiratory Medicine, The Alfred Hospital and Monash University, Melbourne, Australia

Clinical & Experimental

Allergy Correspondence: Erika Jensen-Jarolim Messerli Research Institute of the University of Veterinary Medicine Vienna, Medical University of Vienna and University of Vienna c/o Department of Pathophysiology and Allergy Research Center of Pathophysiology, Infectiology and Immunology Medical University of Vienna Waehringer Guertel 18-20 1090 Vienna Austria E-mail: erika.jensen- jarolim@meduniwien.ac.at Cite this as: P. Starkl, F. Felix, D. Krishnamurthy, C. Stremnitzer, F. Roth-Walter, S. R. Prickett, A. L. Voskamp, A. Willensdorfer, K. Szalai, M. Weichselbaumer, R. E. O’Hehir and E. Jensen-Jarolim, Clinical & Experimental Allergy, 2012 (42) 1801–1812.

Summary Background Peanut allergy causes severe type 1 hypersensitivity reactions and conven- tional immunotherapy against peanut allergy is associated with a high risk of anaphy- laxis. Objective Our current study reports proof of concept experiments on the safety of a stably denatured variant of the major peanut allergen Ara h 2 for immunotherapy. We deter- mined the impact of structure loss of Ara h 2 on its IgE binding and basophil degranula- tion capacity, T cell reactivity as well as anaphylactic potential. Methods The secondary structure of untreated and reduced/alkylated Ara h 2 variants was determined by circular dichroism spectroscopy. We addressed human patient IgE binding to Ara h 2 by ELISA and Western blot experiments. RBL-SX38 cells were used to test the degranulation induced by untreated and reduced/alkylated Ara h 2. We assessed the ana- phylactic potential of Ara h 2 variants by challenge of sensitized BALB/c mice. T cell reactivity was investigated using human Ara h 2-specific T cell lines and splenocytes iso- lated from sensitized mice. Results Reduction/alkylation of Ara h 2 caused a decrease in IgE binding capacity, baso- phil degranulation and anaphylactic potential in vivo. However, the human T cell response to reduced/alkylated and untreated Ara h 2 was comparable. Mouse splenocytes showed higher metabolic activity upon stimulation with reduced/alkylated Ara h 2 and released similar IL-4, IL-13 and IFNc levels upon treatment with either Ara h 2 variant. Conclusions and Clinical Relevance Reduced/alkylated Ara h 2 might be a safer alternative than native Ara h 2 for immunotherapeutic treatment of peanut allergic patients. Keywords alkylation, anaphylaxis, food allergy, human T cells, hypoallergen, immuno- therapy, mouse model, splenocytes, unfolded peanut allergen Ara h 2 Submitted 19 January 2012; revised 10 August 2012; accepted 17 September 2012

Introduction

Food allergy has become a major health problem worldwide. At the moment, allergen specific and non- specific therapeutic approaches for the treatment of IgE-mediated food allergy are being developed [1]. Allergies can be treated by non-specific approaches like application of anti-IgE-antibodies [2, 3], probiotics [4] or herbal mixtures [5]. The most important thera- peutic option is specific immunotherapy (SIT) based on oral, sublingual or subcutaneous immune stimulation

with allergens [1]. Successful immunotherapy is associ- ated with the induction of allergen-specific IgG, par- ticularly IgG4 antibodies, which block IgE–allergen binding. Also, SIT-induced IgG antibodies likely directly block effector cell degranulation through interaction with inhibitory Fcc receptors. However, the results of several independent studies investigating this mechanism are controversial [6–9]. Furthermore, effec- tive treatment leads to increased levels of allergen- specific regulatory T cells (Tregs) and Thelper1 (Th1) cells [10, 11].

74

1802 P. Starkl et al

One major drawback of SIT is that therapeutic

allergen application can lead to IgE-mediated allergic reactions in hypersensitive individuals. This adverse side-effect is often related to the tertiary structure of the applied allergen and the presence of conforma- tional IgE epitopes. Immunization strategies using recombinant hypoallergens (for instance defective in IgE binding due to point mutations in IgE epitopes) have been developed to reduce the risk of anaphylac- tic reactions during SIT (reviewed in [12]). Such engi- neered allergens often have decreased potential to activate effector cells, but retain the beneficial capac- ity to stimulate T cells [13, 14]. Allergy against pea- nut (Arachis hypogaea) is one of the most common and severe type I food allergies with more than 1% of children affected in westernized countries including the United States [15], Canada [16], Australia [17] and the United Kingdom [18]. Safe subcutaneous SIT for treatment of peanut allergy or other IgE-mediated food allergies is currently not available due to the high risk of anaphylaxis [12, 19]. Ara h 2 is the most widely recognized and potent allergen for peanut- allergic individuals [20–22]. We and others have recently reported that heating leads to unfolding of the major peanut allergen Ara h 2 in vitro [23, 24]. However, this unfolded Ara h 2 variant still contains linear IgE epitopes, and conformational epitopes might form again upon refolding in vivo. Alkylation of cysteine sulfhydryl groups is widely used in prote- omics for the generation of irreversibly reduced, line- arized proteins [25]. Recently, this method has been reported as a useful tool for the generation of a hypoallergenic variant of the major peach allergen Pru p 3 [26]. Another study utilized an alkylated form of Ara h 2 for the identification and investiga- tion of linear IgE epitopes and subepitopes [27]. We apply this concept here to stabilize the unfolded state of Ara h 2 and investigate the allergenic and ana- phylactic potential of this variant. Our results provide evidence that stably unfolded alkylated Ara h 2 is a promising therapeutic alternative to native Ara h 2 for SIT of peanut allergy.

Materials and methods

Allergens

Ara h 2 was purified as previously described with minor modifications [23]. A detailed protocol can be found in the Material and methods section of the online supple- ment. Ara h 2 peptides (GenScript USA Inc., Piscataway, NJ, USA) were prepared to > 90% purity, reconstituted at 2 mg/ml in PBS and stored in aliquots at -80°C until use. Human serum albumin (HSA) and ovomucoid were obtained from Sigma Aldrich (Vienna, Austria).

Reduction and alkylation

Proteins were reduced and alkylated according to a pub- lished protocol [25]. Briefly, 1 mg protein/ml 100 mM

(NH4)2CO3 was mixed 1 : 1 with a 2 x alkylation cock- tail (acetonitril containing 0.5% triethylphosphin and 2% iodoethanol, pH 10,0; all reagents obtained from Sigma) yielding a final concentration of 0.5 mg/ml. After 60 min of incubation at 37°C, samples were extensively dialysed against H2O, snap frozen in liquid N2 and stored at -80°C until use. Circular dichroism

Circular dichroism (CD) spectroscopy was performed as previously described [28].

Briefly, measurements were performed with a J-715 spectropolarimeter (Jasco, Gross-Umstadt, Germany) at 0.1 mg/ml H2O using a 1-mm path length quartz cuv- ette (Hellma, Mu llheim, Germany) equilibrated at 20°C. Spectra were measured at a scan speed of 50 nm/min and 0.2 nm resolution. The average of three scans was taken as result after subtraction of the baseline spec- trum. The results are shown as mean residue ellipticity (h) at the respective wavelengths. Patient recruitment and ethics

The sera of US peanut-allergic patients were provided by the Food Allergy Resource Initiative with our serum sam- ple request being kindly supported by Professors Hugh Sampson and Scott Sicherer, Mount Sinai School of Med- icine, New York, USA. This is a voluntary serum reposi- tory of individuals with well-characterized food allergies (funded by the Food Allergy Initiative). The participants (or their parents) provided written informed consent and the programme was approved by the Mount Sinai Pro- gram for the Protection of Human Subjects of the Mount Sinai School of Medicine. The use of the serum samples was approved by the Ethics committee of the Medical University of Vienna (approval number 771/2011). ELISA

Ara h 2-specific IgE (human and mouse serum) and IgG (mouse serum) antibodies were detected by ELISA using a standard protocol (please see the material and meth- ods section of the online supplement for details). Cyto- kine (mouse IL-5, IL-13 and IFNc) contents in splenocyte supernatants were analysed using ELISA Ready-SET-Go kits (eBioscience, Vienna, Austria) according to the manufacturer’s instructions. Apart from IFNc determination in supernatants of Concanava- lin A-stimulated cells (1 : 5 dilution), supernatants were diluted 1 : 1 in assay diluent for analysis.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

75

Unfolded Ara h 2 has decreased allergenicity 1803

Western Blot (4 9 10e5 cells/well) in 96-well round-bottom plates

Sodium dodecyl sulfate polyacrylamide gel electrophor- esis (SDS–PAGE) was performed under non-reducing conditions. Methodological details of the Western blot protocol can be found in the material and methods sec- tion of the online supplement.

Degranulation assay

Details of the basophil degranulation assay can be found in the material and methods section of the online sup- plement. Briefly, RBL-SX38 cells were sensitized over- night with human serum, 1 : 10 diluted in culture medium. Sensitized cells were stimulated with 1 lg/ml [this concentration induces highest degranulation as determined by dose–response experiments (data not shown)] untreated or reduced/alkylated Ara h 2 in Ty- rode’s buffer for 1 h at 37°C. Degranulation was assessed by measurement of released ß-hexosaminidase in the supernatant and of unreleased enzyme in the respective cell lysate. The presented results were calculated as per- centage release of total ß-hexosaminidase content.

(Corning). Next, 100 ll of stimulant (plain complete growth medium or containing 5 lg/ml concanavalin A, 50 lg/ml untreated or reduced/alkylated Ara h 2) were applied. Cell supernatant was harvested after 72 h of incubation at 37°C and stored at -80°C until further investigations. Splenocyte metabolic activity

After counting, splenocytes were resuspended at 4 9 10e6 cells/ml complete growth medium and seeded in triplicates of 100 ll into 96-well flat-bottom plates (Corning). A volume of 100 ll of plain medium or con- taining stimulants was added as described above. XTT [2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenyla- mino)carbonyl]-2//-tetrazolium hydroxide] (Sigma) was

(a) (b)

Mouse anaphylaxis

Female BALB/c mice, 4–6 weeks of age, were obtained from Charles River Laboratories (Willmington, MA, USA) and treated according to European Union rules of animal care with the permission of the Austrian Minis- try of Sciences (BWMF-66.009/01870-II/10b/2009). After induction of Ara h 2-specific IgE, 10 weeks after the initial immunization (the treatment protocol is described in detail in the material and methods section of the online supplement), mice were challenged intra- venously with 100 lg of untreated or reduced/alkylated Ara h 2 or reduced/alkylated ovomucoid (negative con- trol) in saline or with saline alone. The animals were monitored for anaphylactic symptoms during 1 h. Body temperature was measured using a rectal thermometer (Bioseb, Vitrolles, France) directly before the challenge

(c)

(d)

and after the stimulation in indicated intervals for 1 h. Animals were subsequently killed by CO2 application and blood was collected by cardiac puncture. Serum was stored at -80°C until further processing. Serum (1 : 30 diluted in assay diluent) levels of mouse mast cell protease-1 (mMCP-1) were measured in triplicates using the mMCP-1 ready-SET-go kit (eBioscience, Vienna, Austria).

Splenocyte stimulation

Spleen cells were isolated as described in detail in the material and methods section of the online supple- ment. Splenocytes were seeded in triplicates

Fig. 1. Alkylated Ara h 2 is stably unfolded. (a, b) Alkylation of sulf- hydryl groups of cysteine side chains: (a) Under reducing conditions at basic pH, the ethyl group of iodoethanol attaches irreversibly to free sulfhydryl groups of cysteine contained in peptides, thereby masking the reactive sulfhydryl group and avoiding re-establishment of disulphide bridges under oxidizing conditions. (b) The unfolded state (lower scheme) of a protein can be stabilized by alkylation as schematically indicated. ‘S’ represents a sulphhydryl group of cyste- ine, alkylated sulphhydryl groups are indicated in red. (c) Purity of Ara h 2. Ara h 2 was purified from peanuts. Untreated (lane 2) and reduced/alkylated (r/a) Ara h 2 (lane 3) were separated by SDS–PAGE and stained with Coomassie Brilliant blue. Lane 1: protein marker; numbers left of lane 1 indicate the molecular weight (in kDa) of the respective marker band. (d) r/a Ara h 2 is unfolded. The secondary structure of untreated (untr.) and r/a Ara h 2 was analysed by circular dichroism spectroscopy.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

76

1804 P. Starkl et al

solubilized at 1 mg/ml in pre-warmed complete growth medium and stored until use at 20°C [29]. A 10 mM

solution of the electron coupling agent menadione (Sigma) in acetone was prepared fresh and added to the XTT solution at a final concentration of 100 lM imme- diately before use [30]. For measurement of metabolic activity of splenocytes, 50 ll of pre-warmed XTT/men- adione was added to each well after 48 h of cultivation. XTT cleavage as indicator of metabolic activity was assessed after incubation for 9 h at 37°C by absorbance measurement at 450 – 630 nm using a plate reader (Tecan, Groedig, Austria).

T cell line generation and stimulation

Ara h 2-specific oligoclonal CD4 + T cell lines (TCLs) were generated from peripheral blood mononuclear cells (PBMC) of peanut-allergic subjects as described [31] and stored in liquid nitrogen until use. Each TCL used in these experiments was specific for one of the five dominant T cell epitopes of Ara h 2 described by Prickett et al. [31] and did not react to any other pep- tide within Ara h 2. Proliferation assays were performed on 72-h triplicate cultures as described [31]. Antigens

were untreated or r/a Ara h 2 or epitope peptides (all used at 10 lg/mL) with untreated or r/a ovomucoid (10 lg/mL) or culture medium alone as negative con- trols. Cells were pulsed with 3H-thymidine (0.5 lCi/ well) for the last 16 h and uptake measured as mean counts per minute (cpm) of triplicate cultures. Data are presented as a stimulation index (SI; cpm antigen-stim- ulated T cells/cpm unstimulated T cells). An additional 12 replica wells per antigen (without 3H-thymidine) were pooled for RNA extraction (described below).

Spatial distribution of T cell epitopes in Ara h 2 structure [32] (PDB #3OB4) was visualized using the UCSF Chimera software (San Francisco, California; http://www.cgl.ucsf.edu/chimera) [33]. Gene expression analysis

Gene expression of human IL-5, IL-13 and IFNc was analysed by Real-time PCR. The fold change as compared with unstimulated cells was calculated using the DDCT method. A detailed description of RNA isola- tion, PCR protocol and primer sequences can be found in the material and methods section of the online supplement.

Table 1. Clinical characteristics of patients and serum reactivity to peanuts

# code Age years sex (f/m) Allergy grade* peanut-specific IgE [kU/L]†

1 91 5 M 1/3 58.4 2 106 10 F 1/3 > 100 3 114 2 M 1 4.59 4 119 3 F 1/3 31.2 5 122 7 M 1/2/3 7.4 6 157 6 F 0 87.4 7 158 2 F 1/3 3.34 8 163 18 M 1/2 69.8 9 273 4 M 1/3 > 100

10 290 8 F 0/1 29 11 295 3,8 F 1 49.4 12 301 8 F 1 > 100 13 320 5,9 M 1/3 19.5 14 324 7,5 M 1/2/3 79 15 394 15 M 0/1/3 3.89 16 421 11 F 0/1/3 > 100 17 430 3 M 1 2.38 18 445 5,5 F 1/2/3 > 100 19 567 14,6 M 0/1/3 11.8 20 648 6 M 0/1/3 > 100

Sera of 20 peanut-allergic patients were applied for the in vitro experiments (Fig. 1–3) in this study. Age, gender, symptoms and peanut-specific IgE levels are presented. Symptoms are described according to the Muller score of allergic symptoms [42]: 0: symptoms of the oral cavity, 1: symptoms of the skin and mucous membranes, 2: gastrointestinal symptoms, 3: respiratory symptoms, 4: cardiovascular symptoms; serum levels of peanut-specific IgE antibodies were determined using ImmunoCAP (Phadia AB, Vienna, Austria); M, male; F, female. *Muller score of allergic symptoms: 0: symptoms of the oral cavity, 1: symptoms of the skin and mucous membranes, 2: gastrointestinal symp- toms, 3: respiratory symptoms, 4: cardiovascular symptoms. †determined using ImmunoCAP (Phadia AB, Vienna, Austria).

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

77

Unfolded Ara h 2 has decreased allergenicity 1805

Statistical analysis

Data were statistically analysed using the (two-tailed) Mann–Whitney U-test using the software GraphPad Prism (version 5.0 for Windows, GraphPad Software, La Jolla, California). Differences with P-values < 0.05 were considered to be significantly different. Thresh- olds: ***: P-value < 0.001; **: P-value 0.001 – 0,01; *: P-value 0.01 – 0.05;

Results Reduction and alkylation attenuates IgE binding and the cross-linking capacity of Ara h 2 in vitro

We hypothesized that the secondary structure (and associated conformational IgE epitopes) of Ara h 2 is an important factor for the allergenic and anaphylactic potential of the allergen. Application of an unfolded

(a)

(b)

Fig. 2. Alkylation affects IgE binding to Ara h 2. (a) Western blot: Binding of serum IgE of human allergic patients to identical amounts of untreated (upper row) and reduced/alkylated (r/a) (middle row) Ara h 2 was analysed by Western blot. The band intensity was analysed by densi- tometry and the percentage difference in IgE antibody binding induced by alkylation as compared to untreated Ara h 2 is presented (lower row). NA = serum from non-allergic donor; B = Buffer control. (b) ELISA: Binding of serum IgE from peanut-allergic subjects to untreated (untr.) and r/a Ara h 2 as well as r/a human serum albumin (HSA, control protein) was analysed by ELISA. The absorbance values at 405–490 nm are displayed (upper panel). The lower panel shows the calculated, alkylation-induced difference relative to untreated Ara h 2.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

78

1806 P. Starkl et al

Ara h 2 variant could consequently decrease the risk of anaphylactic reactions during SIT. We aimed to test this hypothesis and prepared unfolded Ara h 2 by stabiliz- ing the reduced state by alkylation (Fig. 1a,b) [25, 34]. We checked the purity of untreated and reduced and alkylated (r/a) Ara h 2 by SDS–PAGE, confirming the presence of the characteristic doublet of Ara h 2 iso- forms in the absence of other protein bands (Fig. 1c). Analysis of the secondary structure by CD spectroscopy confirmed the unfolded state of r/a Ara h 2, represented by the single spectrum minimum close to 200 nm as compared with the CD spectrum typical for untreated Ara h 2 [35] and proteins of a-helical confirmation (Fig. 1d).

Alkylation stabilizes the reduced allergen by blocking sulphhydryl groups and might thereby decrease IgE binding to conformational epitopes and cysteine-con- taining linear epitopes. We compared the binding of IgE of human peanut-allergic patients with untreated and r/a Ara h 2. Ara h 2-specific IgE was detected in sera of 16 of 20 (16/20) diagnosed peanut-allergic patients (Table 1) by Western blot (Fig. 2a) and ELISA (Fig. 2b). Reduction/alkylation reduced the signal inten- sity by at least 25% in Western blot assays for 13/16 Ara h 2-reactive patients (Fig. 2a). A 20% or more decrease in IgE binding was also observed by ELISA for

11/16 of these patients (Fig. 2b). None of the investi- gated sera reacted against the control protein [alkylated human serum albumin (HSA)].

We next addressed the functional relevance of these observations and compared the capacity of untreated and r/a Ara h 2 to induce effector cell degranulation. Largely consistent with our Western blot and ELISA results, Ara h 2 stimulation induced degranulation of serum sensitized RBL-SX38 in 14/20 samples (Fig. 3). Alkylation reduced degranulation by 10% or more as compared with untreated Ara h 2 for 10 of these 14 samples (Fig. 3b).

Taken together, these in vitro experiments indicate reduced IgE binding and in vitro IgE cross-linking poten- tial of r/a Ara h 2 as compared with the untreated form. Alkylation marginally influences the response of human Ara h 2 specific T cell lines

The stimulation of T cells during SIT is considered to be important for successful therapy [10]. We therefore compared the response of human TCLs of known Ara h 2 epitope specificity [31] to either untreated or r/a Ara h 2, as well as to the respective T cell epitope peptide (Fig. 4a, Figure S1). Each TCL proliferated in response to its respective epitope peptide and to untreated Ara h

(a)

(b)

Fig. 3. Alkylation reduces the ability of Ara h 2 to induce effector cell degranulation. Effector cell degranulation: RBL-SX38 cells were sensitized with serum from peanut-allergic subjects and then stimulated with untreated or reduced/alkylated (r/a) Ara h 2. (a) The percentage of released ß-hexosaminidase in relation to total ß-hexosaminidase content was calculated. (b) The alkylation-induced difference in ß-hexosaminidase release relative to stimulation with untreated Ara h 2 is shown. NA: serum from non-allergic donor.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

79

Unfolded Ara h 2 has decreased allergenicity 1807

(a)

(b) (c)

(d) (e)

Fig. 4. The response of human Ara h 2-specific T cells to untreated and r/a Ara h 2 is comparable. (a) T cell line (TCL) core epitopes: The amino acid (AA) sequences of Ara h 2 core T cell epitopes (equivalent to the peptides used for TCL stimulation) and their respective position within the complete Ara h 2 AA sequence is shown. The sequences are presented in single letter code and cysteines, being potential alkylation targets, are labelled in red. The spatial distribution of core epitopes is visualized in Figure S1. (b) Human T cell line proliferation: Ara h 2-specific human T cell lines (TCLs) were stimulated with untreated (untr.) or reduced/alkylated (r/a) Ara h 2, or the respective core epitope peptide. Proliferation was measured by 3H-labelled thymidine uptake and data were expressed as stimulation indices (SI: fold increase in thymidine uptake by stimulated cells over cells cultured in plain medium; please see also the 3H-thymidine uptake levels in Figure S1). The letters under the TCL name indicate the core peptide specificity as shown in (a). t-test (two-tailed) statistical analysis between samples stimulated by untreated and reduced/alkylated Ara h 2; samples without asterisk were not significantly different; (c–e) Human TCL cytokine mRNA expression: TCLs were stimulated as described in (b) and mRNA was isolated and processed. Expression levels of genes coding for (c) IL-5, (d) IL-13 and (e) IFNc were analysed by real-time PCR. The expression fold change in mRNA levels for stimulated as compared to unstimulated cells was calculated.

2. Stimulation with r/a Ara h 2 caused equal or greater proliferation as compared with untreated Ara h 2 in all TCLs except TCL-D1 (Fig. 4b and Figure S1). Neither incubation with untreated nor with r/a ovomucoid induced TCL proliferation (Figure S1).

Cytokines released by stimulated T cells initiate and shape immune responses. We analysed the expression of Th1 [interferon (IFN) c] and Th2 [interleukin (IL) -5 and IL-13] cytokine mRNA in resting and stimulated TCLs. Consistent with proliferative responses, an increase in cytokine mRNA was observed for all TCLs following stimulation with specific antigen (peptide or either Ara h 2 preparation) compared with medium alone (Fig. 4c–e).

The fold change in IL-5 mRNA (Fig. 4c) in TCLs stimu- lated with specific allergen was approximately 10-fold higher than in IL-13 (Fig. 4d) or IFNc (Fig. 4e) mRNA. Stimulation of TCLs with the irrelevant negative control allergen ovomucoid (untreated or r/a) induced only mar- ginal differences in cytokine mRNA levels as compared with untreated cells (Figure S1).

Stimulation with r/a Ara h 2 resulted in comparable or increased levels of mRNA for all three cytokines compared with untreated Ara h 2 for all TCLs except TCL-D1, which showed a marked decrease in IL-5 mRNA levels, consistent with the reduced proliferative response observed in Fig. 4b.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

80

1808 P. Starkl et al

(a) (b)

Fig. 5. Alkylated Ara h 2 has attenuated anaphylactic potential in sensitized mice. (a) Body temperature kinetics: BALB/c mice were sensitized intraperitoneally with untreated Ara h 2 and challenged intravenously with untreated (n = 7) or reduced/alkylated (r/a) (n = 7) Ara h 2 or r/a ovomucoid (Ovo) (n = 6) or saline (n = 8). Body temperature was measured immediately before (= time point 0) and after challenge as indicated. Mann–Whitney U-test: untr. Ara h 2 vs. r/a Ara h 2: *: P-value 0.01–0.05; r/a Ara h 2 vs. r/a Ovo: +: P-value 0.01–0.05; r/a Ara h 2 vs. Saline: °: P-value 0.01–0.05; (b) mMCP-1 ELISA: mMCP-1 serum levels 1 h after challenge with untreated (n = 7) or r/a (n = 7) Ara h 2 or r/a Ovo (n = 6) or saline (n = 8) were analysed by ELISA. Mann–Whitney U-test; ***: P-value < 0.001; **: P-value 0.001 – 0,01; *: P-value 0.01 – 0.05; ns = not significant.

Alkylation decreases the anaphylactic potential of Ara h 2 in vivo

After assessment of IgE binding and degranulation capacity in vitro, we next aimed to verify whether alkylation influences the anaphylactic potential of Ara h 2 in an in vivo mouse model of systemic anaphy- laxis. After confirming the successful induction of IgE antibodies specific for untreated Ara h 2 (Figure S2), we challenged the mice intravenously with untreated Ara h 2, r/a Ara h 2 or r/a ovomucoid. We measured body temperature as an immediate parameter of ana- phylaxis and assessed the serum levels of mouse mast cell protease-1 (mMCP-1) 1 h after the challenge. Treatment with r/a Ara h 2 caused a reduced temper- ature drop as compared with application of the untreated form (Fig. 5a). These findings were reflected by lower mMCP-1 serum levels in mice challenged with r/a Ara h 2 (Fig. 5b). Of note, challenge with r/ a ovomucoid neither affected body temperature nor mMCP-1 serum levels (Fig. 5a,b). The capacity of untreated and reduced/alkylated Ara h 2 to induce antibodies specific for the untreated allergen was head-to-head compared in additional immunization experiments. ELISA against untreated and reduced/ alkylated Ara h 2 showed that the reduced variant retained statistically the same immunogenicity as the untreated variant and induced IgG1 antibodies, which were fully cross-reactive to the native, respectively, reduced and alkylated variant (Figure S3).

Alkylated Ara h 2 triggers increased metabolic activity and comparable cytokine release by spleen cells ex vivo

Next, we isolated spleen cells from the challenged ani- mals and tested the metabolic response and cytokine release of splenocytes upon stimulation with untreated or r/a Ara h 2. Untreated and r/a Ara h 2 caused higher

metabolic activity than r/a ovomucoid (Fig. 6a). Among the proteins, r/a Ara h 2 caused the most profound stimulation. Of note, we did not observe a difference in the pattern of splenocyte activity between cells isolated from mice that had been challenged with untreated Ara h 2 (left column) and those that had been challenged with r/a Ara h 2 (right column). The Ara h 2-induced metabolic activity was specific and dependent on the foregoing sensitization of the animals, as splenocytes from na ıve mice did not respond to antigen stimulation (Figure S4).

We analysed the splenocyte release of IFNc, IL-5 and IL-13 and found similar production of IL-5 (Fig. 6b) and IL-13 (Fig. 6c) upon stimulation with untreated and r/a Ara h 2 irrespective of the previous challenge of animals. Although not significant, r/a Ara h 2 seemed to induce less IFNc secretion (Fig. 6d) than the untreated form. Splenocytes of na ıve mice did not pro- duce any of the tested cytokines upon antigen stimula- tion (Figure S4). Discussion Specific immunotherapy is currently the only form of disease-modifying treatment available for allergic indi- viduals [12]. However, due to the high risk of systemic reactions [19], SIT is not clinically applicable for the treatment of food allergy. The use of hypoallergenic variants of proteins or extracts might be a promising alternative approach. In this study, we investigated allergenicity and anaphylactic potential of an unfolded food allergen and addressed its suitability for SIT.

We produced a stably linearized variant of the major peanut allergen Ara h 2 by reduction and alkylation (r/ a Ara h 2; Fig. 1d). R/a Ara h 2 exhibited reduced bind- ing to IgE of peanut-allergic patients as compared to untreated Ara h 2 (Fig. 2). In line with decreased IgE binding, r/a Ara h 2 also caused reduced effector cell

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

81

Unfolded Ara h 2 has decreased allergenicity 1809

(a)

(b)

(c)

(d)

Fig. 6. Alkylation influences the response of allergen-primed mouse splenocytes ex vivo. Spleen cells of mice sensitized with untreated Ara h 2 and intravenously challenged with either untreated (untr.; left column; n = 7) or reduced/alkylated (r/a; right column, n = 7) Ara h 2 were iso- lated and stimulated ex vivo with plain culture medium, untreated or r/a Ara h 2, r/a ovomucoid (Ovo) or concanavalin A (Con A). (a) Activity assay: The metabolic activity of allergen-stimulated splenocytes was assessed using an XTT assay and compared to splenocytes stimulated with plain culture medium (= 100%). (b–d) Cytokine release: Supernatant of spleen cells was collected after 72 h of cultivation. Released (b) IL-4, (c) IL-13 and (d) IFNc were analysed by ELISA. Mann–Whitney U-test; ***: P-value < 0.001; **: P-value 0.001–0.01; *: P-value 0.01–0.05; ns = not significant.

degranulation (Fig. 3), suggesting markedly decreased anaphylactic potential. It can be anticipated that the r/a changes may affect the ‘valency’ of the antigen rather than the affinity of those antibodies [36]. In line with that assumption, we could demonstrate that the media- tor release for both allergen variants reached – concen- tration dependent – a maximum response at 1000 ng/

ml and decreased again at higher concentrations (data not shown).

While an attenuated IgE binding and degranulation capacity would be favourable for SIT application, the T cell stimulatory potential of the applied allergen variant should be retained [12]. We stimulated Ara h 2-specific human T cell lines with untreated and r/a Ara h 2 and

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

82

1810 P. Starkl et al

observed that r/a Ara h 2 had a similar, if not increased stimulatory potential compared to untreated allergen for seven out of the eight TCLs tested (Fig. 4b). The decreased response observed for TCL-D1 to r/a Ara h 2 might be explained by its specific epitope sequence, which contains two cysteine residues (as compared with only one cysteine in the epitopes of the other tested TCLs) (Fig. 4a). We showed previously that replacing the cysteine residues with serine residues in this epitope did not affect responses of this line [31], but it may be that the presence of chemically modified cysteines (Fig. 1a) in this epitope might cause altered epitope processing or interfere with its binding to HLA mole- cules or the T cell receptor.

T cells are important initiators and enhancers of immune responses. We analysed mRNA levels of repre- sentative Th1 and Th2 cytokines in stimulated human TCLs. R/a Ara h 2 tended to induce similar or higher levels of IL-5 (Fig. 4c), IL-13 (Fig. 4d) and IFNc (Fig. 4e) mRNA as compared with the untreated form. We conclude from these experiments that r/a Ara h 2 has similar, if not higher T cell stimulatory potential as compared with the untreated allergen.

One major problem of food allergen SIT is the high risk of systemic anaphylaxis upon allergen injection [19]. We therefore compared the anaphylactic potential of untreated vs. r/a Ara h 2 in mice sensitized with untreated Ara h 2. Intravenous challenge with untreated Ara h 2 caused severe anaphylactic reactions reflected by a significant temperature drop (Fig. 5a) and increased serum levels of the mast cell protease mMCP- 1 (Fig. 5b). In contrast, challenge with r/a Ara h 2 caused only low-grade anaphylactic symptoms (Fig. 5a, b). While work by Toda et al. reported that reduction and alkylation rendered hypoimmunogenicity besides hypoallergenicity to the major peach allergen Pru p 3 [26], we demonstrate here that r/a Ara h 2 retains its full immunogenicity and thus capacity to induce IgG (Figure S3).

We isolated spleen cells from Ara h 2-sensitized and challenged mice and investigated their response to allergen exposure. Spleen cells stimulated with r/a Ara h 2 had similar metabolic activity as compared to untreated Ara h 2 (Fig. 6a). The analogous release of

Th2 cytokines (IL-5, IL-13) and a Th1 cytokine (IFNc) (Fig. 6b–d) by cells stimulated with either Ara h 2 vari- ant was in agreement with the mRNA data obtained with Ara h 2-specific human T cell lines (Fig. 4c–e). Splenocytes from na ıve mice did not respond to aller- gen stimulation, proving the specificity of the response (Figure S3). These in vivo and ex vivo experiments pro- vide evidence that r/a Ara h 2 has decreased anaphylac- tic potential while retaining a T cell stimulatory capacity comparable to untreated Ara h 2.

Successful SIT is associated with the induction of a Th1 bias or regulatory T cells [12]. As r/a Ara h 2 expo- sure alone does not appear to induce the desired shift towards production of Th1 cytokines, the co-application of Th1 adjuvants like CpG-rich oligonucleotides (CpG- ODNs) during therapy might be necessary [37, 38].

In conclusion, our experiments provide evidence that alkylation has the potential to decrease the allergenicity and anaphylactic potential of the major peanut allergen Ara h 2. However, it should be kept in mind that pea- nuts contain additional important allergens, including Ara h 1 or Ara h 6 [39–41]. The concept here presented for Ara h 2 should therefore be tested next for addi- tional peanut allergens and, finally, for whole peanut extract. Furthermore, it will be important to investigate the potential benefit of r/a allergen SIT in a therapeutic mouse model of established peanut allergy. These experiments should reveal the suitability of alkylated allergens for SIT of food allergies. Acknowledgements We thank Ingo Flaschberger (crossip communications gmbh, Vienna, Austria), Silke Schrom and Denise He- iden for excellent technical support. This work was sup- ported by the CCHD PhD programme of the Austrian Science Fund FWF, project #APW01205FW and SFB F4606-B19, the National Health and Medical Research Council of Australia and the Ilhan Food Allergy Foun- dation, Australia. The authors declared no conflict of interest.

Conflict of interest: The authors declare to have no conflict of interest.

References

1 Nowak-Wegrzyn A, Sampson HA. Future therapies for food allergies. J Allergy Clin Immunol 2011; 127:558– 73.

2 Leung DY, Sampson HA, Yunginger JW et al. Effect of anti-IgE therapy in patients with peanut allergy. N Engl J Med 2003; 348:986–93.

3 Sampson HA, Leung DY, Burks AW et al. A phase II, randomized, double- blind, parallelgroup, placebocontrolled oral food challenge trial of Xolair (oma- lizumab) in peanut allergy. J Allergy Clin Immunol 2011; 127:1309–10.

4 Hol J, van Leer EH, Elink Schuurman BE et al. The acquisition of tolerance toward cow’s milk through probiotic supplementation: a randomized, con-

trolled trial. J Allergy Clin Immunol 2008; 121:1448–54.

5 Wang J, Patil SP, Yang N et al. Safety, tolerability, and immunologic effects of a food allergy herbal formula in food allergic individuals: a random- ized, double-blinded, placebo-con- trolled, dose escalation, phase 1 study. Ann Allergy Asthma Immunol 2010; 105:75–84.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

83

Unfolded Ara h 2 has decreased allergenicity 1811

6 Ejrnaes AM, Svenson M, Lund G, Lar- sen JN, Jacobi H. Inhibition of rBet v 1-induced basophil histamine release with specific immunotherapy -induced serum immunoglobulin G: no evidence that FcgammaRIIB signalling is impor- tant. Clin Exp Allergy 2006; 36:273– 82.

7 Cady CT, Powell MS, Harbeck RJ et al. IgG antibodies produced during subcu- taneous allergen immunotherapy medi- ate inhibition of basophil activation via a mechanism involving both FcgammaRIIA and FcgammaRIIB. Immunol Lett 2010; 130:57–65.

8 Uermosi C, Beerli RR, Bauer M et al. Mechanisms of allergen-specific desen- sitization. J Allergy Clin Immunol 2010; 126:375–83.

9 Schmitz N, Dietmeier K, Bauer M et al. Displaying Fel d1 on virus-like parti- cles prevents reactogenicity despite greatly enhanced immunogenicity: a novel therapy for cat allergy. J Exp Med 2009; 206:1941–55.

10 Akdis CA, Akdis M. Mechanisms of allergen-specific immunotherapy. J Allergy Clin Immunol 2011; 127:18– 27.

11 Meiler F, Zumkehr J, Klunker S, Ruck- ert B, Akdis CA, Akdis M. In vivo switch to IL-10-secreting T regulatory cells in high dose allergen exposure. J Exp Med 2008; 205:2887–98.

12 Rolland JM, Gardner LM, O’Hehir RE. Allergen-related approaches to immu- notherapy. Pharmacol Ther 2009; 121:273–84.

13 Chen KW, Fuchs G, Sonneck K et al. Reduction of the in vivo allergenicity of Der p 2, the major house-dust mite allergen, by genetic engineering. Mol Immunol 2008; 45:2486–98.

14 Kahlert H, Suck R, Weber B et al. Characterization of a hypoallergenic recombinant Bet v 1 variant as a can- didate for allergen-specific immuno- therapy. Int Arch Allergy Immunol 2008; 145:193–206.

15 Sicherer SH, Munoz-Furlong A, God- bold JH, Sampson HA. US prevalence of self-reported peanut, tree nut, and sesame allergy: 11-year follow-up. J Allergy Clin Immunol 2010; 125:1322– 6.

16 Ben-Shoshan M, Kagan RS, Alizadeh- far R et al. Is the prevalence of peanut allergy increasing? A 5-year follow-up study in children in Montreal. J Allergy Clin Immunol 2009; 123:783–8.

17 Mullins RJ, Dear KB, Tang ML. Charac- teristics of childhood peanut allergy in the Australian Capital Territory, 1995 to 2007. J Allergy Clin Immunol 2009; 123:689–93.

18 Hourihane JO, Aiken R, Briggs R et al. The impact of government advice to pregnant mothers regarding peanut avoidance on the prevalence of peanut allergy in United Kingdom children at school entry. J Allergy Clin Immunol 2007; 119:1197–202.

19 Nelson HS, Lahr J, Rule R, Bock A, Leung D. Treatment of anaphylactic sensitivity to peanuts by immunother- apy with injections of aqueous peanut extract. J Allergy Clin Immunol 1997; 99:744–51.

20 Koppelman SJ, Wensing M, Ertmann M, Knulst AC, Knol EF. Relevance of Ara h1, Ara h2 and Ara h3 in peanut- allergic patients, as determined by immunoglobulin E Western blotting, basophil-histamine release and intracu- taneous testing: Ara h2 is the most important peanut allergen. Clin Exp Allergy 2004; 34:583–90.

21 McDermott RA, Porterfield HS, El MR et al. Contribution of Ara h 2 to pea- nut-specific, immunoglobulin E-medi- ated, cell activation. Clin Exp Allergy 2007; 37:752–63.

22 Flinterman AE, van Hoffen E, den Har- tog Jager CF et al. Children with pea- nut allergy recognize predominantly Ara h2 and Ara h6, which remains sta- ble over time. Clin Exp Allergy 2007; 37:1221–8.

23 Starkl P, Krishnamurthy D, Szalai K et al. Heating affects structure, Entero- cyte adsorption and signalling, as well as immunogenicity of the Peanut aller- gen Ara h 2. Open Allergy J 2011; 4:24–34.

24 Vissers YM, Blanc F, Skov PS et al. Effect of heating and glycation on the allergenicity of 2S albumins (Ara h 2/ 6) from peanut. PLoS ONE 2011; 6: e23998.

25 Hale JE, Butler JP, Gelfanova V, You JS, Knierman MD. A simplified proce- dure for the reduction and alkylation of cysteine residues in proteins prior to proteolytic digestion and mass spectral analysis. Anal Biochem 2004; 333:174 –81.

26 Toda M, Reese G, Gadermaier G et al. Protein unfolding strongly modulates the allergenicity and immunogenicity of Pru p 3, the major peach allergen. J

Allergy Clin Immunol 2011; 128:1022– 30, e1–7.

27 Albrecht M, Kuhne Y, Ballmer-Weber BK et al. Relevance of IgE binding to short peptides for the allergenic activ- ity of food allergens. J Allergy Clin Immunol 2009; 124:328–36.

28 Swoboda I, Bugajska-Schretter A, Ver- dino P et al. Recombinant carp parval- bumin, the major cross-reactive fish allergen: a tool for diagnosis and ther- apy of fish allergy. J Immunol 2002; 168:4576–84.

29 Scudiero DA, Shoemaker RH, Paull KD et al. Evaluation of a soluble tetrazo- lium/formazan assay for cell growth and drug sensitivity in culture using human and other tumor cell lines. Cancer Res 1988; 48:4827–33.

30 Meletiadis J, Mouton JW, Meis JF, Bouman BA, Donnelly JP, Verweij PE. Colorimetric assay for antifungal sus- ceptibility testing of Aspergillus spe- cies. J Clin Microbiol 2001; 39:3402–8.

31 Prickett SR, Voskamp AL, Dacumos- Hill A, Symons K, Rolland JM, O’Hehir RE. Ara h 2 peptides containing domi- nant CD4 + T-cell epitopes: candi- dates for a peanut allergy therapeutic. J Allergy Clin Immunol 2011; 127:608 –15.

32 Mueller GA, Gosavi RA, Pomes A et al. Ara h 2: crystal structure and IgE binding distinguish two subpopulations of peanut allergic patients by epitope diversity. Allergy 2011; 66:878–85.

33 Pettersen EF, Goddard TD, Huang CC et al. UCSF Chimera–a visualization system for exploratory research and analysis. J Comput Chem 2004; 25:1605–12.

34 Cooke SK, Sampson HA. Allergenic properties of ovomucoid in man. J Immunol 1997; 159:2026–32.

35 Lehmann K, Schweimer K, Reese G et al. Structure and stability of 2S albumin-type peanut allergens: impli- cations for the severity of peanut aller- gic reactions. Biochem J 2006; 395:463–72.

36 Christensen LH, Holm J, Lund G, Riise E, Lund K. Several distinct properties of the IgE repertoire determine effector cell degranulation in response to aller- gen challenge. J Allergy Clin Immunol 2008; 122:298–304.

37 Magone MT, Chan CC, Beck L, Whitcup SM, Raz E. Systemic or mucosal administration of immunostimulatory DNA inhibits early and late phases of

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

84

1812 P. Starkl et al

murine allergic conjunctivitis. Eur J Immunol 2000; 30:1841–50.

38 Horner AA, Nguyen MD, Ronaghy A, Cinman N, Verbeek S, Raz E. DNA- based vaccination reduces the risk of lethal anaphylactic hypersensitivity in mice. J Allergy Clin Immunol 2000; 106:349–56.

39 Porterfield HS, Murray KS, Schlichting DG et al. Effector activity of peanut

allergens: a critical role for Ara h 2, Ara h 6, and their variants. Clin Exp Allergy 2009; 39:1099–108.

40 Blanc F, Adel-Patient K, Drumare MF, Paty E, Wal JM, Bernard H. Capacity of purified peanut allergens to induce degranulation in a functional in vitro assay: Ara h 2 and Ara h 6 are the most efficient elicitors. Clin Exp Allergy 2009; 39:1277–85.

41 Chen X, Zhuang Y, Wang Q et al. Analysis of the effector activity of Ara h 2 and Ara h 6 by selective depletion from a crude peanut extract. J Immu- nol Methods 2011; 372:65–70.

42 Mueller UR. Insect sting allergy: clinical picture, diagnosis and treatment. New York: Gustav Fischer Verlag, 1990.

Supporting Information

Additional Supporting Information may be found in the online version of this article:

Data S1. Materilas and Methods. Figure S1. T cell response to untreated and alkylated

Ovomucoid. Figure S2. IgG and IgE (mouse) serum antibody lev-

els specific to native Ara h 2.

Figure S3. Serum IgG1 and IgG2 of reduced/alkyl- ated Ara h 2 immunized mice also recognize untreated Ara h 2.

Figure S4. Splenocyte activity and cytokine produc- tion of na ıve mice.

© 2012 Blackwell Publishing Ltd, Clinical & Experimental Allergy, 42 : 1801–1812

85

Author contributions Conceived and designed the experiments: PS, SP, EJJ. Performed the experiments:

PS, FF, DK, CS, MW, AV. Analyzed the data: PS, FF, SP, AV. Contributed

reagents/materials/analysis tools: SP, RO. Wrote the paper: PS, EJJ. All authors

reviewed and contributed to the final manuscript version. We thank Blackwell Publishing Ltd for providing the license to use the published

content as a part of this thesis (license number: 3082331232585).

86

Supplementary Information

Title: An unfolded variant of the major peanut allergen Ara h 2 with decreased anaphylactic potential

Authors: Philipp Starkl (1), Ferdinand Felix (1), Durga Krishnamurthy (1),

Caroline Stremnitzer (1), Franziska Roth-Walter (1, 2), Sara R. Prickett (3, 4), Astrid

L. Voskamp (3, 4), Anna Willensdorfer (1, 2), Krisztina Szalai (2), Marlene

Weichselbaumer (1), Robyn E. O’Hehir (3, 4), Erika Jensen-Jarolim (1, 2) Affiliations:

(1) Department of Pathophysiology and Allergy Research, Medical University of

Vienna, Vienna, Austria,

(2) Messerli Research Institute of the University of Veterinary Medicine Vienna,

Medical University of Vienna and University of Vienna, Austria

(3) Department of Immunology, Monash University, Melbourne, Australia

(4) Department of Allergy, Immunology and Respiratory Medicine, The Alfred Hospital

and Monash University, Melbourne, Australia Correspondence:

Prof. Erika Jensen-Jarolim, MD

Messerli Research Institute of the University of Veterinary Medicine Vienna, Medical

University of Vienna and University of Vienna

c/o Department of Pathophysiology and Allergy Research

Center of Pathophysiology, Infectiology and Immunology

Medical University of Vienna

Waehringer Guertel 18-20

1090 Vienna

Austria

Telephone: +43 1 40400 5120

Fax: +43 1 40400 6188

E-mail: erika.jensen-jarolim@meduniwien.ac.at

87

Material and methods Allergens

Crude peanut extract (PE) was prepared from raw, unshelled peanuts (obtained from

a local Asian market, originally imported and distributed by Heuschen & Schrouf,

Landgraaf, The Netherlands). Briefly, 10 g peanuts were ground with mortar and

pestle and subsequently incubated for 2 h in 100ml extraction buffer (20 mM Tris, pH

8.2) under constant agitation at room temperature (RT). This preparation was pre-

cleared by centrifugation at 3000 g for 15 min at RT, the supernatant was then further

centrifuged at 100000 g for 30 min at RT in an ultra centrifuge and finally filtered

using a folded filter (Whatman, Maidstone, United Kingdom). Natural Ara h 2 was

purified from this cleared PE as previously described [1]. Briefly, the cleared PE was

subsequently loaded on a 5ml Q Sepharose Fast Flow anion exchange column (GE

Healthcare, Waukesha, Wisconsin) using the ÄKTA FPLC system (GE Healthcare).

Bound protein was subsequently eluted by application of a three step gradient elution

(elution buffer: 20 mM Tris, 1 M NaCl, pH 8.2): 1-20% over 20 column volumes (CV);

21-50% over 15CV; 51-100% over 5CV. The majority of the two Ara h 2 isoforms was

eluted in the first gradient section between 5% - 20% with minor amounts of

(presumably) Ara h 6 [2]. After SDS-PAGE analysis, Ara h 2 containing fractions were

pooled and (NH4)2SO4 was added to 40%. After incubation for 15 min at room

temperature under agitation and subsequent centrifugation at 15000 g, 1/10 volume

100 mM NaP buffer was added to the harvested supernatant and pH was adjusted to

7.4. The supernatant was then loaded onto a 5 ml HiTrap Phenyl FF (high sub)

column (GE Healthcare) equilibrated with 10 mM NaP, 40% (NH4)2SO4, pH 7.4.

Bound protein was eluted from the column with a gradient of 10 mM NaP, pH 7.4.

The majority of Ara h 2 was eluted at high purity in fractions containing 1-35% of

elution buffer. Ara h 2 containing fractions were pooled, dialyzed over night at room

temperature (to prevent Ara h 2 precipitation) against distilled water, subsequently

lyophilized and stored at 4°C. Ara h 2 peptides (GenScript USA Inc, Piscataway, NJ,

USA) were prepared to >90% purity, reconstituted at 2 mg/ml in PBS and stored in

aliquots at -80°C until use. Human serum albumin (HSA) and ovomucoid were

obtained from Sigma Aldrich (Vienna, Austria).

88

ELISA

For detecting specific IgE in sera of peanut-allergic sera, duplicate wells of MaxiSorp

96 well flat-bottom plates (Nunc, Rochester, NY, USA) were coated with 200 ng/well

of untreated or r/a protein diluted at 2 µg/ml in coating buffer (40 mM Na2CO3, 60 mM

NaHCO3, pH 9.6) and incubated overnight in at 4°C. After 1 h blocking at room

temperature with 200 µl 1% BSA in Tris buffered saline (TBS) + 0.05 % Tween 20

(TBST), wells were incubated with 100 µl of human serum diluted 1:15 in TBST +

0.1% BSA overnight at 4°C. Horse radish peroxidase (HRP) labelled goat anti-human

IgE antibody (Kierkegaard & Perry, Gaithersburg, Maryland) diluted at 1 µg/ml in

TBST was used as secondary antibody. 2,2′-Azino-bis(3-ethylbenzthiazoline-6-

sulfonic acid) diammonium salt (ABTS) at 1 mg/ml Citric acid buffer (70 mM Citric

acid, 125 mM Na2HPO4, pH 4.0) containing 0,03% H2O2 was used as substrate to

detect bound HRP labelled antibodies. The optical density was measured 405 – 490

nm using a SpectraMax Microplate Reader (Molecular Devices, Sunnyvale,

California).

For testing of serum levels of specific IgG or IgE antibodies in intraperitoneally

immunized mice, plates were coated with untreated Ara h 2 as described above.

After blocking, diluted sera (1:50 for IgG and 1:5 for IgE) were added into the wells in

duplicate and incubated overnight at 4°C. Bound IgE was detected using 0.5 µg/ml

diluted rat anti-mouse IgE antibody (BD Pharmingen, San Jose, California) in

combination with 1:2000 diluted HRP labelled ECL goat anti-rat IgG antibody (GE

Healthcare). Total IgG levels were determined with a 1:2000 diluted HRP labelled

goat anti-mouse IgG antibody (Abcam, Cambridge, United Kingdom). Antigen

specific antibody concentration was calculated based on a mouse IgG (Southern

Biotech, Birmingham, Alabama) or IgE (BD Pharmingen) standard. Western Blot

In immunoblots with human sera of peanut allergic patients, the PVDF membrane

(Millipore, Billerca, Massachusetts) was blocked 1 h at room temperature with 1% dry

milk powder in TBST and incubated with human patient sera diluted 1:10 in TBST

overnight at 4°C. HRP labelled monoclonal mouse anti-human IgE antibody (clone

HP6029, Southern Biotech, Birmingham, Alabama) diluted 1:2000 combined with

SuperSignal West Pico Chemiluminescence substrate (Pierce, Rockford, Illinois) was

used for detection.

89

Densitometric analysis was carried out using the free ImageJ software

(http://rsbweb.nih.gov/ij) following the instructions outlined on

http://lukemiller.org/index.php/2010/11/analyzing-gels-and-western-blots-with-image-

j/. Briefly, areas of bands were blotted into representative peaks and the area under

the curve was calculated. The difference in signal values of IgE binding to alkylated

Ara h 2 are expressed in percent difference as compared to untreated Ara h 2. Degranulation assay

RBL-SX38 cells were kindly provided by Jean-Pierre Kinet (Harvard Institute of

Medicine, Boston, Massachusetts). These cells are derivatives of the parental rat

basophilic leukaemia cell line RBL-2H3, engineered to express the α- and β-chain of

the human FcεRI [3]. Cells were cultured in DMEM medium containing 10% heat

inactivated FBS, glutamine,antibiotics, and 2.5 mg/ml Geneticin. Two days prior to

antigen stimulation, RBL-SX38 cells were trypsinized and seeded at 2 x 10e4

cells/well in 96-well plates. One day before stimulation, cells were sensitized

overnight with serum of peanut-allergic patients (or control serum from non-atopic

subjects) diluted 1:10 in culture medium. Immediately before antigen stimulation,

excess IgE was removed by washing cells twice with Tyrode’s buffer (100 mM

HEPES, 130 mM NaCl, 1.8 mM CaCl2, 5 mM KCl, 2 mM MgCl2, 5.5 mM Glucose, 1

g/l BSA; pH 7.4). Cells were stimulated with 1 µg/ml untreated or reduced/alkylated

Ara h 2 diluted in Tyrode’s buffer for 1 h at 37°C. Supernatants of cells and lysates of

the corresponding centrifuged cells (lysed by 0.1% Triton X-100 in Tyrode’s buffer)

were harvested and incubated with 4 mM p-Nitrophenyl-N-acetyl-ß-D-glucosaminide

(Sigma) in substrate buffer (200 mM Na2HPO4, 400 mM citric acid, pH 4.5) for 1 h at

37°C. The reaction was stopped by addition of 200 mM Glycine pH 10.7. ß-

hexosaminidase content was analyzed by measurement of the absorbance of the

cleaved substrate at 405 nm using a SpectraMax microplate reader (Molecular

Devices). The results were calculated as percentage of total release (%

degranulation = O.D.supernatant/[O.D.supernatant + O.D.lysate] x 100). Mouse anaphylaxis

Female BALB/c mice, 4-6 weeks of age, were immunized four times at two weeks

interval by intraperitoneal (i.p.) injection of 200 µl solution containing 50 µg of

untreated natural Ara h 2 solubilized in sterile saline and 1 mg of aluminium

90

hydroxide (Alum) (Sigma) in a 1:1 ratio. Immune sera were collected from the tail vein

three weeks and nine weeks after the first immunization. Ara h 2 specific IgE levels

were tested by ELISA.

For immunogenicity comparison of untreated and r/a Ara h 2, naive BALB/c mice

were immunized as described above four times in weekly intervals with 50 µg of

untreated or r/a Ara h 2. Immune sera were collected six weeks after the first

immunization. Specific serum antibodies (IgG1, IgG2a, IgE) were determined by

ELISA (serum dilution 1:100 for IgG1 and IgG2a, 1:10 for IgE) against untreated

(sera of both immunization groups) and r/a Ara h 2 (only with serum of r/a Ara h 2

immunized mice), respectively, as described above in the ELISA methods section. Splenocyte isolation

Spleen was excised and single cell suspension was prepared immediately. Tissue

was minced and filtered through a 70 µm nylon mesh (BD Biosciences, San Jose,

California) and resuspended in RPMI 1640 medium (Gibco) containing glutamine and

antibiotics. Erythrocytes were lysed using ACK cell lysis buffer (10 mM Tris, pH 7,4,

0,83% NH4Cl). The lysis reaction was stopped by addition of complete growth

medium, RPMI 1640 supplemented with glutamine, antibiotics and 10% fetal bovine

serum (FBS). Splenocytes were counted and 100 µl of cell suspension (4 x 10e6

cells/ml) were seeded in 96-well round bottom plates (Corning). Gene expression analysis

Total RNA was extracted from human T cells after 72 h stimulation using the Purelink

RNA Micro kit (Invitrogen, Carlsbad, California) according to the manufacturer’s

instructions. mRNA was subsequently transcribed into cDNA with the High-Capacity

cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, California) using

random hexamer primers and Multiscribe Reverse Transcriptase as recommended by

the supplier. Samples were stored at -20°C until further use. Real-time PCR analysis

was conducted in duplicates on a 7900HT Real-Time PCR System using the Power

SYBR Green PCR Master Mix (Both Applied Biosystems, Vienna, Austria). Gene

expression levels of IL-5 (5’-3’ primer sequences: forward:

CTGATAGCCAATGAGACTCTGAG; reverse: TTGACTCTCCAGTGTGCCTATTC),

IL-13 (forward: TATTGAGGAGCTGAGCAACATCAC; reverse:

91

TCTGGGTCCTGTAGATGGCA), and IFNγ (forward: TGAGGTCAACAACCCACAGG;

reverse: TTCCGCTTCCTGAGGCTGGA) were normalized against ß-actin (forward:

TGGCTCCCGAGGAGCAC; reverse: TTGAAGGTCTCAAACATGATCTGG). The

relative fold change of gene expression in absence and presence of antigen was

calculated using the ∆∆CT method.

92

References

1. Starkl P, Krishnamurthy D, Szalai K, Felix F, Lukschal A, Oberthuer D, Sampson

HA, Swoboda I, Betzel C, Untersmayr E, Jensen-Jarolim E. Heating Affects

Structure, Enterocyte Adsorption and Signalling, as well as Immunogenicity of

the Peanut Allergen Ara h 2. The Open Allergy Journal 2011; 4:24-34.

2. Chatel JM, Bernard H, Orson FM. Isolation and characterization of two complete

Ara h 2 isoforms cDNA. Int Arch Allergy Immunol 2003; 131:14-8.

3. Wiegand TW, Williams PB, Dreskin SC, Jouvin MH, Kinet JP, Tasset D. High-

affinity oligonucleotide ligands to human IgE inhibit binding to Fc epsilon

receptor I. J Immunol 1996; 157:221-30.

4. Mueller GA, Gosavi RA, Pomes A, Wunschmann S, Moon AF, London RE,

Pedersen LC. Ara h 2: crystal structure and IgE binding distinguish two

subpopulations of peanut allergic patients by epitope diversity. Allergy 2011.

93

Supplementary figures Figure S1

Figure S1: T cell response to untreated and alkylated Ovomucoid: (a) Spatial T cell epitope distribution: The positions of core peptide epitopes A-E are labelled in the 3-dimensional model of Ara h 2 [4]. It should be noted that epitopes A and B as well as C and D overlap. Amino acids not associated with T cell epitopes are shown in grey. (b) Thymidine uptake of human T cell lines: Ara h 2 specific human T cell lines (TCLs) were stimulated as described in Figure 4b. Uptake levels of 3H-thymidine (in contrast to the stimulation index in Figure 4b) are shown. (c) Human T cell line proliferation upon stimulation with ovomucoid: Ara h 2 specific TCLs were stimulated with untreated or reduced/alkylated (r/a) ovomucoid (Ovo). Proliferation was measured by 3H-thymidine uptake and data expressed as stimulation indices (SI;

94

fold increase in thymidine uptake by stimulated cells over cells cultured in plain medium). The letters below the TCL name indicate the core peptide specificity as indicated in Figure 4A. (D-F) Human T cell line cytokine mRNA expression: TCLs were stimulated as described in (c). Fold change in gene expression for stimulated cells as compared to cells in the absence of antigen were determined for (D) IL-5, (E) IL-13, and (F) IFNγ by Real-time PCR.

Figure S2

Figure S2: IgG and IgE (mouse) serum antibody levels specific to native Ara h 2: (a, b) Ara h 2 specific antibody levels: BALB/c mice were immunized intraperitoneally with untreated Ara h 2 (n = 20). Serum was collected from immunized and naïve (n = 8) animals one week after the final immunization. Levels of Ara h 2 specific (a) IgG and (b) IgE antibodies were determined by ELISA.

Figure S3: Serum IgG1 and IgG2 of reduced/alkylated Ara h 2 immunized mice also recognize untreated Ara h 2. BALB/c mice were immunized intraperitoneally

95

four times in a weekly manner with 50 µg of untreated or reduced/alkylated Ara h 2. Serum was collected two week after the final immunization. (a) Serum IgG1 and IgG2a specific for untreated Ara h 2 were determined for both immunization groups by ELISA. Graphs represent mean + SD. Statistics: Mann Whitney test; **: p<0.01; (b) Sera of mice immunized with reduced/alklyated Ara h 2 were analyzed for IgG1, IgG2a, and IgE antibodies specific for reduced/alkylated Ara h 2 by ELISA.

Figure S4: Splenocyte activity and cytokine production of naïve mice: Naïve mice (n = 8) were challenged with saline and spleen cells were isolated. Splenocytes were stimulated ex vivo with plain culture medium or culture medium containing untreated or reduced/alkylated (r/a) Ara h 2, r/a ovomucoid (Ovo) or concanavalin A (Con A). (a) Metabolic activity assay: After 48 h of stimulation, XTT was added for 9 h and the absorbance at 450 nm-630 nm was measured. Activity was calculated in relation to spleen cells stimulated with medium (= 100 %). (b-d) Cytokine release: Splenocyte supernatant was collected after 72 h of cultivation. Levels of (b) IL-4, (c) IL-13, and (d) IFNγ were determined by ELISA.

96

7. Discussion This chapter, discusses the overall work done in each manuscripts composed in this

thesis. In the chapter 2, “Anti-acid medications interact with endotoxin to induce food

allergy to milk allergen casein in BALB/c mice”, it was shown that anti-ulcer

medications, in particular sucralfate (SUC, Ulcogant, Losec (Proton pump inhibitor

(PPI), omeprazole) in presence of endotoxin induce experimental food allergy in the

treated BALB/c mice. According to previous studies from our laboratory, concomitant

application of food allergens and anti-acid/ulcer medications are associated with food

allergy induction in human patients and experimental mice models (1-5). The model

allergens used in these studies were fish, egg allergen ovalbumin and hazelnut. In

continuation of this work, this part of the thesis chapter aimed at investigating 1) the

effect of anti-acid medications, SUC and PPI on cow’s milk casein sensitization,

without the systemic priming of mice and 2) the role of co-applied endotoxin (LPS,

lipopolysaccharide) in the feeding. Cow milk contains allergenic proteins, i.e. 20%

represent the whey proteins alpha-lactalbumin and beta-lactoglobulin and 80%

micellar casein. Casein is known to be easily degradable by proteinases and

exopeptidases (6). As mentioned previously, casein exists as micelles or aggregates

and is known to be heat stable (6, 7); in contrast, beta-lactoglobulin is resistant to

acid hydrolysis and proteainases and aggregates in processed milk (8) and alpha-

lactalbumin is heat sensitive and denatures at 64°C (9). Despite being sensitive to

intestinal proteases, casein is known to induce higher antibody titres than whey

proteins alpha-lactalbumin and beta-lactoglobulin in mouse models, using adjuvant

cholera toxin (7). In the same study, Peyer’s patches was shown to be the main port

of processing and uptake of aggregated/micellar casein (7). It is known that

endotoxin is almost ubiquitously present. There are no studies till today addressing

the effects of endotoxin applied as a feeding constituent in truly oral food allergy

mouse model. It is interesting to note that casein is the least endotoxin containing

milk protein among other major allergens, alpha-lactalbumin and beta-lactoglobulin.

Therefore in this study, it was addressed whether co-applied, LPS least contaminated

micellar casein may affect the sensitization in mice.

Mice groups were treated according to a previously developed scheme, using anti-

ulcer medications (PPI and SUC) and model allergen (CAS) casein, CAS/PPI and

CAS/SUC groups showed no significant casein specific-antibody titres, implying that

97

elevated intestinal pH is not sufficient enough to induce a significant casein

sensitization in BALB/c mice (Fig. 2) Groups treated anti-ulcer medications and

casein and in addition with LPS, CAS/LPS/PPI and CAS/LPS/SUC induced highly

significant levels of casein-specific IgG1 and IgE and IgG2a and IgG2b showing both

Th1/Th2 immune response (Fig. 2). From this observation, we conclude that a

combination of elevated intestinal pH and presence of endotoxin is sufficient to

induce an immune response to co-applied casein. It might be explained by the

followgin: i) an increased intestinal pH keeps the allergen in an immunologically intact

form and in addition, ii) LPS, a potent immuno-stimulatory component from gram

negative bacterial cell walls stimulates the antigen sensing cells to get activated and

process the allergen efficiently. It should be noted that among anti-ulcer drugs used

in this study, SUC seems to elicit a dominant effect on sensitization over PPI.

Interestingly, mice group fed with LPS and casein shows significant casein-IgG2b

titres (Th1 response) compared to naïve group, though the increased levels of IgG1

and IgE were statistically insignificant, showing both elevated intestinal pH and

endotoxin’s presence are required to induce a dominant Th2 response in this model

(Fig. 2D). A combination of CAS/LPS/PPI/SUC induced a significant casein-IgG2a

and IgG2b titres, though the IgG1 and IgE levels were not significant (Fig. 2).

To assess the potential of the formed antibodies, oral provocation was performed

using 50mg of casein and monitored the groups until one hour. A reduction in body

temperature was used a parameter to describe a systemic response, ie. anaphylaxis.

In addition, the standard allergic symptom scores were considered in this model.

Interestingly, CAS/PPI group upon oral allergen provocation, showed a response in

70% of cases, either showing a reduction in body temperature or showing watery

diarrhea. Of note, despite the insignificant titres of antibody titres in CAS/PPI group,

highest response was observed in this group. This might possibly be explained by

different reasons. 1) formed IgE antibodies are predominantly surface bound to mast

cells and 2) increased circulatory immunoglobulin light chains (Ig-fLC) which have

been observed after oral sensitization of mice with casein might act anaphylactogenic

(10). In this study, it is reported that mice sensitized with casein showed no

detectable IgE response, with increased Ig-fLC in serum and by blocking this Ig-fLC

in casein-sensitized group. An anaphylactic response of 40% was observed in groups

treated with CAS/LPS, CAS/LPS/PPI, and CAS/LPS/SUC. Casein-specific

suppressive antibody IgG2b produced in CAS/LPS might have to a part

98

counterregulated the allergic reaction upon oral provocation in this group.

CAS/LPS/PPI and CAS/LPS/SUC showed a mixed antibody response i.e, with

casein-specific IgG1, IgE, IgG2a and IgG2b. A recent study reported that in a mice

model, ingested allergens should be available in the blood to induce a systemic

anaphylactic response in sensitized mice and such systemic response can be

blocked by allergen specific-circulating IgA (11). In accordance with this report, in our

model, serum levels of casein-IgA were appreciable in CAS/LPS/PPI and

CAS/LPS/SUC groups (Fig. S5B). Oral provocation with 50mg casein may have

inhibited by circulating specific IgA antibodies, before binding to surface bound IgE

on mast cells. Further after the oral provocation test serum samples were analysed

for mouse mast cell-protease-1 (mMCP-1), a granular enzyme, a marker of mast cell

degranulation. We could not find any increased levels of mMCP-1 upon oral

provocation test (data not shown). In addition, to address the neutrophil role in this

allergic response, we have assayed mouse myeloperoxidase (MPO), as a sign of

neutrophil activation and participation, as neutrophil has been demonstrated to

induce shock in a mouse model mediated by PAF (12). In our model, CAS/LPS/PPI

group showed 2-3 fold increase in MPO levels upon oral provocation (Fig. S3).

Further, in vitro mast cell degranulation was performed using beta-hexosaminidase

release assay with serum samples of all treated groups. Consistent with our mMCP-1

data, none of the serum samples induced beta-hexosaminidase release (Fig. S2).

We believe that formed blocking antibodies in the circulation might compete with

specific IgE on mast cells to bind allergens, therefore leading to reduced and or no

mast cell activation and degranulation.

As, 50-60% of cow milk allergic patients show cutaneous reactions (13), we have

assessed the skin reactivity by challenging the allergen intradermally. Consistent with

our antibody levels, CAS/LPS/SUC showed higher significant skin reactivity, followed

by CAS/LPS/PPI (Fig 4). Of note, despite the lowered detectable levels of IgE and

milder hypersensitivity reactions in CAS/LPS, we have observed positive skin

reactivity compared to naïve group (Fig. 4). From this skin reactivity test, consistent

with antibody levels, we report that SUC also shows a dominant effect by eliciting the

higher skin reactivity over PPI treatment in this model.

Next we have analyzed the T-cell proliferation in the splenocytes from sensitized

mice. It is known that in cow milk allergic patients, Th2 cells derived cytokines are

critical in inducing skin reactions (14). Splenocytes from CAS/LPS/PPI treated group

99

showed significant levels of mIL-13 when compared to naïve group with casein

stimulation (Fig. 5). mIFN-γ levels showed no difference between medium and

casein stimulation (Fig. S4).

This is the first model to study the adjuvant effect of oral exposure of endotoxin (LPS)

with casein without systemically priming or without using experimental Th2 adjuvants.

In other studies, mice models were developed either priming mice systemically using

a) complete Freund’s adjuvant (CFA) (15, 16) or b) alum (17) as an adjuvant most

often ovalbumin as model allergen or priming with experimental Th2 adjuvants,

cholera toxin (CT) or staphylococcal enterotoxin B (SEB) (18) via the mucosal route.

CT and SEB are often used to develop experimental mouse models of food allergy

towards many food proteins. CT is known to exert its effect while given parenterally

and it enhances antigen capture from the gut lumen and facilitates migration of

dendritic cells (DCs) to interact with naïve T cells (18). Such migration and interaction

is sufficient to induce allergic sensitization to applied food proteins. SEB has been

recently used to develop gastrointestinal allergy when ovalbumin was given both by

the oral and systemic routes(18). In another attempt, a mouse model of cow milk

allergy was developed using cholera toxin, in C3H/HeJ strain, being an endotoxin

resistant strain and which was housed under pathogen free condition (19). Taking our

data into consideration, we propose that micellar/aggregate casein with

lipopolysaccharide and acid-suppressing drugs forms a complex. Elevated gastric pH

protects the allergen in an immunologically intact form, thereby intact allergen with

LPS induce sensitization.

It is worth discussing the clinical relevance of this proposed model. Acid-suppressing

drugs are given to treat patients with gastroesophageal reflux disease (GERD) and

peptic ulcers, also in pediatric patients (20-22). As milk is one among the “Big-8” food

allergens, it is possible that patients under long term medication with acid-

suppressing drugs, by using sucralfate, proton pump inhibitors and histamine H2-

receptor antagonists (H2-RA) are more likely to get sensitized to consumed food

allergens. It is possible that in pediatric patients under long-term acid-suppressing

medications the outgrowing of milk allergy might be prevented over age and prompt

the individual to develop persistent milk allergy. It has been shown in adult patients

under long term medications that IgE is induced towards food proteins (2). Acid-

suppressing drugs, PPIs and H2-RA have been extensively used. These drugs have

100

also been reported to increase the bacterial overgrowth (23-25). In conclusion, our

model demonstrates that acid-suppressing drugs in cooperation with

lipopolysaccharide support allergen sensitization to major milk allergen, casein. This

kind of co-sensitization may be possible in human patients under acid-suppressing

medication and therefore be of clinical importance. In Chapter 3 we went one step further to analyse the cellular players contributing in

the effector phase of food allergy. We showed in, “Changes in the number of

neutrophils and platelets in an experimental BALB/c mouse model of casein-induced

anaphylaxis”, that non-classical allergy effector cell types such as neutrophils and

platelets take part in anaphylaxis. An experimental mouse model of anaphylaxis was

developed taking casein, a major milk allergen as our model allergen. Casein was

chosen, as cow milk allergy is the most common cause of food-induced reactions

associated with gastrointestinal, skin, respiratory symptoms (26). 6-8 week old

BALB/c mice were primed intraperitoneally twice with 2 weeks interval. Serum levels

of casein-specific antibodies IgG1, IgE, IgG2a and IgG2b were measured in the

primed mice. These formed antibodies were then assessed for their biological and

clinical relevance by using in vivo as well as in vitro experiments. In vivo experiments

include systemic allergen and saline challenge in primed mice, followed by

measuring body temperature for 0 min, 10 min, 20 min, 30 min and 60 min using

rectal thermometry and blinded observation of mice for an hour. Hypersensitized

mice, when intravenously challenged with specific allergen, showed anaphylactic

symptoms, assessed by measuring a drop in body temperature; in addition, they

showed either scratching around the nose and head, or puffiness around eyes and

mouth, or wheezing, or no activity after prodding (Figure 2, chapter 3). To affirm

these data, we assessed the in vitro potential of the formed antibodies by performing

ß-hexosaminidase release assay. Sera from sensitized mice also showed enhanced

release of ß-hexosaminidase (Fig 1E, chapter 3). When total blood cell counts were

performed before and after the allergen challenge, we recorded reduction of

neutrophils, platelets and RBCs only in the sensitized mice upon allergen challenge.

Further, when spleen, liver, lungs, heart and kidney were analyzed by

immunohistochemistry, Gr-1+ neutrophil accumulation was observed in casein-

sensitized and casein-challenged mice in the interstitium of lung with congestion in

the lungs as evaluated in HistoQuest analysis. Activation of mast cells by IgE is the

101

key event in anaphylaxis (27). Such mast cell activation leads to degranulation and

releases histamine, prostaglandin D2, leukotriene C4 and causes the manifest

symptoms of anaphylaxis (28, 29). Nevertheless, mast cell deficient strains, WBB6F1-

KitW/KitW-vor WCB6F1-MgfSl/MgfSl-d are able to undergo active anaphylaxis with

similar mortality rates (30-34). IgE-deficient mice can able to undergo fatal active

anaphylaxis with airway response (35). These studies showed that neither IgE nor

mast cells are required to induce the features of active systemic anaphylaxis.

Continuing with these studies, IgG1 isotype has been shown to elicit passive

cutaneous anaphylaxis and passive systemic anaphylaxis in mice (36-39). A model of

active systemic anaphylaxis demonstrated that the anaphylactic response is

mediated by IgG1 via FcγRIII (40). Thus, much focus has been given to the cell types

expressing FcγRIII. Neutrophils, macrophages, natural killer cells and mast cell

express FcγRIII and these cells respond and can be efficiently activated by IgG1

(41). Basophils constitute less than 1% of the total blood cell population and it was

demonstrated that they capture IgG1 –antigen-immune complexes through their

surface expression of FcγRIII (42). In addition, most of the immunization studies with

protein antigens for active anaphylaxis, induced IgG1 predominant production (43).

Basophils actively participate in systemic anaphylaxis mediated by IgG, but not

mediated by IgE (42). Mast cells, FcεRI and histamine are involved in IgE-mediated

anaphylaxis in both mice and humans (44). Basophils, macrophages, FcγRIII, PAF

are involved in IgG-mediated anaphylaxis in mice (44). There are two important

critical requirements that distinguish between IgE- and IgG-mediated anaphylaxis in

mice models. 1) IgE-mediated anaphylaxis requires small amounts of antigen and

100 X higher levels of antigen in IgG-mediated anaphylaxis 2) IgE-dependent

anaphyalxis requires very small amount of antibody levels and IgG-mediated

anaphylaxis requires higher levels of antibody to cause manifest symptoms (44). In

our study, we demonstrated that casein immunization induced predominantly an IgG1

antibody isotype in mice. Adverse reactions to milk are classified into two types. IgE-mediated reactions

involve in about 60% involving skin (45). We took casein as our model allergen, as

casein appears to be the predominant allergen, being both allergenic and antigenic in

cow milk allergic patients, despite the fact that caseins are highly prone to intestinal

digestion (46). In our model, produced IgG1 antibody may form immune complexes

102

with allergen applied intravenously. These immune complexes act on FcγRIII,

expressed on macrophages, mast cells and neutrophils and may thereby activate the

inflammatory cascade. As mentioned earlier, IgG-mediated anaphylaxis requires

higher amount of antigen. Contrary to this phenomenon, it was shown that in a

passive systemic model of anaphylaxis, relatively lowered levels of antigen and

antibody were sufficient to induce IgG-mediated anaphylactic reactions in mice (47).

In addition, both mouse and human neutrophils induce systemic anaphylaxis in a

mouse strain lacking activating receptors for IgG and IgE and, in which PAF is a

dominant mediator rather than histamine. MPO levels were taken as the readouts of

neutrophil activation in this model (12). Taking these studies and our own data into

consideration we propose that neutrophil activation as the primary event mediated by

IgG1-FcγRIII immune complexes and releases MPO and PAF, and H2O2 by

erythrocytes (RBCs). In turn such inflammatory events make the endothelium to

expose P-selectin. Consequently platelets in response to immune complexes and the

local inflammatory stimuli, get activated and interact with neutrophil expressed P-

selectin glycoprotein ligand-1 (PSGL-1). They form thrombi with neutrophil, platelets

and RBCs on the endothelial surface. Disseminated intravascular coagulation (DIC)

occurs in a model of anaphylaxis with subsequent reduction of peripheral platelets

and cellular infiltration in interstitium of the lungs (48). Platelets have gained interest

in terms of IgE biology, as both human platelets and megakaryocytes express high-

affinity IgE receptor FcεRI (49). Platelets are also known to interact with neutrophils

and amplify the acute inflammatory insults (50).

Based on our data we conclude that platelets and neutrophils get reduced from blood

circulation in anaphylaxis. Therefore management of these cell types and their

interactions, may attenuate the clinical symptoms and possibly also reduce late

phase inflammatory episodes.

Finally, in the last chapter of the thesis we approached the urgent question of how to

safely cure food allergies. For food allergies, in the moment no curative treatment is

available as the risk of hyposensitizing patients is very high. However, against

respiratory allergies, specific immunotherapy remains the gold standard therapy to

treat allergic patients, despite the fact that also in this case there is a risk of some

side effects (51, 52). Side effects include local allergic responses, asthma, urticaria

and anaphylaxis (52). Several attempts were made to attenuate the allergenicity and

associated side effects, simultaneously increasing the efficacy of the approach.

103

These attempts were done by either producing short peptide of the allergens by

cleavage or chemically modifying the allergen (53-55). Therefore, we attempted to

establish a modified variant of a food allergen and assess it’s applicability in SIT. We

chose Ara h 2, major peanut allergen as our model allergen, as peanuts may lead

fatal anaphylaxis (56). Therefore, development of a causative therapy is highly

desired.

We have utilised an alkylation method to unfold Ara h 2, as previously applied for

peach allergen Pru p 3 (57). Unfolding of Ara h 2 was done by reduction & alkylation

(r/a Ara h 2). Such unfolded Ara h 2 was shown to bind less IgE in human serum

samples of peanut allergic patients as well as in ELISA and western blotting

experiments. Consistent with this, unfolded Ara h 2 showed a reduced mast cell

degranulation in an in vitro degranulation assay. Human T-cell line specific to Ara h 2

epitopes were stimulated with native Ara h 2 and unfolded r/a Ara h 2 to analyze the

T-cell stimulatory capacity. Seven out of eight T-cell lines showed a comparative T-

cell stimulatory capacity except TCL-D1 cell line with r/a Ara h 2 stimulation, possibly

explained by a cysteine-specific epitope specificity in T cell stimulation. It may be that

the reduction and alkylation at this cysteine residue crucial for the T-cell stimulation.

Using human T-cell lines specific to Ara h 2 epitopes, we found a similar T-cell

stimulatory response to both native and unfolded Ara h 2 consistent with mRNA

levels of IL-5, IL-13 and IFN-γ by stimulation of both native and unfolded Ara h 2.

From these in vitro experiments, unfolded Ara h 2 seems promising applicable to SIT.

Further assessed the in vivo potential, we used a mouse model of anaphylaxis. Mice

were primed with native Ara h 2 and challenged with modified Ara h 2. Mice

challenged with modified Ara h 2 showed lowered anaphylactic symptoms. Although

we showed lowered IgE binding, reduced in vitro mast cell degranulation, there were

no elevated levels of Th1 cytokine, IFNγ, which is critical to induce blocking

antibodies during SIT. Therefore, we propose to use Th1 ligands co-applied with

modified Ara h 2. Our data suggest that modified & unfolded allergen may also be

safer in clinical application, because the modified (hypo-) allergen Ara h 2 when

applied in the mouse model neither locally nor systemically, mast cell degranulation,

could be observed, but with retained T-cell stimulatory capacity was completely

retained. We conclude from our studies, that chemically unfolded Ara h 2 might in the

future be a strategy to deal with peanut allergy. Nevertheless, studies in human

peanut allergic patients are essential to assess its true clinical efficacy and safety.

104

Taken together, in a holostic approach to food allergy, in this theses the following

topics were approached: 1) We studied the anti-acid/ulcer medications and endotoxin

in food; 2) we addressed novel cell types involved anaphylaxis in a relevant mouse

model, and 3) we developed a hypoallergen for one of the most important food

allergens by a chemical modification approach.

Taken together, we studied and addressed novel aspects in the field of food allergy

sensitization, over food-induced anaphylaxis to the development of a safe

immunotherapy for peanut allergy. The results of this thesis may contribute to current

knowledge and understanding of food allergy mechanisms and improve the

treatments applied to food allergic patients in the future.

105

References 1. Untersmayr E, Scholl I, Swoboda I, Beil WJ, Forster-Waldl E, Walter F, et al.

Antacid medication inhibits digestion of dietary proteins and causes food allergy: a

fish allergy model in BALB/c mice. J Allergy Clin Immunol. 2003 Sep;112(3):616-23.

2. Untersmayr E, Bakos N, Scholl I, Kundi M, Roth-Walter F, Szalai K, et al. Anti-

ulcer drugs promote IgE formation toward dietary antigens in adult patients. FASEB

J. 2005 Apr;19(6):656-8.

3. Scholl I, Untersmayr E, Bakos N, Roth-Walter F, Gleiss A, Boltz-Nitulescu G,

et al. Antiulcer drugs promote oral sensitization and hypersensitivity to hazelnut

allergens in BALB/c mice and humans. Am J Clin Nutr. 2005 Jan;81(1):154-60.

4. Diesner SC, Knittelfelder R, Krishnamurthy D, Pali-Scholl I, Gajdzik L, Jensen-

Jarolim E, et al. Dose-dependent food allergy induction against ovalbumin under

acid-suppression: a murine food allergy model. Immunol Lett. 2008 Nov

16;121(1):45-51.

5. Brunner R, Wallmann J, Szalai K, Karagiannis P, Altmeppen H, Riemer AB, et

al. Aluminium per se and in the anti-acid drug sucralfate promotes sensitization via

the oral route. Allergy. 2009 Jun;64(6):890-7.

6. Wal JM. Cow's milk allergens. Allergy. 1998 Nov;53(11):1013-22.

7. Roth-Walter F, Berin MC, Arnaboldi P, Escalante CR, Dahan S, Rauch J, et al.

Pasteurization of milk proteins promotes allergic sensitization by enhancing uptake

through Peyer's patches. Allergy. 2008 Jul;63(7):882-90.

8. Chen WL, Hwang MT, Liau CY, Ho JC, Hong KC, Mao SJ. Beta-lactoglobulin

is a thermal marker in processed milk as studied by electrophoresis and circular

dichroic spectra. J Dairy Sci. 2005 May;88(5):1618-30.

9. McGuffey MK, Epting KL, Kelly RM, Foegeding EA. Denaturation and

aggregation of three alpha-lactalbumin preparations at neutral pH. J Agric Food

Chem. 2005 Apr 20;53(8):3182-90.

10. Schouten B, van Esch BC, van Thuijl AO, Blokhuis BR, Groot Kormelink T,

Hofman GA, et al. Contribution of IgE and immunoglobulin free light chain in the

allergic reaction to cow's milk proteins. J Allergy Clin Immunol. 2010

Jun;125(6):1308-14.

106

11. Strait RT, Mahler A, Hogan S, Khodoun M, Shibuya A, Finkelman FD.

Ingested allergens must be absorbed systemically to induce systemic anaphylaxis. J

Allergy Clin Immunol. 2011 Apr;127(4):982-9 e1.

12. Jonsson F, Mancardi DA, Kita Y, Karasuyama H, Iannascoli B, Van Rooijen N,

et al. Mouse and human neutrophils induce anaphylaxis. J Clin Invest. 2011

Apr;121(4):1484-96.

13. Host A. Frequency of cow's milk allergy in childhood. Ann Allergy Asthma

Immunol. 2002 Dec;89(6 Suppl 1):33-7.

14. Schade RP, Van Ieperen-Van Dijk AG, Van Reijsen FC, Versluis C, Kimpen

JL, Knol EF, et al. Differences in antigen-specific T-cell responses between infants

with atopic dermatitis with and without cow's milk allergy: relevance of TH2 cytokines.

J Allergy Clin Immunol. 2000 Dec;106(6):1155-62.

15. Kweon MN, Yamamoto M, Kajiki M, Takahashi I, Kiyono H. Systemically

derived large intestinal CD4(+) Th2 cells play a central role in STAT6-mediated

allergic diarrhea. J Clin Invest. 2000 Jul;106(2):199-206.

16. Hino A, Kweon MN, Fujihashi K, McGhee JR, Kiyono H. Pathological role of

large intestinal IL-12p40 for the induction of Th2-type allergic diarrhea. Am J Pathol.

2004 Apr;164(4):1327-35.

17. Brandt EB, Strait RT, Hershko D, Wang Q, Muntel EE, Scribner TA, et al. Mast

cells are required for experimental oral allergen-induced diarrhea. J Clin Invest. 2003

Dec;112(11):1666-77.

18. Berin MC, Shreffler WG. T(H)2 adjuvants: implications for food allergy. J

Allergy Clin Immunol. 2008 Jun;121(6):1311-20; quiz 21-2.

19. Li XM, Schofield BH, Huang CK, Kleiner GI, Sampson HA. A murine model of

IgE-mediated cow's milk hypersensitivity. J Allergy Clin Immunol. 1999 Feb;103(2 Pt

1):206-14.

20. De Giorgi F, Savarese MF, Atteo E, Leone CA, Cuomo R. Medical treatment of

gastro-oesophageal reflux disease. Acta Otorhinolaryngol Ital. 2006 Oct;26(5):276-

80.

21. Julapalli VR, Graham DY. Appropriate use of intravenous proton pump

inhibitors in the management of bleeding peptic ulcer. Dig Dis Sci. 2005

Jul;50(7):1185-93.

107

22. Tofil NM, Benner KW, Fuller MP, Winkler MK. Histamine 2 receptor

antagonists vs intravenous proton pump inhibitors in a pediatric intensive care unit: a

comparison of gastric pH. J Crit Care. 2008 Sep;23(3):416-21.

23. Vakil N. Acid inhibition and infections outside the gastrointestinal tract. Am J

Gastroenterol. 2009 Mar;104 Suppl 2:S17-20.

24. Williams C, McColl KE. Review article: proton pump inhibitors and bacterial

overgrowth. Aliment Pharmacol Ther. 2006 Jan 1;23(1):3-10.

25. Chey WD, Spiegel B. Proton pump inhibitors, irritable bowel syndrome, and

small intestinal bacterial overgrowth: coincidence or Newton's third law revisited? Clin

Gastroenterol Hepatol. 2010 Jun;8(6):480-2.

26. Kneepkens CM, Meijer Y. Clinical practice. Diagnosis and treatment of cow's

milk allergy. Eur J Pediatr. 2009 Aug;168(8):891-6.

27. Bochner BS, Lichtenstein LM. Anaphylaxis. N Engl J Med. 1991 Jun

20;324(25):1785-90.

28. Galli SJ. Pathogenesis and management of anaphylaxis: current status and

future challenges. J Allergy Clin Immunol. 2005 Mar;115(3):571-4.

29. Kemp SF, Lockey RF. Anaphylaxis: a review of causes and mechanisms. J

Allergy Clin Immunol. 2002 Sep;110(3):341-8.

30. Takeishi T, Martin TR, Katona IM, Finkelman FD, Galli SJ. Differences in the

expression of the cardiopulmonary alterations associated with anti-immunoglobulin E-

induced or active anaphylaxis in mast cell-deficient and normal mice. Mast cells are

not required for the cardiopulmonary changes associated with certain fatal

anaphylactic responses. J Clin Invest. 1991 Aug;88(2):598-608.

31. Martin TR, Ando A, Takeishi T, Katona IM, Drazen JM, Galli SJ. Mast cells

contribute to the changes in heart rate, but not hypotension or death, associated with

active anaphylaxis in mice. J Immunol. 1993 Jul 1;151(1):367-76.

32. Jacoby W, Cammarata PV, Findlay S, Pincus SH. Anaphylaxis in mast cell-

deficient mice. J Invest Dermatol. 1984 Oct;83(4):302-4.

33. Ha TY, Reed ND, Crowle PK. Immune response potential of mast cell-deficient

W/Wv mice. Int Arch Allergy Appl Immunol. 1986;80(1):85-94.

34. Ha TY, Reed ND. Systemic anaphylaxis in mast-cell-deficient mice of W/Wv

and Sl/Sld genotypes. Exp Cell Biol. 1987;55(2):63-8.

35. Oettgen HC, Martin TR, Wynshaw-Boris A, Deng C, Drazen JM, Leder P.

Active anaphylaxis in IgE-deficient mice. Nature. 1994 Aug 4;370(6488):367-70.

108

36. Watanabe N, Ovary Z. Antigen and antibody detection by in vivo methods; a

reevaluation of passive cutaneous anaphylactic reactions. J Immunol Methods.

1977;14(3-4):381-90.

37. Ovary Z, Benacerraf B, Bloch KJ. Properties of guinea pig 7S antibodies. II.

Identification of antibodies involved in passive cutaneous and systemic anaphylaxis.

J Exp Med. 1963 Jun 1;117:951-64.

38. Ovary Z, Vaz NM, Warner NL. Passive anaphylaxis in mice with gamma-G

antibodies. V. Competitive effects of different immunoglobulins and inhibition of

reactions with antiglobulin sera. Immunology. 1970 Nov;19(5):715-27.

39. Harada M, Nagata M, Takeuchi M, Ohara T, Makino S, Watanabe A. Age-

dependent difference in susceptibility to IgE antibody- and IgG1 antibody-mediated

passive anaphylactic shock in the mouse. Immunol Invest. 1991 Aug-Oct;20(5-

6):515-23.

40. Miyajima I, Dombrowicz D, Martin TR, Ravetch JV, Kinet JP, Galli SJ.

Systemic anaphylaxis in the mouse can be mediated largely through IgG1 and Fc

gammaRIII. Assessment of the cardiopulmonary changes, mast cell degranulation,

and death associated with active or IgE- or IgG1-dependent passive anaphylaxis. J

Clin Invest. 1997 Mar 1;99(5):901-14.

41. Katz HR, Raizman MB, Gartner CS, Scott HC, Benson AC, Austen KF.

Secretory granule mediator release and generation of oxidative metabolites of

arachidonic acid via Fc-IgG receptor bridging in mouse mast cells. J Immunol. 1992

Feb 1;148(3):868-71.

42. Tsujimura Y, Obata K, Mukai K, Shindou H, Yoshida M, Nishikado H, et al.

Basophils play a pivotal role in immunoglobulin-G-mediated but not immunoglobulin-

E-mediated systemic anaphylaxis. Immunity. 2008 Apr;28(4):581-9.

43. Snapper C, Finkelman, F. Immunoglobulin Class Switching. in Fundamental

Immunology (ed Paul, WE) (Lippincott-Raven, Philadelphia, 1999).

44. Finkelman FD. IgE-Dependent and Independent Effector Mechanisms in

Human and Murine Anaphylaxis

Anaphylaxis and Hypersensitivity Reactions. In: Castells MC, editor.: Humana Press;

2011. p. 127-44.

45. Host A, Halken S. A prospective study of cow milk allergy in Danish infants

during the first 3 years of life. Clinical course in relation to clinical and immunological

type of hypersensitivity reaction. Allergy. 1990 Nov;45(8):587-96.

109

46. Shek LP, Bardina L, Castro R, Sampson HA, Beyer K. Humoral and cellular

responses to cow milk proteins in patients with milk-induced IgE-mediated and non-

IgE-mediated disorders. Allergy. 2005 Jul;60(7):912-9.

47. Ishikawa R, Tsujimura Y, Obata K, Kawano Y, Minegishi Y, Karasuyama H.

IgG-mediated systemic anaphylaxis to protein antigen can be induced even under

conditions of limited amounts of antibody and antigen. Biochem Biophys Res

Commun. 2010 Nov 26;402(4):742-6.

48. Choi IH, Ha TY, Lee DG, Park JS, Lee JH, Park YM, et al. Occurrence of

disseminated intravascular coagulation (DIC) in active systemic anaphylaxis: role of

platelet-activating factor. Clin Exp Immunol. 1995 Jun;100(3):390-4.

49. Joseph M, Gounni AS, Kusnierz JP, Vorng H, Sarfati M, Kinet JP, et al.

Expression and functions of the high-affinity IgE receptor on human platelets and

megakaryocyte precursors. Eur J Immunol. 1997 Sep;27(9):2212-8.

50. Zarbock A, Polanowska-Grabowska RK, Ley K. Platelet-neutrophil-

interactions: linking hemostasis and inflammation. Blood Rev. 2007 Mar;21(2):99-

111.

51. Rolland JM, Gardner LM, O'Hehir RE. Allergen-related approaches to

immunotherapy. Pharmacol Ther. 2009 Mar;121(3):273-84.

52. Larche M, Akdis CA, Valenta R. Immunological mechanisms of allergen-

specific immunotherapy. Nat Rev Immunol. 2006 Oct;6(10):761-71.

53. Attallah NA, Sehon AH. Isolation of haptenic material from ragweed pollen.

Immunochemistry. 1969 Jul;6(4):609-19.

54. Malley A, Perlman F. Induction of both reaginic and blocking antibodies with a

low molecular weight fraction of timothy pollen extract. J Allergy. 1969 Feb;43(2):59-

64.

55. Marsh DG, Lichtenstein LM, Campbell DH. Studies on "allergoids" prepared

from naturally occurring allergens. I. Assay of allergenicity and antigenicity of

formalinized rye group I component. Immunology. 1970 May;18(5):705-22.

56. Finkelman FD. Peanut allergy and anaphylaxis. Curr Opin Immunol. 2010

Dec;22(6):783-8.

57. Toda M, Reese G, Gadermaier G, Schulten V, Lauer I, Egger M, et al. Protein

unfolding strongly modulates the allergenicity and immunogenicity of Pru p 3, the

major peach allergen. The Journal of allergy and clinical immunology. 2011

Nov;128(5):1022-30 e1-7.

110

8. CURRICULUM VITAE

Durga Krishnamurthy, M.Sc., Personal Data

Date of Birth: 30th May 1983

Place of Birth: Vellore, India

Nationality: Indian

Permanent Address: No:14, EVR Street

Meenambakkam

Chennai, Tamilnadu, India

Pin-600 027.

Work Address: Division of Comparative Immunology and Oncology

Department of Pathophysiology and Allergy Research

Center of Pathophysiology, Infectiology & Immunology

Medical University of Vienna

Waehringer Guertel 18-20, EB.3Q

1090 Vienna, Austria

Tel: +43/1/40400/5122

Fax: +43/1/40400/5130

E-mail: durga.krishnamurthy@meduniwien.ac.at

Homepage: http://www.meduniwien.ac.at/ipa

111

Education and experience

Education

• Aug 2003- July 2005 Master of Science in Microbial Gene Technology at

Madurai Kamaraj University, Madurai, India.

• June 2000- June 2003 Bachelor of Science in Microbiology, at Madras

University, Chennai, India.

Research experience

• Dec 2005-June 2007 Worked as Junior Research Fellow with fellowship at

National Center for Biological Sciences (NCBS), Bangalore, India.

• Masters Research Thesis (June 2003- June 2005) “Designing of an

Antimicrobial Peptide (Over expression and assaying their activity against

Gram Negative Bacteria).

Doctoral thesis

• Oct 2007- Ongoing: PhD thesis: Cell communications decisive for the type of

immune responses to dietary antigens, under the supervision of Prof. Erika

Jensen-Jarolim, Dept of Pathophysiology, Medical University of Vienna.

112

9. LIST OF PUBLICATIONS Published

• Marat V. Khodoun, Zeynep Yesim Kucuk, Richard T. Strait, Durga

Krishnamurthy, Kevin Janek, Ian Lewkowich, Suzanne C. Morris, and Fred

D. Finkelman. Rapid polyclonal desensitization with antibodies to IgE and

FcεRIα. (Accepted at Journal of Allergy and Clinical Immunology, Feb 2013).

• Durga Krishnamurthy, Philipp Starkl, Krisztina Szalai, Franzciska Roth-

Walter, Susanne C. Diesner, Martina Mittlboeck, Christine Mannhalter, Eva

Untersmayr and Erika Jensen-Jarolim. Monitoring neutrophils and platelets

during casein-induced anaphylaxis in an experimental BALB/c mouse model.

Clin Exp Allergy. 2012 Jul;42(7):1119-28.

• Philipp Starkl, Ferdinand Felix, Durga Krishnamurthy, Sara Prickett, Astrid

Voskamp, Caroline Stremnitzer, Marlene Weichselbaumer, Franziska Roth-

Walter, Robin O’Hehir, Erika Jensen-Jarolim. An unfolded variant of the major

peanut allergen Ara h 2 with decreased anaphylactic potential. Clin Exp

Allergy. 2012 Dec;42(12):1801-12.

• Diesner SC, Knittelfelder R, Krishnamurthy D, Pali-Schöll I, Gajdzik L,

Jensen-Jarolim E, Untersmayr E. ‘Dose-dependent food allergy induction

against ovalbumin under acid-suppression: A murine food allergy model’ Immunol Letters 2008 Nov 16; 121(1):45-51. Epub 2008 Sep 25.

• Untersmayr E, Diesner SC, Oostingh GJ, Selzle K, Pfaller T, Schultz C, Zhang

Y, Krishnamurthy D, Starkl P, Knittelfelder R, Förster-Waldl E, Pollak A,

Scheiner O, Pöschl U, Jensen-Jarolim E, Duschl A. Nitration of the egg-

allergen ovalbumin enhances protein allergenicity but reduces the risk for oral

sensitization in a murine model of food allergy. PLoS One. 2010 Dec

2;5(12):e14210. Submitted

Durga Krishnamurthy, Anna Lukschal, Philipp Starkl, Caroline Stremnitzer, Anna

Willensdorfer, Susanne C. Diesner, Martina Mittlboeck , Isabella Pali-Schöll, Eva

Untersmayr and Erika Jensen-Jarolim. Anti-acid medications interact with endotoxin

to induce food allergy to milk allergen casein in BALB/c mice.